The Genetics of Colored Sequence Synesthesia: Evidence of Linkage to Chromosome 16Q and Genetic Heterogeneity for the Condition
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name katanin p80 (WD repeat containing) subunit B 1 Gene Symbol KATNB1 Organism Human Gene Summary Microtubules polymers of alpha and beta tubulin subunits form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules while the p80 subunit targets the enzyme to the centrosome. Katanin is a member of the AAA family of ATPases. Gene Aliases KAT RefSeq Accession No. NC_000016.9, NT_010498.15 UniGene ID Hs.275675 Ensembl Gene ID ENSG00000140854 Entrez Gene ID 10300 Assay Information Unique Assay ID qHsaCIP0026589 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000379661 Amplicon Context Sequence CACCAAGACAGCCTGGAAGTTGCAAGAGATCGTCGCGCATGCCAGCAACGTGT CCTCACTGGTGCTGGGCAAAGCCTCCGGGCGGCTGCTGGCTACAGGCGGGGAT GACTGCCGCGTCAACCTGTGGTCCATCAACAAGCCCAACTGCATCATGAGCCTG ACG Amplicon Length (bp) 132 Chromosome Location 16:57771173-57778314 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9991 cDNA Cq 21.47 cDNA Tm (Celsius) 89 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 35.43 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report KATNB1, Human Amplification -
Datasheet: VMA00937 Product Details
Datasheet: VMA00937 Description: MOUSE ANTI CIAPIN1 Specificity: CIAPIN1 Format: Purified Product Type: PrecisionAb Monoclonal Clone: AB04/1G9 Isotype: IgG1 Quantity: 100 µl Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio- rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 The PrecisionAb label is reserved for antibodies that meet the defined performance criteria within Bio-Rad's ongoing antibody validation programme. Click here to learn how we validate our PrecisionAb range. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependent on sample type. Target Species Human Product Form Purified IgG - Liquid Preparation Mouse monoclonal antibody affinity purified on Protein G from tissue culture supernatant Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide Stabilisers Approx. Protein IgG concentration 1.0 mg/ml Concentrations Immunogen E. coli-derived recombinant protein of amino acids 1-312 of human CIAPIN1 Page 1 of 3 External Database Links UniProt: Q6FI81 Related reagents Entrez Gene: 57019 CIAPIN1 Related reagents Fusion Partners Spleen cells from immunised BALB/c mice were fused with cells of the mouse SP2/0 myeloma cell line Specificity Mouse anti CIAPIN1 antibody recognizes anamorsin, also known as cytokine-induced apoptosis inhibitor 1. CIAPIN1 is an electron transfer protein required for assembly of cytosolic iron-sulfur clusters, a family of cofactors critical for many cellular functions (Lipper et al. -
KIAA0556 Is a Novel Ciliary Basal Body Component Mutated in Joubert Syndrome Anna A
Sanders et al. Genome Biology (2015) 16:293 DOI 10.1186/s13059-015-0858-z RESEARCH Open Access KIAA0556 is a novel ciliary basal body component mutated in Joubert syndrome Anna A. W. M. Sanders1†, Erik de Vrieze2,3†, Anas M. Alazami4†, Fatema Alzahrani4, Erik B. Malarkey5, Nasrin Sorusch6, Lars Tebbe6, Stefanie Kuhns1, Teunis J. P. van Dam7, Amal Alhashem8, Brahim Tabarki8, Qianhao Lu9,10, Nils J. Lambacher1, Julie E. Kennedy1, Rachel V. Bowie1, Lisette Hetterschijt2,3, Sylvia van Beersum3,11, Jeroen van Reeuwijk3,11, Karsten Boldt12, Hannie Kremer2,3,11, Robert A. Kesterson13, Dorota Monies4, Mohamed Abouelhoda4, Ronald Roepman3,11, Martijn H. Huynen7, Marius Ueffing12, Rob B. Russell9,10, Uwe Wolfrum6, Bradley K. Yoder5, Erwin van Wijk2,3*, Fowzan S. Alkuraya4,14* and Oliver E. Blacque1* Abstract Background: Joubert syndrome (JBTS) and related disorders are defined by cerebellar malformation (molar tooth sign), together with neurological symptoms of variable expressivity. The ciliary basis of Joubert syndrome related disorders frequently extends the phenotype to tissues such as the eye, kidney, skeleton and craniofacial structures. Results: Using autozygome and exome analyses, we identified a null mutation in KIAA0556 in a multiplex consanguineous family with hallmark features of mild Joubert syndrome. Patient-derived fibroblasts displayed reduced ciliogenesis potential and abnormally elongated cilia. Investigation of disease pathophysiology revealed that Kiaa0556-/- null mice possess a Joubert syndrome-associated brain-restricted phenotype. Functional studies in Caenorhabditis elegans nematodes and cultured human cells support a conserved ciliary role for KIAA0556 linked to microtubule regulation. First, nematode KIAA0556 is expressed almost exclusively in ciliated cells, and the worm and human KIAA0556 proteins are enriched at the ciliary base. -
Hypermethylation-Mediated Silencing of NDRG4 Promotes Pancreatic Ductal Adenocarcinoma by Regulating Mitochondrial Function
