DOCSLIB.ORG

MDC1 Cleavage by Caspase-3: a Novel Mechanism for Inactivating the DNA Damage Response During Apoptosis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
MDC1 Cleavage by Caspase-3: a Novel Mechanism for Inactivating the DNA Damage Response During Apoptosis Published OnlineFirst December 8, 2010; DOI: 10.1158/0008-5472.CAN-10-3297 Cancer Molecular and Cellular Pathobiology Research MDC1 Cleavage by Caspase-3: A Novel Mechanism for Inactivating the DNA Damage Response during Apoptosis Stephanie Solier and Yves Pommier Abstract Recently, we identified the "apoptotic ring," containing phosphorylated histone H2AX (g-H2AX), as an early chromatin modification during apoptosis. Because g-H2AX initiates the DNA damage response (DDR), we tested whether the apoptotic H2AX response leads to the full recruitment of the DDR factors that normally coordinate DNA repair and cell-cycle checkpoints. We show that the apoptotic H2AX response does not recruit the DDR factors because MDC1 (mediator of DNA damage checkpoint protein 1), which normally binds to g-H2AX in response to DNA damage and amplifies the DDR, is cleaved by caspase-3. This cleavage separates the BRCT and FHA domains of MDC1 and constitutes a novel mechanism for the inactivation of DNArepairinapoptoticcells.Also, we show that downregulation of MDC1 increases the apoptotic response to TRAIL. Together, these results implicate MDC1 in the cellular apoptotic response. Cancer Res; 71(3); 1–8. Ó2010 AACR. Introduction We recently identified the "apoptotic ring" as the nuclear peripheral staining of phosphorylated histone H2AX Apoptosis (programmed cell death) is required in multi- (g-H2AX; refs. 8, 9). The g-H2AX apoptotic ring forms in cellular organisms for organ formation, elimination of the early phase of the apoptotic response to a broad range damaged or harmful cells, and maintenance of tissue home- of stimuli including TRAIL. g-H2AX (histone H2AX phos- ostasis. Disruption of the equilibrium between cell death and phorylated on serine 139 by ATM, ATR, and DNA-PK) is proliferation leads to tumor formation when cells divide faster otherwise a fundamental chromatin response to DNA dou- than they die (1). Caspases, a family of cysteine proteases that ble-strand breaks (10), serving as a molecular platform for cleave and inactivate a broad range of cellular proteins, have the docking of protein complexes to chromatin and the been identified as the central effectors of apoptosis (2, 3). amplification the DNA damage response (DDR) and DNA One promising approach for cancer therapy is the develop- repair (10, 11). Direct binding of MDC1 (mediator of DNA ment of targeted agents that selectively kill tumor cells by damage checkpoint protein 1) to g-H2AX via the MDC1 activating caspases. One such agent is recombinant human BRCT (breast cancer C-terminal) domain (12) is essential Apo2L/TRAIL (TNF-related apoptosis-inducing ligand), a for DDR because it leads to the subsequent recruitment and proapoptotic agonist that activates the membrane death assembly of DDR protein complexes including 53BP1 that receptors DR4 and DR5. Human endogenous TRAIL is repair DNA and regulate cell-cycle checkpoints (13, 14). expressed by immune cells as a 281-amino acid polypeptide Recruitment of MDC1 at DNA damage sites is critical for involved in the innate immune response, autoimmunity, and the efficient activation of the intra S-phase checkpoint (15). tumor immunosurveillance (4–6). Recombinant Apo2L/TRAIL MDC1 couples DNA double-strand break recognition by is presently in phase II clinical trials against lymphomas and Nbs1 (a member of the MRN complex containing Mre11, non–small cell lung cancers (7). Rad50, and Nbs1) with its H2AX-dependent chromatin À À retention (16). Accordingly, MDC1 / mice recapitulate À À the