Journal of Biogeography
Community assembly and diversification in a species-rich radiation of island weevils (Coleoptera: Cratopini)
Journal: Journal of Biogeography Manuscript ForID JBI-16-0520.R2 Peer Review Manuscript Type: Research Paper
Date Submitted by the Author: 01-Feb-2018
Complete List of Authors: Kitson, James; Newcastle University, School of Biology Warren, Ben; Museum National d'Histoire Naturelle, Institut de Systématique, Evolution, Biodiversité Thébaud, Christophe; Laboratoire Evolution et Diversité Biologique (UMR 5174), Université Paul Sabatier and CNRS Strasberg, Dominique; Universite de la Reunion, Faculté des Sciences et Technologies Emerson, Brent; Instituto de Productos Naturales y Agrobiologia, CSIC; University of East Anglia, School of Biological Sciences
Colonisation, speciation, extinction, island, invertebrate, diversification, Key Words: Mascarene
Page 1 of 45 Journal of Biogeography
1 2 3 EDITOR'S COMMENTS TO AUTHOR 4 5 Editor: Sanmartín, Isabel 6 Comments to the Author: 7 The authors have made a great job in addressing the reviewers' comments from the first round, 8 especially in relation to incorporating inference uncertainty. Yet, this study is so ambitious in scale and 9 scope that some aspects in the methodological approach remain unsatisfactory, in particular the 10 tackling of potential gene tree/species tree incongruence, and the definition of OTUs. Though I agree 11 with the reviewers that further refined analyses are desirable (e.g., Yang & Rannala’s BPP 12 multispecies coalescent model does not require a priori definition of OTUs and their hierarchical 13 Bayesian approach implies that several sequences per species are not a requisite), my impression is 14 that the scale of this study is so large (+6000 sequences) that these will not have a huge impact on 15 their main conclusions. I therefore suggest the authors to follow the reviewers' suggestions as far as 16 possible and to justify in the text the consequences of their data violating the assumptions of their 17 choice of analyses. I am looking forward to seeing a revised, publishable version of this very important 18 contribution to island biogeography. 19 For Peer Review 20 Further comments: Together with Richard Ree, I have now a manuscript tentatively accepted in JBI 21 where we demonstrate that biogeographic model selection in BioGeoBEARS is statistically invalid and 22 criticize the DEC+J model as a poor model of founder speciation. DEC+J can lead to degenerate 23 probabilistic solutions in which the data is explained entirely by the cladogenetic events and branch 24 25 length (time) becomes irrelevant. Though certainly the authors could not know this, I would appreciate 26 if they mention this caveat somewhat in Material and Methods. Since the authors are here dealing 27 with island clades and short branch lengths, the use of the DEC+J (+X) model might be not as 28 misleading as when dealing with continental clades subtended by long branches. 29 “Conceptual and statistical problems with the DEC+J model of founder event speciation and its 30 comparison with DEC via model selection”. Richard H. Ree & Isabel Sanmartin. Journal of 31 Biogeography. 32 33 Dr. Isabel Sanmartín 34 35 Dear Dr Sanmartín, 36 37 Thank you for the opportunity to resubmit our paper for consideration. Please find below our point by 38 point response to the reviewers. We have attempted the *BEAST analysis suggested by reviewer one 39 but had issues with effective sample sizes even when running the analysis with up to 1 billion 40 generations. We have discussed the implications of gene incongruence in the manuscript as 41 suggested. We have also included your caveat regarding BioGeoBEARS model testing and the 42 DEC+J model. This has not been included in the methods but rather in the results directly after the 43 model selection section, as this flows better within the manuscript. We have endeavoured to keep the 44 additional caveats and references requested as short as possible but despite spending much time on 45 reducing the length of this round of changes, it has not been possible to remain below the word limit 46 and we are now 121 words over. We hope that this can be accommodated. 47
48 Thank you for your time. 49
50 Yours sincerely, 51
52 53 James Kitson (on behalf of the authors) 54 55 56 57 58 59 60 Journal of Biogeography Page 2 of 45
1 2 3 REVIEWER COMMENTS TO AUTHOR 4 5 Referee: 1 6 7 Comments to the Author 8 The manuscript has been greatly improved by following many of the reviewers’ and the Editor’s 9 suggestions. In particular, phylogenetic uncertainty is now accounted for in biogeographic analyses, 10 and a wider range of biogeographic models is explored by using BioGeoBEARS. In my opinion, the 11 paper is essentially acceptable for publication in Journal of Biogeography. Still, there a few points that 12 I think the authors should reconsider when preparing a final version: 13 14 • The authors seem very reluctant to use coalescent based methods (such as *BEAST) in their 15 phylogenetic analysis, despite the fact that the quality of their data would, in principle, permit it. It is 16 true that the authors don’t have multiple individuals per OTU sequenced for all four loci, and that is 17 problematic for the estimation of effective populations sizes conducted by *BEAST. However, the 18 authors do have multiple sequences per OTU for one of the loci (COII), and that could be enough to 19 run a reasonably reliableFor *BEAST analysisPeer (in combination Review with the single individual datasets obtained 20 for the other loci, and after excluding the species potentially affected by introgression). I am not saying 21 the authors should redo the whole biogeographic study using a *BEAST phylogeny, but I encourage 22 them to run a *BEAST analysis to check that topology and divergence times are similar to those of the 23 concatenation based analysis they have conducted. Given that incongruence between loci seems to 24 25 be generally low (apart from the case interpreted as resulting from introgression), I expect the results 26 from concatenation and coalescent analyses to be very similar, so major results of the paper shouldn’t 27 be affected. 28 >>We have tried the *BEAST analysis as suggested. Even after 1 billion generations, we still 29 experienced very poor ESS scores (<50) for some parameters. The topology and ages of the tree 30 were comparable but we have not presented this data due to the issues with convergence. 31 32 • The authors argue that their “OTU definitions are not specifically meant to represent ‘true’ 33 species”. However, their hypotheses and predictions explicitly deal with speciation, and therefore, a 34 species phylogeny (where OTUs effectively represent ‘true’ species, at least to a large extent) is 35 required to test them. The potential limitations of this approach should be made clear. 36 >>We acknowledge this limitation but in truth our molecularly defined OTUs confirm several 37 taxonomic synonyms that have been suggested (but not formally described) by previous authors 38 based on sets of species that appear to be forms of each other with varying levels of similarity. For 39 example, the C. humeralis group species are distinguished almost entirely by the extent and 40 patterning of the scales coating their elytra. We have addressed this by adding the following sentence 41 to the discussion: 42 43 “Our inferences regarding the origins of species diversity are dependent on our OTUs being 44 equivalent to species. Comparison of our OTUs with the most recent taxonomic treatise (e.g. Williams 45 and Cox 2003) support this inference, with recently defined species corresponding with our OTUs.“ 46 47 Related to this, I am still not convinced by the use of neighbour joining for the analysis of COII 48 sequences to delimit OTUs. I don’t see a reason for not using a more reliable method like maximum 49 likelihood. 50 >> As suggested we have used Maximum Likelihood implemented in RAxML version 7.7.1 through 51 RAxML BlackBox to generate a revised tree. There are no changes to the OTUs defined. We have 52 53 updated the supplementary figures and relevant text. 54 55 • I still think a selection of taxonomic references used for identification should be included in the 56 main text (“Beetle sampling” section of methods). Please note that references in supplementary 57 58 59 60 Page 3 of 45 Journal of Biogeography
1 2 3 materials are essentially invisible to bibliographic databases (see Rafferty et al., 2015), and this can 4 be particularly detrimental for taxonomists. 5 >> We agree that this is not ideal (indeed some of the authors of this manuscript suffer the same 6 problem in the citation of their articles). Although would like to cite everything in the main text, we are 7 conscious of the need to endeavour to keep to the word limits for JBI. We have included one or two of 8 the bigger references, which themselves cite the others. 9 10 • I am not sure a single nuclear clock is appropriate for the divergence time estimation, given that 11 a broad range of evolutionary rates are expected across the nuclear genome. Has this assumption 12 been tested in any way? 13 >> This is an approach recommended in several tutorials from the BEAST developers. However, we 14 have tried to run analyses with multiple nuclear clock models. These typically show very poor ESS 15 scores even for long runs. We interpret this as over parameterisation for the data we have, perhaps 16 due to missing data within some of the nuclear partitions. 17 18 A minor point: in Table 1, if I am not mistaken, ∆AICc values should be positive, as they represent the 19 difference in AICc betweenFor a particular Peer model and Reviewthe best fitting model (which has the lowest value). 20 >> The reviewer is correct here. We have updated the table to the correct, positive values. 21
22 References 23 Rafferty AR, Wong B, Chapple DG. 2015. An increasing citation black hole in ecology and evolution. 24 25 Ecology and Evolution 5(1): 196 199. 26 >> An interesting paper and we agree. We have dealt with this above by citing the most important 27 works. 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Journal of Biogeography Page 4 of 45
1 2 3 Referee: 2 4 5 Comments to the Author 6 This is a very impressive study in scope. The authors assembled an enormous dataset of over 6000 7 weevil specimens to reconstruct the biogeographical history of the tribe Cratopini in the islands of the 8 SW Indian Ocean. Their focus is on the diversity on Mauritius and Reunion, as the authors are using 9 these two islands as a mean to compare how a radiating lineage diversify and multiply on islands of 10 different ages. Mauritius and Reunion are similar in area and isolation, but differ in age (and in 11 elevation). The authors capitalize on the difference in age to test hypotheses related to the theory of 12 island biogeography originally proposed by MacArthur & Wilson, and the role of colonization and in 13 situ speciation in the formation of diversity. The paper is very well written, the analyses are sound and 14 the conclusions are reasonable given the results. As described below, I only have a few 15 comments/suggestions for the authors to hopefully even further improve the quality of this submission. 16 17 (1) In the intro the authors state that the reason why there might be a time lag before in situ speciation 18 starts contributing to island diversity is because speciation takes time I would be more careful here. 19 We now have many examplesFor of very Peer rapid speciation Review and another potential explanation for the time 20 lag is the number of "seed" lineages available that can contribute to diversity the pool of potential 21 colonizer doesn't change much over the young age of an island, but the number of species that can 22 potentially split and give rise to new species in situ increases steadily as species accumulate on the 23 island. There might be a lag in in situ speciation simply because the number of potential "seed" to 24 25 speciate is very low compared to the pool of species that can reach the island via colonization. 26 >> We agree with this important point and it is somewhat encompassed by our statement that 27 “speciation takes time” but for clarity we have now included this reasoning in our first paragraph. It 28 should now be clear that it both takes time for newly arrived lineages to diverge from their source 29 populations and that low initial diversity of arrivals will contribute to reduced speciation potential 30 compared to a fully realised community. 31 32 (2) I am not sure I am fully following prediction 2. If I follow the earlier logic of the time lag of in situ 33 speciation, one would expect colonist species to be old, and species resulting from in situ speciation 34 to be relatively younger. The proportion of colonists vs. in situ species should sift over time towards 35 the latter (prediction 1). So on an old island, there should be more species resulting from in situ 36 speciation relative to colonists (prediction 3). I don't understand why the authors predict species 37 resulting from in situ speciation are likely to be older than colonization events don't we need a 38 colonization first before we get any speciation within island? Doesn't the rationale above just say the 39 reverse, that the species accumulating early will be doing so via colonization and speciation in situ will 40 kick in later resulting in younger in situ species compared to colonizer species? 41 >> In this prediction, we explicitly state that we are not considering the oldest colonisation of the older 42 island. Instead we are examining the relative contribution to the Mauritian community of in situ 43 speciation vs back colonisation from Reunion i.e. is it likely that new colonists are able to establish on 44 Mauritius or are ecological niches filled by in situ speciation? This is linked to your point above, as 45 there are many more ‘seed’ lineages in an established older community, it is more likely that one of 46 these will lead to the ‘successful’ lineage that we sampled in the field. The corollary of that is that the 47 constant ecological pressure of established communities would lead to extinction/suppression of new 48 arrivals from Reunion making the sampled back colonisations appear younger overall. 49
50 (3) a few places throughout the text (in intro pages 4 and 6, two separate places in discussion pages 51 20 and 21) the authors interpret their results in light of the balance between formation of species 52 53 (either in situ or via colonization) and extinction. The authors have zero result enlightening the 54 process of extinction in this group of species and I don't think they can say anything about the rate of 55 extinction in different groups of weevils (whether it is their mode of origin or the flightlessness) given 56 their analyses. I think they should stay away from over interpreting their results in that sense, or if they 57 58 59 60 Page 5 of 45 Journal of Biogeography
