Spatial and Temporal Variability in the Genetic Diversity of Invasive Smallmouth Bass

Home , Ghost population

View metadata,Downloaded citation and from similar orbit.dtu.dk papers on:at core.ac.uk Mar 29, 2019 brought to you by CORE

provided by Online Research Database In Technology

The ghost of introduction past: Spatial and temporal variability in the genetic diversity of invasive smallmouth bass

Diedericks, G.; Henriques, Romina; von der Heyden, S.; Weyl, O.L.F.; Hui, C. Published in: Evolutionary Applications

Link to article, DOI: 10.1111/eva.12652

Publication date: 2018

Document Version Peer reviewed version

Link back to DTU Orbit

Citation (APA): Diedericks, G., Henriques, R., von der Heyden, S., Weyl, O. L. F., & Hui, C. (2018). The ghost of introduction past: Spatial and temporal variability in the genetic diversity of invasive smallmouth bass. Evolutionary Applications, 11(9), 1609-1629. DOI: 10.1111/eva.12652

General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.

 Users may download and print one copy of any publication from the public portal for the purpose of private study or research.  You may not further distribute the material or use it for any profit-making activity or commercial gain  You may freely distribute the URL identifying the publication in the public portal

If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

This article isThis article by protected copyright. All rightsreserved. 10.1111/eva.12652doi: differences to lead between the of thisversion citethisarticle and asVersion Record.Please copyediting, paginationbeen throughthe andproofreadingtypesetting, process,may which This article acceptedhas been peer for publicationreviewbut has not andundergone full [email protected] Email: Africa. South Grahamstown, (SAIAB), Aquatic Biodiversity IV Email:[email protected] Africa. South Stellenbosch, Bag X1, 7602, III [email protected] Email: Denmark. Kgs.Lyngby, 2800, Kemitorvet, Denmark, II [email protected] Email: Africa. South Stellenbosch, 7602, Matieland, BagX1, University, Private Affiliations: Authors: Running headline: invasive of diversity variabilityinthegenetic Spatialandtemporal past: of introduction The ghost Article :Original Article type :0000- (OrcidID DIEDERICKS GENEVIEVE DR. Section for Marine Living Resources, National Institute of Aquatic Resources, Technical University of University Technical Resources, Aquatic of Institute National Resources, Living Marine for Section Evolutionary Genomics Group, Department of Botany and Zoology, Stellenbosch University, Private Private University, Stellenbosch Zoology, and Botany of Department Group, Genomics Evolutionary Accepted for Institute African South Ecology, Freshwater and Fisheries Inland in Chair Research DST/NRF Article G. Diedericks I Centre for Invasion Biology, Department of Botany and Zoology, Stellenbosch Stellenbosch Zoology, and Botany of Biology, Department Centre forInvasion Genetic variability of invasive smallmouth bass bass smallmouth ofinvasive Genetic variability I, I II* , R. , Henriques s mallmouth bass mallmouth II , S. von der Heyden , S. von 0001

-7700- 8906) III , O.L.F. Weyl O.L.F. ,

IV,V , C. Hui , C.

VI, VII VI, VII This article isThis article by protected copyright. All rightsreserved. of introduction historic a both showed samples andhistorical contemporary of Comparison admixture. of levelshigher revealed USA populations historic both whereas structure, population significant range displayed invasive the Furthermore, bottleneck. genetic arecent experienced populations contemporary both that results suggest These ranges. invasive native and contemporary to both compared levels when historic the that revealed Africa), South into introduced historic and contemporary 572 total of ( bass smallmouth (contemporary) and invasive comparison a three-way by conducting time. over maintained hasbeen range native the structure within historic population the that thepremise heavily on relying samples, contemporary on solely focus however, studies, Most compared. are often aspecies of range invasive and native the within levels of end, this To novel environment. a to adaptability potential and invasive their unravelling for essential is populations introduced of history demographic the Understanding ABSTRACT author *Corresponding Email: [email protected] VII Africa. South 7602, Bag X1, Matieland VI South Africa. V Centre for Invasion Biology, South African Institute for Aquatic Biodiversity (SAIAB), Grahamstown, Grahamstown, (SAIAB), Aquatic Biodiversity for Institute Biology, African South Invasion Centre for Centre for Invasion Biology, Department of Mathematical Sciences, Stellenbosch University, Private Private University, Stellenbosch Sciences, Mathematical of Biology,Department forInvasion Centre Accepted Article 7945. Cape Town, Sciences, Mathematical for African Institute Group, Biosciences Mathematical M. dolomieu M.dolomieu samples, representing the contemporary invasive South African range, African South invasive contemporary the representing samples, al native USA range (dating back to the 1930s when these fish were first first fishwere these when 1930s the to back range(dating USA native of the genetic diversity the genetic diversity Micropterus dolomieu Micropterus M. dolomieu al native range had higher genetic diversity diversity genetic higher had range native , as well as a more recent introduction, recent introduction, amore well as , as of native (historic and contemporary) contemporary) (historic and native Here ) populations. Analyses of a a of Analyses populations. ) al , we assess this assumption thisassumption assess , we and contemporary native contemporary and ge netic diversity diversity netic This article isThis article by protected copyright. All rightsreserved. Accepted et al., (Prentis strategy specific management viability population bemade on to predictions (Edelaaret al. success invasive organisms’ in plays an &Dennis, Santure, Stapley, 2015; & Lowe ofpopulations potential and adaptive demograph the establishing for essential become has diversity genetic of assessment the this end, 2017) Richardson, Hui & 2015; etal., Chown 2014; Darling, Rius& 2007; &Darling, Roman 2002; (Lee, introduction following genetic diversity of levels in alternations rapid frequently experience analys demographic suitable for areparticularly species Invasive biology. evolutionary of aspect a fundamental constitutes populations of history demographic the Understanding INTRODUCTION Article introductions multiple design; sampling DNA historic history; demographic bottleneck; genetic invasive; diversity; Genetic Keywords: analyses. demographic into historic specimens incorporating of theimportance highlight and genetic diversity of levels elevated the for havebeen responsible that may factors alternative discuss we range, invaded inthe genetic diversity high levelsof to the contributed have might multiple introductions Although occurred. have species this of introductions undocumented that demonstrating thereby , 2008; Zenni, Bailey, & Simberloff, 2014; Dlugosch, Anderson, Braasch, Cang, & Gillette, &Gillette, Cang, Braasch, Anderson, Dlugosch, 2014; &Simberloff, Zenni,Bailey, 2008; 2015) in , and provides insight into the role that genetic variability variability the rolethat genetic insight into provides , and novel environments (Prentis, Wilson, Dormontt, Richardson, Dormontt,Richardson, Wilson, (Prentis, novel environments 2008 , aiding aiding ; Chown et al., 2015; Meyer et al., al., et Meyer 2015; etal., ; Chown , , in 201 the development of an appropriate, species- appropriate, an of the development 5). Ultimately, this information allows allows information this Ultimately, 5). 2017 es , as ).

they ; . To To ic

This article isThis article by protected copyright. All rightsreserved. Accepted importance. fundamental DNA historic of theincorporation perspective, evolutionary an from Hence, dispersal. human-mediated with associated often species or taxa stocked) subsequently (and exploited is which there Stepien, Snyder & &Heath, Mandrak, Walter, Beneteau, 2011; Hill, & Garcia, Cortina, (Funk, populations invasive etal., Thompson 2010; &Fischer, Kleunen, Weber, 2009 &Cameron, (Lozier data oncontemporary only focussing studies by overlooked frequently changes & Sorenson, Sefc, Payne, 2003; et al., (Guinand generations diversity across genetic in changes temporal of thefor monitoring allows asit 2014), etal., Dormontt 2009; Lozier & Cameron, 2003; Page, & Scribner, Guinand, 2000; (Bouzat, geneticdiversity contemporary examining when avaluablereference as serves Historic DNA Article time. over maintained been has native range the within structure population historic the that premise the heavily on relying thereby populations, contemporary on exclusively focussed have todate studies invasion of themajority collections, Natural History within housed information and wealth ofspecimens Walters (Ficetola in question species invasive the of history demographic Sherwin, etal., (Kolbe Richardson, Hui& 1965; Stebbins, admixture bottlenecks, genetic effects, (e.g., founder variation genetic on dynamics the invasion of effects toassess attempted have Numerous studies ), and thus allows us allows thus ), and , Fernandes, & Hoffman, 2009; Neilson & Stepien, 2011; Gray et al., 2014). Yet, despite the despite Yet, 2014). Gray et al., 2011; & Stepien, Neilson 2009; & Hoffman, Fernandes, 2009; Naccarato 2009; 2004 a priori ; 2017 Kelly reason to suspect temporal fluctuations in genetic variation, such as highly highly such as ingenetic variation, fluctuations temporal to suspect reason ). , This may be of particular importance in studies conducted on taxa for taxa for on conducted studies in importance particular be mayof This Muirhead 2007) , to Dejarnette, & Allman Dejarnette, delineate the most likely invasion scenario (Gillis et al., 2009; Van Van 2009; et al., (Gillis scenario likely invasion most the delineate . This temporal approach increases the chance of detecting subtle subtle detecting of the chance increases approach temporal . This 2017 , Heath, & Macisaac, 2006; Rollins 2006; Macisaac, & Heath, ) by comparing populations in the native and invasive ranges and native invasive in the populations comparing ) by , 2015). These types of studies aid in unravelling the unravelling aidin studies of types These 2015).

2011) and reveal connectivity levels among levels among connectivity reveal 2011) and , propagule pressure; Mayr, 1963; Baker & & Baker 1963; Mayr, pressure; propagule , Bonin, & Miaud & Bonin, , Woolnough , , 2008; Gillis 2008; Wilton is therefore of of therefore , Sinclair, & Sinclair, , 2012 ; This article isThis article by protected copyright. All rightsreserved. Accepted range. will diversity diversity genetic in the species’ leaving traces genetic bottlenecks experience often species exploited heavily as Furthermore, (2008). and Parker Dlugosch by suggested ofalleles,as aloss to due range American North contemporary) and (historic native to the when compared diversity lowergenetic havea will range African South invasive dolomieu of history the introduction (3) assess and ranges, invasive native and timeboth in changed over diversity within and differentiation the genetic (1) assess to: aims study the present documented, Africa arewell Considering 2014 Weyl,&Cowx, Woodford, (Ellender, Articleoccurr Bruton, Moor & (de angling for opportunities to provide country the across waterbodies intomultiple being released bred before and reared they were 2013). Here, & Venturelli, Vascotto, Loppnow, 1988; &Burton, deMoor 1967; (Powell, in1937 Africa in South hatchery Jonkershoek to the USA, inMaryland, hatchery Lewistown the from were shipped USA, Virginia, River, West inthe Wheeling collected broodstock from &Bruton, Moor (de recorded Africa well Suski Allen (Long, welldocumented are range native the within events stocking subsequent as time, and space through diversity ingenetic variation investigate b Smallmouth , 2015), and its formal introduction history and subsequent spread into and throughout South South throughout and into spread subsequent historyand introduction formal and its 2015), ed prior to the cessation of government support to stocking programs in the early 1990s the early 1990s in programs to stocking support ofgovernment cessation tothe prior into South Africa. Given the small Giventhesmall Africa. South into th be ass, at both the historical record and contemporary distributions of of distributions andcontemporary historical record the at both M. dolomieu M.dolomieu lower in contemporary time when compared to historic compared time when contemporary in lower Micropterus dolomieu dolomieu Micropterus populations in South Africa, (2) investigate how genetic diversity geneticdiversity how investigate (2) Africa, South in populations 1988) . Most of the documented stockings (de Moor & Bruton, 1988) 1988) &Bruton, Moor (de stockings documented ofthe Most . (Lacepède, 1802), presents a suitable model system to system model asuitable presents 1802), (Lacepède, 1988) ).

M.dolomieu (Pinsky & Palumbi, 2014) &Palumbi, (Pinsky . Twenty-nine Twenty-nine . founding population, population, founding M. dolomieu M.dolomieu the species’ exploitation and and exploitation the species’ , al we samples in the native thenative in samples specimens originating originating specimens predict that the genetic the genetic that predict M. dolomieu M.dolomieu we predict that the that predict , Porak, & Porak, in South South in M. , This article isThis article by protected copyright. All rightsreserved. Accepted the amount doubling from Apart tissue. fixed formalin 1950), - (1820 old working with when methods extraction review In a recent kit (QIAGEN). extraction tissue FFPE DNA the QIAamp using extraction, DNA before tube Eppendorf dry moved to a sample was the rehydrated, Once hours. every 24 vortexing days, the sample to each added was distilledwater 1000μL water. Lastly, μLdistilled 1000 by followed 70 %ethanol, 500μL with repeated was the process removed and was The liquid 30seconds. for vigorously vortexed and tissue sample to each added was % ethanol r are if thesamples tissue formalin-fixed from beextracted DNA can highquality that showed (2011) andLam Cameron, Enfield, Pikor, contaminants. potential any bleachto remove 10% treated with were surfaces equipment and all toeachextraction, Prior equipment. sterilised using fishDNA to unexposed previously mg)aroom in (20-50 tissue muscle preserved extracted from was Genomic DNA Article al., 2008). et (Barthel generations ago the of asubset represent These specimens 1). (Table analyses genetic for obtained were drainage systems 11 representing specimens 53formalin-fixed Intotal, 1). 1;Appendix (Table (OSUM) Museum University Ohio State the and (UMMZ), Zoology Museum of University Michigan of (ANSP), University ofDrexel Sciences Natural of Academy The (NMNH), History Natural Museum of National theSmithsonian at housed (1930 South Africa into introduction of time historic the representing Specimens historic from and extraction DNA collection AND METHODS MATERIALS of Proteinase K added to each sample (60 μL), extraction followed the manufacturers’ the manufacturers’ followed μL), extraction (60 sample to each Kadded Proteinase of , Paireder et al. Paireder ehydrated with a series of ethanol washes prior to extraction. Thus, 500 μL of 100 of100 500μL Thus, to extraction. prior washes ethanol of aseries with ehydrated M. dolomieu M.dolomieu