phenotype of the H2AX / mice, including growth Authors' Affiliation: Laboratory of Molecular Pharmacology, Center for retardation, male infertility, immune defects, chromosome Cancer Research, National Cancer Institute, Bethesda, Maryland instability, DNA repair defects, and radiation sensitivity Note: Supplementary data for this article are available at Cancer Research (17). Online (http://cancerres.aacrjournals.org/). The focus of the present study was to determine whether Corresponding Author: Yves Pommier, Laboratory of Molecular Phar- macology, Bldg. 37, Rm. 5068, Center for Cancer Research, National the apoptotic g-H2AX response (apoptotic g-H2AX ring; Cancer Institute, NIH, Bethesda, MD 20892. Phone: 301-496-5944; Fax: refs. 8, 9) is associated with the recruitment of the DDR 301-402-0752; E-mail: [email protected] complexes and the role of MDC1 and phosphorylation doi: 10.1158/0008-5472.CAN-10-3297 of H2AX at its C-terminal tyrosine 142 (18–20) in that Ó2010 American Association for Cancer Research. process. www.aacrjournals.org OF1 Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 2010 American Association for Cancer Research. Published OnlineFirst December 8, 2010; DOI: 10.1158/0008-5472.CAN-10-3297 Solier and Pommier Materials and Methods Plasmid vector The GFP-MDC1 construct used has been previously Chemicals described (21). Recombinant human soluble TRAIL was obtained from Alexis (Axxora). Anti-Fas was purchased from Upstate. Camp- Immunofluorescence microscopy tothecin and cisplatin were from Sigma-Aldrich. The broad- Cells were washed with PBS, fixed with 2% formaldehyde in spectrum caspase inhibitor Z-VAD-fmk (z-Val-Ala-DL-Asp- PBS for 20 minutes, washed with PBS, postfixed and permea- fluoromethylketone) was from Bachem and the proteasome bilized with cold (À20 C) 70% ethanol for 20 minutes, washed inhibitor MG132 from Sigma-Aldrich. with PBS, blocked with 8% bovine serum albumin (BSA) in PBS for 1 hour, washed with PBS, incubated with the first antibody Cell lines (PT2609-DNA-PK, 1/250 dilution; g-H2AX, 1/500 dilution; PY142- Human colon carcinoma HCT116 and leukemic Jurkat cell H2AX, 1/250 dilution; MDC1, 1/200 dilution) in 1% BSA in PBS lines were obtained from American Type Culture Collection. for 2 hours, washed with PBS, incubated with secondary Normal human prostate epithelial PrEC cell line was obtained antibody conjugated with Alexa Fluor 488 or 568 for 1 hour, from Lonza. washed with PBS, and mounted by using Vectashield mount- ing medium (Vector Laboratories). Confocal images were Western blotting and antibodies sequentially acquired with Zeiss AIM software on a Zeiss Cells were washed twice in PBS and lysed at 4C in buffer LSM 510 NLO Confocal system (Carl Zeiss Inc.). containing 1% SDS (sodium dodecyl sulfate), 10 mmol/L Tris- HCl, pH 7.4, supplemented with protease inhibitors (Roche Sub-G1 analysis Applied Science) and phosphatase inhibitors (Sigma-Aldrich). Cells were washed with PBS, fixed, and permeabilized with Viscosity of the samples was reduced by brief sonication. Equal cold (À20 C) 70% ethanol overnight. The next day, cell pellets amounts of proteins were boiled for 5 minutes in Tris-glycine- were washed again with PBS, resuspended in PBS buffer SDS sample buffer (Invitrogen) or heated at 70C for 10 minutes containing 0.2% NP40 and 0.5 mg/mL of RNase A, incubated in LDS (lithium dodecyl sulphate) sample buffer (Invitrogen), at room temperature for 15 minutes, and put on ice 10 separated by Tris-glycine or Tris-acetate polyacrylamide gels minutes before the addition of 50 mg/mL of propidium iodide. (Invitrogen) and electroblotted onto nitrocellulose membranes DNA content was determined with a FACScan flow cytometer (Bio-Rad). The membranes were saturated with milk, incu- (Becton Dickinson) and quantified with