1 2 3 do want to speculate, they should make it clear that their speculation is based on no evidence as 4 related to extinction. 5 >> Overall we consider that we have been quite careful to avoid suggesting that extinction is the 6 absolute cause of new niches or that it is definitely involved in limiting the diversity of flightless 7 lineages. However, we have removed explicit references to extinction in our predictions and have 8 made clear that we are speculating regarding per lineage extinction risk for flightless lineages in the 9 discussion. We hope that this removes any ambiguity about whether or not we are testing predictions 10 regarding extinction rates. 11 12 (4) The authors should consider addressing briefly in the intro what is the selection agent for the 13 evolution of the loss of flight in arthropods to frame the analysis they are presenting. For example, it is 14 thought that arthropods might lose flight ability at higher elevation. Mauritius is markedly lower than 15 Reunion, could that have played a role in the loss of flight in some species? It is difficult to fully grasp 16 the implication of their analyses on that particular question until they mention a few proposed 17 hypotheses in the discussion. I understand that this paper is not about the transition between flighted 18 and flightless species, but since they are testing for convergence of that trait, it seems to make sense 19 to at least introduce the differentFor potential Peer adaptive Review values that have been proposed in the literature 20 (and flightlessness is not evolving more often on islands than on continents see Roff, D.A., 1990. 21 The evolution of flightlessness in insects. Ecological Monographs, 60(4), pp.389 421: "...The 22 incidence of flightlessness increases with altitude and latitude but, contrary to "conventional" wisdom, 23 it is not exceptionally high on oceanic islands compared to mainland areas" , so putting this in a 24 25 broader context seems important here). 26 >> We have followed the reviewer’s suggestions and added a few general hypotheses for flight loss in 27 insular insect groups to the introduction. Flightless Cratopine weevils occur in most habitats and at 28 most elevations in the Mascarenes so attributing any of the main flight loss hypotheses already 29 suggested in the literature to this group is not really possible (at least not with the data we have to 30 hand). For this reason we have refrained from making any strong hypotheses for this group 31 specifically. 32 33 (5) I think the authors should be more upfront about their 2 step approach of OTU delimitation using 34 COII and then phylogenetic reconstruction of gene and species trees. In a way it is odd to use COII 35 first to establish the units of diversity to be studied, and then use a more complete dataset including 36 nuclear genes to develop a hypothesis of how the lineage evolved (as opposed to use all individuals 37 to do the latter). I understand that given the breadth of sampling, it would be an enormous task to 38 generate the nuclear data for all the 6000+ individuals for which COII was sequenced. But the method 39 employed here might overlook some important incongruence that is relevant to the biogeographical 40 history and the evolution of flight loss in these weevils. For example, it is unclear whether the 41 signature of variation in island occupancy and flightlessness is not blurred by collapsing groups down 42 to "the minimal monophyletic group containing all samples belonging to one or more taxonomic 43 species". I don't have a better approach to propose, but I think the authors should address the 44 shortcoming of their approach and be clear from the start that this is a choice they made constrained 45 by logistics of sequencing not a conceptual one (at least that is how I read it). 46 >> In order to make sure that no biogeographic signal is lost (at least at the inter island level), we 47 have included, where relevant, a representative of each OTU from each island it occurs on. This is 48 also coincidentally true for flightless species vs flight capable ones. However, we acknowledge that 49 this is indeed a question of logistics and that this should be much clearer in the manuscript so we 50 have amended this section of the methods to explicitly state that is was beyond the scope of this 51 project to sequence all individuals from all localities for multiple loci. 52 53 54 Minor comments: 55 page 5 line 35: Not sure that the 10 species of Galapaganus can be considered a "large radiation" 56 57 58 59 60 Journal of Biogeography Page 6 of 45
1 2 3 >> We agree that this is not really a large radiation so have now edited this comment to remove any 4 reference to Galapaganus. 5 6 page 5, line 48: the mathematical/graphical model of theory of island biogeography does not include 7 speciation, but M&W devoted a section of their book on speciation as a potential source of diversity 8 on islands, so it is not like this is an idea that was only recently brought up. 9 >> We agree and have amended the manuscript to reference (MacArthur and Wilson 1967) in this 10 statement. 11 12 page 8 line 17, there's a period missing after (Swofford, 2003) 13 >> Done. 14 15 page 14 lines 12 14: what do the authors mean by "well supported"? did they use some cutoff value 16 for nodal support? 17 >> For this statement, we have used a cut off value of 0.95 to define well supported. We have 18 amended the text to reflect this. 19 For Peer Review 20 page 16, line 28, there is an extra "are" in that sentence. 21 >> Fixed. 22
23 page 16, line 37: the final colonization, do the authors mean the earliest colonization? or first 24 25 colonization? dating at 8.2 Mya, I can't imagine that this is the final (i.e., last colonization) 26 >> We are simply referring to the final colonisation to be discussed. We accept that final in this 27 situation is the incorrect term and is confusing to the reader. We have reworded this to remove 28 ambiguity: 29 30 Original: 31 The remaining two colonisations of Reunion are are followed by back colonisations to Mauritius from 32 Reunion. The first of these occurred approximately 6.4 Mya (95% HPD 4.1 8.8 Mya), giving rise to C. 33 septemvittatus and C. exquisitus, followed by a recolonisation of Mauritius giving rise to C. melanocephalus no more than 3.2 Mya (95% HPD 1.9 4.6 Mya). The final colonisation of Reunion is 34 estimated have occurred approximately 8.2 Mya (95% HPD 6.3 10.3 Mya) giving rise to C. bernei 35 and S. dombayae, with a back colonisation to Mauritius no more than 1.5 Mya (95% HPD 0.8 2.2 36 Mya) giving rise to S. subtruncatus. 37 38 New version: 39 The remaining two colonisations of Reunion were followed by back colonisations to Mauritius from 40 Reunion. One occurred approximately 6.4 Mya (95% HPD 4.1 8.8 Mya), giving rise to C. 41 septemvittatus and C. exquisitus, followed by a recolonisation of Mauritius giving rise to C. 42 melanocephalus no more than 3.2 Mya (95% HPD 1.9 4.6 Mya), while the other is estimated have occurred approximately 8.2 Mya (95% HPD 6.3 10.3 Mya) giving rise to C. bernei and S. dombayae, 43 with a back colonisation to Mauritius no more than 1.5 Mya (95% HPD 0.8 2.2 Mya) giving rise to S. 44 subtruncatus. 45 46 page 17, lines 25 30. The so called here second colonization seems to also be discordant with the 47 age of Reunion since it should have been the source for that colonization between 7.2 Mya (5.6 9.2 48 Mya) and 8.1 Mya (6.3 10.3 Mya). 49 >> Thank you for spotting this. You are correct, this is an oversight on our part, given how remote 50 Rodrigues is from Reunion, we would suggest that there are missing intermediate taxa that remain 51 unsampled leading the biogeographic analysis to conclude erroneously that Reunion is the direct 52 source of this colonisation. We have made similar conclusions earlier in the manuscript and amended 53 this section to state: “Given the remoteness of Rodrigues from Reunion, it seems likely that 54 55 unsampled or extinct species on other islands, especially Mauritius, would be the most probable 56 cause for this discrepancy.” 57 58 59 60 Page 7 of 45 Journal of Biogeography
1 2 3 4 page 19, lines 14 and 28, I think it is spelled McDougall, not McDougal 5 >> Corrected. 6 7 Fig 1 looks nice. 8 >> Thank you! 9 10 Fig 2: The colors are confusing. The clades could be put in boxes with a line but no shading to avoid 11 the confusion of using colors for 2 purposes. I would avoid using dashed branches to illustrate a trait, 12 it is so often used for indicating extinct lineages that this is almost a convention. Why not indicate the 13 flightlessness using a symbol next to the name of the species? You also would avoid implying that the 14 flightlessness evolved at the node connecting the branch to its sister taxon. 15 >> We have made the suggested changes to the figure and figure legend. 16 17 The photos of the weevils are amazing! 18 >> Thank you, there are some really spectacular species in this radiation. 19 For Peer Review 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 1 Journal of Biogeography Page 8 of 45
1 2 3 Article type: Original Article 4 Community assembly and diversification in a species-rich radiation of island 5 weevils (Coleoptera: Cratopini) 6 7 Running title: Community assembly in Mascarene weevils. 8 9
10 James J. N. Kitson1, Ben H. Warren2, Christophe Thébaud3, Dominique Strasberg4 and Brent C. 11 Emerson5,6 12 13 1 14 School of Natural and Environmental Sciences, Newcastle University, Newcastle upon Tyne, 15 NE1 7RU, United Kingdom. 16 2 Institut de Systématique, Evolution, Biodiversité, UMR 7205 CNRS MNHN UPMC EPHE, 17 Muséum National d'Histoire Naturelle, Sorbonne Universités, CP 51, 57 Rue Cuvier, 75231 18 PARIS Cedex 05, France. 19 3 Laboratoire EvolutionFor & Diversité Peer Biologique, UMRReview 5174 CNRS-Université Paul Sabatier-ENFA- 20 IRD, 31062 Toulouse Cedex 9, France. 21 4 UMR PVBMT, Université de La Réunion - Faculté des Sciences et Technologies, CS 92003, 22 97744 Saint-Denis, La Réunion, France. 23 5 Island Ecology and Evolution Research Group, IPNA-CSIC , C/Astrofísico Francisco Sánchez 3, 24 38206 La Laguna, Santa Cruz de Tenerife, Spain. 25 6 School of Biological Sciences, University of East Anglia, Norwich Research Park, Norwich NR4 26 7TJ, United Kingdom 27 28 Correspondence author: James Kitson ([email protected]) 29 30 31 ACKNOWLEDGEMENTS 32 33 We thank Juliane Casquet and Emilie Lesseguince for field assistance and the Mauritian 34 Wildlife Foundation, Vincent Florens, Claudia Baider and Owen Griffiths for logistical 35 assistance. We thank the following people for additional specimens: Antoine Franck, 36 Sylvain Hugel, Jacques Poussereau, Owen Griffiths, Vincent Florens and Claudia Baider, 37 38 Karl Phillips; Dave Wright; Justin Gerlach; N. Borowiec; Janske van de Crommenacker . 39 We would additionally like to thank Jacques Poussereau for access to his unpublished 40 keys to the Cratopine weevils of Reunion. We are grateful to Conrad Gillett (University 41 of East Anglia) for providing us with the primers ArgK_F1_semidg and ArgK_R2_fulldg. 42 Permits were awarded by the Mauritius National Parks and Conservation Service, the 43 Seychelles Bureau of Standards and the Parc National de La Réunion. Fieldwork and 44 laboratory work were supported by funding from the ANR, France (ANR-2006- 45 BDIV002)), and a NERC-funded PhD studentship to JJNK. Molecular analysis training for 46 JJNK was supported by the Company of Biologists and the John and Pamela Salter 47 Charitable Trust. The molecular analyses presented in this study were carried out on 48 49 the High Performance Computing Cluster supported by the Research Computing Service 50 at the University of East Anglia. 51 52 53 Abstract word count: 300 54 Total word count: 7121 55 56 57 58 59 60 2 Page 9 of 45 Journal of Biogeography
1 2 3 ABSTRACT 4 5 Aim Weevils from the tribe Cratopini are found on many of the islands of the Southwest 6 Indian Ocean, with a particularly high species richness in the Mascarenes. We construct 7 a molecular phylogeny to test predictions regarding island age and the relative 8 contributions of colonisation vs. in situ speciation for community assembly and species 9 turnover on Mauritius (approximately 9 Ma) and Reunion (approximately 5 Ma), the 10 two main islands of the Mascarenes. We additionally investigate the evolutionary 11 12 dynamics of flight loss in the tribe, since the loss of flight in island lineages can influence 13 patterns of diversification. 14 Location Mascarene Islands; Southwest Indian Ocean. 15 Methods Up to five individuals of each taxonomically described species sampled within 16 each sampling site were sequenced for the mitochondrial gene Cytochrome Oxidase II to 17 delimit operational taxonomic units (OTUs). OTUs were further sequenced for the 18 nuclear genes Arginine Kinase, Histone 3, and ribosomal 28s, to reconstruct the 19 phylogenetic history Forof the group. Peer Review 20 Results Our results support the hypothesis that present-day species richness on the 21 older island of Mauritius is largely the result of in situ speciation, with few colonisation 22 23 events, of which all but the most basal are recent. In contrast, Reunion presents a more 24 uniform temporal spectrum of colonisation times. Flight loss has evolved convergently 25 at least five times, and speciation events associated with flight loss are significantly 26 younger than speciation events that have not resulted in flight loss. 27 Main conclusions Patterns of community assembly on the islands of Mauritius and 28 Reunion fit a model where the addition of new species and species turnover is 29 increasingly dominated by in situ speciation as an island community matures. Repeated 30 flight loss indicates selection for flightlessness, with the young age of flightless lineages 31 suggesting higher extinction rates over longer evolutionary time scales and little 32 influence on present-day species richness. 33 34 35 36 Key words 37 Colonisation, speciation, extinction, island, invertebrate, diversification, Mascarene 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 3 Journal of Biogeography Page 10 of 45
1 2 3 INTRODUCTION 4 5 Island species assemblages result from the accumulation of species through time by 6 colonisation and establishment from outside areas, anagenetic change, in situ speciation 7 and extinction. The relative probabilities of these processes are predicted to be 8 functionally related to each other (e.g. MacArthur & Wilson, 1963, 1967; Emerson & 9 Kolm, 2005; Emerson & Oromí, 2005; Emerson & Gillespie, 2008). A time lag before in 10 situ speciation begins to contribute to island community assembly can be expected, 11 12 given that: (i) speciation takes time; (ii) speciation between island and mainland source 13 populations may be needed before in situ speciation can occur, and; (iii) an initially low 14 number of established lineages means there are fewer lineages across which speciation 15 can occur. It has been further hypothesised that community assembly on young islands 16 should initially be dominated by colonisation, but that in situ speciation should later 17 make an important contribution, giving rise to a dynamic equilibrium of species 18 turnover involving colonisation, extinction and speciation (e.g. Emerson & Oromí, 2005; 19 Emerson & Gillespie,For 2008). Peer Under this Review model one would expect that for islands 20 belonging to the same regional species pool, and with a comparable size and species 21 richness, but of different ages, species origin by in situ speciation would be more 22 23 predominant on older islands, assuming that younger islands had not reached a 24 turnover equilibrium among colonisation, speciation and extinction. 25 The Indian Ocean islands of Mauritius and Reunion offer a near-ideal 26 opportunity to examine the temporal dynamics of community assembly, as both islands 27 are of a similar size and isolation from source areas of colonisation, but are of markedly 28 different ages (Thébaud et al., 2009; Casquet et al., 2015). The subaerial age of Mauritius 29 is estimated to be approximately 8.9 Ma (million years) (Moore et al., 2011), while the 30 age of Reunion is estimated to be up to 5 Ma (Bonneville et al., 1988). The closest long- 31 term source area for both islands is Madagascar, from which both can be considered to 32 be similarly isolated, being 870 km and 665 km away, respectively. Connectivity of both 33 34 islands with the Seychelles and India has been promoted by the appearance of stepping 35 stone islands along the Mascarene plateau during cycles of sea-level low stands (Warren 36 et al., 2010). 37 One of the most species rich invertebrate groups distributed across the islands of 38 the Southwest Indian Ocean is the weevil tribe Cratopini, which is represented by five of 39 the nine recognised genera (Alonso-Zarazaga & Lyal, 1999). Species richness is 40 concentrated on the islands of Mauritius and Reunion, with 75 of the approximately 107 41 described species of Cratopus (abbreviated to C.), 12 of the 14 described species of 42 Cratopopsis (abbreviated to Cr.) and both described species of Scaevinus. Cratopine 43 44 weevils of the Southwest Indian Ocean Islands are unusual in that a large proportion of 45 species are flighted, contrasting with other known large radiations of oceanic island 46 weevils where all species are flightless (e.g. the genus Laparocerus in Macaronesia and 47 Rhyncogonus in Polynesia). While Cratopus species are capable of flight, with the 48 exception of one flightless species (C. triangularis) and one flight polymorphic species, 49 C. murinus [Kitson et al. (2013)], all Cratopopsis and Scaevinus species are exclusively 50 flightless. 51 The equilibrium model of island biogeography (MacArthur & Wilson, 1963, 52 1967) emphasizes island biotas as being typified by rapid turnover through ongoing 53 colonisation and extinction (Heaney 2007). While the equilibrium model does not 54 55 explicitly include speciation, it is expected that species turnover will be increasingly 56 dominated by in situ speciation as an island community matures (addressed by 57 58 59 60 4 Page 11 of 45 Journal of Biogeography
