Regulation of Immune Responses by the Airway Epithelial Cell Landscape
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells
The Journal of Clinical Investigation RESEARCH ARTICLE Prospective isolation of NKX2-1–expressing human lung progenitors derived from pluripotent stem cells Finn Hawkins,1,2 Philipp Kramer,3 Anjali Jacob,1,2 Ian Driver,4 Dylan C. Thomas,1 Katherine B. McCauley,1,2 Nicholas Skvir,1 Ana M. Crane,3 Anita A. Kurmann,1,5 Anthony N. Hollenberg,5 Sinead Nguyen,1 Brandon G. Wong,6 Ahmad S. Khalil,6,7 Sarah X.L. Huang,3,8 Susan Guttentag,9 Jason R. Rock,4 John M. Shannon,10 Brian R. Davis,3 and Darrell N. Kotton1,2 2 1Center for Regenerative Medicine, and The Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, Massachusetts, USA. 3Center for Stem Cell and Regenerative Medicine, Brown Foundation Institute of Molecular Medicine, University of Texas Health Science Center, Houston, Texas, USA. 4Department of Anatomy, UCSF, San Francisco, California, USA. 5Division of Endocrinology, Diabetes and Metabolism, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA. 6Department of Biomedical Engineering and Biological Design Center, Boston University, Boston, Massachusetts, USA. 7Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts, USA. 8Columbia Center for Translational Immunology & Columbia Center for Human Development, Columbia University Medical Center, New York, New York, USA. 9Department of Pediatrics, Monroe Carell Jr. Children’s Hospital, Vanderbilt University, Nashville, Tennessee, USA. 10Division of Pulmonary Biology, Cincinnati Children’s Hospital, Cincinnati, Ohio, USA. It has been postulated that during human fetal development, all cells of the lung epithelium derive from embryonic, endodermal, NK2 homeobox 1–expressing (NKX2-1+) precursor cells. -
Pdf Sub-Classification of Patients with a Molecular Alteration Provides Better Response [57]
Theranostics 2021, Vol. 11, Issue 12 5759 Ivyspring International Publisher Theranostics 2021; 11(12): 5759-5777. doi: 10.7150/thno.57659 Research Paper Homeobox B5 promotes metastasis and poor prognosis in Hepatocellular Carcinoma, via FGFR4 and CXCL1 upregulation Qin He1, Wenjie Huang2, Danfei Liu1, Tongyue Zhang1, Yijun Wang1, Xiaoyu Ji1, Meng Xie1, Mengyu Sun1, Dean Tian1, Mei Liu1, Limin Xia1 1. Department of Gastroenterology, Institute of Liver and Gastrointestinal Diseases, Hubei Key Laboratory of Hepato-Pancreato-Biliary Diseases, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, Hubei Province, China. 2. Hubei Key Laboratory of Hepato-Pancreato-Biliary Diseases; Hepatic Surgery Center, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology; Clinical Medicine Research Center for Hepatic Surgery of Hubei Province; Key Laboratory of Organ Transplantation, Ministry of Education and Ministry of Public Health, Wuhan, Hubei, 430030, China. Corresponding author: Dr. Limin Xia, Department of Gastroenterology, Institute of Liver and Gastrointestinal Diseases, Hubei Key Laboratory of Hepato-Pancreato-Biliary Diseases, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, Hubei Province, China; Phone: 86 27 6937 8507; Fax: 86 27 8366 2832; E-mail: [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2020.12.29; Accepted: 2021.03.17; Published: 2021.03.31 Abstract Background: Since metastasis remains the main reason for HCC-associated death, a better understanding of molecular mechanism underlying HCC metastasis is urgently needed. -
Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis
Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database. -
Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7 -