BMB Rep. 2020; 53(12): 658-663 BMB www.bmbreports.org Reports Hypermethylation-mediated silencing of NDRG4 promotes pancreatic ductal adenocarcinoma by regulating mitochondrial function Hao-Hong Shi1, Hai-E Liu1 & Xing-Jing Luo1,2,* 1Department of Anesthesia, Children’s Hospital of Fudan University, Shanghai 201102, 2Department of Anesthesia, Anhui Provincial Children’s Hospital, Hefei, Anhui 230022, China The N-myc downstream regulated gene (NDRG) family members are diagnosed in the advanced stage with a 5-year overall sur- are dysregulated in several tumors. Functionally, NDRGs play vival rate of less than 6%. Thus, PDAC is internationally called an important role in the malignant progression of cancer cells. the “king of cancer” (2). Unfortunately, even with the advent of However, little is known about the potential implications of diverse detection technologies and advanced treatment methods, NDRG4 in pancreatic ductal adenocarcinoma (PDAC). The aim the incidence and mortality rate of PDAC are still on the rise of the current study was to elucidate the expression pattern of year by year (3, 4). Due to the lack of in-depth understanding NDRG4 in PDAC and evaluate its potential cellular biological of molecular characteristics of malignant development, compre- effects. Here, we firstly report that epigenetic-mediated silencing hensive and in-depth research studies are urgently needed to of NDRG4 promotes PDAC by regulating mitochondrial func- better prevent and treat PDAC. tion. Data mining demonstrated that NDRG4 was significantly N-Myc downstream-regulated gene 4 (NDRG4) is a member down-regulated in PDAC tissues and cells. PDAC patients with of the NDRG family proteins (NDRG1-4) known to share 57%- low NDRG4 expression showed poor prognosis. -
Katanin-P80 Gene Promoter Characterization and Regulation Via Elk1
Katanin-p80 Gene Promoter Characterization and Regulation via Elk1 Ece Selc¸uk., Koray Kırımtay., Derya Canbaz, Gu¨ her Is¸ık Cesur, Sirin Korulu, Arzu Karabay* Department of Molecular Biology and Genetics, Istanbul Technical University, Istanbul, Turkey Abstract Katanin is an ATPase family member protein that participates in microtubule severing. It has heterodimeric structure consisting of 60 kDa (katanin-p60) and 80 kDa (katanin-p80) subunits encoded by KATNA1 and KATNB1 genes, respectively. Katanin-p60 has the enzymatic activity for microtubule severing, whereas katanin-p80 consists of multiple domains with different functions such as targeting katanin-p60 to the centrosome, augmenting microtubule severing by katanin-p60, and even suppressing microtubule severing. Despite the various important functions of katanin-p80, its transcriptional regulation has not been studied yet. Elk1 transcription factor has been shown to interact with microtubules and regulate the transcription of another microtubule severing protein, spastin. In spite of katanin’s importance, and structural and functional similarities to spastin, there is no study on the transcriptional regulation of katanin yet. In this study, we aimed to characterize KATNB1 promoter and analyze the effects of Elk1 on katanin-p80 expression. We identified a 518- bp TATA-less promoter including a critical CpG island and GC boxes as an optimal promoter, and sequential deletion of CpG island and the GC elements gradually decreased the KATNB1 promoter activity. In addition, we showed Elk1 binding on the KATNB1 promoter by EMSA. We found that Elk1 activated KATNB1 promoter, and increased both mRNA and protein levels of katanin- p80 in SH-SY5Y cells. On the other hand, KCl treatment increasing SUMOylation decreased KATNB1 promoter activity. -
Neuronal Ndrg4 Is Essential for Nodes of Ranvier Organization in Zebrafish
RESEARCH ARTICLE Neuronal Ndrg4 Is Essential for Nodes of Ranvier Organization in Zebrafish Laura Fontenas1¤a, Flavia De Santis2☯, Vincenzo Di Donato2☯, Cindy Degerny1, BeÂatrice Chambraud1, Filippo Del Bene2, Marcel Tawk1* 1 U1195, Inserm, University Paris Sud, University Paris-Saclay, Kremlin-Bicêtre, France, 2 Institut Curie, PSL Research University, Paris, France ☯ These authors contributed equally to this work. ¤a Current address: Department of Biology, University of Virginia, Charlottesville, Virginia, United States of America * [email protected] a11111 Abstract Axon ensheathment by specialized glial cells is an important process for fast propagation of action potentials. The rapid electrical conduction along myelinated axons is mainly due to its saltatory nature characterized by the accumulation of ion channels at the nodes of Ranvier. However, how these ion channels are transported and anchored along axons is not fully OPEN ACCESS understood. We have identified N-myc downstream-regulated gene 4, ndrg4, as a novel fac- Citation: Fontenas L, De Santis F, Di