1 2 3 MacArthur & Wilson, 1963; e.g. Emerson & Oromí, 2005; Emerson & Gillespie, 2008). It 4 thus follows that colonisation would be expected to contribute more to species richness 5 on the younger island of Reunion, because it is in a younger stage of the community 6 assembly/species turnover spectrum (sensu Whittaker et al., 2008), and less to the 7 more mature island of Mauritius, because it is at a later stage. Here we reconstruct 8 phylogenetic relationships among cratopine weevils of the Mascarene Islands to infer 9 the biogeographic history of the group, and to test the hypothesis that in situ speciation 10 11 contributes proportionally more to species richness on mature islands (Mauritius) than 12 on younger islands (Reunion). We explore this dynamic by distinguishing between 13 divergence events that have added species to an island by colonisation from those that 14 have added species through in situ speciation, and by testing the following three 15 predictions: (i) the probability of establishment and persistence of a colonising species 16 decreases as an island matures, (ii) excluding the earliest colonisation event, in situ 17 speciation events on a mature island are more likely to be older than colonisation 18 events, reflecting a dynamic dominated more by species turnover within the local 19 species pool rather thanFor colonisation Peer of empty Review niche space by the regional species pool; 20 21 and (iii) in situ speciation events on young islands are more likely to be of comparable 22 age or even younger than colonisation events, reflecting a dynamic dominated more by 23 colonisation of unoccupied ecological niches by the regional species pool, rather than 24 species turnover within the local species pool. 25 An important part of community assembly is in situ evolution following 26 colonisation, as colonist lineages adapt to their new niche. A recurring feature of this 27 process in many insular insect and vertebrate groups is the loss of flight (Wright et al., 28 2016) with multiple hypotheses for this trend being proposed such as; reduced 29 temperature at high altitude (Medeiros & Gillespie, 2011), strong winds displacing 30 individuals from restricted environments (Sattler, 1991) and increased fecundity due to 31 32 rebalancing an organism’s energy budget (Roff, 1990). Loss of flight is particularly 33 relevant in the context of community assembly within islands or groups of islands, as it 34 can accelerate allopatric speciation and promote diversification, as shown in carrion 35 beetles (Ikeda et al., 2012). Given that many weevil genera present on archipelagos are 36 flightless (see Williams, 2000; Samuelson, 2003; Machado et al., 2008 for examples), the 37 occurrence of just two flightless species within the otherwise flight capable genus 38 Cratopus is surprising. However, the number of flight loss events within the Cratopini of 39 the Southwest Indian Ocean Islands may be underestimated by taxonomy. The 40 monophyly of the genus Cratopopsis in particular is defined by morphological 41 characteristics that could be the consequence of convergent evolution through the 42 43 repeated evolution of flight loss (partially fused elytra and reduced prothoracic 44 anatomy). Thus it is possible that cratopine taxonomy is a poor predictor of the 45 evolutionary history within the tribe. We used our phylogenetic data to re-examine the 46 evolutionary dynamics of flight loss in Mauritius and Reunion Cratopini to assess the 47 frequency and timing of speciation events associated with flight loss, and their potential 48 influence on patterns of community assembly. 49 50 51 METHODS 52 53 Beetle sampling 54 Specimens were collected from the islands of the Southwest Indian Ocean by foliage 55 beating during wet seasons between June 2007 and December 2011. Samples were 56 57 58 59 60 5 Journal of Biogeography Page 12 of 45
1 2 3 placed directly in 99% ethanol and sampling sites were recorded with a handheld GPS 4 unit. Samples were identified to taxonomic species using morphological keys for 5 Cratopus and Cratopopsis provided by Jaques Poussereau (unpublished work) and the 6 original descriptions of most species (Hustache, 1919; Williams & Cox, 2003 - but see 7 Appendix S1.2 in Supplementary Materials for more references). 8 9 Defining operational taxonomic units for the multilocus phylogeny 10 11 While there is a rich taxonomic literature for the three Cratopine genera of the 12 Southwest Indian Ocean (see Appendix S1.2), the validity of several Mascarene species 13 has been questioned (Voisin & Poussereau, 2009). To address the taxonomic 14 uncertainty within the group, we used a phylogenetic approach to help define 15 operational taxonomic units (OTUs). It was beyond the scope of this project to sequence 16 all samples for multiple loci so we first selected up to five individuals per species per 17 Mascarene sampling locality for genomic DNA extraction, PCR, and sequencing of the 18 mitochondrial locus Cytochrome Oxidase II (COII). All COII sequences locus were 19 aligned using MAFFTFor v6.814b Peerand model testing Review was undertaken to determine the best 20 21 phylogenetic model in jModeltest2 (Darriba et al., 2012). A maximum likelihood tree 22 was generated using the GTRGAMMA model in RAxML 7.7.1 (Stamatakis et al., 2008) 23 using the RAxML BlackBox (https://embnet.vital-it.ch/raxml-bb/index.php). 24 Operational taxonomic units (OTUs) were then defined as the minimal monophyletic 25 group containing all samples belonging to one or more taxonomic species. If an OTU 26 occurred on multiple islands, then a representative from each island was included in the 27 multilocus phylogeny. Single individuals of species from islands outside the Mascarenes 28 were also included in the final set of OTUs. Full details of the procedure for OTU 29 definition (including PCR conditions and sequencing) can be found in Appendix S1. 30 31 32 Molecular protocols for phylogenetic analyses 33 To reconstruct phylogenetic relationships among the defined OTUs, individuals were 34 chosen for the amplification and DNA sequencing of three additional loci: Arginine 35 Kinase (ArgK), Histone 3 and the ribosomal gene 28S. Sequences for all primers used 36 can be found in Table S1.6.2 and detailed molecular methods including PCR conditions 37 are available in Appendix S1.6. 38 All sequences were checked, and in the case of reverse sequencing, consensus 39 sequences generated with Geneious Pro version 5.6. Sequences were aligned using 40 MAFFT v6.814b (Katoh et al., 2002) with the following parameter values: scoring matrix 41 1PAM/k = 2, Gap open penalty = 1.53, Offset value = 0.123, and then checked by eye. 42 43 The aligned sequences were tested for saturation using the entropy-based index of 44 substitution saturation as implemented in DAMBE v5.2.78 (Xia et al., 2003). This was 45 performed on two data sets, one comprised of the first and second codon positions and 46 the second comprised of the third codon positions, with the exception of 28S which was 47 not partitioned. 48 49 Phylogenetic analyses 50 Trees for OTUs defined from the mtDNA COII analysis were constructed from individual 51 alignments of each locus using MrBayes 3.2 (Huelsenbeck & Ronquist, 2001). Four 52 MrBayes replicate analyses were performed on each alignment for 20 million 53 54 generations using eight MCMC chains, discarding 25% of the samples as burnin. Model 55 testing was undertaken to determine the best model for each locus in jModeltest2 56 (Darriba et al., 2012). The alignments for COII, ArgK and H3 were assigned the GTR+G 57 58 59 60 6 Page 13 of 45 Journal of Biogeography
1 2 3 substitution model and 28S was assigned the HKY+I+G model, all parameters permitted 4 under these models were estimated. The outputs of all MrBayes analyses were assessed 5 for stationarity and convergence in Tracer v1.5.0 (Rambaut & Drummond, 2007) and 6 AWTY (Nylander et al., 2007), and only runs with ESS scores greater than 200 for all 7 parameters were accepted. Consensus trees were plotted and formatted in R (R 8 Development Core Team, 2017) using the ‘ggtree’ R package (Yu et al., 2017). Before 9 performing multilocus analyses, congruence between gene trees was assessed by 10 11 comparing consensus tree for each gene to check for conflicting well supported clades 12 (>0.95 Bayesian posterior probability) present in one partition but not the others as (as 13 in Meseguer et al., 2013). In addition to this, a sensitivity analysis was performed as in 14 Meseguer et al. (2013) to examine the effects of missing data. Four separate 15 concatenated alignments were produced: (1) all-samples; (2) samples with at least two 16 loci; (3) samples with at least three loci; (4) samples which have all four loci. Each 17 concatenated alignment was analysed using the same parameters as above with all 18 substitution model parameters unlinked for each partition. 19 For Peer Review 20 21 Divergence time estimation 22 Timings of colonisation and divergence events were estimated with BEAST2 v2.4.5 23 (Bouckaert et al., 2014) using all four loci. Each partition was given the substitution 24 model previously determined by jModeltest2 and all substitution models were unlinked 25 to allow each partition to have its own parameters. Ten replicate analyses each of 100 26 million generations were performed. The COII partition was assigned a relaxed 27 lognormal clock model with a mean rate of 0.0154 substitutions/site/Ma with a 28 standard deviation of 0.06, taken from (Cicconardi et al., 2009). A single nuclear clock, 29 estimated relative to the COII clock, was applied to all nuclear partitions. Stationarity 30 and convergence were assessed as with the individual locus MrBayes trees. A maximum 31 32 clade credibility (MCC) tree was generated from the BEAST2 output by combining tree 33 files in Logcombiner v2.4.5 (Bouckaert et al., 2014) and then generating the MCC tree in 34 TreeAnnotator v2.4.5 (Bouckaert et al., 2014). 35 36 Biogeographic analyses 37 For all analyses, the Seychelles were treated as a single island as they have formed one 38 connected landmass at least six times due to changing sea levels over the last 500,000 39 years (Warren et al., 2010). All other islands were treated as independent entities as 40 they are surrounded by deep water and are unlikely to have ever been connected. 41 Ancestral ranges for each node in the multilocus phylogeny were estimated using the 42 43 BioGeoBEARS package (Matzke, 2013) in R. All of the base models DEC (Ree & Smith, 44 2008), DIVALIKE and BAYAREALIKE (maximum likelihood implementations of DIVA - 45 Ronquist & Cannatella, 1997; and BAYAREA - Landis et al., 2013) were used for model 46 testing in conjunction with the founder event (+J - Matzke, 2014) and distance based 47 dispersal (+X -Van Dam & Matzke, 2016) modifiers giving a total of twelve possible 48 biogeographic models. The best model was chosen using relative model probability with 49 any model with a relative probability less than 0.05 being discounted and ΔAICc 50 (corrected Akaike information criteria) values >2 being used as a cutoff between the 51 most similar models (Burnham & Anderson, 2002). 52
53 54 Statistical analysis of node ages 55 Statistical tests comparing nodal ages were performed to test if: nodes representing 56 colonisations of Mauritius are younger than nodes representing colonisations of 57 58 59 60 7 Journal of Biogeography Page 14 of 45
1 2 3 Reunion (prediction 1); nodes representing colonisations of Mauritius are younger than 4 nodes representing in situ speciation on Mauritius (prediction 2); nodes representing in 5 situ speciation events on Reunion are younger than nodes representing colonisation 6 events of Reunion (prediction 3). Nodes leading to flight loss were also tested to 7 evaluate if they are significantly younger than other nodes, as might be expected if there 8 is high evolutionary turnover of flightless lineages. To account for uncertainty in the 9 estimated phylogenetic history and node ages, the above analysis was replicated across 10 11 1000 random trees drawn from the post burnin BEAST2 .trees files. For each node in 12 each randomly selected tree, the most probable biogeographic range for that node and 13 the ancestor of that node were extracted from the BioGeoBEARS output along with the 14 median age of each node. These were then used to identify the node types listed above 15 and calculate the maximum possible age for each colonisation or in situ speciation 16 event. The mean age of each node was then used in a series of t-tests that were paired to 17 account for overall variation in tree age. R scripts for subsampling of BEAST2 trees and 18 performing the BioGeoBEARS analysis are available as part of our supplementary 19 GitHub repository. For Peer Review 20 21 22 23 RESULTS 24 25 Beetle sampling 26 A total of 5565 beetles were collected across 19 islands, representing 77 described 27 species, accounting for approximately 70% of the recognised species richness. A 28 complete list of species and islands is provided in Table S2.3 in Appendix S2. 29 30 Operational taxonomic units 31 Subsampling five individuals, where possible, of each taxonomic species sampled within 32 each Mascarene sampling site resulted in a dataset of 915 individuals for the definition 33 of OTUs. A full list of Mascarene sites and GPS coordinates can be found in Table S1.2.1 34 35 in Appendix S1. A total of 32 OTUs were identified across the Mascarenes (See Figures 36 S1.5.1 and S1.5.2 in Appendix S1 for OTUs and the taxonomic species they contain). 37 There are an additional 19 species from non-Mascarene islands, four OTUs that are 38 shared across islands, two species that did not amplify for COII and one outgroup 39 (Polyclaeis equestris) giving 58 OTUs in the final dataset. 40 41 DNA sequencing for the OTU phylogeny 42 A full summary of sequencing success for each locus can be found in Table S2.4 in 43 Appendix S2 while Table S2.5 in Appendix S2 contains the corrected and uncorrected 44 genetic distances among individuals for each locus. The sequencing success for each 45 46 OTU partitioned by locus is provided in Table S2.6 in Appendix S2. All sequences are 47 available on GenBank (accession numbers will be provided upon acceptance). The 48 results of Xia’s test for saturation for each locus divided into first and second codon 49 position vs. third codon position (except 28S which was not partitioned) is provided in 50 Table S2.7 in Appendix S2. Results indicate that sequences are not saturated with the 51 possible exception of the third codon position for COII which had a test statistic that 52 was not significantly less than the critical value. 53 54 55 56 57 58 59 60 8 Page 15 of 45 Journal of Biogeography
1 2 3 Phylogenetic analyses of individual genes 4 Among the four partitions, the COII (Fig S2.3 in Appendix S2) and ArgK (Fig. S2.4 in 5 Appendix S2) trees are better supported, with ArgK providing greater resolution among 6 basal nodes. The Histone 3 (Fig. S2.5 in Appendix S2) and 28S (Fig. S2.6 in Appendix S2) 7 trees are less well supported. Histone 3 contains much missing data (39.0% of the 8 alignment is missing or ambiguous compared to 6.8% for COII, no missing data for ArgK 9 and 2.1% for 28S). The lack of support in the 28S tree is consistent with the low number 10 11 of variable sites (90.2% of aligned sites are identical compared to 59.4% for COII, 65% 12 for ArgK and 64.3% for Histone 3). The individual gene trees are in broad agreement 13 with one notable exception. Cratopopsis bistigma from Reunion and the Mauritius 14 Cratopopsis OTU are recovered as sister OTUs with very high support for all nuclear loci. 15 However Cr. bistigma is recovered with very high support as a sister species to C. 16 frappieri, also from Reunion, in the COII tree. The sequences for the Mauritius 17 Cratopopsis OTU and Cr. bistigma were confirmed by repeat PCR and resequencing. The 18 incongruent mtDNA relationships among the three OTUs was also evident within the 19 broader mtDNA analysisFor to definePeer OTUs, Review indicating that the incongruence between 20 21 nuclear and mitochondrial loci is not due to error. An explanation of incomplete lineage 22 sorting can be excluded due to both the phylogenetic depth involved and limited 23 opportunity in the context of island colonisation (see Faria et al., 2016), indicating 24 mtDNA introgression from C. frappieri to Cr. bistigma. Because of this, the COII partition 25 for Cr. bistigma was excluded from the multilocus phylogenetic alignment. As with 26 individual gene analyses, the trees produced by the sensitivity analysis were in broad 27 agreement. Overall we found no large changes in tree support when including missing 28 data with: 71.2% of nodes were well supported (≥0.95 Bayesian posterior probability) 29 in the all sample analysis (58 OTUs); 70.8% with a minimum of two loci (54 OTUs); 30 71.1% with a minimum of three loci (52 OTUs); and, 74.2% with a minimum of four loci 31 32 (37 OTUs). Subsequent analyses were thus performed using the four locus matrix for all 33 58 OTUs. 34 35 Multilocus phylogenetic analysis 36 The concatenated multilocus alignment of the 58 OTUs was 2,173 bp long. Overall, the 37 MCC chronogram (Fig. 2. See Fig. S2.7 for HPD intervals on node ages) is generally well 38 supported and can be divided into two main clades. Clade one contains much of the 39 diversity from the Seychelles and the Comoros with some additional species from 40 Rodrigues, Mauritius and Reunion. Clade 2 includes most species from Mauritius and 41 Reunion and all of the species strictly associated with coralline or coastal habitats in the 42 43 smaller islets of the Indian Ocean and the Seychelles (C. gloriosus, C. adspersus, C. 44 viridisparsus and C. griseovestitus). Clade two can be further divided into three 45 subclades (Fig. 2, Clades 2a, 2b and 2c). Clades 2b and 2c are well supported but the 46 arrangement of relationships among them and clade 2a is poorly resolved, largely due 47 to the unresolved position of C. nigrogranatus. Cratopus and Cratopopsis are not 48 recovered as reciprocally monophyletic, with Cratopopsis OTUs occurring in both clades 49 and two of the three subclades of clade two. Rodrigues and Reunion each have their 50 own Cratopopsis lineage and a third is represented on both Mauritius and Reunion. 51 Scaevinus is recovered within clade 1 as a sister lineage to C. bernei. 52