(2013) demonstrated that this kit consistently outcompeted other outcompeted consistently thiskit that demonstrated (2013) al native range (Figure 1), corresponding to the approximate the toapproximate corresponding 1), (Figure range native genet al – ic diversity that was present in the native range 20 range native inthe present that was ic diversity

specimens 1941) , were obtained from a host of collections ofcollections host a from were obtained , sample and left to soak at 55 °C for five five at 55°Cfor leftto soak and sample

–

25 This article isThis article by protected copyright. All rightsreserved. Accepted (MACHEREY-NAGEL, (gDNA) kit extraction Tissue NucleoSpin the using &SA) (USA specimen contemporary each extracted from was DNA 1). Appendix 1; (Table riversystems eight representing specimens of306 sample size total a rendering Africa, South Grahamstown, (SAIAB), Biodiversity Aquatic for Institute African theSouth from obtained were =63) (n specimens Additional extraction. subsequent for ethanol in70% werestored Tissue samples tissue. piece samplingof a before Stellenbosch) Universityof SU-ACUM14-00011, number clearance reference Ethical 5498/2; MPB. number permit Mpumalanga 166/14CR; and CRO CRO 165/14CR numbers permit Eastern Cape 0056-AAA043-00004; number permit oil(CapeNature clove euthanised with were All SA specimens Canada. (ROM), Museum Ontario theRoyal from wereobtained River, the Detroit 1).Addition (Table comparisons the historic by represented area same ‘broad’ the from sampled were specimens of213 a total localities, rendering Nine Acknowledgements). (see Canada and theUSA in based andorganisations individuals of ahost led by Articlewere North America in Collections 1). (Figure and2015 of2014 months the summer ranges during (SA) African South invasive the and and Canada (USA) America States of United native the in both angling collected by fromspecimens derived were clippings) (muscle, liver,fin samples Fresh tissue specimens contemporary from and extraction DNA collection DNA All 30μL. of extraction volume total DNA a to yield times three repeated was This minutes. 1.5 for rpm at 14,000 centrifuging before minutes added 25.5 °C) was to (warmed buffer elution ofbound elution themaximum toensure Lastly, steps. wash with the commencing before hour one to 90°Cfor were heated the samples bonds, break theformalin To protocol. al specimens collected in 2014 (n = 7; formalin fixed), representing fixed), representing (n =7; formalin 2014 in collected specimens al and left to ‘incubate’ at room temperature for 5 for atroom temperature to ‘incubate’ left and extractions were stored at -20 °C. -20 °C. at stored were extractions samples to allow for direct genetic diversity diversity direct genetic for toallow samples DNA, 10 μL 10 DNA, DN A This article isThis article by protected copyright. All rightsreserved. fora polymorphic werenot andLma117 Lma102 As amplified. successfully 1999) were Gross, Fu, & Lma21 genus-specific: and three Mdo11 Mdo10, Mdo9, Mdo8, Mdo7, Mdo5, (Table literature published from were selected amplification, genus-level and both species- for designed loci, Fifteen microsatellite 1 inGeneious® aligned and inspected were visually Chromatographs Africa). South Stellenbosch, beforebeing sequenced electrophoresis followe PCR reactions Both (5ˊ fragment G GTG AGG (5ˊ primers, basscytbf1 mtDNA forboth prepared was μL mastermix samples 519). (n = samples the contemporary forall were amplified mitochondrial populations invasive and bothnative of history demographic and genetic diversity the of identification morphological the To corroborate amplification DNA contemporary and Historical at were stored Africa South Cape Town, Separations, Accepted Zealand). New Auckland, 0.0.2 (Biomatters, Article - GTGCTTATGCTTTAGTTAAGC

d .

ue to the to ue T - he p he

3ˊ;

DNA - 20 °C. Near, Kassler, Koppelman, Dillman, Koppelman, Kassler, Near, rimer set CB3R set rimer

limited availability of tissue and the the tissue and availability of limited (mtDNA) (mtDNA)

- CAC CCC TAC TTC TCC TAC AAA GA TCCTAC AAA TACTTC CCC CAC d the authors’ protocols. d theauthors’ gene regions gene - L (5 ˊL (5 - S1 –

3ˊ; Bernatchez & Danzmann Bernatchez 3ˊ; Colbourne, Neff, Wright, & Gross, 1996; Lma102, Lma117 Lma117 Lma102, 1996; Gross, Wright, & Neff, Colbourne, ). Of these, only 11 loci (eight loci(eight species-specific 11 these, only ).Of - ) following the manufacturers protocol. All DNA extractions DNA extractions protocol. All manufacturers following the ) CATATTAAACCCGAATGATATTT

(ABI 3730 XL DNA Analyzer, Applied Biosystems, CAF, AppliedBiosystems, DNAAnalyzer, 3730XL (ABI ,

namely – p

Malloy, Malloy, olymerase olymerase

cytochrome b (cytb) and b(cytb) and cytochrome

& Philipp, & Philipp,

A ll PCR products were visualised through gel through visualised were ll PCRproducts Van contemporary contemporary degraded nature of degraded c - Den Bussche Den hain reaction hain

This was not possible f not possible was This 3ˊ) and basscytbr1 (5ˊ basscytbr1 3ˊ) and , 2003) were used to amplify the cytb cytb the to amplify used 2003) were

1993) 1993) - was

collected collected 3ˊ; Palumbi 3ˊ; s ,

Coughlin, & Echelle, 2000; 2000; Echelle, & Coughlin,

( used to amplify the CR. amplifythe to used PCR the control region (CR) region control ) .

specimens The internal cytb The internal DNA : - , Mdo3, Mdo4, Mdo4, Mdo3,

AAG GCR AAG CGG AAGCGG GCR AAG or the historic the or , 1996) and HN20 1996) and

t wo partial partial wo . A standard 25 A standard

and and – Neff, Neff, assess assess ,

- R This article isThis article by protected copyright. All rightsreserved. Accepted historic the for analysed loci were microsatellite eight but only dataset, the contemporary for analysed were loci ninemicrosatellite Thus, entirely. ofhistoric the majority for not amplify did Mdo8, locus, microsatellite since one Similarly, study. fromthe excluded and the dataset from historic (for both scored not be (historic observed were inconsistencies Where scoring consistency and accuracy to ensure times three repeated and removed) name (i.e. specimen blindly Historic controls. aspositive used were scored previously individuals reference scoring, accurate Toensure New Zealand). Auckland, 10.0.2(Biomatters, Geneious® in conducted was scoring and marker, size an internal as usingLIZ Africa), South Stellenbosch, CAF, (Applied Biosystems, Analyzer XLDNA 3730 ABI an performed on was genotyping microsatellite historic 2007), Sefc etal., Article & Alberts Moss, Horn, Van Archie, (Buchan, DNA formalin-fixed and ancient- of amplification the with oftenassociated diversity genetic of the overestimation avoid and to amplification obtain water to with distilled diluted were each multiplex for products PCR resulting Thus, the yield results. did not this oftheDNA nature degraded to the DNA,butdue contemporary the for used procedure follow samples, thehistoric for amplified were loci microsatellite nine The same Africa). Town,South Cape Kit(KapaBiosystems, (Table study present inthe used lociwere nine polymorphic therefore excluded; were they specimens subset of a 1 / 10 10 PCR product which, in turn, served as template in the subsequent PCR. To ensure PCR. To ensure the subsequent in template served as turn, in which, product PCR S1 ). Three multiplex reactions were performed using the KAPA2G using performed were multiplex reactions ).Three al samples were amplified twice for each microsatellite locus. locus. microsatellite each twice for amplified were samples al and contemporary specimens), the entire specimen was removed removed was theentire specimen specimens), contemporary and al samples, it was removed from the historic fromthe removed was it samples, al dataset. dataset. al specimens) and more than three loci could loci three than more and specimens) al specimens were scored werescored specimens TM ing Fast Multiplex PCR PCR Multiplex Fast al the amplification the amplification dataset dataset All , 2005; 2005; . This article isThis article by protected copyright. All rightsreserved. F of Lischer, & (Excoffier 3.5.2.2 ARLEQUIN 2005) and (Kalinowski, Rare 1.1 (F coefficient (H observed (AR), allelic richness (Na), ofalleles number as assessed levels were diversity genetic within-population and Intraspecific 1977). & Rubin, Laird, (Dempster, algorithm EM the using alleles ofnull presence the check for used to 2007) was &Estoup, (Chapuis 1.2 FreeNA assumptions, HWE with notcomply to were found thepopulations most of 2006). As Hutchinson, & Weetman, Oosterhout, (Van 2.2.3 MICROCHECKER with assessed was stuttering and drop-out large allele with associated errors Amplification 10 (HWE) equilibrium All andhistoric Contemporary with significance assessed (Excoffier &Lischer, 3.5.2.2 ARLEQUIN in were conducted All analyses localities. sampled among subdivision ofpopulation amount the to determine conducted (AMOVA) Pairwise fragment. gene each for datasets contemporary invasive and native both combining conducted was structure using Fu’s examined site eachsample for calculated ( ofhaplotypes the number ranges, - native (USA contemporary the levels inboth diversity genetic To assess analyses mtDNA Contemporary ,000 iterations. The Bonferroni method was used to correct for multiple comparisons (Rice, 1989). 1989). (Rice, multiple comparisons correct for to wasused method Bonferroni The iterations. ,000

Accepted Hardy-Weinberg from deviations and linkagedisequilibrium for assessed were loci microsatellite Article IS was assessed after 1000 permutations in FSTAT 2.9.3.2 (Goudet, 1995). Allelic richness (AR) Allelic richness 1995). (Goudet, 2.9.3.2 FSTAT in permutations after 1000 assessed was IS ), as implemented in FSTAT 2.9.3.2 (Goudet, 1995), Genepop 4.2 (Rousset, 2008), HP- 2008), (Rousset, 4.2 Genepop 1995), (Goudet, 2.9.3.2 inFSTAT ), implemented as

in F ST Fs Fs Genepop 4.2.1 (Rousset, 2008), with statistical significance assessed after after assessed significance with 2008), statistical (Rousset, 4.2.1 Genepop values were calculated and a hierarchical Analysis of Molecular Variance Molecular Variance of Analysis hierarchical a and calculated were values (Fu, 1997) and Tajima’s Tajima’s 1997) and (Fu, 10 al ,000 permutations. ,000 microsatellite analyses analyses microsatellite . The population history for for history population The O ) and expected heterozygosity (H heterozygosity expected ) and H ), haplotype diversity ( diversity haplotype ), D

(Tajima, (Tajima, 1989) M. dolomieu h ) and nucleotide diversity (π) were (π) were diversity nucleotide and . Assessment of genetic population genetic population of Assessment . E ), and Wright’s inbreeding inbreeding Wright’s ), and 2010 2010 in both ranges both in CN ), with statistical ),statistical with ). ) and invasive (SA - (SA invasive ) and Statistical significance significance Statistical

was was CI ) This article isThis article by protected copyright. All rightsreserved. AcceptedRank a Wilcoxon using groups three ofthe for each evaluated was excess significant heterozygote Thus, 1999). (Piry et al., populations to stable compared heterozygosity when of levels elevated display and (rare)alleles of loss witha associated often are bottleneck a genetic undergone have bottleneck recent genetic a experienced CN) (CI and populations contemporary both that prediction the test to used was 1999) & Cornuet, Luikart, (Piry, 1.2.02 BOTTLENECK Next, 2007). Estoup, & (Chapuis significance statistical to employed assess was replicates bootstrap 1000 with jackknifeapproach A 2007). &Estoup, - Chapuis previousanalysis inthe null (detected alleles estimate correctly to shown been has which 2007), Estoup, (Chapuis & FreeNA 2007). Estoup, (Chapuis & 1.2 FreeNA localities using (1986) Weir’s Secondly, loci. and localities among variation the to visualise constructed was graph bar stacked a In addition, groups. between differences the further assess usedto was test post-hoc aBonferroni Subsequently, in conducted (Hheterozygosity Article observed in difference a was there whether todetermine loci.Firstly, nine encompassed historic the historic for amplified historic and (contemporary among connectivity andgenetic structuring thepopulation investigate to employed were approaches Multiple MUS) mos sizefor smallsample the to but due datasets, the twocontemporary for perpopulation were conducted Analyses analysis. rarefaction using calculated was to obtain the genetic diversity indices. diversityindices. genetic the to obtain al samples only compared the eight loci, while contemporary SA contemporary loci,while the eight compared only samples SPSS STATISTICS O ) between the three groups (CI, CN, HN), an Analysis of Variance (ANOVA) was was Variance of (ANOVA) Analysis HN), an CN, (CI, groups three the between ) HP - F Rare al ST native (HN) specimens, all comparative analyses incorporating the the incorporating analyses comparative all (HN) specimens, native was employed to assess the genetic differentiation among sampled sampled among genetic differentiation the employed to assess was 20.0.0 (SPSS Inc., Chicago, IL, USA), with loci selected as random factors asrandom selected withloci USA), IL, Inc., Chicago, (SPSS 20.0.0