CellQuest software bated overnight at 4C with primary antibodies, washed, and (Becton Dickinson). then incubated for 45 minutes with secondary antibodies: peroxidase-conjugated goat anti-mouse IgG or peroxidase- Site-directed mutagenesis conjugated goat anti-rabbit IgG (Santa Cruz Biotechnology). Point mutations were introduced into the MDC1 expression Signals were revealed by autoradiography with the Enhanced vector with the "QuickChange Lightning Site-Directed Muta- Chemiluminescence Detection Kit (Pierce). genesis kit" (Stratagene) according to the manufacturer's Primary antibodies used were as follows: anti-caspase-2 instructions. MDC1 expression vector was used with the (551094; BD Biosciences), anti-PT2609-DNA-PK (ab18356; relevant oligonucleotides, and PCR was carried out for 18 Abcam), anti-GAPDH (glyceraldehyde 3-phosphate dehydro- cycles. Mutations were confirmed by sequencing. Primers genase; 2118; Cell Signaling), anti-g-H2AX (05-636; Upstate), used for mutagenesis are listed as follows: anti-PY142-H2AX (07-1590; Millipore), anti-H2AX (07-627; 0 0 Upstate), anti-MDC1 (ab11169; Abcam), and anti-tubulin Sequence (5 to 3 ) (MS-581; Lab Vision). D173A sense ctcggaggaggaagtagcttttctttctgaaaggc D173A antisense gcctttcagaaagaaaagctacttcctcctccgag Short interfering RNA D219A sense ccttcaatttgaacagtgccacagatgtggaagaagg Short interfering RNA (siRNA) targeting MDC1 was D219A antisense ccttcttccacatctgtggcactgttcaaattgaagg obtained from Dharmacon (SMARTpool, catalogue number D261A sense gaaatccagcttgaaaaggctcagcctttag- M-003506-04-0005). Negative control siRNA was obtained tgaaggag from Ambion (catalogue number AM4635). Cells were seeded D261A antisense ctccttcactaaaggctgagccttttcaagctggatttc in 6-well plates at a density of 50,000 cells per well 16 hours D683A sense gtgggtgggaccaaggcctctgaagacaactat before transfection. For each sample, 500 pmoles of siRNA D683A antisense atagttgtcttcagaggccttggtcccacccac were mixed with 250 mL of Optimem (Invitrogen; mix A). Five D686A sense gaccaaggactctgaagccaactatggtgattctg microliters of Lipofectamine 2000 (Invitrogen) was mixed with D686A antisense cagaatcaccatagttggcttcagagtccttggtc 250 mL of Optimem and incubated for 5 minutes at room D690-693-695A
Load more

Recommended publications
  • The Functions of DNA Damage Factor RNF8 in the Pathogenesis And
    Int. J. Biol. Sci. 2019, Vol. 15 909 Ivyspring International Publisher International Journal of Biological Sciences 2019; 15(5): 909-918. doi: 10.7150/ijbs.31972 Review The Functions of DNA Damage Factor RNF8 in the Pathogenesis and Progression of Cancer Tingting Zhou 1, Fei Yi 1, Zhuo Wang 1, Qiqiang Guo 1, Jingwei Liu 1, Ning Bai 1, Xiaoman Li 1, Xiang Dong 1, Ling Ren 2, Liu Cao 1, Xiaoyu Song 1 1. Institute of Translational Medicine, China Medical University; Key Laboratory of Medical Cell Biology, Ministry of Education; Liaoning Province Collaborative Innovation Center of Aging Related Disease Diagnosis and Treatment and Prevention, Shenyang, Liaoning Province, China 2. Department of Anus and Intestine Surgery, First Affiliated Hospital of China Medical University, Shenyang, Liaoning Province, China Corresponding authors: Xiaoyu Song, e-mail: [email protected] and Liu Cao, e-mail: [email protected]. Key Laboratory of Medical Cell Biology, Ministry of Education; Institute of Translational Medicine, China Medical University; Collaborative Innovation Center of Aging Related Disease Diagnosis and Treatment and Prevention, Shenyang, Liaoning Province, 110122, China. Tel: +86 24 31939636, Fax: +86 24 31939636. © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2018.12.03; Accepted: 2019.02.08; Published: 2019.03.09 Abstract The really interesting new gene (RING) finger protein 8 (RNF8) is a central factor in DNA double strand break (DSB) signal transduction.