53 54 Biogeographic and dating analyses 55 Model testing in BioGeoBEARS indicated that DEC+J+X is the best fitting model to the 56 MCC chronogram (see Table 1 for model testing results). DIVALIKE+J+X had a 57 58 59 60 9 Journal of Biogeography Page 16 of 45
1 2 3 marginally significant relative model probability but it was discarded as significantly 4 worse than DEC+J+X because the ΔAICc value was greater than two between the 5 models. All of the most probable models contain both the +J and +X modifiers indicating 6 that both long range dispersal and the distance between islands are important in the 7 biogeographic history of Cratopine weevils. It should be noted however that there is 8 criticism of how BioGeoBEARS implements model selection and that the DEC+J model 9 may be inappropriate for phylogenies with long branch lengths (Ree & Sanmartin, 10 11 2018- unpublished), although it is unlikely to be consequential here as are dealing with 12 relatively short branches. Figure 2 shows the results of the stratified DEC+J+X analysis 13 performed on the BEAST2 MCC chronogram. All general biogeographic discussion refers 14 to this analysis while the statistical analysis of node ages (next section) employs the 15 same biogeographic model but iterates across a random sample of 1000 dated trees 16 from the BEAST2 posterior. 17 Overall, the biogeographic history estimated on the BEAST2 MCC tree (Fig. 2) 18 suggests that the sampled diversity arose from an ancestor on Mauritius. The DEC+J+X 19 analysis infers nine For colonisations Peer from Mauritius Review to Reunion and three colonisations 20 21 from Reunion to Mauritius. There are two inferred colonisations to Rodrigues, two to 22 the Seychelles and two to the Comoros. One of the two colonisations to each of the 23 Seychelles and the Comoros involves a group of species that have colonised coastal 24 habitats in Mauritius, Reunion and the Comoros and eventually northwards to the 25 Seychelles. 26 Of the nine colonisations from Mauritius to Reunion inferred by BioGeoBEARS, 27 four have a median estimated divergence time of two million years or less. Most of these 28 have resulted in taxonomically defined species that are extremely similar (Scaevinus 29 dombayae, Fig.2 clade 1, Cr. bistigma and C. brunnipes, Fig. 2, clade 2b) to their 30 counterparts on Mauritius while the remaining colonisation (the C. nigridorsis species 31 32 group, Fig. 2, clade 2b) is represented by a single OTU containing three taxonomically 33 defined species. A fifth colonisation of Reunion is estimated to have occurred 34 approximately 4.8 Mya (Million years ago) (95% HPD 3.6 - 6.2 Mya) , giving rise to the 35 remaining Cratopopsis from Reunion (seven taxonomically defined species), C. nanus, C. 36 ditissimus and the C. humeralis species group (four taxonomically defined species). Two 37 further colonisations of Reunion occurred 4.2 Mya (95% HPD 2.8 - 5.7 Mya) and 2.6 Mya 38 (95% HPD 1.7 - 3.7 Mya) respectively with one colonisation resulting in C. frappieri (Fig 39 2, clade 2b) and another resulting in C. murinus (Fig2, clade 2c). 40 The remaining two colonisations of Reunion were followed by back colonisations 41 to Mauritius from Reunion. One occurred approximately 6.4 Mya (95% HPD 4.1 - 8.8 42 43 Mya), giving rise to C. septemvittatus and C. exquisitus, followed by a recolonisation of 44 Mauritius giving rise to C. melanocephalus no more than 3.2 Mya (95% HPD 1.9 - 4.6 45 Mya), while the other is estimated have occurred approximately 8.2 Mya (95% HPD 6.3 - 46 10.3 Mya) giving rise to C. bernei and S. dombayae, with a back colonisation to Mauritius 47 no more than 1.5 Mya (95% HPD 0.8 - 2.2 Mya) giving rise to S. subtruncatus. The 95% 48 HPD interval of this event does not include the maximum estimated age of Reunion, 49 invoking either (i) an older age for Reunion, (ii) an underestimation of molecular rate, or 50 (iii) colonisation associated with a more recent node, but this is masked by unsampled 51 or extinct Mauritian taxa within this clade. The third colonisation from Reunion to 52 Mauritius is inferred to have occurred at least 1.2 Mya (95% HPD 0.6 - 1.8 Mya) leading 53 54 to the Mauritian population of C. punctum. 55 Lineage 2c contains the exclusively coastal species C. punctum, C. griseovestitus, C. 56 viridisparsus, C. adspersus, C. gloriosus, Cratopus GrandeComore sp. 1 and Cratopus Moheli 57 58 59 60 10 Page 17 of 45 Journal of Biogeography
1 2 3 sp. 1. Dating analyses suggest the diversification among these taxa began approximately 4 2.1 Mya (95% CI 1.5 - 2.7 Mya), radiating from Reunion to the low lying islands of Juan 5 de Nova, Europa, Grande Glorieuse and Aldabra not less than 1.1 Mya (95% HPD 0.8 - 6 1.5 Mya), followed more recently by a colonisation of Seychelles not less than less than 7 0.5 Mya (95% HPD 0.3 - 0.8 Mya). 8 Rodrigues is inferred to have been colonised twice. A colonisation giving rise to 9 C. virescens and C. viridipunctatus (Fig. 2, clade 2b) is inferred to have its source on 10 11 Mauritius and to have occurred at least 3.8 Mya (95% HPD 2.4 - 5.4 Mya). The second 12 colonisation gave rise to C. inornatus, C. rocki and Cr. pauliani (Fig. 2, clade 1), with 13 Reunion inferred as the most probable source between 7.2 Mya (95% HPD 5.6 - 9.2 14 Mya) and 8.1 Mya (95% HPD 6.3 - 10.3 Mya). As with the genus Scaevinus, the 95% HPD 15 interval of this event does not include the maximum estimated age of Reunion. Given 16 the remoteness of Rodrigues from Reunion, it seems likely that unsampled or extinct 17 species on other islands, especially Mauritius, would be the most probable cause for this 18 discrepancy. 19 The remainingFor species Peerin clade 1 are Review recovered in two well supported groups. 20 21 The first consists of species restricted to the granitic Seychelles while the second 22 exclusively contains species from the Comoros. The granitic Seychelles appear to have 23 been colonised by the ancestor of Cratopus La Digue sp. 1, Cratopus Mahe sp. 1, C. 24 segregatus and C. aurostriatus at least 4.3 Mya (95% HPD 3.0 - 5.8 Mya) while the 25 Comoros are estimated to have been colonised by the ancestor of C. subdenudatus, 26 Cratopus Anjouan sp. 1 and Cratopus Anjouan sp. 2 at least 3.8 Mya (95% HPD 2.8 - 5.1 27 Mya). 28 29 Statistical analysis of node ages 30 Across all 1000 trees, there was a mean of 8.97 colonisations from Mauritius to Reunion 31 32 and 3.03 colonisations from Reunion to Mauritius (mean difference 5.94 colonisations, 33 95% CI = 5.92 to 5.95, t = 665.9, df = 999, p < 0.0001). Colonisations of Mauritius from 34 Reunion are inferred to be significantly younger than those of Reunion from Mauritius 35 (mean difference = -1.07 Ma, 95% CI = -1.10 to -0.1.04 Ma, t = -66.0, df = 999, p < 36 0.0001). Colonisation events to Mauritius are inferred to be significantly younger than 37 in situ speciation events (mean difference = -2.19 Ma, 95% CI = -2.22 to -2.16 Ma, t = - 38 120.3, df = 999, p < 0.0001). In situ speciation events on Reunion are inferred to be 39 significantly younger than colonisation events (mean difference = -0.097 Ma, 95% CI = - 40 0.116 to -0.078 Ma, t = -10.275, df = 999, p < 0.0001). Statistical analyses of node ages 41 indicate that nodes leading to flight loss are significantly younger than other nodes 42 43 (mean difference = -1.327 Ma, 95% CI = -1.344 to -1.1.308 Ma, t = -146.7, df = 999, p < 44 0.0001) indicating that flight loss is a relatively recent phenomenon within this group, 45 or alternatively that flightless lineages show high extinction rates. 46 47 48 49 DISCUSSION 50 51 Biogeography of Southwest Indian Ocean cratopine weevils 52 In addition to addressing our hypotheses, the phylogenetic analyses provide an 53 overview of the colonisation dynamics that has given rise to the diversity of cratopine 54 weevils in the islands of the Southwest Indian Ocean. Rodrigues has been colonised 55 twice, as have both the Seychelles and Comoros archipelagos. The more recent 56 colonisation of both the Seychelles and Comoros archipelagos also involves 57 58 59 60 11 Journal of Biogeography Page 18 of 45
1 2 3 colonisations of the islands to the northeast (Aldabra and Grande Glorieuse) and 4 southwest (Juan de Nova and Europa) of the Comoros archipelago with an apparent 5 source on Reunion. The older colonisation of both archipelagos is inferred to be from 6 Rodrigues. Warren et al. (2010) have described how sea level changes in the Indian 7 Ocean over at least the last five million years would have exposed many now submerged 8 islands of the Mascarene plateau. Thus stepping stone islands are likely to have been 9 intermittently present over much of the evolutionary history of the cratopine weevils, 10 11 potentially providing routes for dispersal between the granitic Seychelles, the Comoros 12 and Rodrigues. 13 The estimated colonisation times for Rodrigues are significantly older than its 14 presumed age. The 1.5 Ma age for Rodrigues suggested by McDougall et al. (1965) and 15 based on the oldest exposed lavas falls outside the 95% HPD interval for both 16 colonisation events. Additionally, all three speciation events within Rodrigues are 17 estimated to significantly predate 1.5 Ma. It may be that our mutation rate 18 overestimates divergence times within the Cratopini, but it has previously been 19 suggested that RodriguesFor is much Peer older than Review 1.5 Ma (Thébaud et al., 2009; Warren et al., 20 21 2013; Strijk et al., 2014), and the estimates of McDougal et al. (1965) do not sample 22 older buried strata, nor take into account those removed by extensive erosion 23 (Montaggioni & Nativel, 1988). 24 All nodes inferred as having their most probable location on Mauritius are either 25 younger than or have confidence intervals that include the 8.9 Ma provided by Moore et 26 al. (2011). While the oldest nodes involving Reunion are much older than the 2.0 Ma age 27 for the oldest lavas sampled on Reunion (McDougall, 1971), all but one are consistent 28 with the maximum 5 Ma inferred using methods other than radiometric dating of lavas 29 (Bonneville et al., 1988). While estimates of molecular rate and island age may hold 30 some explanation for this single difference, no speciation events within Reunion exceed 31 32 its 5 Ma age estimate. An alternative explanation is that colonisation time is 33 overestimated due to unsampled or extinct taxa from Mauritius. 34 35 Island age, community assembly and species turnover 36 Biogeographic inference of ancestral areas supports the hypothesis that in situ 37 speciation has contributed more to cratopine species richness on the older island of 38 Mauritius than it has on the younger island of Reunion. Our inferences regarding the 39 origins of species diversity are dependent on our OTUs being equivalent to species. 40 Comparison of our OTUs with the most recent taxonomic treatise (e.g. Williams & Cox, 41 2003) support this inference, with recently-defined species corresponding with our 42 43 OTUs. Our first prediction that colonising species to Mauritius should have lower 44 persistence times, compared to those colonising Reunion, is supported by the statistical 45 analysis of node ages. Mauritius is characterised by older in situ speciation events, with 46 younger colonising lineages, supporting prediction two. With regard to Reunion, 47 likelihood inferences suggest that species origin by colonisation has been more 48 predominant in the history of the island, with the contribution of in situ speciation 49 appearing in only a small subset of lineages present on the island, supporting prediction 50 three. 51 Results are largely consistent with the expectation that the contribution of 52 colonisation to community assembly is more important in the early stages of assembly, 53 54 with speciation assuming a more dominant role as community assembly gives way to a 55 dynamic of species turnover (Emerson & Oromí, 2005; Emerson & Gillespie, 2008), 56 which is expected under the equilibrium model (Heaney, 2007). Over evolutionary time, 57 58 59 60 12 Page 19 of 45 Journal of Biogeography
1 2 3 it appears that niche space within an island becomes occupied by colonising species. 4 Newly arriving species are less able to establish and remaining niche space becomes 5 increasingly likely to be colonised by resident species through in situ speciation, as are 6 niches that may become vacant through extinction (Emerson & Oromí, 2005; Emerson & 7 Gillespie, 2008). 8 9 Polyphyly of Cratopopsis and loss of flight capability 10 11 Our data demonstrate that the genera Cratopus and Cratopopsis are not monophyletic 12 (Fig. 2), with at least three independent instances of the Cratopopsis morphology 13 evolving convergently within Cratopus. Cratopopsis species mainly differ from Cratopus 14 by a lack of wings and a characteristically-shaped reduced thorax that is probably 15 associated with a loss of flight musculature. This pattern is seen more widely in the 16 tribe with at least two further flight loss events (in C. murinus and Scaevinus) and the 17 number of events may be higher, as two flightless Indian Ocean cratopine weevils were 18 not sampled (C. triangularis from Mauritius and Cr. matilei from Anjouan). A number of 19 authors have arguedFor that there Peer are benefits Review to flightlessness, such as energetic savings 20 21 and increased reproductive output (Roff, 1990), and selection against dispersal has also 22 been hypothesised for organisms inhabiting limited habitat patches (Harrison, 1980). A 23 tendency toward flightlessness is part of a wider pattern seen in beetles on islands, with 24 examples from many archipelagos [e.g Rhyncogonus of Polynesia (Samuelson, 2003), 25 Laparocerus of Macaronesia (Machado et al., 2008)]. While there has been repeated 26 selection for flightlessness within the Cratopini of the Indian Ocean, our statistical 27 analysis of node ages indicates that flightless lineages are significantly younger than 28 flighted lineages. Rather than flight loss being a recent phenomenon within this group, 29 we speculate that it is more likely to be a recurrent phenomenon, but characterised by a 30 higher per species extinction probability for flightless species than flighted species. 31 32 33 34 CONCLUSIONS 35 36 Phylogenetic reconstruction and ancestral area inference indicate that the extensive 37 radiation of Cratopine weevils across the islands of the Indian Ocean has occurred 38 within the last 10 million years, with the earliest diversification events inferred to have 39 occurred on the island of Mauritius. Geographic inferences for colonisation and 40 speciation on the species rich islands of Mauritius and Reunion are consistent with 41 predictions from equilibrium theory regarding species turnover, when extended to 42 incorporate speciation. Compared to Mauritius, colonisation is found to have 43 contributed more to species richness on Reunion, consistent with its younger geological 44 age and earlier stage of community assembly. In contrast, much of the species richness 45 46 on the older island of Mauritius is consistent with a more mature community dynamic 47 where turnover is dominated by in situ speciation of already established lineages. These 48 data offer support for a model where island community assembly is initially dominated 49 by colonisation, but where in the later stages of an island life-cycle, turnover is more 50 likely to involve species replacement by speciation within the island, rather than 51 colonisation from an external source. 52 53 54 55 56 57 58 59 60 13 Journal of Biogeography Page 20 of 45