1.1

(Kalinowski t thehistoric of ,

2005), correct 2005), al ) populations. As only eight loci were successfully successfully eight only were loci As ) populations. al

localities (Table localities ing , employing the employing

for sample size disparity through through disparity sample for size F – ST USA comparisons comparisons USA

values in the presence of presence inthe values 1) 1) these ENA . Populations that that Populations correction method method correction

were grouped grouped were (= . This article isThis article by protected copyright. All rightsreserved. al., 2014) et 2.1.0(Cornuet using DIYABC records, the historical by stated USA as the event from introduction SouthAfrican theinvasive whether determine to dataset the microsatellite on (ABC) Computation Bayesian Approximate an we performed Lastly, composite assignments. the visualise to used 2004) was (Rosenberg, likely the most for runs replicate compile the five to 2007) Rosenberg, & (Jakobsson 1.1.2 CLUMPP beforeusing 2005), Goudet, & Regnaut, (Evanno, method Evanno the following HARVEST STRUCTURE 75 each for conducted were runs replicate Five frequency. genotype its determinedby as clusters multiple to be to allocated individual allowing each allele frequencies, correlated with model the admixture using conducted HN) were CN and CI, combining ananalysis by followed independently group (each analyses STRUCTURE Four originated. stocks African South theinvasive fromwhere population source a potential for (c) search and native range, contemporary and historical the from populations overlapping compare HN),(b) CN, (CI, groups three ofthe each within structure population the visualise and (a) identify 2000) to 2011). & Ahmed, 1.3.1 (Jombart Adegenet R package the in conducted was frequencies allelic microsatellite (PCA)using Analysis Component Principal alleles, a ofnull presence the HWEor lackby the of influenced being without amongthem, as aswell groups three the of withineach associations thegenetic To investigate model (IAM). Alleles Infinite the and model (TPM) Mutation the Two-Phase microsatellite evolution with oftenassociated models mutational fortwo iterations) test (10,000

Accepted MCMCsteps 350,000 by followed generations, (MCMC) Monte Carlo Chain Markov ,000 Article . As null alleles were only observed in one locus (Mdo9) of the HN dataset, all loci and and allloci HNdataset, the (Mdo9) of onelocus in onlyobserved null were alleles As ER 0.6.94 (Earl & vonHoldt, 2012) was used to determine the most probable most probable the to determine used was 2012) vonHoldt, & (Earl 0.6.94

Next, we used STRUCTURE 2.3.4 (Pritchard, Stephens, & Donnelly, & Donnelly, Stephens, (Pritchard, STRUCTURE 2.3.4 used we Next, K (1< K <15) M. dolomieu . Runs were conducted using an initial burn-in of burn-in initial an using conducted were Runs populations originated from a single asingle from originated populations K . DISTRUCT 1.1 1.1 DISTRUCT . ; K

This article isThis article by protected copyright. All rightsreserved. Accepted was rate error scenarios Each 2014). et al., (Cornuet components discriminant analysis the linear on conducted which was alogistic regression, through compared weresubsequently Scenarios each. Next, analyses. inthe current used statistics the summary from excluded it was 2001). Hence, Williamson, & (Garza sizes population starting andsmall sizes sampling unequal well withsmall, not perform does thismind, statistic in planning conservation with developed initially 2001) was & Williamson, and samples between distance distance, shared allele classification, of index mean variance, size alleles, allele of diversity,number genetic (i.e. mean statistics two-sample loci) and across variance size and allele geneticdiversity alleles, numberof mean (i.e. single-sample simulated forboth summary statistics comparing and datasets 100,000 by simulating accomplished was This observed. ofthe to that similar datasets simulated couldgenerate priors associated andits onescenario at that least ensure pre-evaluation a performed we Firstly, 2014). et al., (Cornuet guidelines program the to according specified were parameters over-parameterization, To prevent Appendix 2). source thesame events from introduction Article two independent (2) HN), (CN + population the source from introduction serial (1) a single simulated were scenarios supplementary three (2010), Estoup & Cornuet, Coisi, Guillemaud, Beaumont, by suggested as Lastly, nine 4 OL;Figure BE and populations from individuals (predominantly (CI) individuals (CI individuals African South the invasive of subsample a that resultsrevealed the STRUCTURE ofpossibilities list exhaustive an rather than - 1 5: (Figure framework acoalescent under generated were scenarios introduction yet competing, six simple, included were populations additional scenarios to test the theory of multiple introductions (Figure 5: A 5: (Figure introductions multiple of testthe theory to scenarios additional we simulated 10 simulated F 6) S ST ) were more closely related to the historic native samples than to the remaining SA the remaining SA to than samples the historic native to closelyrelated )more were , in order to focus the computational efforts on probable introduction scenarios scenarios introduction onprobable efforts computational focusthe orderto , in ) to the observed data (Cornuet et al., 2014). As the mean mean the 2014). As et al., (Cornuet data ) theobserved to 6 data sets per scenario before calculating the posterior probability (PP) for for (PP) probability posterior the calculating before scenario sets per data to . Sampled localities were pooled into three groups (CI, CN and HN), and and HN), CNand (CI, three groups into pooled were localities Sampled determine whether the two SA groupings (CI and CI and (CI SAgroupings two the whether determine or (s (3), an unsampled source population (Figure 5 (Figure population source unsampled (3), an ee Appendix 2 for detailed introduction scenarios). As scenarios). introduction detailed for 2 Appendix ee M index across loci (Garza (Garza loci index across M. dolomieu M.dolomieu : S ) originated from from ) originated B – of I ), the dataset to dataset the ; we simulated we simulated Appendix 2). 2). Appendix : i –

iii ; This article isThis article by protected copyright. All rightsreserved. - LOL and BE 0.05 ranging from groups two the from between localities comparisons F Tajima’s for were observed neutrality from deviations Significant 2). (Table CIpopulations cytbinthe for higher diversitywas nucleotide overall particular, In 2). (Table fragment gene and localities sampling π0.0 0.007, = ±0.025;CR: π0.051 0.005, = high the the for haplotypes fewer andCR rendered cytb Both CR, respectively. sequenced successfully 174 209and total of localities yielded a (CN) USA ninenative the while CR, of 979bp cytband of 306bp for sequenced were successfully A total of292 analyses mtDNA Contemporary RESULTS Estou Ravigne, & (Cornuet, PPsupport the highest received unrightfully that sets data ofpseudo-observed number the calculated bycounting was rate typeIIerror the while 100), (i.e. datasets pseudo-observed of number bythe divided scenario, chosen the otherthan anyscenario for higher were the PPs times of number the counting by wasdetermined errorrate type I 1). The (e.g.scenario theof scenarios one from obtained values usingparameter sets, data pseudo-observed generating 100 by evaluated ST

Accepted groupings significantly differentiated revealed two measures Article CI ) haplotype and low nucleotide diversity levels were observed for both native (cytb: (cytb: bothnative for observed levelswere diversity nucleotide low and haplotype for cytb (DO - SAR and KO - VES) and and - VES) KO and - SAR (DO cytb for range, but similar haplotype and nucleotide diversity levels were observed (Table 2). Overall, Overall, 2). (Table were observed levels diversity nucleotide and haplotype but similar range, D and Fu’s and ; 87 ± 0.043; CR: 87 ±0.043;CR: Table S2). With regards to the cytb gene fragment, the CN DET population was not not was population CN DET the fragment, the cytbgene to regards With Table S2). M. dolomieu M. dolomieu p, 2010). 2010). F S

in both native and invasive range and both gene fragments (Table 2). Pairwise Pairwise 2). (Table genefragments both range and invasive and native in both specimens collected from eight river systems in the invasive SA range (CI) (CI) SA range the invasive in eight riversystems collected from specimens h h = 0.985 ± 0.003, π = 0.039 ± π=0.039 0.019) 0.003, ± = 0.985 (cytb: and invasive ± π=0.044 0.021) 0.007, ± = 0.977 F ST

= 0.013 to 0.013 F ST

= 0.125 (both (both 0.125 M. dolomieu M.dolomieu : CI populations, but differed between but differed populations, F and ST

CN = 0.013 to to 0.013 CN range when compared to whencompared range P (Table S2), with with S2), (Table < 0.05 specimens for cytb and cytb and for specimens F ) ST for CR (KR - NIA NIA (KR- CR for

= h 0.172 (both (both 0.172 = 0.967 ± = 0.967 h = 0.976 ± = 0.976 P

< This article isThis article by protected copyright. All rightsreserved. H heterozygosity, (observed diversity genetic Multi-locus S3). (Table = CN AR 2.17-2.69 = CIAR 1.79-3.15, 4.25, HN = AR datasets: contemporary two the between similar and HN dataset, dataset complete conduct were further analyses all Hence, al.,2015). et Guillemaud 2011; Goulson, & (Lye, Lepais, negligible albeit 2014), Waples, 1928; (Wahlund, effect Wahlund a of presence the suggesting populations, the three each within of deficit heterozygote a dueto deviation was (F population observed were fromHWE Deviations groups. the within Mdo9 microsatellite in null of alleles the presence revealed 2007) &Estoup, (Chapuis FreeNA linkage disequilibrium. exhibit any loci did nor stuttering), dropout, (i.e.allele errors large amplification HN) displayed (CI, CN, groups three ofthe Neither loci. eight microsatellite for genotyped successfully range, were native the historical within 11 localities representing museum samples, loci,while53 microsatellite nine genotyped for were successfully ninelocalities) ranges, 213; (n= native and localities) = 306;eight (n invasive both representing specimens, sampled contemporary A total of519 andhistoric Contemporary ( 0 from different significantly were components All variance %). CR: %; 2.26 (cytb:3.06 within groups amongpopulations wellas as %), %; CR: 1.58 (cytb: 2.15 groups the observed between variation little very with population, each distributed within was %) 95.79 %;CR: 94.79 (cytb: genetic variation of proportion the largest that results revealed AMOVA The S2). andCR (Table cytb in both observed also was cytb) USA forthe so less markedly (though differentiation grouping within Significant S2). (Table CI populations majorityof the from different significantly not SAR was ONEO and populations the CN theCR, for KO.Similarly, except populations, theCI any of from significantly different P

Accepted Article < 0.001). IS : BE = 0.26, OL = 0.17, MUS = 0.43; Table Table S3) = 0.43; MUS OL =0.17, 0.26, BE = . The number of alleles (Na) and allelic richness (AR) were consistently higher in the higher in consistently (AR) were allelic richness (Na) and alleles of number The al microsatellite analyses analyses microsatellite HN samples, but this was not the case for either of the contemporary ofthecontemporary foreither case notthe was this but samples, in two CI populations (BE and OL) as well as the HN well the as as OL) (BE and CI populations two . Further inspection revealed that this revealed that inspection Further ed on the the on O ) ranged ranged ) This article isThis article by protected copyright. All rightsreserved. sub-structuring population revealed inSTRUCTURE conducted clustering analyses The Bayesian wereobserved. groups two the between associations genetic Limited 3). (Figure the HNpopulations comprising second the and populations and CI CN both firstcomprising the twoaxes; first along the The (IAM: population CN: 0.230; ( model theIAM CNunder and bothCI for heterozygotes of excess asignificant revealed test Rank Wilcoxon ( thisgroup localities within sampled among differentiation population less significantly displayed CNpopulations contrast, ( HN CI,CNand alli.e. three groups, across (DO 0.469 ranging from CI populations, among differentiation population revealed significant CI ( Overall hoc P in H differences significant revealed ANOVA the Moreover, < 5000km (catchment size reservoirs (H heterozygosity observed in variation substantial There was all loci. across (MUS) to 0.73 (H expected heterozygosity of levels while (DET), 0.59 to 0.39 (ONEI) from

Accepted Articlewith H = <0.001), F test principal component analysis (PCA), based on allelic frequencies, revealed two distinct groups distinctgroups two revealed allelic frequencies, basedon (PCA), analysis component principal ST

= 0.211; = 0.211; P P F P ST = 0.002 and 0.002 = <0.001). A significant marker effect ( marker significant A <0.001). – among HN samples was significantly low ( low significantly was HN samples among P P KO and BE - MP), with similar results being observed when comparing populations populations when comparing observed being results similar with MP), - BE and KO = 0.473). Similarly, no significant excess of heterozygotes was detected for the HN detected for was heterozygotes of excess nosignificant Similarly, = 0.473). P P <0.05) and CN( and <0.05) P = O being higher for for being higher 0. P P 473 = 0.010, respectively), but this was not the case under the TPM model (CI: model TPM the under case notthe was this but respectively), = 0.010, ; F TPM: ST

= F 0.072 0.072 P ST

= 0.998). 0.998). = = 0.091; = 0.091; 2 HN ) consistently displaying lower levelsofH lower displaying consistently ) – 0.129; LOL LOL 0.129; compared to both contemporary groups (Bonferroni (Bonferroni groups bothcontemporary to compared F ST P P

= <0.05) populations. Likewise, pairwise Likewise, pairwise populations. <0.05) F 0.123 0.123 7,214 – = 19.82, = F NIA and SAR SAR and NIA ST – 0.537; MP MP 0.537;

= 0.013; = 0.013; O P the between O < 0.001) was, however, observed. observed. however, was, < 0.001) ) among populations and loci, with loci, and amongpopulations ) P P <0.05), but this was not so forthe so not this was but <0.05), – – SAR and OL OL and SAR

STL ; Table S4 Table th E ) ranged from 0.35 (MP) 0.35 ) from ranged ree groups ( groups ree O (Figure 2, S2). S2). 2, (Figure – ). MUS As predicted, the As predicted, F ST F ST

= ; values values F Table S4). In S4). Table 0.066 0.066 2,214 2,214 = 22.90, post post –

P P = This article isThis article by protected copyright. All rightsreserved. S5). (Table simulation third the for not but (Table S5), conducted simulations S5) (Table support Scenario inconclusive. was population, source unsampled an or source a single from multiple introductions single versus S5) (Table C andF I; Figure - A (Scenario analyses of second set The S5). (Table probability 1 (Scenarios tested scenarios set Thefirst of introduction. ofamorerecent notion the supported consistently The analysis ABC 1 SU; Table ONEO, VES, LOL, River: Susquehanna HUD, (DET, localities sampling overlapping despite theof populations, CN any for case notthe was butthis HN, cluster with a KO)shared and extent alesser DO to (and and OL BE localities the CI within individuals subsetof a Interestingly, observed. was groups contemporary clustersof number the most probable Krevealed Delta 4B). (Figure combined were all 28localities populations, HN most probable the Krevealing Delta with differentiation, population indicative shallow of admixture population of highlevels exhibited CNpopulations The 4A). (Figure OL BEand localities inparticular admixture, of levels displayed substantial however, populations, six CI remaining The S3). Table 2; (Figure results diversity the genetic corroborating variation, population very little andshowed cluster theirown by MP) represented (BU were and reservoirs CI Both 4A). (Figure clusters of number retrieving 2005) etal., K(Evanno withDelta CIlocalities, within the

Accepted Article ofthe CI population source probable most the To determine 4A). (Figure populations

to be to K = 4 (Figure 4A). Similar levels of admixture and Delta K( and levelsadmixture of Similar 4A). = 4(Figure K . = 3, with each cluster representing a group, though admixture between the two the between admixture group,though a representing cluster each with = 3, . The third set of simulations (Scenarios i (Scenarios simulations set third of The Type I and Type II error rates were marginally low for the first two sets of sets the first two for low marginally rateswere error and Type II I Type iii ; (unsampled source population) did, however, marginally receive the most the most receive marginally however, did, population) source (unsampled Figure 4 Figure – 6; Figure 5), revealed that Scenario 2 had the highest posterior posterior the highest 2had that Scenario 5), revealed Figure 6; B).