Deciphering the Nature of Trp73 Isoforms in Mouse
cancers Article Deciphering the Nature of Trp73 Isoforms in Mouse Embryonic Stem Cell Models: Generation of Isoform-Specific Deficient Cell Lines Using the CRISPR/Cas9 Gene Editing System Lorena López-Ferreras 1,2,†, Nicole Martínez-García 1,3,†, Laura Maeso-Alonso 1,2,‡, Marta Martín-López 1,4,‡, Ángela Díez-Matilla 1,‡ , Javier Villoch-Fernandez 1,2, Hugo Alonso-Olivares 1,2, Margarita M. Marques 3,5,* and Maria C. Marin 1,2,* 1 Instituto de Biomedicina (IBIOMED), Universidad de León, 24071 León, Spain; [email protected] (L.L.-F.); [email protected] (N.M.-G.); [email protected] (L.M.-A.); [email protected] (M.M.-L.); [email protected] (Á.D.-M.); [email protected] (J.V.-F.); [email protected] (H.A.-O.) 2 Departamento de Biología Molecular, Universidad de León, 24071 León, Spain 3 Departamento de Producción Animal, Universidad de León, 24071 León, Spain 4 Biomar Microbial Technologies, Parque Tecnológico de León, Armunia, 24009 León, Spain 5 Instituto de Desarrollo Ganadero y Sanidad Animal (INDEGSAL), Universidad de León, 24071 León, Spain * Correspondence: [email protected] (M.M.M.); [email protected] (M.C.M.); Tel.: +34-987-291757 Citation: López-Ferreras, L.; (M.M.M.); +34-987-291490 (M.C.M.) Martínez-García, N.; Maeso-Alonso, † Equal contribution. ‡ Equal contribution. L.; Martín-López, M.; Díez-Matilla, Á.; Villoch-Fernandez, J.; Simple Summary: The Trp73 gene is involved in the regulation of multiple biological processes Alonso-Olivares, H.; Marques, M.M.; Marin, M.C. Deciphering the Nature such as response to stress, differentiation and tissue architecture. -
Ten Commandments for a Good Scientist
Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Wageningen 2010 Thesis committee Thesis supervisors Prof. dr. ir. Ivonne M.C.M. Rietjens Professor of Toxicology Wageningen University Prof. dr. Albertinka J. Murk Personal chair at the sub-department of Toxicology Wageningen University Thesis co-supervisor Dr. ir. Jacques J.M. Vervoort Associate professor at the Laboratory of Biochemistry Wageningen University Other members Prof. dr. Michael R. Muller, Wageningen University Prof. dr. ir. Huub F.J. Savelkoul, Wageningen University Prof. dr. Everardus J. van Zoelen, Radboud University Nijmegen Dr. ir. Toine F.H. Bovee, RIKILT, Wageningen This research was conducted under the auspices of the Graduate School VLAG Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Thesis submitted in fulfillment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. dr. M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Tuesday 14 September 2010 at 4 p.m. in the Aula Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds. Ana María Sotoca Covaleda Thesis Wageningen University, Wageningen, The Netherlands, 2010, With references, and with summary in Dutch. ISBN: 978-90-8585-707-5 “Caminante no hay camino, se hace camino al andar. Al andar se hace camino, y al volver la vista atrás se ve la senda que nunca se ha de volver a pisar” - Antonio Machado – A mi madre. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
HOXB6 Homeo Box B6 HOXB5 Homeo Box B5 WNT5A Wingless-Type
5 6 6 5 . 4 2 1 1 1 2 4 6 4 3 2 9 9 7 0 5 7 5 8 6 4 0 8 2 3 1 8 3 7 1 0 0 4 0 2 5 0 8 7 5 4 1 1 0 3 6 0 4 8 3 7 4 7 6 9 6 7 1 5 0 8 1 4 1 1 7 1 0 0 4 2 0 8 1 1 1 2 5 3 5 0 7 2 6 9 1 2 1 8 3 5 2 9 8 0 6 0 9 5 1 9 9 2 1 1 6 0 2 3 0 3 6 9 1 6 5 5 7 1 1 2 1 1 7 5 4 6 6 4 1 1 2 8 4 7 1 6 2 7 7 5 4 3 2 4 3 6 9 4 1 7 1 3 4 1 2 1 3 1 1 4 7 3 1 1 1 1 5 3 2 6 1 5 1 3 5 4 5 2 3 1 1 6 1 7 3 2 5 4 3 1 6 1 5 3 1 7 6 5 1 1 1 4 6 1 6 2 7 2 1 2 e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S HOXB6 homeo box B6 HOXB5 homeo box B5 WNT5A wingless-type MMTV integration site family, member 5A WNT5A wingless-type MMTV integration site family, member 5A FKBP11 FK506 binding protein 11, 19 kDa EPOR erythropoietin receptor SLC5A6 solute carrier family 5 sodium-dependent vitamin transporter, member 6 SLC5A6 solute carrier family 5 sodium-dependent vitamin transporter, member 6 RAD52 RAD52 homolog S. -