1 2 3 TABLES 4 5 Table 1: Statistical comparison of biogeographic models tested. Relative model 6 probability indicates that DEC+J+X is the best fit model for the data. 7 8 Number of Relative model LnL d e j x AICc ΔAICc 9 parameters probability 10 DEC+J+X -82.62 4 1.00E-12 1.00E-12 0.0061 -1.72 174 0 1 11 12 DIVALIKE+J+X -85.42 4 1.00E-12 0.78 0.0088 -1.41 179.6 5.59 0.061 13 BAYAREALIKE+J+X -88.03 4 0.0000001 1.21 0.0061 -1.77 184.8 10.81 0.0045 14 DIVALIKE+J -102.4 3 1.00E-12 1.00E-12 0.033 0 211.3 37.26 8.10E-09 15 BAYAREALIKE+J -106.5 3 0.0000001 0.58 0.035 0 219.5 45.5 1.30E-10 16 17 DEC+J -109.3 3 1.00E-12 1.72 0.034 0 225.1 51.06 8.20E-12 18 DIVALIKE+X -121.8 3 0.15 0.0000013 0 -1.29 250 76 3.10E-17 19 DIVALIKE -137.8 For2 Peer 0.63 1.00E-12 Review 0 0 279.8 105.8 1.10E-23 20 21 DEC+X -137.8 3 0.16 2.66 0 -1.37 282.1 108.1 3.30E-24 22 DEC -154.9 2 0.83 5 0 0 314.1 140.1 3.80E-31 23 BAYAREALIKE+X -173.5 3 0.26 5 0 -1.15 353.5 179.5 1.00E-39 24 BAYAREALIKE -225.3 2 0.38 0.98 0 0 454.7 280.7 1.10E-61 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 14 Page 21 of 45 Journal of Biogeography
1 2 3 4 5 6 FIGURES 7 8 9 10 11 12 13 14 15 16 17 18 19 For Peer Review 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 Fig. 1. The islands of the Southwest Indian Ocean area, with ages where known. 53 Additionally marked is the Mascarene plateau, an area of shallow water that is likely to 54 have been exposed multiple times during glacial periods. 55 56 57 58 59 60 15 Journal of Biogeography Page 22 of 45
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 For Peer Review 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 Fig. 2. The estimated biogeographic history of Cratopine weevils as inferred by 37 BioGeoBEARS under the DEC+J+X model using the BEAST2 MCC chronogram. Pie charts 38 on nodes represent the relative probabilities of the inferred geographic range of the 39 ancestral taxon represented by the node. Empty boxes on nodes represent inferred 40 colonisations of Reunion from Mauritius while black boxes on nodes represent inferred 41 colonisations of Mauritius from Reunion. Taxa with * after their label are flightless. 42
43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 16 Page 23 of 45 Journal of Biogeography
1 2 3 REFERENCES 4 5 Alonso-Zarazaga, M.A. & Lyal, C.H.C. (1999) A world catalogue of families and genera of 6 Curculionoidea (Insecta: Coleoptera)(excepting Scolytidae and Platypodidae). Entomopraxis, 7 Barcelona. 8 9 Bonneville, A., Barriot, J.P., & Bayer, R. (1988) Evidence from geoid data of a hotspot origin for 10 the southern Mascarene Plateau and Mascarene Islands (Indian Ocean). Journal of 11 Geophysical Research, [Solid Earth], 93, 4199–4212. 12 13 Bouckaert, R., Heled, J., Kühnert, D., Vaughan, T., Wu, C.-H., Xie, D., Suchard, M.A., Rambaut, A., & 14 Drummond, A.J. (2014) BEAST 2: a software platform for Bayesian evolutionary analysis. 15 PLoS computational biology, 10, e1003537. 16 17 Burnham, K.P. & Anderson, D.R. (2002) Model Selection and Multimodel Inference: a Practical 18 Information-Theoretic Approach. Springer, New York. 19 Casquet, J., Bourgeois, Y.X.C.,For Cruaud, Peer C., Gavory, Review F., Gillespie, R.G., & Thébaud, C. (2015) 20 Community assembly on remote islands: a comparison of Hawaiian and Mascarene spiders. 21 Journal of biogeography, 42, 39–50. 22 23 Cicconardi, F., Nardi, F., Emerson, B.C., Frati, F., & Fanciulli, P.P. (2009) Deep phylogeographic 24 divisions and long-term persistence of forest invertebrates (Hexapoda: Collembola) in the 25 North-Western Mediterranean basin. Molecular ecology, 19, 386–400. 26 27 Darriba, D., Taboada, G.L., Doallo, R., & Posada, D. (2012) jModelTest 2: more models, new 28 heuristics and parallel computing. Nature methods, 9, 772. 29 30 Emerson, B.C. & Gillespie, R.G. (2008) Phylogenetic analysis of community assembly and 31 structure over space and time. Trends in ecology & evolution, 23, 619–630. 32 33 Emerson, B.C. & Kolm, N. (2005) Species diversity can drive speciation. Nature, 434, 1015– 34 1017. 35 36 Emerson, B.C. & Oromí, P. (2005) Diversification of the forest beetle genus Tarphius on the 37 Canary Islands, and the evolutionary origins of island endemics. Evolution; international 38 journal of organic evolution, 59, 586–598. 39 40 Faria, C., Machado, A., Amorim, I.R., Gage, M.J.G., Borges, P.A.V., & Emerson, B.C. (2016) Evidence 41 for multiple founding lineages and genetic admixture in the evolution of species within an 42 oceanic island weevil (Coleoptera, Curculionidae) super-radiation. Journal of biogeography, 43 43, 178–191. 44 45 Harrison, R.G. (1980) Dispersal Polymorphisms in Insects. Annual review of ecology and 46 systematics, 11, 95–118. 47 Heaney, L.R. (2007) Is a new paradigm emerging for oceanic island biogeography? Journal of 48 49 biogeography, 34, 753–757. 50 Huelsenbeck, J.P. & Ronquist, F. (2001) MRBAYES: Bayesian inference of phylogenetic trees. 51 Bioinformatics , 17, 754–755. 52 53 Hustache, A. (1919) Synopsis des Curculionides de la faune malgache. I. Brachydérides et 54 Otiorrhynchides. Annales de la Societe entomologique de France. Societe entomologique de 55 France, 87, 441–520. 56 57 58 59 60 17 Journal of Biogeography Page 24 of 45
1 2 3 Ikeda, H., Nishikawa, M., & Sota, T. (2012) Loss of flight promotes beetle diversification. Nature 4 communications, 3, 648. 5 6 Katoh, K., Misawa, K., Kuma, K.-I., & Miyata, T. (2002) MAFFT: a novel method for rapid multiple 7 sequence alignment based on fast Fourier transform. Nucleic acids research, 30, 3059– 8 3066. 9 10 Kitson, J.J.N., Warren, B.H., Florens, F.B.V., Baider, C., Strasberg, D., & Emerson, B.C. (2013) 11 Molecular characterization of trophic ecology within an island radiation of insect 12 herbivores (Curculionidae: Entiminae: Cratopus). Molecular ecology, 22, 5441–5455. 13 Landis, M.J., Matzke, N.J., Moore, B.R., & Huelsenbeck, J.P. (2013) Bayesian analysis of 14 biogeography when the number of areas is large. Systematic biology, 62, 789–804. 15 16 MacArthur, R.H. & Wilson, E.O. (1963) An Equilibrium Theory of Insular Zoogeography. 17 Evolution; international journal of organic evolution, 17, 373–387. 18 19 MacArthur, R.H. & Wilson,For E.O. (1967) Peer The Theory Review of Island Biogeography. Princeton University 20 Press, 21 22 Machado, A., López, M., Almeida, T., & Hernández, M. (2008) Mitochondrial DNA phylogenetic 23 analysis of the genus Laparocerus (Coleoptera: Curculionidae: Entiminae). I. The Madeiran 24 clade. Zoologica scripta, 37, 415–427. 25 26 Matzke, N.J. (2013) Probabilistic historical biogeography: new models for founder-event 27 speciation, imperfect detection, and fossils allow improved accuracy and model-testing. 28 Frontiers of Biogeography, 5, 242–248. 29 30 Matzke, N.J. (2014) Model selection in historical biogeography reveals that founder-event 31 speciation is a crucial process in Island Clades. Systematic biology, 63, 951–970. 32 33 McDougall, I. (1971) Geochronology and evolution of the young volcanic island of Reunion, 34 Indian Ocean. Geochimica et cosmochimica acta, 35, 261–&. 35 36 McDougall, I., Upton, B.G.J., & Wadsworth, W.J. (1965) A geological reconnaissance of Rodriguez 37 Island, Indian Ocean. Nature, 206, 26–27. 38 39 Medeiros, M.J. & Gillespie, R.G. (2011) Biogeography and the evolution of flightlessness in a 40 radiation of Hawaiian moths (Xyloryctidae: Thyrocopa). Journal of biogeography, 38, 101– 41 111. 42 Meseguer, A.S., Aldasoro, J.J., & Sanmartín, I. (2013) Bayesian inference of phylogeny, 43 morphology and range evolution reveals a complex evolutionary history in St. John’s wort 44 (Hypericum). Molecular phylogenetics and evolution, 67, 379–403. 45 46 Montaggioni, L.F. & Nativel, P. (1988) La Reunion, Ile Maurice: Geologie et apercus biologiques, 47 plantes et animaux. Masson, France. 48 49 Moore, J., White, W.M., Paul, D., Duncan, R.A., Abouchami, W., & Galer, S.J.G. (2011) Evolution of 50 shield-building and rejuvenescent volcanism of Mauritius. Journal of Volcanology and 51 Geothermal Research, 207, 47–66. 52 53 Nylander, J.A.A., Wilgenbusch, J.C., Warren, D.L., & Swofford, D.L. (2007) AWTY (are we there 54 yet?): a system for graphical exploration of MCMC convergence in Bayesian phylogenetics. 55 Bioinformatics , 24, 581–583. 56 57 58 59 60 18 Page 25 of 45 Journal of Biogeography
1 2 3 Rambaut, A. & Drummond, A.J. (2007) Tracer v1.5.0 available from 4 http://tree.bio.ed.ac.uk/software/tracer/. 5 6 R Development Core Team (2017) R: A Language and Environment for Statistical Computing. R 7 Foundation for Statistical Computing, Vienna, Austria., 8 9 Ree, R.H. & Sanmartin, I. (2018) Conceptual and statistical problems with the DEC+J model of 10 founder-event speciation and its comparison with DEC via model selection. Journal of 11 biogeography, . 12 Ree, R.H. & Smith, S.A. (2008) Maximum likelihood inference of geographic range evolution by 13 dispersal, local extinction, and cladogenesis. Systematic biology, 57, 4–14. 14 15 Roff, D.A. (1990) The evolution of flightlessness in insects. Ecological monographs, 60, 389–421. 16 17 Ronquist, F. & Cannatella, D. (1997) Dispersal-Vicariance Analysis: A New Approach to the 18 Quantification of Historical Biogeography. Systematic biology, 46, 195–203. 19 For Peer Review 20 Samuelson, G.A. (2003) Review of Rhyncogonus of the Hawaiian Islands. Bishop Museum 21 Bulletins in Entomology, 11, 1–107. 22 23 Sattler, K. (1991) A review of wing reduction in Lepidoptera. Bulletin of the British Museum, 60, . 24 25 Stamatakis, A., Hoover, P., & Rougemont, J. (2008) A rapid bootstrap algorithm for the RAxML 26 Web servers. Systematic biology, 57, 758–771. 27 28 Strijk, J.S., Bone, R.E., Thébaud, C., Buerki, S., Fritsch, P.W., Hodkinson, T.R., & Strasberg, D. 29 (2014) Timing and tempo of evolutionary diversification in a biodiversity hotspot: 30 Primulaceae on Indian Ocean islands. Journal of biogeography, 41, 810–822. 31 32 Thébaud, C., Warren, B.H., Strasberg, D., & Cheke, A. (2009) Mascarene Islands, biology. 33 Encyclopedia of Islands (ed. by R.G. Gillespie and D.A. Clague), pp. 612–619. University of 34 California Press, Berkeley. 35 36 Van Dam, M.H. & Matzke, N.J. (2016) Evaluating the influence of connectivity and distance on 37 biogeographical patterns in the south-western deserts of North America. Journal of 38 biogeography, 43, 1514–1532. 39 Voisin, J.-F. & Poussereau, J. (2009) A propos de Cratopus nanus et de Cratopus parvus de l’île de 40 la Réunion (Coleoptera, Curculionidae). Nouvelle Revue d’Entomologie, 26, 59–65. 41 42 Warren, B.H., Safford, R.J., Strasberg, D., & Thébaud, C. (2013) Bird biogeography and evolution 43 in the Malagasy region. The Birds of Africa: Volume VIII: The Malagasy Region: Madagascar, 44 Seychelles, Comoros, Mascarenes (ed. by R. Safford, F. Hawkins, and J. Gale), pp. 35–36. A&C 45 Black, London. 46 47 Warren, B.H., Strasberg, D., Bruggemann, J.H., Prys-Jones, R.P., & Thébaud, C. (2010) Why does 48 the biota of the Madagascar region have such a strong Asiatic flavour? Cladistics: the 49 international journal of the Willi Hennig Society, 26, 526–538. 50 51 Whittaker, R.J., Triantis, K.A., & Ladle, R.J. (2008) A general dynamic theory of oceanic island 52 biogeography. Journal of biogeography, 35, 977–994. 53 54 Williams, J.R. (2000) A revision of the Mascarene weevil genus Syzygops Schonherr (Coleoptera 55 : Curculionidae : Entiminae). Invertebrate Taxonomy, 14, 411–432. 56 57 58 59 60 19 Journal of Biogeography Page 26 of 45
1 2 3 Williams, J.R. & Cox, M.L. (2003) A contribution to the study of Mascarene Weevils of the genus 4 Cratopus Schonherr (Coleoptera: Curculionidae: Entiminae: Cratopini): The species of 5 Mauritius and Rodrigues. The Mauritius Institute Bulletin, 12, 1–67. 6 7 Wright, N.A., Steadman, D.W., & Witt, C.C. (2016) Predictable evolution toward flightlessness in 8 volant island birds. Proceedings of the National Academy of Sciences of the United States of 9 America, 113, 4765–4770. 10 11 Xia, X., Xie, Z., Salemi, M., Chen, L., & Wang, Y. (2003) An index of substitution saturation and its 12 application. Molecular phylogenetics and evolution, 26, 1–7. 13 Yu, G., Smith, D.K., Zhu, H., Guan, Y., & Lam, T.T.-Y. (2017) ggtree: an r package for visualization 14 and annotation of phylogenetic trees with their covariates and other associated data. 15 Methods in ecology and evolution, 8, 28–36. 16 17 18 19 For Peer Review 20 BIOSKETCH 21 22 JJNK undertook most of the beetle sampling and performed all the laboratory work and 23 data analyses. BHW and DS contributed to the fieldwork. JJNK and BCE wrote the 24 manuscript. All authors discussed the results and commented on the manuscript. This 25 project was conceived by BCE, DS and CT. It was supervised primarily by BCE and 26 secondarily by BHW. 27 28 SUPPORTING INFORMATION 29 30 Additional Supporting Information may be found in the online version of this article: 31 Appendix S1: Molecular methods and results for definition of OTUs. 32 Appendix S2: Gene trees and summary information for each locus used in the main 33 phylogeny. 34 35 GitHub repository: https://github.com/James-Kitson/Biogeography
N N Aride 1 Grande Comore (0.13±0.02 Ma) Cousin 2 3 Cousine Praslin Anjouan La Digue 4 (~11.5 Ma) 5 Sillhouette 6 The Seychelles are considered to have split from India ~ 64 Ma 7 8 Moheli Mayotte 9 (5.0±0.4 Ma) (7.7±1.0 Ma) 10 Mahe 11 0 10 mi 12 0 20 mi 10 km 13 20 km 14 For Peer Review 15 16 17 18 19 20 21 The Seychelles 22 23 Africa 24 Aldabra T h 25 e Grande Glorieuse M
26 a s 27 c a 28 r e 29 n The Comoros e
30 p
l l a
ne 31 n t
ha e c a
32 e u u Rodrigues 33 iq b (1.54±0.05 Ma) m 34 Juan de Nova a z Mauritius 35 o M (8.9±0.17 Ma) 36 Europa 37 (~0.08 Ma) 38 Madagascar The Mascarenes N 39 Reunion 40 (~5 Ma) 41 0 250 500km 42 Indian Ocean 0 150 300mi 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Journal of Biogeography Page 28 of 45
1 2 3 4 5 6 7 8 9 10 11 12 Polyclaeis equestris (Madagascar) Cratopus variegatus (Mauritius) 13 Cratopus bernei (Reunion) Scaevinus subtruncatus (Mauritius) 14 Scaevinus dombayae (Reunion) * 15 Cratopus LaDigue_sp1 (La Digue) * Cratopus Mahe_sp1 (Mahe) 16 Cratopus segregatus (Praslin) ● Cratopus aurostriatus (La Digue) 17 Cratopus subdenudatus (Grande Comore) Cratopus Anjouan_sp1 (Anjouan) 18 Clade 1 ● Cratopus Anjouan_sp2 (Anjouan) 19 Cratopus inornatus (Rodrigues) Cratopus rocki (Rodrigues) 20 ● Cratopopsis pauliani (Rodrigues) 21 For Peer Review Cratopus septemvittatus (Reunion)* Cratopus melanocephalus (Mauritius) Clade 2a 22 Cratopus exquisitus (Reunion) Cratopus virescens (Rodrigues) 23 Cratopus viridipunctatus (Rodrigues) 24 Cratopus fasciger (Mauritius) Cratopus nothus (Mauritius) 25 Cratopus aeneoniger group (Mauritius) Cratopus brunnipes (Reunion) 26 Cratopus striga (Mauritius) 27 Cratopopsis bistigma (Reunion) Mauritius Cratopopsis group * 28 Cratopus cariei (Mauritius) * Cratopus mundulus (Mauritius) 29 Cratopus nigridorsis group (Reunion) Clade 2b 30 Cratopus armatus (Mauritius) Cratopus viridilimbatus (Mauritius) 31 Cratopus frappieri (Reunion) Cratopus nigrogranatus (Mauritius) 32 Cratopus murinus (Reunion) 33 Cratopus murinus (Mauritius) * Cratopus ovalis (Mauritius) 34 Cratopus psittacus (Mauritius) ● Cratopus molitor (Mauritius) 35 Cratopus caliginosus (Mauritius) 36 Reunion Cratopopsis group Madagascar Cratopus humeralis group (Reunion)* 37 Madagascar/Mauritius ● Cratopus ditissimus (Reunion) ● Cratopus nanus (Reunion) 38 Mauritius Cratopus Moheli_sp1 (Moheli) 39 Reunion Cratopus punctum (Reunion) Rodrigues Cratopus punctum (Mauritius) 40 Europa Cratopus GrandeComore_sp1 (Grande Comore) Cratopus gloriosus (Grande Glorieuse) 41 Grande Glorieuse Cratopus adspersus (Juan de Nova) Clade 2c 42 Moheli Cratopus viridisparsus (Europa) Anjouan Cratopus griseovestitus (Aldabra) 43 Cratopus griseovestitus (Silhouette) Grande Comore Cratopus griseovestitus (La Digue) 44 Juan de Nova Cratopus griseovestitus (Cousin Island) 45 Aldabra Cratopus griseovestitus (Cousine Island) Seychelles Cratopus griseovestitus (Aride Island) 46 ● Cratopus viridsparsus (Aldabra) 47 ● ● ● 48 49 50 51 12 10 8 6 4 2 0 52 Time (Millions of years ago) 53 54 55 56 57 58 59 60 Page 29 of 45 Journal of Biogeography