–

iii ; Figure S1), where we tested for a for wetested where S1), Figure ; K = 5 as the most probable most probable asthe = 5 S1 K = 4) were obtained the for obtained = 4) were ) supported both Scenarios Scenarios both ) supported This article isThis article by protected copyright. All rightsreserved. Bowen, (Grant & expansion experiencing before bottleneck a genetic undergone had that population well proposition bottleneck. recent genetic duetoa before,likely collected 60years samples to when compared population contemporary the inNafor decrease a significant observed authors ( salmon Atlantic for reported previously the for size sample the smaller to due artefact a statistical from resulted have might this Although (AR). allelic richness alleles (Na) and of number heterozygosity, ( native historical the groups, three all when comparing populations native long-established in than ranges invaded inrecently diversity is lower ( native contemporary the to compared invasive ( contemporary the in observed were diversity genetic of levels Elevated time and space through Genetic diversity po samples range invaded native and contemporary population native the historically that of to correspond would thenative range within structure population the contemporary that assumes and shifts frequency allele for notaccount does however, This, geneticspecimens. contemporary utilise only studies ofthese most 2014), yet Darling, Rius & 2008; &Parker, Dlugosh Darling, 2007; & Roman Mack, 2005; Novak & 2004; & Hipkin, Wainwright, Lee in (reviewed species invasive of history invasion the to reconstruct attempt rangesin an invasive native and across diversity levels genetic compared have Numerous studies DISCUSSION

Accepted Article scales. temporal and both spatial across differ can indeed dynamics pulation as significantly negative negative significantly . , Using Using as the CN population exhibited high haplotype, but low nucleotide genetic diversity, as genetic diversity, nucleotide low but haplotype, high exhibited the population as CN M. dolomieu M.dolomieu Tajima’s Tajima’s as a study organism and incorporating both historic both and incorporating organism study a D

CN and Fu’s Fu’s and Salmo salar Salmo ) range, contradicting the general assumption that genetic that general assumption the contradicting ) range, Fs , our results reveal that genetic diversity and and diversity genetic that resultsreveal our levels ; Nie HN lsen, Hansen, & Loeschcke, 1997) & Loeschcke, lsen, Hansen, , all of which are commonly observed in in observed commonly are which all of ) range displayed the highest levels of of levels the highest displayed range ) HN range, similar findings were were findings similar range, Our , results support this results support Patel CI al ) range when ) range and and , Conlan . However, However, . The The , a This article isThis article by protected copyright. All rightsreserved. n =1 (KO: Kouga and n=2), (DO: Doring n =7), (OL: Olifants n=14), the Berg(BE: from samples Accepted cluster encompassing A genetic USA 1937. the in from event introductory a single originate from African South that invasive stating records historical the to contradict review) comprehensive a for 2014 Darling, Rius & (see mixture population or and/ introductions tomultiple attributed areoften and invaded range novel a in species invasive in uncommon not however, diversity are, genetic of levels Elevated range invaded in an sub-structuring Population Lamaze 2010; Garant, & Bernatchez, (Marie, intensity stocking with increasing levels admixture with individual ( charr the brook species, freshwater exploited another beenreported for have structure population genetic for consideration without conducted populations, CN in admixture elevated observed the to contributed and genomic signatures left to have are likely sizes population in fluctuations Concomitant Article 2015). Long et al., etal.,2013; Loppnow 1905; (Bowers, theUSA across into waterbodies ~5 1903alone, In (Long etal.,2015). 1870s the fishing in on regulations stricter enforce and programmes breeding tostart government USA This ledthe 1867). (Marsh, localities in some extirpations even and declines population several experienced has dolomieu Micropterus al., 2015). et (Long centuries two the last during events re-stocking and overfishing between of dynamics population contemporary the observed Thus, 2014). Palumbi, & (Pinsky andAR Na by reducing in particular species, of geneticdiversity inthe signatures to leave known species, are exploited by commercially notion this support further andNa, AR well low as as range, inthe CN structure population of lack the Moreover, 1998). , Sauvage . Strong and sustained declines in population size, such as the ones experienced onesexperienced the suchas size, population in declines sustained and Strong has been harvested both commercially and recreationally since the 1800s and the1800s since recreationally and commercially both harvested been has , M. dolomieu Marie , Garant, & Bernatchez, 2012). 2012). Garant, & Bernatchez, in its native range might have resulted from the interaction interaction the from resulted have might range in itsnative . The results from the STRUCTURE analyses appear analyses STRUCTURE from the results The 00 , 000 juvenile black bass were released were released black bass juvenile in as M.dolomieu M. dolomieu M. dolomieu

re -introductions were were -introductions Silvanus fontinalis Silvanus . Similar findings findings Similar populations populations ) ), This article isThis article by protected copyright. All rightsreserved. the Within 2017). &Heath, Wellband 2007; &Molofsky, Lavergne 2006; (Dlugosch, potential Accepted (Gaither make better invaders to arethought populations diversesource genetically harbouring large, of capable species Invasive 2012). etal., Lamaze 2010; stockings of the introduced that possible Aprahamian (e.g. abundance and production species enhance to techniques selection useartificial make of thathatcheries Given Gray etal. etal.,2015; (Chown population source the in admixture and marker resolution geneticdrift,insufficient post-invasion population, source an unsampled including thisfor pattern, responsible may factors be asseveral caution with beinterpreted should this multiple introductions, of notion the resultssupport our Although the results. ofABC accuracy the decreased have may too populations, multiple of pooling the likely dueto range, the HN within effect Wahlund a temporal of the presence Furthermore, HWE. notin was theHNpopulation that thefact to be could ascribed it orperhaps models, the ABC of thesimplicity range, CI/CN HNand between sizes sample unequal Article asthe such tofactors, several due may be This 6).4, 5, (Scenarios admixture postulating scenario i (Scenarios source a single from multiple introductions versus single examining scenario USA originatedthe from also introduction recent themore that suggests CN CIand between admixture the observed Indeed, introduction. more recent one and least at introduction historic recorded the with coinciding one introductions: (CI population African South a separate cluster as HNSTRUCTURE the with associated African individuals 2) (Scenario America North from introduction more recent, second, suggested a scenario thebest-fit as notion, this support The results ABC introductions. ofmultiple idea atthe hinting clusters, to fouradditional belong African populations South invasive the of remainder butthe HNsamples, the with ancestry shared Rivers, suggests S. fontinalis S ), the ABC analyses supported the STRUCTURE results and suggested at least two two least at suggested and results STRUCTURE the supported ), ABCanalyses the (Sloss , M. dolomieu M. dolomieu Smith , , Bowen, & Toonen, 2013), as they are equipped with high equipped are asthey 2013), & Toonen, Bowen, Jennings , McGinnity , Franckowiak, & Pratt Franckowiak, . were of admixed or hybrid origin, as has been reported beenreported for has as origin, orhybrid admixed of were Unexpectedly, no support was obtained for either either for wasobtained nosupport Unexpectedly, . Furthermore, when considering the invasive South South the invasive considering when Furthermore, , McKelvey, & Taylor McKelvey, , 2008; Cooper 2008; , 2003; Lamaze et al., 2012), it is itis 2012), Lamazeetal., 2003; , Miller, &Kapuscinski Miller, , er ii , adaptive adaptive ), nor any ), nor 2014). 2014). , This article isThis article by protected copyright. All rightsreserved. particular freshwater species, aquatic Forexample, diversity. genetic Accepted andhence, genetic composition, populations’ oneach have may locality’ ‘sampling the effect that looked at study has no however, date, To 2010). Cornuet, &Estoup, Ciosi, Beaumont, (Guillemaud, source population identifythe markersto molecular ofthe the accuracy may hinder population, per sampled ofindividuals thenumber and sampled populations invasive nativeversus of the number such as problems sampling However, al., 2015). et Guillemaud Estoup, 2010; & Cornuet, Guillemaud, & Estoup 2009; &Richardson, Lowe, Prentis, Dormont, (Wilson, routes and histories invasion species reconstructing for particularly 2012), Blanchet, 2008; al., et (Muirhead biology toolsininvasion indispensable are techniques Molecular diversity genetic design on ofsampling The influence al., 2013). et (Berthouly-Salazar novel environment mixing population to increase known are events dispersal (human-mediated) long-distance Such a mechanism. Article as excluded cannot be stocking via intentional dispersal long-distance human-mediated, species and angling ‘hotspots’, fromknown away conducted was sampling Bagley 1998; &Bulow, Pipas 1997; dolomieu al. et (Diedericks introduction post hybridisation from among admixture observed 2016 ( introduced whichit was into the systems throughout this,despite (Rutherford regimes temperature and rainfall fluctuating range, African South invasive ). Although the initial introduced individuals may have been of admixed stock, the substantial thesubstantial ofadmixed stock, havebeen may individuals introduced initial the ). Although introductions elsewhere (Whitmore & Butler, 1982; Whitmore & Hellier, 1988; Avise et al., al., Aviseet 1988; Hellier, & Whitmore 1982; Butler, & (Whitmore elsewhere introductions M. dolomieu M.dolomieu , ultimately increasing the species’ genetic diversity and hence, adaptability to the adaptability hence, and genetic diversity the species’ increasing ultimately , has M. dolomieu M. dolomieu

M. dolomieu M. dolomieu not only survived, but also established viable populations and spread spread and populations established viable also but survived, not only , Mayden populations experiences an array of climatic conditions with with conditions ofclimatic anarray experiences , Roe , Holznagel, & Harris & Holznagel,

in the invaded range may also have resulted have also may range invaded in the , Van in review) as has been observed for for observed hasbeen as in review) , 2010 Mucina, & Powrie Mucina, Der Walt M. dolomieu ; Guillemaud, Beaumont, Ciosi, Ciosi, Beaumont, Guillemaud, , ly Weyl, Woodford, & Radloff, & Radloff, Weyl, Woodford, , fish, are often collected from collected from often are fish, 2011). Further, although although 2011). Further, are popular angling popularangling are , 2006 ). However, ). However, M. M. This article isThis article by protected copyright. All rightsreserved. study Asour invader. successful highly already this of the fitness may increase novel environments, Accepted to localadaptation andultimately persistence establishment, population toassist thought diversity, genetic increase might further that ofstrategies theas facilitation prudent strategy This isa 2017). Weyl, & Zengeya Kimberg, Ivey,Jordaan, (see Woodford, stocking restricting by catchments uninvaded previously into prevent spread is to strategy management andthe current invasion, of eradication South Africa, In genetic of variation. analysis guided byarange-wide be should that stocking (2015) and Orth by Brewer recommendations management the datasupport range,our the native in to management for history demographic complex reveala Ourresults etal.,2009). (Prentis question in species forthe strategy management a on decide to wanting when iscrucial species aninvasive of history introduction the Understanding implications Management species. Article a of history orinvasion demographic the when assessing considerations are important isolation, of degree the particular in and locality ofsampling choice Thus, et al., 2017). (Hargrove species co-occurring between orhybridisation events introduction multiple suggesting diverse, km ofa580 attheend located Weir, Kowie from sampled population that a but a singleallele, by dominated frequencies hadallele lenticpopulations all that results revealed populations salmoides Micropterus bass, the largemouth historyof the invasion reconstructing a recent study Similarly, range). invasive the MP in BUand results (localities by our suggested as to rivers, compared when genetic variability of levelslower much oftendisplay however, sites, specific sampling These present. individuals numberof and thelarge collection of the ease to due reservoirs man-made or lakes natural in lentic environments with limited connectivity (Hargrove connectivity withlimited environments lentic , identified extremely low levels of neutral genetic diversity within invasive invasive diversity within genetic neutral of levels low extremely identified M. dolomieu M. M. dolomieu M. dolomieu , both within its native USA and invasive SA range. With regard regard range. With SA invasive USAand native its within , both is no longer a feasible option due to the magnitude of theof themagnitude to optiondue afeasible is nolonger , Weyl, & Austin, & Austin, Weyl, 2 catchment, was more was catchment, Micropterus 2017) . Their Their