Transcriptomic Response to 1,25-Dihydroxyvitamin D
cells Article Transcriptomic Response to 1,25-Dihydroxyvitamin D in Human Fibroblasts with or without a Functional Vitamin D Receptor (VDR): Novel Target Genes and Insights into VDR Basal Transcriptional Activity 1 1,2, 3 1 Pedro L. F. Costa , Monica M. França y, Maria L. Katayama , Eduardo T. Carneiro , Regina M. Martin 2, Maria A. K. Folgueira 3, Ana C. Latronico 2 and Bruno Ferraz-de-Souza 1,* 1 Laboratorio de Endocrinologia Celular e Molecular LIM-25 e Unidade de Doencas Osteometabolicas, Divisao de Endocrinologia, Hospital das Clinicas HCFMUSP, Faculdade de Medicina, Universidade de Sao Paulo, Sao Paulo, SP 01246-903, Brazil; [email protected] (P.L.F.C.); [email protected] (M.M.F.); [email protected] (E.T.C.) 2 Laboratorio de Hormonios e Genetica Molecular LIM-42, Divisao de Endocrinologia, Hospital das Clinicas HCFMUSP, Faculdade de Medicina, Universidade de Sao Paulo, Sao Paulo, SP 05403-900, Brazil; [email protected] (R.M.M.); [email protected] (A.C.L.) 3 Departamento de Radiologia e Oncologia, Instituto do Cancer do Estado de Sao Paulo (ICESP), Faculdade de Medicina FMUSP, Universidade de Sao Paulo, Sao Paulo, SP 01246-000, Brazil; [email protected] (M.L.K.); [email protected] (M.A.K.F.) * Correspondence: [email protected] or [email protected] Present address: The University of Chicago, Department of Medicine, Section of Endocrinology, y 5841 S. Maryland Av., Chicago, IL 60637, USA. Received: 12 February 2019; Accepted: 3 April 2019; Published: 5 April 2019 Abstract: The vitamin D receptor (VDR) mediates vitamin D actions beyond bone health. -
Chloride Channels Regulate Differentiation and Barrier Functions
RESEARCH ARTICLE Chloride channels regulate differentiation and barrier functions of the mammalian airway Mu He1†*, Bing Wu2†, Wenlei Ye1, Daniel D Le2, Adriane W Sinclair3,4, Valeria Padovano5, Yuzhang Chen6, Ke-Xin Li1, Rene Sit2, Michelle Tan2, Michael J Caplan5, Norma Neff2, Yuh Nung Jan1,7,8, Spyros Darmanis2*, Lily Yeh Jan1,7,8* 1Department of Physiology, University of California, San Francisco, San Francisco, United States; 2Chan Zuckerberg Biohub, San Francisco, United States; 3Department of Urology, University of California, San Francisco, San Francisco, United States; 4Division of Pediatric Urology, University of California, San Francisco, Benioff Children’s Hospital, San Francisco, United States; 5Department of Cellular and Molecular Physiology, Yale University School of Medicine, New Heaven, United States; 6Department of Anesthesia and Perioperative Care, University of California, San Francisco, San Francisco, United States; 7Department of Biochemistry and Biophysics, University of California, San Francisco, San Francisco, United States; 8Howard Hughes Medical Institute, University of California, San Francisco, San Francisco, United States *For correspondence: Abstract The conducting airway forms a protective mucosal barrier and is the primary target of [email protected] (MH); [email protected] airway disorders. The molecular events required for the formation and function of the airway (SD); mucosal barrier, as well as the mechanisms by which barrier dysfunction leads to early onset airway [email protected] (LYJ) diseases, -