1 2 3 Journal of Biogeography 4 5 6 SUPPORTING INFORMATION 7 8 9 Community assembly and diversification in a species-rich radiation of island weevils 10 (Coleoptera: Cratopini) 11 12 James J. N. Kitson, Ben H. Warren, Christophe Thébaud, Dominique Strasberg and Brent C. 13 Emerson 14 15 16 Appendix S1: Methods and results for molecular methods 17 18 and OTU definitions used in the main manuscript. 19 20 21 S1.1 Introduction For Peer Review 22 The purpose of the methods and results presented here is to describe methods used to define 23 the operational taxonomic units (OTUs) used for figure 2 in the main manuscript and to give 24 further detail in the molecular methods used throughout. 25 26 27 S1.2 Study sites and reference list used for the identification of samples 28 29 Specimens were collected from the islands of the Southwest Indian Ocean by foliage beating 30 during wet seasons between June 2007 and December 2011. Samples were placed directly in 31 99% ethanol. Sampling sites were recorded with handheld GPS units. Samples were identified to 32 taxonomic species using morphological keys for Cratopus and Cratopopsis provided by Jaques 33 Poussereau (unpublished work) and the original descriptions of most species (Hustache 1919, 34 1920; Richard 1957, 1958, 1961, 1977, 1995a, b; Vinson 1967; Ferragu & Richard 1990, 1993; 35 Williams & Cox 2003; Voisin & Poussereau 2007a, b, 2009; Poussereau & Voisin 2009; Galman 36 et al. 2011). Once identified, up to five individuals of each taxonomically described species were 37 chosen from every site in which they were collected. See table S1.2.1 for locality information. 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Journal of Biogeography Page 30 of 45
1 2 3 Table S1.2.1: GPS co-ordinates for localities used in this study 4 Island Site Latitude Longtitude 5 6 La Réunion Basse Vallee -21.3510 55.7020 7 La Réunion Bayonne -21.2210 55.4630 8 9 La Réunion Bois Ozoux -21.1980 55.6480 10 La Réunion Cap Blanc -21.2770 55.6610 11 12 La Réunion Cap Jaune -21.3780 55.6770 13 La Réunion Cap Mechant -21.3760 55.7090 14 La Réunion Cascade du Chien -21.0330 55.6100 15 16 La Réunion Col de Bellevue -21.1660 55.5910 17 La Réunion Colorado -20.9050 55.4280 18 19 La Réunion Etang du Gol -21.2840 55.3910 20 La Réunion Etang St Paul -20.9960 55.2950 21 For Peer Review La Réunion Foret de Bebour -21.1200 55.5680 22 23 La Réunion Foret de Bel Air -21.3070 55.6020 24 La Réunion Foret de Tevelave -21.1840 55.3750 25 26 La Réunion Foret dominale de la cote sous le Vent -21.2820 55.3630 27 La Réunion Foret dominale Notre Dame de la Paix -21.2640 55.6030 28 La Réunion Foret du Volcane -21.2060 55.6050 29 30 La Réunion Grand Etang -21.0960 55.6490 31 La Réunion Grande Coude -21.2780 55.6310 32 33 La Réunion Gros Piton Rond -21.1550 55.5980 34 La Réunion Hell Bourg -21.0730 55.5210 35 La Réunion La Ravine de la Grande Chaloupe -20.9280 55.3880 36 37 La Réunion Le Block -21.1310 55.4950 38 La Réunion Le Maido -21.0700 55.3870 39 40 La Réunion Le Tampon -21.2810 55.5170 41 La Réunion Les Makes -21.1850 55.4330 42 43 La Réunion Mare Longue -21.3500 55.7430 44 La Réunion Nez de Boeuf -21.2030 55.6190 45 La Réunion Pic Adam -20.9460 55.4650 46 47 La Réunion Piton de Grande Anse -21.3730 55.5510 48 La Réunion Piton de l'eau -21.1750 55.6850 49 50 La Réunion Piton Desforges -21.1960 55.5750 51 La Réunion Piton Enchaing -21.0440 55.5000 52 La Réunion Piton Hyacinthe -21.2180 55.5370 53 54 La Réunion Piton Mahot -21.2250 55.5860 55 La Réunion Piton Textor -21.1850 55.6310 56 57 La Réunion Plaine d'Affouches -20.9830 55.4030 58 La Réunion Plaine des Chicots -20.9800 55.4460 59 La Réunion Plaine des Fougiers -20.9800 55.5050 60 Page 31 of 45 Journal of Biogeography
1 2 3 La Réunion Plaine des Gregues -21.3260 55.6100 4 5 La Réunion Plaine des Lianes -21.0540 55.5760 6 La Réunion Plaine des Tamarinds -21.0790 55.4430 7 8 La Réunion Ravine Jean Payet -21.2970 55.5270 9 La Réunion Route de Plaine de les Fougiers -20.9800 55.5220 10 La Réunion Route des Tamarinds -21.0590 55.3660 11 12 La Réunion Route forrestiere du Maido -21.0566 55.3634 13 La Réunion Sentier Trophee Mondial -21.2000 55.4930 14 15 La Réunion Site Dior -20.9990 55.5670 16 La Réunion Takamaka -21.0940 55.6090 17 La Réunion Trois Bassins -21.1180 55.3610 18 19 La Réunion Vallee Heureuse -21.3290 55.6970 20 La Réunion Volcano -21.2180 55.6870 21 For Peer Review 22 Mauritius Brise Fer -20.3780 57.4420 23 Mauritius Camp -20.3756 57.4441 24 Mauritius Camp Thorel -20.2090 57.6390 25 26 Mauritius Chamarel -20.4300 57.3740 27 Mauritius Corps de Garde -20.2490 57.4510 28 29 Mauritius Ebony Forest -20.4317 57.3727 30 Mauritius Florin unknown unknown 31 32 Mauritius Gorges -20.4040 57.4320 33 Mauritius Ile Marianne -20.3800 57.7870 34 Mauritius Ille aux Vacoas -20.3980 57.7700 35 36 Mauritius Ille de la Passe -20.3990 57.7670 37 Mauritius Illot Sancho -20.5040 57.4490 38 39 Mauritius Kanaka -20.4060 57.5190 40 Mauritius Le Pouce -20.1980 57.5290 41 Mauritius L'Etoiles -20.3230 57.6700 42 43 Mauritius Lion Mountain -20.3620 57.7250 44 Mauritius Machabee -20.3960 57.4560 45 46 Mauritius Mondrain -20.3250 57.4550 47 Mauritius Montagne Camizard -20.3360 57.7150 48 Mauritius Montagne Cocotte -20.4400 57.4670 49 50 Mauritius Montagne de Belle Ombre -20.4670 57.4170 51 Mauritius Petrin -20.4080 57.4730 52 53 Mauritius Pidgeon wood -20.4410 57.4870 54 Mauritius Plaine Champagne -20.4190 57.4450 55 Mauritius Plaine des Roches -20.1237 57.7423 56 57 Mauritius Pointe de Roche Noire -20.1089 57.7462 58 Mauritius Roches Noires -20.1055 57.7323 59 60 Mauritius Round Island -19.8520 57.7880 Journal of Biogeography Page 32 of 45
1 2 3 Mauritius Seama Beach -20.3550 57.3610 4 5 Mauritius Snail Rock -20.1920 57.5070 6 Mauritius Souillac -20.5250 57.5280 7 8 Mauritius Trois Marmelles -20.3130 57.4490 9 Mauritius Vallee de l'est -20.3320 57.7260 10 Mauritius Yemen -20.2990 57.4110 11 12 Rodrigues Grande Montagne -19.7052 63.4659 13 Rodrigues Ille aux cocos -19.7213 63.2998 14 15 Rodrigues Montagne Limon -19.7057 63.4459 16 Rodrigues Montagne Maractic -19.7124 63.4336 17 Rodrigues Montagne Persil -19.7014 63.4523 18 19 Rodrigues Riviere Mourouk -19.7264 63.4607 20 21 For Peer Review 22 23 S1.3 DNA extraction, PCR amplification and sequencing for the definition of 24 OTUs 25 DNA was extracted from the head and pronotum using the DNeasy 96 well Blood and Tissue 26 Extraction kit (QIAGEN, West Sussex, UK) with the digestion buffer volumes amended for large 27 28 specimens as recommended by the manufacturer. The primers COIICraF and COIICraR (see 29 Table S1.6.1) were used to amplify the mitochondrial gene Cytochrome Oxidase II (COII). 30 Amplification conditions were; 0.5 mM of each primer, 5 mM MgCl2 and a thermal profile of: 31 95°C for 60s, 58°C for 60s and 72°C for 90s, 40 cycles. 32 33 Sequencing reactions were performed with the Big Dye Terminator v3.1 Cycle Sequencing kit 34 (Applied Biosystems, California, USA). COIICraF was used for forward sequencing and COIICraR 35 was used for reverse sequencing when forward sequences of less than 600bp were produced. 36 When reverse sequencing was employed, the consensus of each pair of forward and reverse 37 sequences was generated in Geneious Pro version 5.6 (Drummond et al. 2012). The thermal 38 profile used for sequencing reactions was: 96°C for 10s, 58°C for 5s and 60°C for 240s, 25 cycles. 39 Sequences were read on a 3730XL sequencer (Applied Biosystems). All sequences were checked 40 in Geneious Pro version 5.4. Sequences were aligned using MAFFT v6.814b (Katoh et al. 2002) 41 with the following parameter values: scoring matrix 1PAM/k=2, Gap open penalty = 1.53, Offset 42 43 value = 0.123, and then checked by eye. 44 45 46 S1.4 Phylogenetic analyses and definition of OTUs 47 A maximum likelihood tree was generated using RAxML version 7.7.1 (Stamatakis et al. 2008) 48 49 using RAxML BlackBox (https://embnet.vital-it.ch/raxml-bb/index.php) to assess the clustering 50 of individuals with respect to their taxonomic assignment. Operational taxonomic units were 51 defined as the minimal monophyletic group containing samples belonging to a single 52 taxonomically described species or set of taxonomically described species. For example, if any 53 single taxonomically described species was paraphyletic with regard to mtDNA relationships 54 among individuals then a monophyletic OTU was created from all other taxonomically described 55 species sharing the same common ancestor as the paraphyletic species. In this way, the OTUs 56 represent taxonomic uncertainty, with the objective of underestimating rather than 57 overestimating species number. 58 59 60 Page 33 of 45 Journal of Biogeography
1 2 3 S1.5 Results for definition of OTUs 4 5 Of the 915 beetles selected for sequencing, 909 were successfully amplified and sequenced for 6 COII with 397 samples that required reverse sequencing (a 99.3% success rate) yielding 7 sequences from 536bp to 663bp with a mean length of 653.1bp and a standard deviation of 8 19.0bp. Five hundred and ninety-seven unique sequences were recovered from across 76 9 taxonomically described species with an average pairwise p-distance of 14.0%, a maximum of 10 24.0% and a standard deviation of 3.5%. Figure S1.5.1 shows the Maximum Likelihood tree 11 generated with samples colour coded by island. Yellow stars have been used to indicate samples 12 of C. caliginosus that are recovered within the C. murinus clade and separately from the 13 remaining C. caliginosus samples. As these taxonomically described species are distinct from 14 15 each other, misidentification of the samples is unlikely. The position of these C. caliginosus 16 samples may be due to hybridisation between C. caliginosus and C. murinus but further nuclear 17 markers would be necessary in order to confirm this. The identified OTUs are mapped on to 18 figure S1.5.2. 19 20 21 For Peer Review 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Journal of Biogeography Page 34 of 45
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Outgroup Naupactus xanthographus (GenBank (GU176345.1)) 26 T−Reu 3785 Scaevinus dombayae (Plaine des Fougiers−Reunion) 27 T−Reu 2431 Scaevinus dombayae (Plaine des Fougiers−Reunion) T−Reu 2318 Scaevinus dombayae (Bayonne−Reunion) 28 T−Reu 2323 Scaevinus dombayae (Bayonne−Reunion) 29 T−Reu 2320 Scaevinus dombayae (Bayonne−Reunion) T−Reu 2316 Scaevinus dombayae (Bayonne−Reunion) 30 T−Reu 2322 Scaevinus dombayae (Bayonne−Reunion) 31 T−Reu 3051 Scaevinus dombayae (Plaine des Gregues−Reunion) T−Reu 2922 Scaevinus dombayae (Mare Longue−Reunion) 32 T−Mau 3843 Scaevinus subtruncatus (Brise Fer−Mauritius) 33 T−Mau 51 Scaevinus subtruncatus (Montagne Cocotte−Mauritius) T−Mau 3343 Scaevinus subtruncatus (Vallee de lest−Mauritius) 34 T−Mau 69 Scaevinus subtruncatus (Brise Fer−Mauritius) 35 T−Mau 130 Scaevinus subtruncatus (Florin−Mauritius) T−Mau 45 Scaevinus subtruncatus (Montagne Cocotte−Mauritius) 36 T−Mau 245 Scaevinus subtruncatus (Pigeon wood−Mauritius) 37 T−Mau 3707 Scaevinus subtruncatus (Le Pouce−Mauritius) T−Mau 3705 Scaevinus subtruncatus (Le Pouce−Mauritius) 38 T−Mau 3706 Scaevinus subtruncatus (Le Pouce−Mauritius) 39 T−Reu 5117 Cratopus bernei (Cascade du Chien−Reunion) T−Reu 5115 Cratopus bernei (Cascade du Chien−Reunion) 40 T−Reu 5116 Cratopus bernei (Cascade du Chien−Reunion) 41 T−Reu 5118 Cratopus bernei (Cascade du Chien−Reunion) T−Mau 3792 Cratopus armatus (Le Pouce−Mauritius) 42 T−Mau 3629 Cratopus armatus (Le Pouce−Mauritius) 43 T−Mau 177 Cratopus armatus (Le Pouce−Mauritius) T−Mau 178 Cratopus armatus (Le Pouce−Mauritius) 44 T−Mau 176 Cratopus armatus (Le Pouce−Mauritius) 45 T−Mau 3649 Cratopus armatus (Le Pouce−Mauritius) T−Mau 3650 Cratopus armatus (Le Pouce−Mauritius) 46 T−Mau 3796 Cratopus armatus (Gorges−Mauritius) 47 T−Mau 3798 Cratopus armatus (Gorges−Mauritius) T−Mau 282 Cratopus armatus (Machabee−Mauritius) 48 T−Mau 128 Cratopus armatus (Florin−Mauritius) 49 T−Mau 3797 Cratopus armatus (Gorges−Mauritius) T−Mau 273 Cratopus armatus (Kanaka−Mauritius) 50 T−Mau 3788 Cratopus armatus (Camp Thorel−Mauritius) 51 T−Reu 4073 Cratopus circumcinctus (Plaine d'Affouches−Reunion) T−Reu 4134 Cratopus marmoreus (Plaine d'Affouches−Reunion) 52 T−Reu 4092 Cratopus marmoreus (Plaine d'Affouches−Reunion) T−Reu 4150 Cratopus marmoreus (Plaine d'Affouches−Reunion) 53 T−Reu 2408 Cratopus marmoreus (Ravine de la Grande Chaloupe−Reunion) 54 T−Reu 4585 Cratopus circumcinctus (Site Dior−Reunion) T−Reu 2983 Cratopus nigridorsis (Vallee Heureuse−Reunion) 55 T−Reu 3808 Cratopus nigridorsis (Sentier Trophee Mondial−Reunion) 56 T−Reu 3824 Cratopus nigridorsis (Sentier Trophee Mondial−Reunion) T−Reu 2371 Cratopus nigridorsis (Ravine Jean Payet−Reunion) 57 T−Reu 2370 Cratopus circumcinctus (Ravine Jean Payet−Reunion) 58 T−Reu 3809 Cratopus circumcinctus (Sentier Trophee Mondial−Reunion) T−Reu 3329 Cratopus circumcinctus (Bayonne−Reunion) 59 T−Reu 3330 Cratopus nigridorsis (Bayonne−Reunion) 60 T−Mau 3852 Cratopus viridilimbatus (Brise Fer−Mauritius) T−Mau 3836 Cratopus viridilimbatus (Brise Fer−Mauritius) T−Mau 3848 Cratopus viridilimbatus (Camp−Mauritius) T−Mau 3872 Cratopus viridilimbatus (Gorges−Mauritius) T−Mau 3760 Cratopus viridilimbatus (Le Pouce−Mauritius) T−Mau 3757 Cratopus viridilimbatus (Le Pouce−Mauritius) T−Mau 3194 Cratopus viridilimbatus (Brise Fer−Mauritius) T−Mau 3572 Cratopus viridilimbatus (Le Pouce−Mauritius) T−Mau 3681 Cratopus viridilimbatus (Le Pouce−Mauritius) T−Mau 107 Cratopus viridilimbatus (Machabee−Mauritius) T−Mau 140 Cratopus viridilimbatus (L'Etoiles−Mauritius) T−Mau 3820 Cratopus viridilimbatus (Montagne Cocotte−Mauritius) T−Mau 3274 Cratopus viridilimbatus (Montagne Cocotte−Mauritius) T−Mau 3835 Cratopus viridilimbatus (Camp−Mauritius) T−Mau 113 Cratopus viridilimbatus (Machabee−Mauritius) T−Mau 3919 Cratopus viridilimbatus (Brise Fer−Mauritius) T−Mau 3809 Cratopus viridilimbatus (Montagne Cocotte−Mauritius) T−Mau 3874 Cratopus viridilimbatus (Gorges−Mauritius) T−Mau 3916 Cratopus viridilimbatus (Gorges−Mauritius) T−Mau 3841 Cratopus viridilimbatus (Brise Fer−Mauritius) T−Mau 467 Cratopus viridilimbatus (Plaine Champagne−Mauritius) T−Mau 106 Cratopus viridilimbatus (Machabee−Mauritius) T−Mau 123 Cratopus viridilimbatus (Machabee−Mauritius) T−Mau 3849 Cratopus viridilimbatus (Camp−Mauritius) T−Mau 101 Cratopus viridilimbatus (Machabee−Mauritius) T−Reu 2745 Cratopus frappieri (Route des Tamarinds−Reunion) T−Reu 5062 Cratopus frappieri (Plaine des Tamarinds−Reunion) T−Reu 5082 Cratopus frappieri (Plaine des Tamarinds−Reunion) T−Reu 2690 Cratopus frappieri (Route des Tamarinds−Reunion) T−Reu 2606 Cratopus frappieri (Le Maido−Reunion) T−Reu 2617 Cratopus frappieri (Le Maido−Reunion) T−Reu 5049 Cratopus frappieri (Plaine des Tamarinds−Reunion) T−Reu 4091 Cratopus frappieri (Plaine d'Affouches−Reunion) T−Reu 4106 Cratopus frappieri (Plaine d'Affouches−Reunion) T−Reu 4101 Cratopus frappieri (Plaine d'Affouches−Reunion) T−Reu 4107 Cratopus frappieri (Plaine d'Affouches−Reunion) T−Reu 4804 Cratopus frappieri (Plaine des Chicots−Reunion) T−Reu 4783 Cratopus frappieri (Plaine des Chicots−Reunion) T−Reu 4838 Cratopus frappieri (Plaine des Chicots−Reunion) T−Reu 4839 Cratopus frappieri (Plaine des Chicots−Reunion) T−Reu 2121 Cratopus frappieri (Hell Bourg−Reunion) T−Reu 2268 Cratopus frappieri (Hell Bourg−Reunion) T−Reu 2876 Cratopus frappieri (Gros Piton Rond−Reunion) T−Reu 3550 Cratopus frappieri (Foret de Bebour−Reunion) T−Reu 2878 Cratopus frappieri (Gros Piton Rond−Reunion) T−Reu 2873 Cratopus frappieri (Gros Piton Rond−Reunion) T−Reu 3776 Cratopus frappieri (Plaine des Fougiers−Reunion) T−Reu 2428 Cratopus frappieri (Plaine des Fougiers−Reunion) T−Reu 3767 Cratopus frappieri (Plaine des Fougiers−Reunion) T−Reu 3752 Cratopus frappieri (Plaine des Fougiers−Reunion) T−Reu 3790 Cratopus frappieri (Plaine des Fougiers−Reunion) T−Reu 3127 Cratopus frappieri (Plaine d'Affouches−Reunion) T−Reu 2911 Cratopus frappieri (Mare Longue−Reunion) T−Reu 2759 Cratopus frappieri (Grand Etang−Reunion) T−Reu 2755 Cratopus frappieri (Grand Etang−Reunion) T−Reu 2894 Cratopus frappieri (Mare Longue−Reunion) T−Reu 2881 Cratopus frappieri (Mare Longue−Reunion) T−Reu 2884 Cratopus frappieri (Mare Longue−Reunion) T−Reu 3080 Cratopus frappieri (Basse Vallee−Reunion) T−Reu 2450 Cratopus frapieri (Vallee Heureuse−Reunion) T−Reu 3834 Cratopus frappieri (Basse Vallee−Reunion) T−Reu 4315 Cratopus frappieri (Plaine des Gregues−Reunion) T−Reu 3832 Cratopus frappieri (Basse Vallee−Reunion) T−Reu 2021 Cratopus frappieri (Basse Vallee−Reunion) T−Reu 2026 Cratopus frappieri (Vallee Heureuse−Reunion) T−Reu 2900 Cratopus frappieri (Mare Longue−Reunion) T−Reu 2082 Cratopus frappieri (Vallee Heureuse−Reunion) T−Reu 2044 Cratopus frappieri (Vallee Heureuse−Reunion) T−Reu 3835 Cratopus frappieri (Basse Vallee−Reunion) T−Reu 2027 Cratopus frappieri (Vallee Heureuse−Reunion) T−Reu 2033 Cratopus frappieri (Vallee Heureuse−Reunion) T−Reu 3927 Cratopus frappieri (Les Makes−Reunion) T−Reu 3181 Cratopus frappieri (Les Makes−Reunion) T−Reu 4900 Cratopus frappieri (Le Block−Reunion) T−Reu 4952 Cratopus frappieri (Le Block−Reunion) T−Reu 5024 Cratopus frappieri (Le Block−Reunion) T−Reu 5008 Cratopus frappieri (Le Block−Reunion) T−Reu 3167 Cratopus frappieri (Foret de Tevelave−Reunion) T−Reu 3930 Cratopus frappieri (Les Makes−Reunion) T−Reu 3223 Cratopus frappieri (Les Makes−Reunion) T−Reu 3988 Cratopus frappieri (Les Makes−Reunion) T−Reu 3172 Cratopus frappieri (Les Makes−Reunion) T−Reu 3926 Cratopus frappieri (Les Makes−Reunion) T−Reu 3995 Cratopus frappieri (Les Makes−Reunion) T−Reu 3191 Cratopus frappieri (Les Makes−Reunion) T−Reu 3226 Cratopus frappieri (Les Makes−Reunion) T−Reu 3220 Cratopus frappieri (Les Makes−Reunion) T−Reu 3165 Cratopus frappieri (Foret de Tevelave−Reunion) T−Reu 4758 Cratopus frappieri (Trois Bassins−Reunion) T−Reu 4757 Cratopus frappieri (Trois Bassins−Reunion) T−Reu 2667 Cratopus frappieri (Route des Tamarinds−Reunion) T−Reu 4756 Cratopus frappieri (Trois Bassins−Reunion) T−Reu 4748 Cratopus frappieri (Trois Bassins−Reunion) T−Reu 3280 Cratopus frappieri (Route forrestiere du Maido−Reunion) T−Reu 3271 Cratopus frappieri (Route forrestiere du Maido−Reunion) T−Reu 3274 Cratopus frappieri (Route forrestiere du Maido−Reunion) T−Reu 4755 Cratopus frappieri (Trois Bassins−Reunion) T−Reu 3265 Cratopus frappieri (Route forrestiere du Maido−Reunion) T−Reu 4203 Cratopus frappieri (Foret de Bel Air−Reunion) T−Reu 4726 Cratopus frappieri (Grande Coude−Reunion) T−Reu 4629 Cratopus frappieri (Grande Coude−Reunion) T−Reu 4708 Cratopus frappieri (Grande Coude−Reunion) T−Reu 4725 Cratopus frappieri (Grande Coude−Reunion) T−Reu 4492 Cratopus frappieri (Cap Blanc−Reunion) T−Reu 245 Cratopus tristis (Volcano−Reunion) T−Reu 3821 Cratopus frappieri (Sentier Trophee Mondial−Reunion) T−Reu 3816 Cratopus frappieri (Sentier Trophee Mondial−Reunion) T−Reu 3831 Cratopus frappieri (Sentier Trophee Mondial−Reunion) T−Reu 4272 Cratopus frappieri (Foret de Bel Air−Reunion) T−Reu 4270 Cratopus frappieri (Foret de Bel Air−Reunion) T−Reu 4271 Cratopus frappieri (Foret de Bel Air−Reunion) T−Reu 4512 Cratopus frappieri (Foret Dominale Notre Dame de la Paix−Reunion) T−Reu 4513 Cratopus frappieri (Foret Dominale Notre Dame de la Paix−Reunion) T−Reu 4508 Cratopus frappieri (Foret Dominale Notre Dame de la Paix−Reunion) T−Reu 3464 Cratopus frappieri (Piton Hyacinthe−Reunion) T−Reu 3704 Cratopus frappieri (Foret du Volcane−Reunion) T−Reu 3387 Cratopus frappieri (Piton Mahot−Reunion) T−Reu 2264 Cratopus frappieri (Piton Desforges−Reunion) T−Reu 3668 Cratopus frappieri (Foret du Volcane−Reunion) T−Reu 3447 Cratopus frappieri (Piton Mahot−Reunion) T−Reu 2191 Cratopus frappieri (Piton Hyacinthe−Reunion) T−Reu 3642 Cratopus frappieri (Nez de Boeuf−Reunion) T−Reu 3641 Cratopus frappieri (Nez de Boeuf−Reunion) T−Reu 3667 Cratopus frappieri (Bois Ozoux−Reunion) T−Reu 2968 Cratopus frappieri (Foret du Volcane−Reunion) T−Reu 3665 Cratopus frappieri (Nez de Boeuf−Reunion) T−Reu 3072 Cratopus septemvittatus (Basse Vallee−Reunion) T−Reu 2433 Cratopus septemvittatus (Mare Longue−Reunion) T−Reu 2434 Cratopus septemvittatus (Mare Longue−Reunion) T−Mau 171 Cratopus melanocephalus (Le Pouce−Mauritius) T−Mau 3699 Cratopus melanocephalus (Le Pouce−Mauritius) T−Mau 274 Cratopus melanocephalus (Kanaka−Mauritius) T−Mau 3570 Cratopus melanocephalus (Le Pouce−Mauritius) T−Mau 3628 Cratopus melanocephalus (Le Pouce−Mauritius) T−Mau 172 Cratopus melanocephalus (Le Pouce−Mauritius) T−Mau 3224 Cratopus melanocephalus (Montagne Cocotte−Mauritius) T−Mau 459 Cratopus melanocephalus (Plaine Champagne−Mauritius) T−Mau 25 Cratopus melanocephalus (Montagne Cocotte−Mauritius) T−Mau 464 Cratopus melanocephalus (Plaine Champagne−Mauritius) T−Mau 27 Cratopus melanocephalus (Montagne Cocotte−Mauritius) T−Mau 3290 Cratopus melanocephalus (Montagne Cocotte−Mauritius) T−Mau 3252 Cratopus melanocephalus (Montagne Cocotte−Mauritius) T−Mau 279 Cratopus melanocephalus (Kanaka−Mauritius) T−Mau 250 Cratopus melanocephalus (Pigeon wood−Mauritius) T−Reu 2929 Cratopus exquisitus (Foret du Volcane−Reunion) T−Reu 2872 Cratopus exquisitus (Gros Piton Rond−Reunion) T−Reu 3436 Cratopus exquisitus (Piton Mahot−Reunion) T−Reu 3404 Cratopus exquisitus (Piton Mahot−Reunion) T−Reu 2222 Cratopus exquisitus (Col de Bellevue−Reunion) T−Reu 2049 Cratopus exquisitus (Col de Bellevue−Reunion) T−Reu 2109 Cratopus exquisitus (Ravine de la Grande Chaloupe−Reunion) T−Reu 3452 Cratopus exquisitus (Piton Mahot−Reunion) T−Reu 2975 Cratopus exquisitus (Foret du Volcane−Reunion) T−Reu 5126 Cratopus exquisitus (Foret Dominale Notre Dame de la Paix−Reunion) T−Reu 4531 Cratopus exquisitus (Foret Dominale Notre Dame de la Paix−Reunion) T−Reu 4507 Cratopus exquisitus (Foret Dominale Notre Dame de la Paix−Reunion) T−Reu 2865 Cratopus exquisitus (Nez de Boeuf−Reunion) T−Reu 2856 Cratopus exquisitus (Nez de Boeuf−Reunion) T−Reu 3025 Cratopus exquisitus (Piton Textor−Reunion) T−Reu 3022 Cratopus exquisitus (Piton Textor−Reunion) T−Reu 3817 Cratopus exquisitus (Sentier Trophee Mondial−Reunion) T−Reu 4227 Cratopus exquisitus (Foret de Bel Air−Reunion) T−Reu 5125 Cratopus exquisitus (Foret Dominale Notre Dame de la Paix−Reunion) T−Reu 4625 Cratopus exquisitus (Grande Coude−Reunion) T−Reu 4724 Cratopus exquisitus (Grande Coude−Reunion) T−Reu 4681 Cratopus exquisitus (Grande Coude−Reunion) T−Reu 3631 Cratopus exquisitus (Vallee Heureuse−Reunion) T−Reu 4189 Cratopus exquisitus (Foret de Bel Air−Reunion) T−Reu 2377 Cratopus exquisitus (Plaine des Gregues−Reunion) T−Reu 4314 Cratopus exquisitus (Foret de Bel Air−Reunion) T−Reu 2292 Cratopus exquisitus (Vallee Heureuse−Reunion) T−Reu 4653 Cratopus exquisitus (Grande Coude−Reunion) T−Reu 4503 Cratopus exquisitus (Cap Blanc−Reunion) T−Reu 2910 Cratopus exquisitus (Mare Longue−Reunion) T−Reu 3630 Cratopus exquisitus (Vallee Heureuse−Reunion) T−Reu 4478 Cratopus exquisitus (Cap Blanc−Reunion) T−Reu 2007 Cratopus exquisitus (Vallee Heureuse−Reunion) T−Reu 3259 Cratopus exquisitus (Route forrestiere du Maido−Reunion) T−Reu 3163 Cratopus exquisitus (Foret de Tevelave−Reunion) T−Reu 3258 Cratopus exquisitus (Route forrestiere du Maido−Reunion) T−Reu 2708 Cratopus exquisitus (Route des Tamarinds−Reunion) T−Reu 3156 Cratopus exquisitus (Les Makes−Reunion) T−Reu 2064 Cratopus exquisitus (Plaine d'Affouches−Reunion) T−Reu 4123 Cratopus exquisitus (Plaine d'Affouches−Reunion) T−Reu 2034 Cratopus exquisitus (Plaine d'Affouches−Reunion) T−Reu 2018 Cratopus exquisitus (Plaine d'Affouches−Reunion) T−Reu 2577 Cratopus exquisitus (Le Maido−Reunion) T−Reu 2574 Cratopus exquisitus (Le Maido−Reunion) T−Reu 2579 Cratopus exquisitus (Le Maido−Reunion) T−Reu 2655 Cratopus exquisitus (Route des Tamarinds−Reunion) T−Reu 2578 Cratopus exquisitus (Le Maido−Reunion) T−Reu 2580 Cratopus exquisitus (Le Maido−Reunion) T−Reu 2825 Cratopus exquisitus (Trois Bassins−Reunion) T−Reu 5113 Cratopus exquisitus (Plaine des Tamarinds−Reunion) T−Reu 5068 Cratopus exquisitus (Plaine des Tamarinds−Reunion) T−Reu 2797 Cratopus exquisitus (Route de Plaine de les fougiers−Reunion) T−Reu 5114 Cratopus exquisitus (Plaine des Tamarinds−Reunion) T−Reu 2775 Cratopus exquisitus (Route de Plaine de les fougiers−Reunion) T−Reu 3749 Cratopus exquisitus (Plaine des Fougiers−Reunion) T−Reu 3804 Cratopus exquisitus (Plaine des Fougiers−Reunion) T−Reu 3224 Cratopus exquisitus (Les Makes−Reunion) T−Reu 3155 Cratopus exquisitus (Les Makes−Reunion) T−Reu 3225 Cratopus exquisitus (Les Makes−Reunion) T−Reu 3197 Cratopus exquisitus (Les Makes−Reunion) T−Reu 3623 Cratopus exquisitus (Foret de Bebour−Reunion) T−Reu 2087 Cratopus exquisitus (Ravine de la Grande Chaloupe−Reunion) T−Reu 4889 Cratopus exquisitus (Le Block−Reunion) T−Reu 5002 Cratopus exquisitus (Le Block−Reunion) T−Reu 4886 Cratopus exquisitus (Le Block−Reunion) T−Reu 417 Cratopus exquisitus (Foret de Bebour−Reunion) T−Reu 418 Cratopus exquisitus (Foret de Bebour−Reunion) T−Reu 3033 Cratopus exquisitus (Pic Adam−Reunion) T−Reu 4771 Cratopus exquisitus (Plaine des Chicots−Reunion) T−Reu 4885 Cratopus exquisitus (Site Dior−Reunion) T−Reu 4784 Cratopus exquisitus (Plaine des Chicots−Reunion) T−Reu 4817 Cratopus exquisitus (Plaine des Chicots−Reunion) T−Reu 4807 Cratopus exquisitus (Plaine des Chicots−Reunion) T−Reu 2769 Cratopus exquisitus (Grand Etang−Reunion) T−Reu 3840 Cratopus exquisitus (Grand Etang−Reunion) T−Reu 2879 Cratopus exquisitus (Gros Piton Rond−Reunion) T−Reu 3553 Cratopus exquisitus (Foret de Bebour−Reunion) T−Reu 401 Cratopus exquisitus (Hell Bourg−Reunion) T−Reu 382 Cratopus exquisitus (Hell Bourg−Reunion) T−Reu 2880 Cratopus exquisitus (Gros Piton Rond−Reunion) T−Reu 3160 Cratopus exquisitus (Volcano−Reunion) T−Reu 2768 Cratopus exquisitus (Grand Etang−Reunion) T−Reu 2333 Cratopus exquisitus (Bayonne−Reunion) T−Reu 3726 Cratopus exquisitus (Takamaka−Reunion) T−Reu 3740 Cratopus exquisitus (Takamaka−Reunion) T−Reu 4569 Cratopus exquisitus (Site Dior−Reunion) T−Reu 2985 Cratopus exquisitus (Plaine des Lianes−Reunion) T−Reu 2989 Cratopus exquisitus (Plaine des Lianes−Reunion) T−Mau 3817 Cratopus cariei (Montagne de Belle Ombre−Mauritius) T−Mau 3801 Cratopus cariei (Montagne de Belle Ombre−Mauritius) T−Mau 3855 Cratopus cariei (Camp−Mauritius) T−Mau 3854 Cratopus cariei (Camp−Mauritius) T−Mau 3856 Cratopus cariei (Camp−Mauritius) T−Mau 3680 Cratopus fasciger (Le Pouce−Mauritius) T−Mau 3284 Cratopus mundulus (Montagne Cocotte−Mauritius) T−Rod 159 Cratopus viridipunctatus (Ille aux Cocos−Mauritius, Rodrigues Island) T−Rod 164 Cratopus viridipunctatus (Ille aux Cocos−Mauritius, Rodrigues Island) T−Rod 101 Cratopus virescens (Mt Malartic−Mauritius, Rodrigues Island) T−Rod 31 Cratopus virescens (Mt Limon−Mauritius, Rodrigues Island) T−Rod 120 Cratopus virescens (Grande Montagne−Mauritius, Rodrigues Island) T−Rod 267 Cratopus virescens (Riviere Mourouk−Mauritius, Rodrigues Island) T−Rod 100 Cratopus virescens (Mt Malartic−Mauritius, Rodrigues Island) T−Rod 234 Cratopus virescens (Mt Limon−Mauritius, Rodrigues Island) T−Rod 99 Cratopus virescens (Mt Malartic−Mauritius, Rodrigues Island) T−Rod 224 Cratopus virescens (Mt Limon−Mauritius, Rodrigues Island) T−Rod 3 Cratopus virescens (Mt Limon−Mauritius, Rodrigues Island) T−Rod 126 Cratopus virescens (Grande Montagne−Mauritius, Rodrigues Island) T−Rod 268 Cratopus virescens (Riviere Mourouk−Mauritius, Rodrigues Island) T−Rod 144 Cratopus virescens (Ille aux Cocos−Mauritius, Rodrigues Island) T−Rod 123 Cratopus virescens (Grande Montagne−Mauritius, Rodrigues Island) T−Mau 3546 Cratopopsis impressus (Le Pouce−Mauritius) T−Reu 80 Cratopopsis bistigma (Bayonne−Reunion) T−Reu 4918 Cratopopsis bistigma (Le Block−Reunion) T−Reu 3461 Cratopopsis bistigma (Piton Mahot−Reunion) T−Reu 3491 Cratopopsis bistigma (Piton Hyacinthe−Reunion) T−Mau 26 Cratopopsis impressus (Montagne Cocotte−Mauritius) T−Mau 35 Cratopopsis mauritianus (Montagne Cocotte−Mauritius) T−Mau 30 Cratopopsis mauritianus (Montagne Cocotte−Mauritius) T−Mau 3266 Cratopopsis impressus (Montagne Cocotte−Mauritius) T−Mau 3273 Cratopopsis mauritianus (Montagne Cocotte−Mauritius) T−Mau 3270 Cratopopsis mauritianus (Montagne Cocotte−Mauritius) T−Mau 3268 Cratopopsis mauritianus (Montagne Cocotte−Mauritius) T−Mau 3300 Cratopopsis impressus (Montagne Cocotte−Mauritius) T−Mau 256 Cratopus striga (Brise Fer−Mauritius) T−Mau 3281 Cratopus mundulus (Montagne Cocotte−Mauritius) T−Mau 3807 Cratopus vulgaris (Montagne Cocotte−Mauritius) T−Mau 249 Cratopus emarginatus (Pigeon wood−Mauritius) T−Mau 3234 Cratopus aeneoniger (Montagne Cocotte−Mauritius) T−Mau 3230 Cratopus aeneoniger (Montagne Cocotte−Mauritius) T−Mau 3233 Cratopus aeneoniger (Montagne Cocotte−Mauritius) T−Mau 160 Cratopus confusus (L'Etoiles−Mauritius) T−Mau 289 Cratopus vulgaris (Souillac−Mauritius) T−Mau 3280 Cratopus mundulus (Montagne Cocotte−Mauritius) T−Mau 84 Cratopus vulgaris (Pigeon wood−Mauritius) T−Mau 3808 Cratopus vulgaris (Montagne de Belle Ombre−Mauritius) T−Mau 476 Cratopus deceptus (Plaine Champagne−Mauritius) T−Mau 253 Cratopus vulgaris (Brise Fer−Mauritius) T−Mau 3811 Cratopus vulgaris (Montagne de Belle Ombre−Mauritius) T−Mau 3813 Cratopus vulgaris (Montagne de Belle Ombre−Mauritius) T−Mau 105 Cratopus confusus (Machabee−Mauritius) T−Mau 93 Cratopus vulgaris (Machabee−Mauritius) T−Mau 3847 Cratopus vulgaris (Camp−Mauritius) T−Mau 96 Cratopus aeneoniger (Machabee−Mauritius) T−Mau 265 Cratopus vulgaris (Brise Fer−Mauritius) T−Mau 3833 Cratopus vulgaris (Camp−Mauritius) T−Mau 264 Cratopus vulgaris (Brise Fer−Mauritius) T−Mau 3223 Cratopus aeneoniger (Montagne Cocotte−Mauritius) T−Mau 57 Cratopus confusus (Brise Fer−Mauritius) T−Mau 73 Cratopus vulgaris (Machabee−Mauritius) T−Mau 3810 Cratopus vulgaris (Montagne de Belle Ombre−Mauritius) T−Mau 3257 Cratopus vulgaris (Montagne Cocotte−Mauritius) T−Mau 3193 Cratopus vulgaris (Chamarel−Mauritius) T−Mau 3213 Cratopus aeneoniger (Montagne Cocotte−Mauritius) T−Mau 3192 Cratopus vulgaris (Chamarel−Mauritius) T−Mau 3227 Cratopus stigmaeus (Montagne Cocotte−Mauritius) T−Mau 463 Cratopus aeneoniger (Plaine Champagne−Mauritius) T−Mau 472 Cratopus aeneoniger (Plaine Champagne−Mauritius) T−Mau 482 Cratopus deceptus (Plaine Champagne−Mauritius) T−Reu 2054 Cratopus brunnipes (Plaine d'Affouches−Reunion) T−Reu 2005 Cratopus brunnipes (Piton Hyacinthe−Reunion) T−Reu 4229 Cratopus brunnipes (Foret de Bel Air−Reunion) T−Reu 4202 Cratopus brunnipes (Foret de Bel Air−Reunion) T−Reu 4743 Cratopus brunnipes (Cascade du Chien−Reunion) T−Reu 4550 Cratopus brunnipes (Site Dior−Reunion) T−Reu 4593 Cratopus brunnipes (Site Dior−Reunion) T−Reu 3347 Cratopus brunnipes (Bayonne−Reunion) T−Reu 4745 Cratopus brunnipes (Cascade du Chien−Reunion) T−Reu 3635 Cratopus brunnipes (Vallee Heureuse−Reunion) T−Reu 3539 Cratopus brunnipes (Les Makes−Reunion) T−Reu 2058 Cratopus brunnipes (Plaine d'Affouches−Reunion) T−Reu 4829 Cratopus brunnipes (Plaine des Chicots−Reunion) T−Reu 2165 Cratopus brunnipes (Plaine d'Affouches−Reunion) T−Reu 4252 Cratopus brunnipes (Foret de Bel Air−Reunion) T−Reu 2040 Cratopus brunnipes (Plaine d'Affouches−Reunion) T−Reu 2041 Cratopus brunnipes (Plaine d'Affouches−Reunion) T−Reu 4732 Cratopus brunnipes (Cascade du Chien−Reunion) T−Reu 3091 Cratopus brunnipes (Basse Vallee−Reunion) T−Reu 3639 Cratopus brunnipes (Vallee Heureuse−Reunion) T−Reu 4741 Cratopus brunnipes (Cascade du Chien−Reunion) T−Reu 5120 Cratopus brunnipes (Cascade du Chien−Reunion) T−Mau 155 Cratopus aeneoniger (L'Etoiles−Mauritius) T−Mau 154 Cratopus aeneoniger (L'Etoiles−Mauritius) T−Mau 142 Cratopus aeneoniger (L'Etoiles−Mauritius) T−Mau 141 Cratopus aeneoniger (L'Etoiles−Mauritius) T−Mau 156 Cratopus aeneoniger (L'Etoiles−Mauritius) T−Mau 3558 Cratopus aeneoniger (Le Pouce−Mauritius) T−Mau 3627 Cratopus deceptus (Le Pouce−Mauritius) T−Mau 3621 Cratopus vulgaris (Le Pouce−Mauritius) T−Mau 2 Cratopus vulgaris (Le Pouce−Mauritius) T−Mau 3 Cratopus deceptus (Le Pouce−Mauritius) T−Mau 3575 Cratopus aeneoniger (Le Pouce−Mauritius) T−Mau 3753 Cratopus emarginatus (Le Pouce−Mauritius) T−Mau 3203 Cratopus vulgaris (Mondrain−Mauritius) T−Mau 3819 Cratopus confusus (Montagne de Belle Ombre−Mauritius) T−Mau 3804 Cratopus confusus (Montagne de Belle Ombre−Mauritius) T−Mau 3806 Cratopus confusus (Montagne de Belle Ombre−Mauritius) T−Mau 3579 Cratopus aeneoniger (Le Pouce−Mauritius) T−Mau 3578 Cratopus confusus (Le Pouce−Mauritius) T−Mau 3557 Cratopus confusus (Le Pouce−Mauritius) T−Mau 3605 Cratopus confusus (Le Pouce−Mauritius) T−Mau 272 Cratopus vulgaris (Kanaka−Mauritius) T−Mau 3895 Cratopus vulgaris (Camp Thorel−Mauritius) T−Mau 3894 Cratopus vulgaris (Camp Thorel−Mauritius) T−Mau 3908 Cratopus deceptus (Camp Thorel−Mauritius) T−Mau 421 Cratopus confusus (Lion Mountain−Mauritius) T−Mau 442 Cratopus deceptus (Lion Mountain−Mauritius) T−Mau 3315 Cratopus confusus (Vallee de lest−Mauritius) T−Mau 3328 Cratopus vulgaris (Vallee de l'est−Mauritius) T−Mau 3406 Cratopus aeneoniger (Vallee de l'est−Mauritius) T−Mau 3309 Cratopus vulgaris (Vallee de l'est−Mauritius) T−Mau 437 Cratopus confusus (Lion Mountain−Mauritius) T−Mau 3305 Cratopus aeneoniger (Vallee de l'est−Mauritius) T−Mau 450 Cratopus deceptus (Plaine Champagne−Mauritius) T−Mau 3547 Cratopus confusus (Le Pouce−Mauritius) T−Mau 3694 Cratopus deceptus (Le Pouce−Mauritius) T−Mau 3277 Cratopus stigmaeus (Montagne Cocotte−Mauritius) T−Mau 3279 Cratopus mundulus (Montagne Cocotte−Mauritius) T−Mau 3661 Cratopus emarginatus (Le Pouce−Mauritius) T−Mau 3754 Cratopus aeneoniger (Le Pouce−Mauritius) T−Mau 3584 Cratopus aeneoniger (Le Pouce−Mauritius) T−Mau 3581 Cratopus emarginatus (Le Pouce−Mauritius) T−Mau 3642 Cratopus emarginatus (Le Pouce−Mauritius) T−Mau 3582 Cratopus emarginatus (Le Pouce−Mauritius) T−Mau 3541 Cratopus vulgaris (Le Pouce−Mauritius) T−Mau 3923 Cratopus vulgaris (Trois Mamelles−Mauritius) T−Mau 3569 Cratopus vulgaris (Le Pouce−Mauritius) T−Mau 3590 Cratopus vulgaris (Le Pouce−Mauritius) T−Mau 3639 Cratopus confusus (Le Pouce−Mauritius) T−Mau 3922 Cratopus vulgaris (Trois Mamelles−Mauritius) T−Mau 3921 Cratopus vulgaris (Trois Mamelles−Mauritius) T−Mau 3918 Cratopus vulgaris (Gorges−Mauritius) T−Mau 3869 Cratopus vulgaris (Gorges−Mauritius) T−Mau 3870 Cratopus vulgaris (Gorges−Mauritius) T−Mau 3871 Cratopus vulgaris (Gorges−Mauritius) T−Mau 3306 Cratopus confusus (Vallee de l'est−Mauritius) T−Mau 3338 Cratopus confusus (Vallee de l'est−Mauritius) T−Mau 3323 Cratopus confusus (Vallee de l'est−Mauritius) T−Mau 3337 Cratopus confusus (Vallee de lest−Mauritius) T−Mau 422 Cratopus confusus (Lion Mountain−Mauritius) For