This article isThis article by protected copyright. All rightsreserved. Accepted historic native incorporate should species invasive of history demographic the infer to attempting studies future that we recommend this, Despite discrepancies. genotyping to itsusceptible renders 2007), but also 2003; etal., (Sefc theof specimens amplification successful the hampers not only theof DNA nature the as degraded specimens historical with when working Our range. theCI diversity of genetic the shaping role in played a may have factors thatvarious suggest times, ourresults multiple introduced been structur limited population and admixture of highlevels range CN displayed CIand Both scales. spatio-temporal change over dolomieu Article bass, smallmouth the Using 2009). Cameron, Lozier& 2002; data(Hansen, contemporary only monitor historic incorporating 2009), &Cameron, (Lozier valuable ranges are invasive and native among geneticvariation contemporary comparing whilestudies In conclusion, et al., 2016). derWalt (van biota onnative impacts considerable thealready andexacerbate spread further could facilitate and invaders, successful alreadyhighly these of genetic fitness the inincreasing may invaded aid been already have systemsthat eveninriver introductions addition, In species. invasive ofthisalready introductions avoiding new to with regard current itslegislation enforces strictly Africa thatSouth imperative undocumented of possibility the demonstrates study highlights the importance of including historical DNA, however caution should be taken be taken should caution however DNA, historical including of theimportance highlights study ing , as study organism, o study organism, as , temporal changes in genetic diversity that are often overlooked in comparisons using comparisons in overlooked areoften that diversity in genetic changes temporal ing . A ur lt results corroborate the idea that genetic variation can indeed indeed can variation genetic that the idea corroborate results hough this pattern is not uncommon for invasive species that have that species invasive for not uncommon is thispattern hough M. dolomieu introductions into the country, it it is the country, into introductions al DNA is essential for for is essential DNA al samples. samples. M. This article isThis article by protected copyright. All rightsreserved. Accepted https://doi.org/10.5061/dryad.5jf41k5 Repository: Digital fromtheDryad available Data STATEMENT DATA ARCHIVING Biology. forInvasion Excellence of Centre DST-NRF andthe 109244), CH: 89967, 109015; 110507, OLFW: (Grant numbers, Africa South (NRF) of Foundation Research and National (DST) and Technology Science of theDepartment by partly supported research on based This work is Platforms. Collections and Research the NRF-SAIAB by provided equipment and infrastructure specimens, use of We acknowledge site. heritage aworld River Canyon, the Blyde trips to the sampling coordinating and permits, anglers, sampling in obtaining forassistance Board) Parks (Mpumalanga Roux Francois ( Fraser Craig and Aproskie SA Conservation); Environmental Article of State Department (New York Loukmas and Jeff University), Cornell Resources, Natural of (Department Jackson Randy Resources), Natural of Department (Ohio Carter Rich director), conservation (B.A.S.S Gilliland Gene District), Aurora Forestry, and Resources ofNatural Ministry (Ontario Wegman Wil OceansCanada), and Barnucz (Fisheries Jason Museum), University State (Ohio Kibbey Mark Sciences), ofNatural (Academy Pérez MarkSabaj History), Natural Museum of (National Williams Jeff Zoology), Museum of Michigan (University of Nelson Douglas Museum), Ontario (Royal Erling Holm - USA contributions: sample their for institutions and people following the thank liketo We would ofthemanuscript. versions onearlier suggestions and comments valuable for reviewers two anonymous and Bernatchez Louis thank to would like The authors ACKNOWLEDGEMENTS

South African Bass South African – Chris Broeckhoven, Riaan, Beverley & Adriaan Diedericks, Jacques Jacques Diedericks, & Adriaan Riaan, Beverley Broeckhoven, Chris Angling Association) Angling . A special word of thanks to to thanks wordof A special This article isThis article by protected copyright. All rightsreserved. expansion. range geographic … Berthouly and Evolution ( charr brook DNAof in mitochondrial site variation R. &Danzmann, L., Bernatchez, distribution. ofits edge northern darted ( thegreenside of invasion of genetic characterization Beneteau, lake system. bass smallmouth historiesamong life Divergent Barthel, B. NewYork. York, New Press, Academic colonizing species. of genetics The (1965). (eds.) L. G. & Stebbins, G., H. Baker, (Centrarchidae: phyl J.Bagley, Heredity introduction. after an ofbass speciesturnover and swamping introgressive Cytonuclear J.Avise, salmonids M. Aprahamian, REFERENCES

Accepted J. Roux, Le Article ogeographical sampling reveals polyphyly and novel biodiversity within black basses blackbasses within biodiversity novel and polyphyly reveals sampling ogeographical

C., Pierce, Pierce, P. C., ,

88 C., Mayden, R. Mayden, C., -

Salazar, C., Hui, C., Blackburn, T. Blackburn, C., C.,Hui, Salazar, - C. L., Cooke, S. Cooke, L.,

opportunities and limitations. opportunities , 14 ,

L., Walter, R. P., Mandrak, N. E., & Heath, D. D. (2012). Range expansion by invasion: by invasion: expansion Range (2012). D. D. Heath, E., & N. P., Mandrak, R. L., Walter,

Journal of Fish Biology Fish of Journal J. (2013) ,

10 - Micropterus

20. W., Smith, K. W., Smith, , 1002

C., Van Den Avyle, M. Avyle, Den Van C., .

Long

- J., Svec, J., Svec, J.

1002. 1002. L., Roe,K. L., - ). distance dispersal maximizes evolutiona maximizes dispersal distance Molecular Ecology Molecular

M., McGinnity, P., McKelvey, S., & Taylor, J. (2003). Restocking of of Restocking J.(2003). Taylor, S.,& McKelvey, P., McGinnity, M., Biological Journal of the Linnean Society the Linnean of Journal Biological

G. (1993). Congruence incontrol (1993). Congruence G.

Biological Invasions, Invasions, Biological H., Suski, C. Suski, H.,

J., Holznagel, W., & Harris, P. & Harris, W., Holznagel, J., ,

73 , 829 ,

Fisheries Research Fisheries

M., Gaboriaud, C., van Rensburg, B. Rensburg, van C., Gaboriaud, M., J., Smith, M. J., Smith, - 852.

D., Bunt, C. Bunt, D., , Micropterus dolomieu Micropterus 22

Salvelinus fontinalis fontinalis Salvelinus , 5793 , 14

H., , 191-

- M., Phelan, F. M., Phelan, 5804. Nelson, W. Nelson, , Etheostoma blennioides Etheostoma

62 201.

, 211 M. (2011). Congeneric Congeneric M.(2011). - region sequence and restriction and sequence region

ry potential during rapid during rapid ry potential - 227.

inhabiting a connected river connected a inhabiting

S., & Asmussen, M. &Asmussen, S.,

104 Mitchill). J.

S.,

, 346 …

Philipp, D. J., van Vuuren, B. vanVuuren, J., -

363. Molecular Biology Biology Molecular ) at ) the at

Journal of Journal

P. (2008). (2008). P.

A. (1997). (1997). A.

J., J., - -

This article isThis article by protected copyright. All rightsreserved. 11 using Cornuet, populations. ( trout coaster brook remnant of captive breeding under genetic diversity A. Cooper, success. ( sunfish J. Colbourne, genomics. and climatechange invasions, Biological S. Chown, differentiation. population of estimation alleles and null Microsatellite (2007). A. &Estoup, P., M. Chapuis, in non oferror sources J. Buchan, Symposium Society Fisheries S. Brewer, D.C. Washington, Office, Printing Government Fisheries. ofFishand Commission U.S. 30,1903, June the ending year for ofthecommissioner Report M. (1905). G. Bowers, genetic diversity. J. Bouzat, ecosystems. freshwater on emphasis an biology: ininvasion tools ofmolecular use The S.(2012). Blanchet,

Accepted, Article 401

DNA .

Lepomis macrochirus Lepomis Canadian Journal of Fisheries and Aquatic Sciences Aquatic and ofFisheries Journal Canadian

L. L.

L., Hodgins, K. Hodgins, L.,

C., Archie, E. C.,

K. sequence M., Miller, L. M., M.

(2000). The importance of control populations for the identification and management of of and management theidentification for populations control of importance The (2000).

, Fisheries Management and Ecology and Management Fisheries

Conservation Genetics Conservation

K., Neff, B. & ,

Ravigne,

Molecular Biology and Evolution, andEvolution, Biology Molecular Orth, D. Orth,

Genetica

and -

invasive genotyping. invasive

A., Van Horn,R. Van A.,

V., M.

J. D., Wright,J. D.,

A., Griffin, P. Griffin, A., microsatellite , (

, & Kapuscinski, A. , &Kapuscinski,

2015 & 110 ,

82 ) using (GT) n microsatellites and its potential for assessment of mating of assessment for potential its and microsatellites (GT) n ) using Estoup, , , 9

) 109 . Smallmouth bass bass Smallmouth . - 26. ,

- 11 115.

A M., & M., C., Oakeshott, J. Oakeshott, C.,

, 1087 ,

. ( .

data C., Moss, C. Moss, C., 2010)

Gross, M. Gross, Molecular Ecology Resources Ecology Molecular with -

R. (2010). Conservation of population structure and structure population of Conservation R. (2010). 1093. . Inference ,

24 19 the

Evolutionary Applications Evolutionary

, 621- , Micropterus dolomieu Micropterus , 120 J., & Alberts, S. &Alberts, J.,

software

R. (1996). DNA fingerprinting of bluegill bluegill of fingerprinting DNA R. (1996).

G., Byrne, M., & Hoffmann, A. &Hoffmann, M., Byrne, G., - 631.

132. on ,

population

, 342 DIYABC

C. (2005). Locus effects and effects and (2005). Locus C. - 349.

(v1.0)

history

Salvelinus Salvelinus fontinalis ,

lacepede, 1802. lacepede, 5 , 680 , .

8 BMC , 23 ,

and - 683.

- Bioinformatics, 46.

model

A. (2015). (2015). A.

American American

checking )

This article isThis article by protected copyright. All rightsreserved. a parakeet suggests the monk rangeof invasive the global across diversity genetic Shared L. (2015). Accepted E. S.,Hobson, Roques, Edelaar, P., 361. method. Evanno the implementing and output STRUCTURE Earl, D. collections. andhistorical contemporary from invasions reconstructing space: and time in Genetic bottlenecks E. Dormontt, Ecology toinvasion. itscontributions and populations introduced in variation details: genetic K. Dlugosch, introductions. roleofmultiple the and adaptive evolution, variation, genetic invasions: inspecies events Founding M. (2008). Parker,I. M., & K. Dlugosch, endemic ofanisland invasions Article K. Dlugosch, the EM algorithm. Dempster, A. Africa. South Research, Pretoria, Industrial Scientificand for andCouncil Development Research for 144.Foundation Report Programmes Scientific African National South Africa. southern in animals aquatic indigenous translocated alien of and Atlas (1988). N. M. &Bruton, J., I. De Moor, data. microsatellite and sequence DNA polymorphism, single nucleotide using history population about inferences computation Bayesian make approximate to asoftware 0: v2. DIYABC J. Cornuet,

Bioinformatics

A., & vonHoldt, B. &vonHoldt, A., ,

M., Pudlo, P., Veyssier, J., Dehne P.,Veyssier, Pudlo, M.,

, 2095 , PloS One PloS

M., Anderson, S. M., Anderson, M.(2006).

E., Gardner, M. E., Gardner, P., Laird, N. P., Laird, -

2111. Journal of the Royal Statistical Society. Series B (methodological) Series B Statistical Society. Royal of the Journal , ,

9 ,

Adaptation and colonization in in colonization and Adaptation

, 1187

106874.

M., & Rubin, D. Rubin, M., & M. (2012). STRUCTURE HARVESTER: a website and program for visualizing visualizing for program and website a HARVESTER: STRUCTURE M.(2012).

G., Breed, M. Breed, G.,

R., Braasch, J., Cang, F. J., Cang, R., Braasch, - . PhD Thesis, University of California, SantaCruz. ofCalifornia, University PhDThesis, . 1189.

A., Gonçalves d Gonçalves A.,

B. (1977). Maximum likelihood from incomplete data via via data incomplete from likelihood Maximum (1977). B.

F., Rodger, J. Rodger, F., - Garcia, A., Gautier, M., Leblois, Leblois, M., Gautier, Garcia, A., a Silva, A.,Avery,M. a Silva,

A., & Gillette, H. Gillette, A., & Hypericum canariense Hypericum

G., Prentis, P. G., Prentis, Molecular Ecology, Ecology, Molecular Conservation Genetics Resources, Conservation

D. (2015). The devil is in the in The devilis (2015). D. J., & Lowe, A. &Lowe, J.,

L., Russello, M. Russello, L., R., … Estoup, A. (2014). (2014). A. … Estoup, R., : past and present present and : past 17

, 431- , 1

J. (2014). J. (2014).

Molecular Molecular -

38. A., … Tella, J. … Tella, A., 449.

4 , 359

- This article isThis article by protected copyright. All rightsreserved. Accepted loci. microsatellite Garza, J. Sciences, species. marine introduced of spread predicts the M. Gaither, Invasions, bullfrogs, introduced of genetics Population (2011). H. R. &Hill, A., G. Cortina, S., Garcia, T. C., Funk, W. selection. background Fu, Y. biological invasion. a in founders of number originand reveals genetics (2008). Population Miaud, C. A.,& Bonin, F., G. Ficetola, Windows. Linux under and analyses genetics population ArticleExcoffier, L. a STRUCTURE: the software using individuals of ofclusters number the (2005). Detecting J. Goudet, S., & Regnaut, G., Evanno, what? and so Estoup, A. 1890 Africa. southern in fishes non‐native on based enhancements fisheries B. Ellender, Ecology convergent of thepossibility origin and geographic restricted common -

1906. X. (1997). Statistical tests of neutrality of mutations against population growth, hi growth, againstpopulation ofmutations ofneutrality tests (1997). Statistical X. ,

24 C., & C.,

280

Rana Rana , 13

& Guillemaud, & , 2164 ,

, R., Woodford, D. Woodford, R., R., Bowen, B. Bowen, R.,

& Lischer, H. & Lischer, , 651- , 20130409.

Molecular Ecology Molecular Williamson, E. Williamson, ( Lithobates - 2176.

658. Molecular Ecology Molecular

Genetics

W., & Toonen, R. W., &Toonen, E. (2010). Arlequin suite ver 3.5: a new series of programs to perform to perform ofprograms series 3.5:anew suitever Arlequin E. (2010). T. (2010). Reconstructing routes of invasion using genetic data: why, how how why, data: usinggenetic ofinvasion routes Reconstructing T. (2010). ) catesbeianus simulation study. simulation

G. (2001). Detection of reduction in population size using data from from data using size population in reduction of Detection G. (2001). J., Weyl, O. J., Weyl, ,

, 147

Molecular Ecology, Ecology, Molecular 19 , 4113 , 915 ,

L. , 305 - , in the Willamette Valley, Oregon, USA. USA. Oregon, Valley, theWillamette , in 925. -

4130. F. J. (2013). Population structure in the native range range native in the structure Population (2013). J. ,

- Molecular Ecology Molecular &

318.