Chromatin and Epigenetics Cross-Journal Focus Chromatin and Epigenetics
EMBO Molecular Medicine cross-journal focus Chromatin and epigenetics cross-journal focus Chromatin and epigenetics EDITORS Esther Schnapp Senior Editor [email protected] | T +49 6221 8891 502 Esther joined EMBO reports in October 2008. She was awarded her PhD in 2005 at the Max Planck Institute for Molecular Cell Biology and Genetics in Dresden, Germany, where she studied tail regeneration in the axolotl. As a post-doc she worked on muscle development in zebrafish and on the characterisation of mesoangioblasts at the Stem Cell Research Institute of the San Raffaele Hospital in Milan, Italy. Anne Nielsen Editor [email protected] | T +49 6221 8891 408 Anne received her PhD from Aarhus University in 2008 for work on miRNA processing in Joergen Kjems’ lab. As a postdoc she then went on to join Javier Martinez’ lab at IMBA in Vienna and focused on siRNA-binding proteins and non-conventional splicing in the unfolded protein response. Anne joined The EMBO Journal in 2012. Maria Polychronidou Editor [email protected] | T +49 6221 8891 410 Maria received her PhD from the University of Heidelberg, where she studied the role of nuclear membrane proteins in development and aging. During her post-doctoral work, she focused on the analysis of tissue-specific regulatory functions of Hox transcription factors using a combination of computational and genome-wide methods. Céline Carret Editor [email protected] | T +49 6221 8891 310 Céline Carret completed her PhD at the University of Montpellier, France, characterising host immunodominant antigens to fight babesiosis, a parasitic disease caused by a unicellular EMBO Apicomplexan parasite closely related to the malaria agent Plasmodium. -
KRAS Drives Immune Evasion in a Genetic Model of Pancreatic Cancer
ARTICLE https://doi.org/10.1038/s41467-021-21736-w OPEN KRAS drives immune evasion in a genetic model of pancreatic cancer Irene Ischenko1, Stephen D’Amico1, Manisha Rao2, Jinyu Li2, Michael J. Hayman1, Scott Powers 2, ✉ ✉ Oleksi Petrenko 1,3 & Nancy C. Reich 1,3 Immune evasion is a hallmark of KRAS-driven cancers, but the underlying causes remain unresolved. Here, we use a mouse model of pancreatic ductal adenocarcinoma to inactivate 1234567890():,; KRAS by CRISPR-mediated genome editing. We demonstrate that at an advanced tumor stage, dependence on KRAS for tumor growth is reduced and is manifested in the sup- pression of antitumor immunity. KRAS-deficient cells retain the ability to form tumors in immunodeficient mice. However, they fail to evade the host immune system in syngeneic wild-type mice, triggering strong antitumor response. We uncover changes both in tumor cells and host immune cells attributable to oncogenic KRAS expression. We identify BRAF and MYC as key mediators of KRAS-driven tumor immune suppression and show that loss of BRAF effectively blocks tumor growth in mice. Applying our results to human PDAC we show that lowering KRAS activity is likewise associated with a more vigorous immune environment. 1 Department of Molecular Genetics and Microbiology, Stony Brook University, Stony Brook, NY, USA. 2 Department of Pathology, Stony Brook University, ✉ Stony Brook, NY, USA. 3These authors jointly supervised this work: Oleksi Petrenko, Nancy C. Reich. email: [email protected]; [email protected] NATURE COMMUNICATIONS | (2021) 12:1482 | https://doi.org/10.1038/s41467-021-21736-w | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-021-21736-w RAS is frequently associated with some of the deadliest and characterization of KRASG12D p53KO mouse cell lines forms of cancer.