    [Show full text]
  • Mediator of DNA Damage Checkpoint Protein 1 Facilitates V(D)J Recombination in Cells Lacking DNA Repair Factor XLF
    biomolecules Article Mediator of DNA Damage Checkpoint Protein 1 Facilitates V(D)J Recombination in Cells Lacking DNA Repair Factor XLF Carole Beck 1,2, Sergio Castañeda-Zegarra 1,2 , Camilla Huse 1,2, Mengtan Xing 1,2 and Valentyn Oksenych 1,2,3,* 1 Department of Clinical and Molecular Medicine (IKOM), Norwegian University of Science and Technology (NTNU), 7491 Trondheim, Norway; [email protected] (C.B.); [email protected] (S.C.-Z.); [email protected] (C.H.); [email protected] (M.X.) 2 St. Olavs Hospital, Trondheim University Hospital, Clinic of Medicine, Postboks 3250 Sluppen, 7006 Trondheim, Norway 3 Department of Biosciences and Nutrition (BioNuT), Karolinska Institutet, 14183 Huddinge, Sweden * Correspondence: [email protected] Received: 27 November 2019; Accepted: 24 December 2019; Published: 30 December 2019 Abstract: DNA double-strand breaks (DSBs) trigger the Ataxia telangiectasia mutated (ATM)-dependent DNA damage response (DDR), which consists of histone H2AX, MDC1, RNF168, 53BP1, PTIP, RIF1, Rev7, and Shieldin. Early stages of B and T lymphocyte development are dependent on recombination activating gene (RAG)-induced DSBs that form the basis for further V(D)J recombination. Non-homologous end joining (NHEJ) pathway factors recognize, process, and ligate DSBs. Based on numerous loss-of-function studies, DDR factors were thought to be dispensable for the V(D)J recombination. In particular, mice lacking Mediator of DNA Damage Checkpoint Protein 1 (MDC1) possessed nearly wild-type levels of mature B and T lymphocytes in the spleen, thymus, and bone marrow. NHEJ factor XRCC4-like factor (XLF)/Cernunnos is functionally redundant with ATM, histone H2AX, and p53-binding protein 1 (53BP1) during the lymphocyte development in mice.
    [Show full text]
  • Polo-Like Kinase 1 in Genomic Instability
    Polo-like Kinase 1 in genomic instability Xiaoqi Liu Department of Toxicology and Cancer Biology University of Kentucky The fate of a single parental chromosome throughout the eukaryotic cell cycle Cytokinesis Activation of cell division Preparation for mitosis The stages of mitosis and cytokinesis in an animal cell MT MT - + kinetochore Centrosome Spindle pole + (MTOC) Spindle pole Centrosome Spindle Nucleus G2 Prophase Prometaphase Metaphase Central spindle Contractile ring Midbody Anaphase Telophase Cytokinesis Control of mitotic entry and exit by Cdc2/cyclin B and APC Anaphase promoting complex (APC) Cdc2 Cyclin B Cdc2 Anaphase inhibitor Cyclin B Cdc2 G2 Prophase Metaphase Anaphase Telophase G1 (Liu & Erikson, PNAS 2002; Liu & Erikson, PNAS 2003; Liu et al, MCB 2005; Liu et al, MCB 2006) The polo-like kinases have a C-terminal polo-box domain M-phase kinase domain polo-box Plk1 603 Plx1 (Xl) 80% 598 polo (Dm) 65% 576 Plo1 (Sp) 50% 683 Cdc5 (Sc) 51% 705 Early phase of cell cycle Plk2 52% 683 Plk3 52% 631 Plk1 localizes to mitotic structures G2/pro Prometa Spindle poles Centrosomes kinetochores Centrosomes Centrosomes kinetochores Meta Telo Spindle poles Midbodies kinetochores Spindle poles Central spindles kinetochores Plk1 in cancer ---Plk1 overexpression is correlated with cell proliferation and carcinogenesis. ---Plk1 is a new diagnostic marker for cancer. ---Plk1 inhibitors are in various clinical trails. ---However, how Plk1 contributes to carcinogenesis is elusive. Does Plk1 elevation contribute to cancer progression? Approach:
    [Show full text]
  • Insights Into Regulation of Human RAD51 Nucleoprotein Filament Activity During
    Insights into Regulation of Human RAD51 Nucleoprotein Filament Activity During Homologous Recombination Dissertation Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Ravindra Bandara Amunugama, B.S. Biophysics Graduate Program The Ohio State University 2011 Dissertation Committee: Richard Fishel PhD, Advisor Jeffrey Parvin MD PhD Charles Bell PhD Michael Poirier PhD Copyright by Ravindra Bandara Amunugama 2011 ABSTRACT Homologous recombination (HR) is a mechanistically conserved pathway that occurs during meiosis and following the formation of DNA double strand breaks (DSBs) induced by exogenous stresses such as ionization radiation. HR is also involved in restoring replication when replication forks have stalled or collapsed. Defective recombination machinery leads to chromosomal instability and predisposition to tumorigenesis. However, unregulated HR repair system also leads to similar outcomes. Fortunately, eukaryotes have evolved elegant HR repair machinery with multiple mediators and regulatory inputs that largely ensures an appropriate outcome. A fundamental step in HR is the homology search and strand exchange catalyzed by the RAD51 recombinase. This process requires the formation of a nucleoprotein filament (NPF) on single-strand DNA (ssDNA). In Chapter 2 of this dissertation I describe work on identification of two residues of human RAD51 (HsRAD51) subunit interface, F129 in the Walker A box and H294 of the L2 ssDNA binding region that are essential residues for salt-induced recombinase activity. Mutation of F129 or H294 leads to loss or reduced DNA induced ATPase activity and formation of a non-functional NPF that eliminates recombinase activity. DNA binding studies indicate that these residues may be essential for sensing the ATP nucleotide for a functional NPF formation.