Cowx, I. Cowx,

Proceedings of the Royal Society B: Biological Biological SocietyB: the Royal of Proceedings

17 , 773-

Molecular Ecology Resources Ecology Molecular G. ( 2014 782. ,

)

14 . Managing conflicts arising from from conflicts arising . Managing , 2611

Journal of Fish Biology of Fish Journal selection. - 2620.

Molecular Molecular Biological Biological ,

10 tchhiking and tchhiking and , 564 ,

- 85 567. 567. ,

This article isThis article by protected copyright. All rightsreserved. Accepted samples. and contemporary ( trout brown M. Hansen, Sciences Biological B: ofLondon Society Lakes. Great in Upper the trout populations lake remnant extinct and K. Scribner, B., Guinand, Chile. Central from introduction borer, tomato E., M., Tabone, Reyes, N., Desneux, Goff, I., Le T., Blin,A., Guillemaud, data. microsatellite on computation Bayesian using approximate species ofinvasive routes M. T., Beaumont, Guillemaud, Gough. Article of Island the isolated miceon house of invasion arecent of history Demographic (2014). B. A. & Payseur, ... Searle, J.B., I., Gabriel,S. A., R.White,M. Haasl, J., D., Wegmann, M., Gray, M. Heredity conservation. for and lessons anchovies and from sardines insights marine fishes: Grant, W. Heredity, calculate F-statistics. to program a computer 1.2): (Version (1995). FSTAT J. Goudet, sites. introduction admixture at the mussel of populations innative than introduced in diversity genetic Higher (2009). A. E. &Hoffman, C., F. Fernandes, J., L. Walters, K., Gillis, N.

Heredity

Molecular ,

89 86

M. (2002). Estimating the long‐term effects of stocking domesticated trout into wild into trout domesticated stocking effects of long‐term the Estimating M.(2002). , 415 , 485- ,

S., & Bowen, B. S., &Bowen, Salmo trutta , Tuta absoluta

104 - 486. 426. E , 88 cology

- 99

T., &Page,K. T., . ) populations: An approach using microsatellite DNA analysis of historical historical of analysis microsatellite DNA using An approach populations: ) ,

, invading the Mediterranean Basin, originates from a single from originates Basin, Mediterranean the , invading Molecular Ecology Molecular W. (1998). Shallow population histories in deep evolutionary lineages of of lineages evolutionary indeep histories population Shallow (1998). W. , 1923

A., Ciosi, M., Cornuet, J. M., Cornuet, A., Ciosi,

Diversity and Diversity Scientific Scientific - 1939.

S. (2003). Genetic variation over space and time: analyses of of time: analyses overspace and Genetic variation (2003). S. ,

270 R

eports , 425

Distributions ,

11 - , 433.

, 1003 , 5 , 8371 , Mytella charruana Mytella

M. - 1015. , -

, & 837 15

Estoup, A. Estoup, , 784- 6

795.

Proceedings of the Royal theRoyal of Proceedings … & : evidence of population ofpopulation : evidence (

2010

Lombaert, E. E. Lombaert, ) . Inferring introduction introduction Inferring .

Journal of of Journal Journal of Journal ( 2015 ) . The . The This article isThis article by protected copyright. All rightsreserved. grass. invasive ofan success S. Lavergne, ( charr brook instocked coding genes of genomics population bySNP assessed hybridization F. Lamaze, Paris. B. Lacepèdé, lizard. Cuban bya invasion increases during biological variation (2004). Genetic J. B. A.,&Losos, Larson, C., A. Lara, R., L. E., Schettino, R. Glor, J., Kolbe, J. 3653. waters. andbrackish offresh invasions multiple diversity following Kelly, D. allelic richness. S. Kalinowski, data. T. Jombart, 23 structure. ofpopulation analysis in multimodality and switching label with dealing for program permutation and matching cluster a CLUMPP: (2007). A. N. Rosenberg, M.,& Jakobsson, D. Richardson, Hui, C.,& Africa. inSouth predator fish invasive J. Hargrove, Salvelinus fontinalis Salvelinus

Accepted Article, 1801-

Bioinformatics

W 1806.

., Muirhead, J. Muirhead, ., C., C., ,

, S., Weyl,O. S., &

& Molof G.

T. (2005). hp‐rare 1.0: a computer program for performing rarefaction on measures of of measures on rarefaction performing for program computer 1.0: a hp‐rare (2005). T. Sauvage, C., Marie, A., Garant, D. Marie, A.,Garant, C., Sauvage, Ahmed, I. I. Ahmed,

E. (1802). Histoire naturelle des poissons. [Natural history of fish.] Chez Plasson, Plasson, Chez fish.] historyof [Natural poissons. des naturelle Histoire (1802). E. Molecular Ecology Notes Ecology Molecular , ).

27 sky, J. (2007). Increased genetic variation and evolutionary potential drive the drive potential evolutionary and variation genetic Increased (2007). sky, J.

Molecular Ecology Molecular ,

J. & Austin, L.,

( M.(2017). 3070

2011 R., Heath, D. R., Heath,

Proceedings of the National Academy of Sciences of Academy National ofthe Proceedings - ) 3071. . adegenet . adegenet

Invasion dynamics Invasion

Biological Invasions, Invasions, Biological

D., & Macisaac, H. &Macisaac, D., D. (2017). Reconstructing the introduction history of an an historyof introduction the Reconstructing (2017). D. , ,

5 21 1.3 , 187 , 2877 - 1: new tools for the analysis of genome of theanalysis for tools 1: new , -

& Bernatchez, L. (2012). Dynamics of introgressive introgressive of Dynamics L.(2012). & Bernatchez, 189. - 2895.

Nature . Oxford University Press University . Oxford

J. (2006). Contrasting patterns in genetic in patterns Contrasting J. (2006). 19 , , 2261 431 , 177- ,

Molecular Ecology Molecular - 2276. 180.

104 .

, 3883 Bioinformatics, Bioinformatics, , -

wide SNP wide 15 - , 3641 3888.

- This article isThis article by protected copyright. All rightsreserved. (1963). Mayr, E. York. New Scribner &Company, Charles action. byhuman modified as physicalgeography or, nature; Manand (1867). P. G. Marsh, ( charr brook intensity in Marie, A. 9 Centrarchidae), characterization Malloy, Zealand. to New ofbumblebees the genetic data: introduction Lye, G. and co J.Lozier, dolomieu ( bass smallmouth Invasive (2013). P. A. K., &Venturelli, L., Vascotto, G. Loppnow, States. the United in management C. W., &Suski, M., J.,Allen, Porak, Long, Fossat). ( mustard hoary of alien populations native and diversities in Lee, P. 391. species. invasive of genetics Evolutionary E. (2002). Lee, C. ,

llections highlight contrasting demographic histories for the bumble bees bumble the for histories demographic contrasting highlight llections Accepted191 Article B. impatiens

195 L., Patel, R. Patel, L., C., Lepais, O. Lepais, C.,

T. International Jour International

D., & Cameron, S. & Cameron, D.,

): history, impacts, and control. andcontrol. impacts, ): history, D., Bernatchez, L. Bernatchez, D.,

P., .

Van

and

Animal species and evolution species and Animal

of in Illinois.

Den

M., Conlan, R. Conlan, M.,

microsatellite

, cross

Bussche,

Goulson, D. Goulson, Salvelinus fontinalis Salvelinus - nal of PlantSciences nal of specific

, A. (2009). Comparative genetic analyses of historical and contemporary contemporary and historical of genetic analyses Comparative (2009). A. Molecular Ecology Molecular

Garant, D. Garant, D.

Jr.

S., Wainwright, S. S., Wainwright, loci

amplification R. American Fisheries SocietySymposium Fisheries American ( 2011

A. in ,

smallmouth Coughlin, D. (2015). A historical perspective of black bass black bass of perspective A historical (2015). D. Management ( ) 2010 . Reconstructing demographic events from population frompopulation events demographic . Reconstructing ). . ,

Molecular Ecology Molecular , Cambridge, Mass: Belknap Press, Harvard. Harvard. Press, Belknap Mass: Cambridge, 18

)

165 . Loss of genetic integrity correlates with stocking stocking with integrity correlates genetic of . Loss in , 1875

W. spotted

, 833 , J., &Hipkin,C. J.,

bass,

D.,

of Biological of - - 1886.

843. &

Micropterus bass, Trends in Ecology and Evolution, Evolution, and Ecology in Trends Echelle, Hirschfeldia incana Hirschfeldia

Molecular Ecology Molecular

M. ,

19 R. (2004). Comparison of genetic ofgenetic Comparison R. (2004).

A. punctulatus Invasions, 4 Invasions, , 2025

dolomieu

( , 2000) 82 - 2037. Bombus pensylvanicus Bombus , 99 . .

, 191-

[L.] Lagreze [L.] Isolation Molecular - (Teleostei:

, 122.

Micropterus Micropterus 20 , 2888 206.

and

- Ecology,

- 17 2900.

, 386-

This article isThis article by protected copyright. All rightsreserved. Accepted Massachusetts. Biogeography. In: dynamics. introduction systems and mating of influences in plant species: alien bottlenecks Genetic (2005). N. R. Mack,J., & S. Novak, years. salmon ofAtlantic samples E. Nielsen, morphology. ( gobies monkey ofEurasian recentcolonization and speciation Historic (2011). A. C. &Stepien, E., M. Neilson, Sciences Aquatic and Fisheries of Journal Canadian Neff, B. basses, black American Near, T. Article236. spiny black in variability introduced ND4 investigating event: introduction single an apparent species after Naccarato, A. 1035. diver vs.genetic intensity sampling species invasions: the of source J. Muirhead, can and EST gSSR New V.(2017). Corre, … Le B., Chauvel, G., R., Bailly, F.,Scalone, R., Pernin, Causse, Meyer, L., be transferred to other invasive invasive other to transferred be

tailed tailed Molecular Ecology Molecular

- D., Fu, P., & Gross, M. Gross, P.,& Fu, D., J., Kassler, T. J., Kassler, SSR markers reveal high genetic diversity in the invasive plant plant the ininvasive diversity highgenetic markers reveal SSR

E., Hansen, M. Hansen, E., iguanas ( iguanas

R., Gray, D. R., Gray, Diversity and Distributions, Diversity and

M., Dejarnette, J. Dejarnette, M., Eds D. F. Sax, J. J. Stachowicz & S. D. Gaines. Sinauer Associates, Sunderland, Sunderland, Associates, Sinauer Gaines. D. &S. J. Stachowicz J. Sax, F. D. Eds Neogobius fluviatilis fluviatilis Neogobius

Ctenosaura similis Ctenosaura W., Koppelman, J. Koppelman, W., Micropterus

K., Kelly, D. K., ,

M., & Loeschcke, V. (1997). An (1997). V. Loeschcke, M., & 6 , 487 Salmo salar Salmo

R. (1999). Microsatellite evolution in sunfish (Centrarchidae). insunfish evolution Microsatellite R. (1999).

B., & Allman, P. (2015). Successful establishment of a non a of establishment Successful (2015). P. Allman, & B., - 492.

(Actinopterygii: Centr (Actinopterygii: W., Ellis, S. W., Ambrosia and and

: a comparison of genetic composition over 60 over composition ofgenetic a comparison : ) in southwestern Florida. ) southwestern in

Species B., Dillman,C. B.,

17 N. pallasi N. , 1-

15. species.

Invasions: Insights into Ecology, Evolution, and Evolution, Ecology, into Insights Invasions: M., Heath, D. M., Heath,

, ) revealed by DNA sequences, microsatellites, and microsatellites, sequences, DNA by ) revealed

, 1198

B., & Philipp, D. &Philipp, B., PloS PloS alysis of microsatellite DNA from old scale oldscale DNAfrom microsatellite of alysis archidae). O -

1205. ne D., & Macisaac, H. Macisaac, & D., ,

12 Journal of Herpetology of Journal

sity. , p.e0176197.

Evolution

P. (2003). Speciation in North inNorth Speciation (2003). P. Ambrosia artemisiifolia Ambrosia

Molecular Ecology Molecular ,

J. (2008). Identifying Identifying J. (2008).

, 1610 - , 1621.

- 49 , native native

, 230 , , 1020

L. and L. - - This article isThis article by protected copyright. All rightsreserved. Accepted populations? colonising Darling, J. M.,Rius, & Rice, W. 945 Donnelly, in evolution P. Prentis, 503. data. frequency allele using size population the effective in reductions G. S., Piry, Luikart, streams. Tennessee J. Pipas, Articlepopulations. M.Pinsky, analyses. epigenetic material forgenetic and L. Pikor, Inc. 205 eds.,pp. Mable, B.K. C.Moritz,and Hillis, ed., D.M. 2nd Systematics, Molecular In Reaction. Chain Polymerase II: The Acids Nucleic (1996). R. Palumbi, S. Analytical Chemistry, tissues. fixed formalin preserved long-term extraction forDNA from ofprotocols Comparison B., E., Patzak, W.,Schmid, J.,Werther, B.,Bailer, S.,Werner, Paireder, -

959

. C. A., Enfield, K. Enfield, A., R. (1989). Analyzing tables of statistical ofstatistical tables Analyzing R. (1989).

, J., Wilson, J. Wilson, J., L.

& Bulow, F. Bulow, &

, invasive species. invasive

( Molecular Molecular 2000) &

Palumbi, S. Palumbi, ,

. &

Inference Transactions of the American Fisheries Society Fisheries theAmerican of Transactions

Cornuet, J. Cornuet, 439

A. (2014). How important is intraspecific genetic admixture to the success of the success to admixture genetic intraspecific is important How (2014). A. S., Cameron, H., & Lam,W. H., Cameron, S.,

R., Dormontt, E. R., Dormontt, J. (1998). Hybridization between redeye bass and smallmouth bass in in bass andsmallmouth bass between redeye Hybridization J. (1998). Ecology Trends in Ecology inEcology Trends , 152- ,

Trends inPlantScience Trends

( of 2014 160. ,

23 M. population , 29

) ( . Meta‐analysis reveals lower genetic diversity in overfished in overfished genetic diversity lower reveals . Meta‐analysis 1999 -

39. E., Richardson, D. E., Richardson, ) and . BOTTLENECK: a . BOTTLENECK:

structure

Journal of Visualized Experiments ofVisualized Journal

Evolution tests.