Donato V, tor that regulates sodium channel clustering in zebrafish. Analysis of chimeric larvae indi- Degerny C, Chambraud B, Del Bene F, et al. (2016) Neuronal Ndrg4 Is Essential for Nodes of Ranvier cates that ndrg4 functions autonomously within neurons for sodium channel clustering at Organization in Zebrafish. PLoS Genet 12(11): the nodes. Molecular analysis of ndrg4 mutants shows that expression of snap25 and nsf e1006459. doi:10.1371/journal.pgen.1006459 are sharply decreased, revealing a role of ndrg4 in controlling vesicle exocytosis. This Editor: David Lyons, Centre for Neuroregeneration, uncovers a previously unknown function of ndrg4 in regulating vesicle docking and nodes of Edinburgh, UNITED KINGDOM Ranvier organization, at least through its ability to finely tune the expression of the t-SNARE/ Received: May 3, 2016 NSF machinery. -
Down Regulation of CIAPIN1 Reverses Multidrug Resistance in Human Breast Cancer Cells by Inhibiting MDR1
Molecules 2012, 17, 7595-7611; doi:10.3390/molecules17067595 OPEN ACCESS molecules ISSN 1420-3049 www.mdpi.com/journal/molecules Article Down Regulation of CIAPIN1 Reverses Multidrug Resistance in Human Breast Cancer Cells by Inhibiting MDR1 Dan Lu 1,†,*, Zhibo Xiao 2,†, Wenxiu Wang 1, Yuqing Xu 1, Shujian Gao 1, Lili Deng 1, Wen He 1, Yu Yang 1, Xiaofei Guo 1 and Xuemei Wang 1 1 Department of Oncology, the Second Affiliated Hospital of Harbin Medical University, Harbin 150086, China 2 Department of Plastic Surgery, the Second Affiliated Hospital of Harbin Medical University, Harbin 150086, China † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]. Received: 13 March 2012; in revised form: 11 June 2012 / Accepted: 11 June 2012 / Published: 20 June 2012 Abstract: Cytokine-induced apoptosis inhibitor 1 (CIAPIN1), initially named anamorsin, a newly indentified antiapoptotic molecule is a downstream effector of the receptor tyrosine kinase-Ras signaling pathway. Current study has revealed that CIAPIN1 may have wide and important functions, especially due to its close correlations with malignant tumors. However whether or not it is involved in the multi-drug resistance (MDR) process of breast cancer has not been elucidated. To explore the effect of CIAPIN1 on MDR, we examined the expression of P-gp and CIAPIN1 by immunohistochemistry and found there was positive correlation between them. Then we successfully interfered with RNA translation by the infection of siRNA of CIAPIN1 into MCF7/ADM breast cancer cell lines through a lentivirus, and the expression of the target gene was significantly inhibited. -
Supplemental Information
Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig. -
Variation in Protein Coding Genes Identifies Information
bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number. -
Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement. -
Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A. -
CIAPIN1 Gene Silencing Enhances Chemosensitivity in a Drug-Resistant Animal Model in Vivo
Brazilian Journal of Medical and Biological Research (2014) 47(4): 273-278, http://dx.doi.org/10.1590/1414-431X20133356 ISSN 1414-431X CIAPIN1 gene silencing enhances chemosensitivity in a drug-resistant animal model in vivo X.M. Wang1, S.J. Gao1, X.F. Guo1, W.J. Sun1, Z.Q. Yan2, W.X. Wang1, Y.Q. Xu1 and D. Lu1 1Department of Oncology, The Second Affiliated Hospital, Harbin Medical University, Harbin, China 2Department of Breast Surgery, The Second Affiliated Hospital, Harbin Medical University, Harbin, China Abstract Overexpression of cytokine-induced apoptosis inhibitor 1 (CIAPIN1) contributes to multidrug resistance (MDR) in breast cancer. This study aimed to evaluate the potential of CIAPIN1 gene silencing by RNA interference (RNAi) as a treatment for drug-resistant breast cancer and to investigate the effect of CIAPIN1 on the drug resistance of breast cancer in vivo. We used lentivirus-vector-based RNAi to knock down CIAPIN1 in nude mice bearing MDR breast cancer tumors and found that lentivirus-vector-mediated silencing of CIAPIN1 could efficiently and significantly inhibit tumor growth when combined with chemotherapy in vivo. Furthermore, Western blot analysis showed that both CIAPIN1 and P-glycoprotein expression were efficiently downregulated, and P53 was upregulated, after RNAi. Therefore, we concluded that lentivirus-vector-mediated RNAi targeting of CIAPIN1 is a potential approach to reverse MDR of breast cancer. In addition, CIAPIN1 may participate in MDR of breast cancer by regulating P-glycoprotein and P53 expression. Key words: CIAPIN1 gene; Multidrug resistance; RNA interference; MDR1 gene; Breast neoplasms Introduction Breast cancer is the most common cancer of women inhibiting the expression of P-gp to overcome MDR in worldwide, accounting for 22.9% of all female cancers.