    [Show full text]
  • RNF168 Ubiquitylates 53BP1 and Controls Its Response to DNA Double-Strand Breaks
    RNF168 ubiquitylates 53BP1 and controls its response to DNA double-strand breaks Miyuki Bohgakia,b,1, Toshiyuki Bohgakia,b,1, Samah El Ghamrasnia,b, Tharan Srikumara,b, Georges Mairec, Stephanie Panierd, Amélie Fradet-Turcotted, Grant S. Stewarte, Brian Raughta,b, Anne Hakema,b, and Razqallah Hakema,b,2 aOntario Cancer Institute, University Health Network and bDepartment of Medical Biophysics, University of Toronto, Toronto, M5G 2M9 ON, Canada; cThe Hospital for Sick Children, Toronto, M5G 2L3 ON, Canada; dDepartment of Molecular Genetics, University of Toronto, Toronto, ON, Canada M5S 1A8; and eCancer Research UK, Institute for Cancer Studies, Birmingham University, Birmingham B15 2TT, United Kingdom Edited* by Stephen J. Elledge, Harvard Medical School, Boston, MA, and approved November 14, 2013 (received for review October 30, 2013) Defective signaling or repair of DNA double-strand breaks has X–MDC1–RNF8 axis, RNF168 also functions in DSB signaling been associated with developmental defects and human diseases. independently of this pathway. Therefore, we postulated that The E3 ligase RING finger 168 (RNF168), mutated in the human RNF168 also might regulate DSB signaling through direct radiosensitivity, immunodeficiency, dysmorphic features, and modulation of 53BP1 functions. learning difficulties syndrome, was shown to ubiquitylate H2A- In the present study, we demonstrate that RNF168 associates γ – – type histones, and this ubiquitylation was proposed to facilitate with 53BP1 independently of the -H2A.X MDC1 RNF8 sig- the recruitment of p53-binding protein 1 (53BP1) to the sites of naling axis. RNF168 ubiquitylates 53BP1 before its localization DNA double-strand breaks. In contrast to more upstream proteins to DSB sites, and this ubiquitylation is important for the initial signaling DNA double-strand breaks (e.g., RNF8), deficiency of recruitment of 53BP1 to DSB sites and its function in non- homologous end joining (NHEJ) and activation of checkpoints.