L. (2011). DNA extrac DNA (2011). L. ,

using Evolution – , , 288 247. Sunderland, MA: Sinauer Associates, MA: Associates, Sinauer Sunderland, 247.

M., & Lowe, A. Lowe, M., &

, 233 computer program for detecting recent detecting recent for program computer multilocus - 294. ,

- 43 242. Pritchard, ,

, 223 127

…

Journal of of Journal genotype tion from paraffin embedded embedded paraffin tion from , 141 - Cichna-Markl, M. (2013). (2013). M. Cichna-Markl,

225. J. (2008). Adaptive Adaptive J. (2008).

- J. 146.

K. , , 49

data H

Stephens, eredity ,

e2763 . Genetics ,

- 90 e2763.

M., , 502 ,

& 155

- , This article isThis article by protected copyright. All rightsreserved. Accepted inNorth America. goby round the for Eurasian stasis versus M. Snyder, efforts. rehabilitat and ofstocking monitoring genetic potentialfor streams: south shore Lake Superior B. Sloss, Genetics historical of estimates on theireffect and specimens museum Sefc, K. Auk feather samples: Sefc, K. Institute NationalBiodiversity South African The vegetatio ArticleM. Rutherford, Linux. and Windows Rousset 4 EcologyNotes, Molecular structure. ofpopulation display thegraphical for program a DISTRUCT: (2004). A. N. Rosenberg, invasions. J.Darling, & Roman, J., Australia. Western in populations ( ofstarling management toassist microsatellites using theirtracks: can't cover Rollins, L. ,

120

M., Payne, R. M., Payne, R. M., Payne, Transactions of the American Fisheries Society Fisheries theAmerican of Transactions , F. (2008). genepop’007: a complete re‐implementation of the genepop software for for software genepop the of re‐implementation acomplete genepop’007: (2008). , F.

, L., Jennings, M. L., Jennings, , 982

A., Woolnough, A. Woolnough, A., Trends in Ecology Ecology Trends in

, 879 R., & Stepien, C. &Stepien, R., - n of South Africa, Lesotho and Swaziland and Africa,Lesotho n ofSouth 989.

C., Mucina, L., & Powrie, L. L.,& Powrie, Mucina, C., - 884. effects of fragment size and template concentration on genotyping errors. genotyping on concentration template and fragment size of effects

Molecular Ecology Resources Ecology Molecular

B., & Sorenson, M. Sorenson, & B., M. Sorenson, & B.,

A. (2007). (2007). A.

J., Franckowiak, R., & Pratt,D. R., & Franckowiak, J., , 137-

A. (2017). Genetic patterns across an invasion's history: a test of change of atest history: aninvasion's across patterns Genetic (2017). A.

and P., Wilton, A. P., Wilton,

Evolution 138. Paradox lost: genetic diversity and the success of aquatic ofaquatic thesuccess and diversity lost: genetic Paradox Molecular Ecology, Ecology, Molecular

D. (2007). Single base errors in PCR products from avian avian in from PCR products errors base Single (2007). D. museum from amplification Microsatellite (2003). D.

N., Sinc N.,

W. (2006). Biomes and bioregions of southern Africa. southern of bioregions and (2006). Biomes W. 22 , Pretoria. , 454 , lair, R., & Sherwin, W. Sherwin, R., & lair,

- 8 464. , 103 , 18

, , eds L. Mucina & M.C. Rutherford, pp. 30 pp. Rutherford, &M.C. Mucina , edsL.

M. (2008). Genetic identity of brook trout in trout brook of Genetic identity M. (2008). 137

, 1560 - 106. , 1244

Molecular Molecular

genetic diversity. genetic - 1573. - 1251.

Ecology

B. (2009). Invasive species (2009). Invasive B. ,

Sturnus

26 Conservation Conservation , 1075

vulgaris - 1090.

The

ion ) -

In In 51.

This article isThis article by protected copyright. All rightsreserved. animals. M. Webster, Heredity R Waples, Stroudsburg M 11:65 Hereditas. ausbetrachtet. vererbungslehre punkt der Wahlund populations. nonequilibrium alleles null in microsatellite adjustment of and Estimation (2006). F. W. Hutchinson, D.,& C.,Weetman, Oosterhout, Van andnon invasive M.(2010). E.,&Fischer, Weber, M., Kleunen, Van Ecosystems Freshwater and Marine Conservation: in a invasion spp.) (Micropterus ofblackbass consequences J. DerWalt, Van saligna models: distribution using species invasive of identity the subspecific Predicting (2011). J. &Wilson, J., J. Roux, M., Le D. Richardson, L., B. P., Webber, M. Robertson, D., G. Thompson, polymorphism. methodfo Statistical F.(1989). Tajima, species. invasive of genetic paradox the explain may adaptation J., A. Stapley, Santure, .

Accepted, Article

Ballonoff as an example. an as

, Methods in Enzymology in Methods , 106 . S

S. S. .

(

S. 1928 , ( 224

2014 1 ,

Genetics

& Reichart, L. (2005). Use of microsatellites for parentage and kinship analyses in analyses kinship and parentage for ofmicrosatellites Use (2005). L. Reichart, & P A., Weyl, O. Weyl, A., 19. - – invasive plant species. plant species. invasive .

) 263 A . Zusammensetzung von population und und population von . Zusammensetzung )

. Testing Hardy for Testing . .,

editors. editors.

. W., & Dennis, S. & Dennis, W.,

Diversity and Distributions, andDistributions, Diversity ,

123

L., Woodford, D. Woodford, L., , 585 ( 1975 ,

395 - 595. ) . Demographic Genetics. Dowden, Hutchinson and Ross, andRoss, Hutchinson Dowden, Genetics. Demographic . , 222 , – r testing the neutral mutation hypothesis by DNA by DNA hypothesis mutation neutral testing the r

R. (2015). Transposable elements as agents of rapid ofrapid asagents elements Transposable R. (2015). Weinberg proportions: have we lost the plot? we the have lost proportions: Weinberg Ecology Letters, Ecology - 238.

J. ,

& ,

A meta A

Radloff, F. Radloff, 17 26 , 1001- , 736

13 Molecular Ecology Notes, Ecology Molecular - analysis of trait differences between between traitdifferences of analysis - 748. , 235 – korrelationserscheinung vomstand korrelationserscheinung 1014. Cape Floristic Region riverbasin. Region Floristic Cape

106 [English translation. In: Weiss translation. [English 106 G.

( - Molecular Ecology Molecular 245. 2016

) . Spatial extent and extent and . Spatial

, 6

24 , 255-

Journal of Journal , 2241 Acacia Acacia 256. -

2252. Aquatic Aquatic

, R. -

K U. .

This article isThis article by protected copyright. All rightsreserved. provenance by driven plant are Zenni, R. & African Biodiversity Africa. South in legislation species ofinvasive the context in management fish invasive D. Woodford, ( bass Whitmore, D. Naturalist Southwestern ( Whitmore, D. fishspecies. twoinvasive of performance K. Wellband, Accepted ArticleMicropterus Microp

D., Bailey, J.Bailey, D.,

terus ): Evidence based on biochemical genetic and morphological analyses. morphological geneticand onbiochemical Evidencebased ): W., & Heath, D. W., &Heath,

H. H. J., Ivey, P., Jordaan, M. P.,Jordaan, J., Ivey, , ,

& Butler, W. (1982). Interspecific hybridization ofsmallm hybridization Interspecific (1982). Butler,W. & & Hellier, T. Hellier, & ).

Copeia

K., & Simberloff, D. (2014). Rapid evolution and range expansion of an invasive invasive an of expansion and range Rapid evolution (2014). D. & Simberloff, K., Conservation , 27 ,

493 , 99

D. (2017). Plasticity in gene transcription explains the differential the differential explains transcription gene Plasticity in (2017). D. R. (1988). Natural hybridization between largemouth and smallmouth smallmouth and largemouth between Natural hybridization R. (1988). – - - 496. 106. environment interactions. environment ,

S., Kimberg, P. Kimberg, S., ,

- Evolutionary Evolutionary 9.

K., Zengeya, T. Zengeya, K., A pplications

Ecology Letters Ecology , ,

& 10

Weyl, O. Weyl, , 563 , outh and Guadalupe bass Guadalupe and outh

17 - 576. , 727

L. L.

( 2017 -

The 735.

Bothalia )

. Optimising . Optimising - This article isThis article by protected copyright. All rightsreserved. 1. Appendix text and tables, in used subsequent to those correspond Abbreviations historic (CN) and native (CI),contemporary invasive contemporary the from populations sampled ofthe overview An Table 1. AcceptedHistorical Specimens Article Native Native Native e Invasiv Native/ Native Native Native Native Native Native Native Nativ

Virginia Virginia; West M N N New York N Ohio Ohio Michigan; Ontario Ohio Ohio State/ Province ew York ew York ew York aryland

1933 1941 1936 1935 1931 1937 1938 1941 1940 1934;1935; 1940;1941 1930 Col lectionDate

1936

Shenandoah River Monocacy River Rondout River River Otselic River; Susquehanna Fall Creek Allegheny River Mosquito Creek Lake Lake Erie Detroit River Auglaize River White Oak Creek Sampled Locality

River Shenandoah Potomac River Hudson River River Susquehanna Etna Cayuga Lake, Allegheny River Mosquito Creek Lake Erie Detroit River Auglaize River Ohio River Drainage System

SH PO HUD SU FC AL MO LE DET AU OH s Table in Abbr.

53 4 4 4 5 2 3 2 3 18 5 3 N

yes no yes yes yes yes yes yes yes yes yes e Exposure Formaldehyd

al native (HN) ranges (HN) native

NMNH ANSP UMMZ UMMZ UMMZ UMMZ OSUM OSUM UMMZ OSUM OSUM Supplied By Material

. K J I H G F E D C B A (Fig. 1) g Map Samplin on Symbol

This article isThis article by protected copyright. All rightsreserved. AcceptedContemporary Specimens Article Native Native Native Native Native e Invasiv e Invasiv e I Native Native Native Native nvasiv

Western Cape Western Cape Western Cape New York New York New York New York New York New York New York New York Ontario

2014 2014 2014 2014 2015 2015 2015 2015 2015 2014 2014 2013;2014

Niagra River Detroit River Berg River River Olifants River; Jan Dissels Doring River Hudson River Lolliersville Oneonta; Susquehanna River Vestal; Susquehanna River Saratoga Lake Oneida Lake LawrenceSt River

Niagra River Detroit River Berg River Olifants River Doring River Hudson River River Susquehanna River Susquehanna River Susquehanna Hudson River Oneida River LawrenceSt River

BE OL DO HUD LOL ONEO VES SAR ONEI STL NIA DET

22 44 38 3 21 21 20 10 14 10 27 55 49 7

no no no no no no no no no no no yes

Collected Self Collected Self Collected Self collectors USA collectors USA collectors USA collectors USA collectors USA collectors USA collectors USA collectors USA ROM - - -

3 2 1 9 8 7 6 5 4 3 2 1

Accepted isThis article by protected copyright. All rightsreserved. Article e Invasiv e Invasiv e Invasiv e Invasiv e Invasiv

Mpumalanga Eastern Cape Eastern Cape Eastern Cape Western Cape

2014 2014 2012 2014 2014

Kouga River Breede River Blyde Dam Rooikranz Dam Krom River

Kouga River Breede River Blyde River Buffalo River Krom River

MP BU KR KO BR

6 30 50 48 15 46 43

no no no no no

MPB SAIAB SAIAB Collected Self Collected Self - -

8 7 6 5 4

This article isThis article by protected copyright. All rightsreserved. ( significant results by denoted size Sample is CR. and cytb mtDNA based on ranges, (CN) native contemporary ( (haplotype diversity indices Genetic Table 2. AcceptedContemporary Native USA Article Contemporary Invasive SA Localities Localities ONEI NIA LOL HUD DET Overall OL MP KR KO DO BU BR BE

P 30 48 20 20 7 292 43 45 14 46 35 47 42 20 n < 0.05) are indicted in bold. inbold. are indicted < 0.05)

26 31 16 15 7 176 24 37 9 24 30 30 33 16 H

0.989 ± 0.013 0.957 ± 0.018 0.974 ± 0.025 0.968 ± 0.025 1.000 ± 0.076 0.967 ± 0.007 0.947 ± 0.020 0.987 ± 0.009 0.835 ± 0.101 0.756 ± 0.071 0.987 ±0.012 0.965 ± 0.013 0.976 ± 0.014 0.963 ± 0.033 h

) and nucleotide ( nucleotide and )

Cytochrome b (cytb) 0.022 ± 0.012 0.032 ± 0.017 0.040 ± 0.021 0.050 ± 0.026 0.144 ± 0.083 0.087 ± 0.043 0.033 ± 0.017 0.071 ± 0.036 0.050 ± 0.027 0.044 ± 0.022 0.263 ± 0.129 0.061 ± 0.031 0.061 ± 0.031 0.066 ± 0.034 π

π )) and neutrality tests (Tajima’s (Tajima’s tests neutrality )) and

- - - - 0.767 - - - - - 0.314 - - - D 1.545 2.445 1.940 2.140 1.899 2.071 0.257 1.768 2.310 2.004 1.295 1.682

------0.833 - - - - - Fs 20.166 12.403 3.662 1.675 0.226 23.547 5.458 11.881 2.777 1.295 4.574 9.88 1.758

n , while , while 18 38 20 17 - 292 40 45 15 45 36 47 43 21 n

and Fu’s Fu’s and H refers to the number of haplotypes. Statistically Statistically haplotypes. of number tothe refers 17 28 13 17 - 179 17 31 15 36 30 35 33 14 H

F S ) 0.994 ± 0.021 0.976 ± 0.014 0.884 ± 0.067 1.000 ± 0.020 - 0.985 ± 0.003 0.906 ± 0.029 0.942 ± 0.024 1.000 ± 0.024 0.984 ± 0.010 0.979 ± 0.016 0.984 ± 0.008 0.981 ± 0.011 0.867 ± 0.074 h

for the contemporary invasive (CI) and (CI) invasive contemporary the for

Control Region(CR) 0.082 ± 0.042 0.011 ± 0.006 0.001 ± 0.001 0.134 ± 0.068 - 0.039 ± 0.019 0.045 ± 0.022 0.063 ± 0.031 0.046 ± 0.024 0.013 ± 0.007 0.084 ± 0.041 0.020 ± 0.010 0.036 ± 0.018 0.088 ± 0.044 π

- - - 0.692 ------D 2.389 2.157 1.174 2.717 1.603 2.646 2.047 1.71 2.537 2.594 2.011 2.277

------8.417 0.974 - - 0.321 - - 6.160 Fs 0.867 13.583 15.968 1.145 23.604 2.642 21.924 10.918 4.340

Accepted isThis article by protected copyright. All rightsreserved. Article

Overall VES STL SAR ONEO

209 14 47 13 10

116 10 34 12 8

0.976 ± 0.005 0.923 ± 0.060 0.966 ± 0.017 0.987 ± 0.035 0.956 ± 0.059

0.051 ± 0.025 0.022 ± 0.012 0.032 ± 0.017 0.030 ± 0.017 0.156 ± 0.084

- - - - - 0.829 0.615 0.689 2.191 1.950

- - 2.782 - - 18.178 4.471 23.870 2.114

51 7 10 174 13

117 10 32 7 10

0.977 ± 0.007 0.962 ± 0.041 0.942 ± 0.023 1.000 ± 0.076 1.000 ± 0.045

0.044 ± 0.021 0.059 ± 0.031 0.002 ± 0.001 0.301 ± 0.169 0.012 ± 0.007

- - - - - 1.829 1.418 1.960 1.806 1.575

- 2.703 - 2.179 - 23.756 28.464 4.188

Accepted isThis article by protected copyright. All rightsreserved. USA USA USA USA USA USA USA USA USA USA USA ArticleUSA USA USA Country number. accession itscorresponding and specimen forthe responsible museum 1, inTable used that to corresponding abbreviation specimen date, origin,collection thespecimen including museums, various from specimensobtained of description A detailed 1. Appendix

Ohio Ohio Ohio Ohio Ohio Ohio Virginia West Virginia Virginia Virginia Maryland Maryland Maryland Maryland State

Pusheta Creek Auglaize River Auglaize River Auglaize River Mosquito Creek Mosquito Creek Shenandoah River Shenandoah River Shenandoah River Shenandoah River Plummer Is., Maryland. Monocacy River Monocacy River Monocacy River S ampled Locality

Auglaize River Auglaize River Auglaize River Auglaize River Mosquito Creek Mosquito Creek Shenandoah River Shenandoah River Shenandoah River Shenandoah River Potomac River Potomac River Potomac River Potomac River Drainage System

1941 1940 1940 1940 1938 1938 1933 1936 1935 1934 1930 1941 1941 1941 Daten Collectio

Specime AU_4 AU_3 AU_2 AU_1 MO_2 MO_1 SH_4 SH_3 SH_2 SH_1 PO_4 PO_3 PO_2 PO_1 Abbrev. n

OSUM OSUM OSUM OSUM OSUM OSUM NMNH NMNH NMNH NMNH NMNH ANSP ANSP ANSP Byd Supplie l Materia

OSUM 4343 OSUM 3942 OSUM 3814 OSUM 3814 OSUM 3568 OSUM 3568 USNM 104928 USNM 100694 USNM 93780 USNM 102132 USNM 284083 ANSP 95683 ANSP 95683 ANSP 95683 Accession#

Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue lead(Pb) arsenic (As),mercury (Hg), m fin snip & bits of gillraker; fry fry fry Notes ight

have been exposedto

Accepted isThis article by protected copyright. All rightsreserved. USA USA Canada Canada USA USA USA USA USA USA USA USA USA ArticleUSA USA USA USA USA USA USA

Michigan Michigan Ontario Ontario Michigan Michigan Michigan Michigan Michigan Michigan Michigan Michigan Michigan Ohio Ohio Ohio Ohio Ohio Ohio Ohio

Detroit River Detroit River Detroit River Detroit River Detroit River Detroit River Detroit River Detroit River Detroit River Grosse Isle shore,Detroit river Grosse Isle shore,Detroit river Grosse Isle shore,Detroit river Grosse Isle shore,Detroit river White Oak White Oak Creek White Oak Creek Lake Erie Lake Erie Lake Erie Pusheta Creek

Creek

Lake Erie Lake Erie Auglaize River Detroit River Detroit River Detroit River Detroit River Detroit River Detroit River Detroit River Detroit River Detroit River Detroit River Detroit River Detroit River Detroit River Ohio River Ohio River Ohio River Lake Erie

1941 1941 1941 1934 1934 1940 1940 1935 1935 1935 1935 1935 1935 1935 1935 1935 1930 1930 1930 1941

LE_2 LE_1 AU_5 DE_13 DE_12 DE_11 DE_10 DE_9 DE_8 DE_7 DE_6 DE_5 DE_4 DE_3 DE_2 DE_1 OH_3 OH_2 OH_1 LE_3

UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ OSUM OSUM OSUM OSUM OSUM OSUM OSUM

UMMZ 243009 UMMZ 243009 UMMZ 130878 UMMZ 130878 UMMZ 243077 UMMZ 243077 UMMZ 243077 UMMZ 243226 UMMZ 243226 UMMZ 243459 UMMZ 243459 UMMZ 243459 UMMZ 243459 OSUM 10834 OSUM 10834 OSUM 10834 OSUM 4272 OSUM 4272 OSUM 4272 OSUM 4343

Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue tissue

Accepted isThis article by protected copyright. All rightsreserved. USA USA USA USA USA USA USA USA USA USA USA ArticleUSA USA USA USA USA USA

New York New York New York New York New York New York New York New York New York New York New York New York Ontario Ontario Ontario Michigan Michigan

Allegheny River Allegheny River Allegheny River tribRondout River toHudson River tribRondout River toHudson River tribRondout River toHudson River tribRondout River toHudson River Susquehanna River Susquehanna River Otselic River Otselic River Otselic River Detroit River Detroit River Detroit River Detroit River Detroit River

Detroit River Detroit River Detroit River Alleghany River Alleghany River Alleghany River Hudson River Hudson River Hudson River Hudson River River Susquehanna River Susquehanna River Susquehanna River Susquehanna River Susquehanna Detroit River Detroit River

1940 1934 1934 1937 1937 1937 1936 1936 1936 1936 1935 1935 1935 1935 1935 1940 1940

DE_16 DE_15 DE_14 AL_3 AL_2 AL_1 HU_4 HU_3 HU_2 HU_1 SU_5 SU_4 SU_3 SU_2 SU_1 DE_18 DE_17

UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ UMMZ

UMMZ 180878 UMMZ 180878 UMMZ 180878 UMMZ 114240 UMMZ 114240 UMMZ 114240 UMMZ 114240 UMMZ 109759 UMMZ 109759 UMMZ 109652 UMMZ 109652 UMMZ 109652 UMMZ 130896 UMMZ 130896 UMMZ 130896 UMMZ 243009 UMMZ 243009

Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue

This article isThis article by protected copyright. All rightsreserved. SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA USA USA

Accepted Article

Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Eastern Cape New York New York Cape

Rooikranz Dam Rooikranz Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Elandsjacht Dam Etna Fall Creek, trib.Cayuga to Lake, Etna Fall Creek, trib.Cayuga to

Lake, Fall Creek Fall Creek Buffalo Buffalo River Buffalo River Krom Krom Krom Krom Krom Krom Krom Krom Krom Krom Krom Krom Krom Krom Krom

1931 1931 2014 2014 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012 2012

FC_2 FC_1 BU2 BU1 KR16 KR15 KR14 KR13 KR12 KR11 KR10 KR9 KR8 KR7 KR6 KR5 KR4 KR3 KR2

SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB UMMZ UMMZ

OW14 OW14 AC09 B963 AC09 B984 AC09 B970 AC09 B997 AC09 B971 AC09 B978 AC09 B982 AC09 B964 AC09 B960 AC09 B977 AC09 B994 AC09 B992 AC09 B875 AC09 B955 AC09 B425 UMMZ 94455 UMMZ 94455 - - 985 965

This article isThis article by protected copyright. All rightsreserved. SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA

Accepted Article Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape

Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam

Buffalo Buffalo River Buffalo River Buffalo River Buffalo Buffalo River Buffalo Buffalo River Buffalo River Buffalo Buffalo River Buffalo River Buffalo Buffalo River Buffalo River Buffalo Buffalo River Buffalo River Buffalo Buffalo River Buffalo River Buffalo River

River River River River River

2014 2014 2014 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2014 2014 2014 2014 2014 2014 2014

BU5 BU4 BU3 BU22 BU21 BU20 BU19 BU18 BU17 BU16 BU15 BU14 BU13 BU12 BU11 BU10 BU9 BU8 BU7 BU6

SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB

OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 ------744 702 675 796 797 686 724 742 735 737 808 684 688 798 700 791 828 835 941 979

This article isThis article by protected copyright. All rightsreserved. SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA SA

Buffalo Buffalo River Buffalo Buffalo River Buffalo Buffalo River Buffalo River Buffalo River Buffalo River Buffalo River Buffalo River Buffalo Buffalo River Buffalo River Buffalo Buffalo River Buffalo River Buffalo Buffalo River Buffalo River Buffalo Buffalo River River River River River River

2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015 2015

BU25 BU24 BU23 BU42 BU41 BU40 BU39 BU38 BU37 BU36 BU35 BU34 BU33 BU32 BU31 BU30 BU29 BU28 BU27 BU26

SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB

OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 OW14 ------690 727 762 704 715 799 739 733 738 756 746 732 782 705

This article isThis article by protected copyright. All rightsreserved. SA SA SA SA SA SA

Accepted Article Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape Eastern Cape

Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam Rooikranz Dam

Buffalo Buffalo River Buffalo River Buffalo River Buffalo Buffalo River Buffalo River Buffalo River

2015 2015 2015 2015 2015 2015

BU45 BU44 BU43 BU48 BU47 BU46

SAIAB SAIAB SAIAB SAIAB SAIAB SAIAB

Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue Muscle tissue

This article isThis article by protected copyright. All rightsreserved. and CI + (HN CI grouping CI HNand tie acloser between Dproposes Scenario HN the stock. from turn, originating CI CIand states that A, scenario C,like Scenario source population. communal a from groupings stem (CI Bothinvasive another. one related to more closely are and HN CI CI and B: Both Scenario pool. gene the CN from came which stock from HN but originated population, other to than any another one related to (CI SA individuals of thesubsample and individuals theCI Most of A: Scenario A-I Scenario population. ghost unsampled an and populations CN the sampled eventbetween an admixture from originate populations 6:CI Scenario population; ghost unsampled an HN and the sampled event between admixture an originate from populations 5:CI HN;Scenario and CN both from populations admixed represent populations 4:CI Scenario population; anunsampled from rather but HNpopulation, CN or either from originate CIdidnot 3: Scenario record); the one on than event introduction more recent (i.e.a from HN being derived populations withboth CN populations, from originated CI 2: Scenario populations; the CN of asubsample which represents HNstock, the from originated CI 1: Scenario 1-6 Scenario inDIYABC. implemented (ABC) Computation Bayesian the Approximate in used information scenario The Appendix 2. S

Accepted CI and CN Both population. the CN from originating related, closely are most Article S are once again closest related to one another, originating from CN. The Remaining CI Remaining CI The CN. from originating oneanother, to related closest again are once S ) along with CI individuals originated from a CN population. In scenario E,theHN Inscenario CNpopulation. a from originated individuals with alongCI ) S individuals are closest related to one another, while CN while CN one toanother, related areclosest individuals

and CI S ) and native (CN and HN) (CN native and ) and S ) are more closely closely aremore )

+ CI S populations, in populations, S . This . This This article isThis article by protected copyright. All rightsreserved. fromthe source). asingle introduction but only introductions, (i.e.multiple source the from turnoriginated which in population, source unsampled CIand both that I states Lastly,scenario introduction). only suggests that H scenario Contrastingly, source). single from introductions (i.e. multiple the source from population CI and G: Both HN).Scenario + (CN USA i.e. population one from source (CIand introductions both if test to wererun threescenarios The following i- Scenario from introductions fromindependent each originate population well asthe CN (HN +CI) as grouping This CI. and HN between tie I acloser H,scenario suggests like scenario Lastly, population. alongwith CI +CI) (HN grouping This CI. and between HN CN+ and (HN+CI CN and and together CI and HN G groups F, scenario Like scenario + CI (HN groupings Both closely related. CN aremore F CI HN the+ with individuals along

Accepted Article andCI HN that states results,and STRUCTURE the supports iii

CI S CI ) originate from an unsampled ghost population. Scenario H proposes a closer tie acloser proposes H Scenario population. ghost unsampled froman originate ) S originated from the source population, with CI originating from from CIoriginating with population, fromthe source originated

S + CN grouping originate from an unsampled population. Scenario Scenario population. unsampled an from originate grouping + CN S and CI + CN) share an unsampled ghost origin ghost anunsampled share + and CI CN) CI S S were founded independently from an from independently founded were individuals originated from a CN fromaCN originated individuals S are most closely related, while CI and CIand related, while most closely are CI S S together. Both groupings groupings together. Both CI S originated independently independently originated CI S ) did in fact originate factoriginate in did ) CI S S (i.e. single (i.e. single CI S . . . This article isThis article by protected copyright. All rightsreserved. Accepted Article

This article isThis article by protected copyright. All rightsreserved. Accepted Article