    [Show full text]
  • MDC1 and RNF8 Function in a Pathway That Directs BRCA1
    Research Article 6049 MDC1 and RNF8 function in a pathway that directs BRCA1-dependent localization of PALB2 required for homologous recombination Fan Zhang1, Gregory Bick1, Jung-Young Park1 and Paul R. Andreassen1,2,* 1Division of Experimental Hematology and Cancer Biology, Cincinnati Children’s Research Foundation, Cincinnati, OH 45229, USA 2Department of Pediatrics, University of Cincinnati College of Medicine, Cincinnati, OH 45229, USA *Author for correspondence ([email protected]) Accepted 6 September 2012 Journal of Cell Science 125, 6049–6057 ß 2012. Published by The Company of Biologists Ltd doi: 10.1242/jcs.111872 Summary The PALB2 protein is associated with breast cancer susceptibility and Fanconi anemia. Notably, PALB2 is also required for DNA repair by homologous recombination (HR). However, the mechanisms that regulate PALB2, and the functional significance of its interaction with the BRCA1 breast cancer susceptibility protein, are poorly understood. Here, to better understand these processes, we fused PALB2, or the PALB2(L21P) mutant which cannot bind to BRCA1, with the BRCT repeats that are present in, and which localize, BRCA1. Our results yield important insights into the regulation of PALB2 function. Both fusion proteins can bypass BRCA1 to localize to sites of DNA damage. Further, the localized fusion proteins are functional, as determined by their ability to support the assembly of RAD51 foci, even in the absence of the capacity of PALB2 to bind BRCA1. Strikingly, the localized fusion proteins mediate DNA double-strand break (DSB)-initiated HR and resistance to mitomycin C in PALB2-deficient cells. Additionally, we show that the BRCA1–PALB2 heterodimer, rather than the PALB2–PALB2 homodimer, mediates these responses.
    [Show full text]
  • Mdmx Promotes Genomic Instability Independent of P53 and Mdm2
    Oncogene (2015) 34, 846–856 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc ORIGINAL ARTICLE Mdmx promotes genomic instability independent of p53 and Mdm2 AM Carrillo1, A Bouska2, MP Arrate1 and CM Eischen1 The oncogene Mdmx is overexpressed in many human malignancies, and together with Mdm2, negatively regulates the p53 tumor suppressor. However, a p53-independent function of Mdmx that impacts genome stability has been described, but this function is not well understood. In the present study, we determined that of the 13 different cancer types evaluated, 6–90% of those that had elevated levels of Mdmx had concurrent inactivation (mutated or deleted) of p53. We show elevated levels of Mdmx-inhibited double-strand DNA break repair and induced chromosome and chromatid breaks independent of p53, leading to genome instability. Mdmx impaired early DNA damage-response signaling, such as phosphorylation of the serine/threonine-glutamine motif, mediated by the ATM kinase. Moreover, we identified Mdmx associated with Nbs1 of the Mre11-Rad50-Nbs1 (MRN) DNA repair complex, and this association increased upon DNA damage and was detected at chromatin. Elevated Mdmx levels also increased cellular transformation in a p53-independent manner. Unexpectedly, all Mdmx-mediated phenotypes also occurred in cells lacking Mdm2 and were independent of the Mdm2-binding domain (RING) of Mdmx. Therefore, Mdmx-mediated inhibition of the DNA damage response resulted in delayed DNA repair and increased genome instability and transformation independent of p53 and Mdm2. Our results reveal a novel p53- and Mdm2-independent oncogenic function of Mdmx that provides new insight into the many cancers that overexpress Mdmx.
    [Show full text]
  • Characterization of Histone H2A Functional Domains Important for Regulation of the DNA Damage Response Elizabeta Gjoneska
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2010 Characterization of Histone H2A Functional Domains Important for Regulation of the DNA Damage Response Elizabeta Gjoneska Follow this and additional works at: http://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons Recommended Citation Gjoneska, Elizabeta, "Characterization of Histone H2A Functional Domains Important for Regulation of the DNA Damage Response" (2010). Student Theses and Dissertations. Paper 267. This Thesis is brought to you for free and open access by Digital Commons @ RU. It has been accepted for inclusion in Student Theses and Dissertations by an authorized administrator of Digital Commons @ RU. For more information, please contact [email protected]. CHARACTERIZATION OF HISTONE H2A FUNCTIONAL DOMAINS IMPORTANT FOR REGULATION OF THE DNA DAMAGE RESPONSE A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Elizabeta Gjoneska June 2010 © Copyright by Elizabeta Gjoneska 2010 CHARACTERIZATION OF HISTONE H2A DOMAINS IMPORTANT FOR REGULATION OF THE DNA DAMAGE RESPONSE Elizabeta Gjoneska, Ph.D. The Rockefeller University 2010 DNA double strand breaks represent deleterious lesions which can either be caused by environmental or endogenous sources of DNA damage. Efficient DNA damage response which ensures repair of these lesions is therefore critical for maintenance of genomic stability. The repair happens in the context of chromatin, a three-dimensional nucleoprotein complex consisting of DNA, histones and associated proteins. As such, mechanisms that modulate chromatin structure, many of which involve the histone component of chromatin, have been shown to play a role in regulation of the DNA damage response.
    [Show full text]
  • NFBD1/MDC1 Regulates Cav1 and Cav2 Independently of DNA Damage and P53
    Author Manuscript Published OnlineFirst on May 6, 2011; DOI: 10.1158/1541-7786.MCR-10-0317 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. NFBD1/MDC1 regulates Cav1 and Cav2 independently of DNA damage and p53 Kathleen A. Wilson1,2,*, Sierra A. Colavito1,*, Vincent Schulz1, Patricia Wakefield1, William Sessa3, David Tuck1, and David F. Stern1 1Department of Pathology, 2Graduate Program in Genetics, 3Department of Pharmacology; Yale University School of Medicine; New Haven, Connecticut USA, *K.A.W. and S.A.C. contributed equally to this work Running title: NFBD1/MDC1 regulates Cav1 Keywords: NFBD1, MDC1, Cav1, Cav2, caveolin 1 Downloaded from mcr.aacrjournals.org on October 2, 2021. © 2011 American Association for Cancer Research. Author Manuscript Published OnlineFirst on May 6, 2011; DOI: 10.1158/1541-7786.MCR-10-0317 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract NFBD1 (nuclear factor with BRCT domains 1) is involved in DNA damage checkpoint signaling and DNA repair. NFBD1 binds to the chromatin component γH2AX at sites of DNA damage, causing amplification of ATM pathway signaling and recruitment of DNA repair factors. Residues 508-995 of NFBD1 possess transactivation activity, suggesting a possible role of NFBD1 in transcription. Furthermore, NFBD1 influences p53-mediated transcription in response to adriamycin. We sought to determine the role of NFBD1 in ionizing radiation (IR)-responsive transcription and if NFBD1 influences transcription independently of p53. Using microarray analysis, we identified genes altered upon NFBD1 knockdown. Surprisingly, most NFBD1 regulated genes are regulated in both the absence and presence of IR, thus pointing toward a novel function for NFBD1 outside of the DNA damage response.
    [Show full text]
  • Chromatin and Nucleosome Dynamics in DNA Damage and Repair
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Chromatin and nucleosome dynamics in DNA damage and repair Michael H. Hauer1,2,3 and Susan M. Gasser1,2 1Friedrich Miescher Institute for Biomedical Research, CH-4058 Basel, Switzerland; 2Faculty of Natural Sciences, University of Basel, CH-4056 Basel, Switzerland Chromatin is organized into higher-order structures that In yeast, nucleosome remodelers indeed promote long- form subcompartments in interphase nuclei. Different range chromatin movement and the relocation of genomic categories of specialized enzymes act on chromatin and loci to specific sites of anchorage or repair (Dion et al. regulate its compaction and biophysical characteristics 2012; Neumann et al. 2012; Seeber et al. 2013a; Horigome in response to physiological conditions. We present an et al. 2014; Strecker et al. 2016). Intriguingly, the subnu- overview of the function of chromatin structure and its clear mobility of chromatin in yeast, as monitored by dynamic changes in response to genotoxic stress, focusing time-lapse microscopy, increases both at sites of induced on both subnuclear organization and the physical mobili- double-strand breaks (DSBs) and genome-wide; that is, at ty of DNA. We review the requirements and mechanisms undamaged sites in response to widespread damage. In that cause chromatin relocation, enhanced mobility, and both cases, the increase depends on both the INO80 chromatin unfolding as a consequence of genotoxic le- remodeler and checkpoint kinase activation (Dion et al. sions. An intriguing link has been established recently be- 2012; Mine-Hattab and Rothstein 2012; Seeber et al. tween enhanced chromatin dynamics and histone loss.
    [Show full text]
  • Cantharidin Induces DNA Damage and Inhibits DNA Repair-Associated Protein Expressions in TSGH8301 Human Bladder Cancer Cell
    ANTICANCER RESEARCH 35: 795-804 (2015) Cantharidin Induces DNA Damage and Inhibits DNA Repair-associated Protein Expressions in TSGH8301 Human Bladder Cancer Cell JEHN-HWA KUO1,2, TING-YING SHIH3, JING-PIN LIN4, KUANG-CHI LAI5,6, MENG-LIANG LIN7, MEI-DUE YANG8* and JING-GUNG CHUNG3,9* 1Special Class of Healthcare, Industry Management, Central Taiwan University of Science and Technology, Taichung, Taiwan, R.O.C.; 2Department of Urology, Jen-Ai Hospital, Taichung, Taiwan, R.O.C.; 3Department of Biological Science and Technology, 4School of Chinese Medicine, and 5School of Medicine, China Medical University, Taichung, Taiwan, R.O.C.; 6Department of Surgery, China Medical University Beigang Hospital, Yunlin, Taiwan, R.O.C.; 7Department of Medical Laboratory Science and Biotechnology, China Medical University, Taichung, Taiwan, R.O.C.; 8Department of Surgery, China Medical University Hospital, Taichung, Taiwan, R.O.C.; 9Department of Biotechnology, Asia University, Wufeng, Taichung, Taiwan, R.O.C. Abstract. Cantharidin is an active component of mylabris, protein kinase, poly-ADP ribose polymerase, phosphate- which has been used as a traditional Chinese medicine. ataxia-telangiectasia and RAD3-related, O-6-methylguanine- Cantharidin has been shown to have antitumor activity against DNA methyltransferase, breast cancer susceptibility protein 1, several types of human cancers in vitro and in animal models mediator of DNA damage checkpoint protein 1, phospho- in vivo. We investigated whether cantharidin induces DNA histone H2A.X, but increased that of phosphorylated p53 damage and affects DNA damage repair-associated protein following 6 and 24 h treatment. Confocal laser microscopy levels in TSGH8301 human bladder cancer cells. Using flow was used to examine the protein translocation; cantharidin cytometry to measure viable cells, cantharidin was found to suppressed the levels of p-H2A.X and MDC1 but increased the reduce the number of viable cells in a dose-dependent manner.
    [Show full text]
  • Variants in Activators and Downstream Targets of ATM, Radiation Exposure, and Contralateral Breast Cancer Risk in the WECARE Study
    RESEARCH ARTICLE OFFICIAL JOURNAL Variants in Activators and Downstream Targets of ATM, Radiation Exposure, and Contralateral Breast Cancer Risk www.hgvs.org in the WECARE Study Jennifer D. Brooks,1∗ Sharon N. Teraoka,2 Anne S. Reiner,1 Jaya M. Satagopan,1 Leslie Bernstein,3 Duncan C. Thomas,4 Marinela Capanu,1 Marilyn Stovall,5 Susan A. Smith,5 Shan Wei,6 Roy E. Shore,7,8 John D. Boice, Jr.,9,10 Charles F. Lynch,11 Lene Mellemkjær,12 Kathleen E. Malone,13 Xiaolin Liang,1 the WECARE Study Collaborative Group,14 Robert W. Haile,4 Patrick Concannon,2 and Jonine L. Bernstein1 1Department of Epidemiology and Biostatistics, Memorial Sloan-Kettering Cancer Center, New York, New York; 2Center for Public Health Genomics and the Department of Biochemistry and Molecular Genetics, University of Virginia, Charlottesville, Virginia; 3Division of Cancer Etiology, Department of Population Sciences, Beckman Research Institute and City of Hope Comprehensive Cancer Center, Duarte, California; 4Department of Preventive Medicine, University of Southern California, Los Angeles, California; 5Department of Radiation Physics, M.D. Anderson Cancer Center, University of Texas, Houston, Texas; 6Benaroya Research Institute at Virginia Mason, Seattle, Washington; 7Department of Environmental Medicine, New York University, New York, New York; 8Radiation Effects Research Foundation, Hiroshima, Japan; 9International Epidemiology Institute, Rockville, Maryland; 10Department of Medicine, Vanderbilt Epidemiology Center, Vanderbilt-Ingram Cancer Center, Vanderbilt School of Medicine, Nashville, Tennessee; 11Department of Epidemiology, University of Iowa, Iowa City, Iowa; 12Institute of Cancer Epidemiology, Danish Cancer Society, Copenhagen, Denmark; 13Division of Public Health Sciences, Fred Hutchinson Cancer Research Center, Seattle, Washington; 14WECARE Study Collaborative Group members are listed in the Acknowledgments Communicated by Peter J.
    [Show full text]