Peer Review T−Mau 429 Cratopus confusus (Lion Mountain−Mauritius) T−Mau 407 Cratopus confusus (Lion Mountain−Mauritius) T−Mau 3322 Cratopus vulgaris (Vallee de l'est−Mauritius) T−Mau 3312 Cratopus vulgaris (Vallee de l'est−Mauritius) T−Mau 3188 Cratopus vulgaris (Montagne Camizard−Mauritius) T−Mau 3307 Cratopus vulgaris (Vallee de l'est−Mauritius) T−Mau 3828 Cratopus caliginosus (Brise Fer−Mauritius) T−Mau 3850 Cratopus caliginosus (Brise Fer−Mauritius) T−Mau 39 Cratopus caliginosus (Petrin−Mauritius) T−Mau 131 Cratopus caliginosus (Florin−Mauritius) T−Mau 102 Cratopus caliginosus (Machabee−Mauritius) T−Mau 3503 Cratopus caliginosus (Ebony Forest−Mauritius) T−Mau 3799 Cratopus caliginosus (Montagne Cocotte−Mauritius) T−Mau 3818 Cratopus caliginosus (Montagne de Belle Ombre−Mauritius) T−Mau 24 Cratopus caliginosus (Montagne Cocotte−Mauritius) T−Mau 453 Cratopus caliginosus (Plaine Champagne−Mauritius) T−Mau 103 Cratopus caliginosus (Machabee−Mauritius) T−Mau 68 Cratopus caliginosus (Machabee−Mauritius) T−Mau 3383 Cratopus caliginosus (Vallee de l'est−Mauritius) T−Mau 3229 Cratopus caliginosus (Montagne Cocotte−Mauritius) T−Mau 3862 Cratopus caliginosus (Gorges−Mauritius) T−Mau 120 Cratopus caliginosus (Pigeon wood−Mauritius) T−Mau 32 Cratopus caliginosus (Montagne Cocotte−Mauritius) T−Mau 3237 Cratopus caliginosus (Montagne Cocotte−Mauritius) T−Mau 72 Cratopus caliginosus (Machabee−Mauritius) T−Mau 3860 Cratopus caliginosus (Gorges−Mauritius) T−Mau 457 Cratopus caliginosus (Plaine Champagne−Mauritius) T−Mau 104 Cratopus caliginosus (Machabee−Mauritius) T−Mau 3868 Cratopus caliginosus (Gorges−Mauritius) T−Mau 3880 Cratopus caliginosus (Le Pouce−Mauritius) T−Mau 3713 Cratopus caliginosus (Le Pouce−Mauritius) T−Mau 3906 Cratopus caliginosus (Camp Thorel−Mauritius) T−Mau 3907 Cratopus caliginosus (Camp Thorel−Mauritius) T−Mau 3905 Cratopus caliginosus (Camp Thorel−Mauritius) T−Mau 3659 Cratopus caliginosus (Le Pouce−Mauritius) T−Mau 3594 Cratopus caliginosus (Le Pouce−Mauritius) T−Mau 3392 Cratopus caliginosus (Vallee de l'est−Mauritius) T−Mau 3189 Cratopus caliginosus (Montagne Camizard−Mauritius) T−Mau 3652 Cratopus caliginosus (Le Pouce−Mauritius) T−Mau 3407 Cratopus caliginosus (Vallee de l'est−Mauritius) T−Mau 3346 Cratopus caliginosus (Vallee de l'est−Mauritius) T−Mau 136 Cratopus caliginosus (L'Etoiles−Mauritius) T−Mau 137 Cratopus caliginosus (L'Etoiles−Mauritius) T−Mau 3186 Cratopus caliginosus (Montagne Camizard−Mauritius) T−Mau 414 Cratopus caliginosus (Lion Mountain−Mauritius) T−Mau 428 Cratopus caliginosus (Lion Mountain−Mauritius) T−Mau 424 Cratopus caliginosus (Lion Mountain−Mauritius) T−Mau 3372 Cratopus caliginosus (Vallee de l'est−Mauritius) T−Mau 3202 Cratopus molitor (Mondrain−Mauritius) T−Mau 3889 Cratopus psittacus (Plaine des Roches−Mauritius) T−Mau 444 Cratopus psittacus (Lion Mountain−Mauritius) T−Mau 3190 Cratopus psittacus (Montagne Camizard−Mauritius) T−Mau 3191 Cratopus psittacus (Montagne Camizard−Mauritius) T−Mau 3333 Cratopus psittacus (Vallee de l'est−Mauritius) T−Mau 3327 Cratopus psittacus (Vallee de l'est−Mauritius) T−Mau 3195 Cratopus ovalis (Mondrain−Mauritius) T−Mau 3006 Cratopus ovalis (Trois Mamelles−Mauritius) T−Mau 3876 Cratopus ovalis (Gorges−Mauritius) T−Mau 377 Cratopus ovalis (Corps de Garde−Mauritius) T−Mau 363 Cratopus ovalis (Corps de Garde−Mauritius) T−Mau 391 Cratopus ovalis (Corps de Garde−Mauritius) T−Mau 360 Cratopus ovalis (Corps de Garde−Mauritius) T−Mau 3079 Cratopus ovalis (Snail Rock−Mauritius) T−Mau 3043 Cratopus ovalis (Trois Mamelles−Mauritius) T−Mau 3040 Cratopus ovalis (Trois Mamelles−Mauritius) T−Mau 379 Cratopus ovalis (Corps de Garde−Mauritius) T−Mau 3507 Cratopus ovalis (Ebony Forest−Mauritius) T−Mau 3899 Cratopus ovalis (Pointe de Roche Noire−Mauritius) T−Mau 3896 Cratopus ovalis (Plaine des Roches−Mauritius) T−Mau 3893 Cratopus ovalis (Roches Noires−Mauritius) T−Mau 3096 Cratopus ovalis (Snail Rock−Mauritius) T−Mau 284 Cratopus ovalis (Snail Rock−Mauritius) T−Mau 3150 Cratopus ovalis (Snail Rock−Mauritius) T−Mau 3084 Cratopus ovalis (Snail Rock−Mauritius) T−Mau 3888 Cratopus ovalis (Plaine des Roches−Mauritius) T−Mau 3822 Cratopus ovalis (Plaine des Roches−Mauritius) T−Mau 3914 Cratopus ovalis (Plaine des Roches−Mauritius) T−Mau 3909 Cratopus ovalis (Roches Noires−Mauritius) T−Mau 419 Cratopus tigratus (Lion Mountain−Mauritius) T−Mau 409 Cratopus murinus (Lion Mountain−Mauritius) T−Mau 440 Cratopus tigratus (Lion Mountain−Mauritius) T−Mau 408 Cratopus murinus (Lion Mountain−Mauritius) T−Mau 405 Cratopus tigratus (Lion Mountain−Mauritius) T−Mau 417 Cratopus tigratus (Lion Mountain−Mauritius) T−Mau 418 Cratopus tigratus (Lion Mountain−Mauritius) T−Mau 3864 Cratopus murinus (Gorges−Mauritius) T−Mau 3867 Cratopus murinus (Gorges−Mauritius) T−Mau 3433 Cratopus murinus (Riviere des Galets−Mauritius) T−Mau 3452 Cratopus murinus (Illot Sancho−Mauritius) T−Mau 3468 Cratopus murinus (Ebony Forest−Mauritius) T−Mau 3504 Cratopus murinus (Ebony Forest−Mauritius) T−Mau 3494 Cratopus caliginosus (Ebony Forest−Mauritius) T−Mau 3480 Cratopus murinus (Ebony Forest−Mauritius) T−Mau 3482 Cratopus caliginosus (Ebony Forest−Mauritius) T−Mau 3001 Cratopus murinus (Trois Mamelles−Mauritius) T−Mau 3074 Cratopus murinus (Trois Mamelles−Mauritius) T−Mau 3042 Cratopus murinus (Trois Mamelles−Mauritius) T−Mau 3000 Cratopus murinus (Trois Mamelles−Mauritius) T−Mau 3207 Cratopus murinus (Yemen−Mauritius) T−Mau 3036 Cratopus murinus (Trois Mamelles−Mauritius) T−Mau 3837 Cratopus murinus (Brise Fer−Mauritius) T−Mau 129 Cratopus viridulus (Florin−Mauritius) T−Mau 3839 Cratopus murinus (Brise Fer−Mauritius) T−Mau 3199 Cratopus murinus (Mondrain−Mauritius) T−Mau 372 Cratopus murinus (Corps de Garde−Mauritius) T−Mau 3529 Cratopus caliginosus (Corps de Garde−Mauritius) T−Mau 3208 Cratopus murinus (Yemen−Mauritius) T−Mau 3527 Cratopus caliginosus (Corps de Garde−Mauritius) T−Mau 3532 Cratopus caliginosus (Corps de Garde−Mauritius) T−Mau 3838 Cratopus murinus (Brise Fer−Mauritius) T−Mau 3844 Cratopus murinus (Camp−Mauritius) T−Mau 3201 Cratopus murinus (Mondrain−Mauritius) T−Mau 3200 Cratopus murinus (Mondrain−Mauritius) T−Mau 371 Cratopus murinus (Corps de Garde−Mauritius) T−Mau 383 Cratopus murinus (Corps de Garde−Mauritius) T−Mau 358 Cratopus murinus (Corps de Garde−Mauritius) T−Mau 3441 Cratopus murinus (Illot Sancho−Mauritius) T−Mau 3442 Cratopus murinus (Illot Sancho−Mauritius) T−Mau 3435 Cratopus murinus (Riviere des Galets−Mauritius) T−Mau 3445 Cratopus murinus (Illot Sancho−Mauritius) T−Mau 3443 Cratopus murinus (Illot Sancho−Mauritius) T−Mau 3437 Cratopus murinus (Riviere des Galets−Mauritius) T−Mau 3450 Cratopus murinus (Illot Sancho−Mauritius) T−Mau 353 Cratopus murinus (Ile aux Vacoas−Mauritius) T−Mau 3169 Cratopus murinus (Ile Marianne−Mauritius) T−Mau 328 Cratopus murinus (Ile de la Passe−Mauritius) T−Mau 297 Cratopus murinus (Ile de la Passe−Mauritius) T−Mau 329 Cratopus murinus (Ile de la Passe−Mauritius) T−Mau 3170 Cratopus murinus (Ile Marianne−Mauritius) T−Mau 3165 Cratopus murinus (Ile Marianne−Mauritius) T−Mau 3163 Cratopus murinus (Ile Marianne−Mauritius) T−Mau 3164 Cratopus murinus (Ile Marianne−Mauritius) T−Mau 335 Cratopus murinus (Ile aux Vacoas−Mauritius) T−Mau 341 Cratopus murinus (Ile aux Vacoas−Mauritius) T−Mau 336 Cratopus murinus (Ile aux Vacoas−Mauritius) T−Mau 327 Cratopus murinus (Ile de la Passe−Mauritius) T−Mau 351 Cratopus murinus (Ile aux Vacoas−Mauritius) T−Mau 3728 Cratopus murinus (Le Pouce−Mauritius) T−Mau 3562 Cratopus murinus (Le Pouce−Mauritius) T−Mau 12 Cratopus murinus (Le Pouce−Mauritius) T−Mau 3846 Cratopus murinus (Camp−Mauritius) T−Mau 11 Cratopus murinus (Le Pouce−Mauritius) T−Mau 3091 Cratopus murinus (Snail Rock−Mauritius) T−Mau 3732 Cratopus murinus (Le Pouce−Mauritius) T−Mau 3136 Cratopus murinus (Snail Rock−Mauritius) T−Mau 3100 Cratopus murinus (Snail Rock−Mauritius) T−Mau 3115 Cratopus murinus (Snail Rock−Mauritius) T−Mau 3148 Cratopus tigratus (Snail Rock−Mauritius) T−Mau 3078 Cratopus murinus (Snail Rock−Mauritius) T−Reu 2952 Cratopus murinus (Piton de Grande Anse−Reunion) T−Reu 2945 Cratopus murinus (Piton de Grande Anse−Reunion) T−Reu 2948 Cratopus murinus (Piton de Grande Anse−Reunion) T−Reu 2955 Cratopus murinus (Piton de Grande Anse−Reunion) T−Reu 2957 Cratopus murinus (Piton de Grande Anse−Reunion) T−Reu 3850 Cratopus murinus (Cap Mechant−Reunion) T−Reu 3861 Cratopus murinus (Cap Mechant−Reunion) T−Reu 3858 Cratopus murinus (Cap Mechant−Reunion) T−Reu 3854 Cratopus murinus (Cap Mechant−Reunion) T−Reu 3847 Cratopus murinus (Cap Mechant−Reunion) T−Reu 3884 Cratopus murinus (Cap Jaune−Reunion) T−Reu 3743 Cratopus murinus (Cap Jaune−Reunion) T−Reu 3886 Cratopus murinus (Cap Jaune−Reunion) T−Reu 3882 Cratopus murinus (Cap Jaune−Reunion) T−Reu 3742 Cratopus murinus (Cap Jaune−Reunion) T−Mau 127 Cratopus nigrogranatus (Florin−Mauritius) T−Mau 125 Cratopus nigrogranatus (Machabee−Mauritius) T−Mau 3863 Cratopus nigrogranatus (Gorges−Mauritius) T−Mau 3800 Cratopus variegatus (Montagne de Belle Ombre−Mauritius) T−Mau 3402 Cratopus variegatus (Vallee de l'est−Mauritius) T−Mau 3357 Cratopus variegatus (Vallee de lest−Mauritius) T−Mau 3374 Cratopus variegatus (Vallee de l'est−Mauritius) T−Rod 284 Cratopus rocki (Riviere Mourouk−Mauritius, Rodrigues Island) T−Rod 124 Cratopus rocki (Grande Montagne−Mauritius, Rodrigues Island) T−Rod 236 Cratopus rocki (Mt Limon−Mauritius, Rodrigues Island) T−Rod 283 Cratopus rocki (Riviere Mourouk−Mauritius, Rodrigues Island) T−Rod 29 Cratopus rocki (Mt Limon−Mauritius, Rodrigues Island) T−Rod 41 Cratopus rocki (Mt Limon−Mauritius, Rodrigues Island) T−Rod 102 Cratopopsis pauliani (Mt Malartic−Mauritius, Rodrigues Island) T−Rod 241 Cratopopsis pauliani (Mt Limon−Mauritius, Rodrigues Island) T−Rod 56 Cratopopsis pauliani (Mt Limon−Mauritius, Rodrigues Island) T−Rod 219 Cratopopsis pauliani (Mt Persil−Mauritius, Rodrigues Island) T−Rod 117 Cratopopsis pauliani (Mt Malartic−Mauritius, Rodrigues Island) T−Rod 110 Cratopopsis pauliani (Mt Malartic−Mauritius, Rodrigues Island) T−Mau 3204 Cratopus punctum (Yemen−Mauritius) T−Mau 271 Cratopus punctum (Seama Beach Hotel−Mauritius) T−Mau 270 Cratopus punctum (Seama Beach Hotel−Mauritius) T−ROU47 Cratopus punctum (Round Island−Mauritius) T−ROU46 Cratopus punctum (Round Island−Mauritius) T−Reu 3921 Cratopus punctum (Foret dominale de la cote sous le vent−Reunion) T−Reu 3913 Cratopus punctum (Foret dominale de la cote sous le vent−Reunion) T−Reu 3918 Cratopus punctum (Foret dominale de la cote sous le vent−Reunion) T−Reu 3915 Cratopus punctum (Foret dominale de la cote sous le vent−Reunion) T−Reu 3911 Cratopus punctum (Foret dominale de la cote sous le vent−Reunion) T−Mau 3911 Cratopus punctum (Plaine des Roches−Mauritius) T−Mau 248 Cratopus punctum (Seama Beach Hotel−Mauritius) T−Mau 3912 Cratopus punctum (Plaine des Roches−Mauritius) T−Mau 3884 Cratopus punctum (Plaine des Roches−Mauritius) T−Mau 313 Cratopus punctum (Ile de la Passe−Mauritius) T−Mau 311 Cratopus punctum (Ile de la Passe−Mauritius) T−Mau 312 Cratopus punctum (Ile de la Passe−Mauritius) T−Mau 294 Cratopus punctum (Ile de la Passe−Mauritius) T−Reu 3131 Cratopopsis obscurus (Plaine d'Affouches−Reunion) T−Reu 3605 Cratopopsis antiquus (Foret de Bebour−Reunion) T−Reu 4744 Cratopopsis villosulus (Cascade du Chien−Reunion) T−Reu 4265 Cratopopsis antiquus (Foret de Bel Air−Reunion) T−Reu 4057 Cratopopsis alluaudi (Les Makes−Reunion) T−Reu 4058 Cratopopsis alluaudi (Les Makes−Reunion) T−Reu 4056 Cratopopsis alluaudi (Les Makes−Reunion) T−Reu 3153 Cratopopsis alluaudi (Les Makes−Reunion) T−Reu 4047 Cratopopsis alluaudi (Les Makes−Reunion) T−Reu 3812 Cratopopsis alluaudi (Sentier Trophee Mondial−Reunion) T−Reu 81 Cratopopsis alluaudi (Bayonne−Reunion) T−Reu 4396 Cratopopsis alluaudi (Cap Blanc−Reunion) T−Reu 4458 Cratopopsis alluaudi (Cap Blanc−Reunion) T−Reu 4374 Cratopopsis alluaudi (Cap Blanc−Reunion) T−Reu 4343 Cratopopsis alluaudi (Cap Blanc−Reunion) T−Reu 2367 Cratopopsis alluaudi (Plaine des Gregues−Reunion) T−Reu 3462 Cratopopsis antiquus (Piton Mahot−Reunion) T−Reu 3458 Cratopopsis antiquus (Piton Mahot−Reunion) T−Reu 3460 Cratopopsis antiquus (Piton Mahot−Reunion) T−Reu 3459 Cratopopsis antiquus (Piton Mahot−Reunion) T−Reu 3471 Cratopopsis antiquus (Piton Hyacinthe−Reunion) T−Reu 3522 Cratopopsis antiquus (Piton Hyacinthe−Reunion) T−Reu 3526 Cratopopsis antiquus (Piton Hyacinthe−Reunion) T−Reu 3467 Cratopopsis antiquus (Piton Hyacinthe−Reunion) T−Reu 3465 Cratopopsis antiquus (Piton Hyacinthe−Reunion) T−Reu 268 Cratopopsis cribatus (Volcano−Reunion) T−Reu 228 Cratopopsis cribatus (Volcano−Reunion) T−Reu 257 Cratopopsis obscurus (Volcano−Reunion) T−Reu 256 Cratopopsis obscurus (Volcano−Reunion) T−Reu 258 Cratopopsis obscurus (Volcano−Reunion) T−Reu 269 Cratopopsis cribatus (Volcano−Reunion) T−Reu 261 Cratopopsis obscurus (Volcano−Reunion) T−Reu 232 Cratopopsis cribatus (Volcano−Reunion) T−Reu 241 Cratopopsis cribatus (Volcano−Reunion) T−Reu 3246 Cratopopsis coquereli (Le Maido−Reunion) T−Reu 3236 Cratopopsis coquereli (Le Maido−Reunion) T−Reu 3243 Cratopopsis coquereli (Le Maido−Reunion) T−Reu 3253 Cratopopsis coquereli (Le Maido−Reunion) T−Reu 3232 Cratopopsis coquereli (Le Maido−Reunion) T−Reu 227 Cratopopsis coquereli (Volcano−Reunion) T−Reu 230 Cratopopsis coquereli (Volcano−Reunion) T−Reu 225 Cratopopsis coquereli (Volcano−Reunion) T−Reu 237 Cratopopsis coquereli (Volcano−Reunion) T−Reu 3146 Cratopopsis coquereli (Piton de l'eau−Reunion) T−Reu 235 Cratopopsis coquereli (Volcano−Reunion) T−Reu 2664 Cratopopsis fulvicornis (Route des Tamarinds−Reunion) T−Reu 4137 Cratopopsis villosulus (Plaine d'Affouches−Reunion) T−Reu 4761 Cratopopsis fulvicornis (Trois Bassins−Reunion) T−Reu 2661 Cratopopsis fulvicornis (Route des Tamarinds−Reunion) T−Reu 4767 Cratopopsis fulvicornis (Trois Bassins−Reunion) T−Reu 4759 Cratopopsis fulvicornis (Trois Bassins−Reunion) T−Reu 4763 Cratopopsis fulvicornis (Trois Bassins−Reunion) T−Reu 2663 Cratopopsis fulvicornis (Route des Tamarinds−Reunion) T−Reu 4768 Cratopopsis fulvicornis (Trois Bassins−Reunion) T−Reu 2623 Cratopopsis fulvicornis (Le Maido−Reunion) T−Reu 5084 Cratopopsis obscurus (Plaine des Tamarinds−Reunion) T−Reu 5093 Cratopopsis obscurus (Plaine des Tamarinds−Reunion) T−Reu 5054 Cratopopsis obscurus (Plaine des Tamarinds−Reunion) T−Reu 5073 Cratopopsis obscurus (Plaine des Tamarinds−Reunion) T−Reu 3148 Cratopopsis fulvicornis (Route des Tamarinds−Reunion) T−Reu 2609 Cratopopsis fulvicornis (Le Maido−Reunion) T−Reu 2749 Cratopopsis fulvicornis (Route des Tamarinds−Reunion) T−Reu 2612 Cratopopsis fulvicornis (Le Maido−Reunion) T−Reu 2572 Cratopopsis fulvicornis (Le Maido−Reunion) T−Reu 2744 Cratopopsis fulvicornis (Route des Tamarinds−Reunion) T−Reu 2614 Cratopopsis fulvicornis (Le Maido−Reunion) T−Reu 3261 Cratopopsis obscurus (Route forrestiere du Maido−Reunion) T−Reu 3260 Cratopopsis obscurus (Route forrestiere du Maido−Reunion) T−Reu 3179 Cratopopsis villosulus (Les Makes−Reunion) T−Reu 4051 Cratopopsis villosulus (Les Makes−Reunion) T−Reu 3227 Cratopopsis villosulus (Les Makes−Reunion) T−Reu 4279 Cratopopsis nitidifrons (Foret de Bel Air−Reunion) T−Reu 4296 Cratopopsis nitidifrons (Foret de Bel Air−Reunion) T−Reu 4194 Cratopopsis nitidifrons (Foret de Bel Air−Reunion) T−Reu 2720 Cratopopsis fulvicornis (Route des Tamarinds−Reunion) T−Reu 296 Cratopopsis fulvicornis (Le Block−Reunion) T−Reu 4873 Cratopopsis villosulus (Plaine des Chicots−Reunion) T−Reu 2430 Cratopopsis obscurus (Route de Plaine de les fougiers−Reunion) T−Reu 3765 Cratopopsis obscurus (Plaine des Fougiers−Reunion) T−Reu 2426 Cratopopsis obscurus (Plaine des Fougiers−Reunion) T−Reu 3757 Cratopopsis obscurus (Plaine des Fougiers−Reunion) T−Reu 3799 Cratopopsis villosulus (Plaine des Fougiers−Reunion) T−Reu 4777 Cratopopsis obscurus (Plaine des Chicots−Reunion) T−Reu 4775 Cratopopsis obscurus (Plaine des Chicots−Reunion) T−Reu 4072 Cratopopsis obscurus (Plaine d'Affouches−Reunion) T−Reu 4780 Cratopopsis obscurus (Plaine des Chicots−Reunion) T−Reu 3254 Cratopopsis obscurus (Le Maido−Reunion) T−Reu 2735 Cratopopsis fulvicornis (Route des Tamarinds−Reunion) T−Reu 4857 Cratopopsis villosulus (Le Block−Reunion) T−Reu 4779 Cratopopsis cribatus (Plaine des Chicots−Reunion) T−Reu 4781 Cratopopsis obscurus (Plaine des Chicots−Reunion) T−Reu 4805 Cratopopsis obscurus (Plaine des Chicots−Reunion) T−Reu 4778 Cratopopsis villosulus (Plaine des Chicots−Reunion) T−Reu 4841 Cratopus humeralis (Plaine des Chicots−Reunion) T−Reu 4840 Cratopus humeralis (Plaine des Chicots−Reunion) T−Reu 4149 Cratopus humeralis (Plaine d'Affouches−Reunion) T−Reu 4136 Cratopus humeralis (Plaine d'Affouches−Reunion) T−Reu 2037 Cratopus humeralis (Plaine d'Affouches−Reunion) T−Reu 2036 Cratopus humeralis (Plaine d'Affouches−Reunion) T−Reu 4153 Cratopus humeralis (Plaine d'Affouches−Reunion) T−Reu 4586 Cratopus humeralis (Site Dior−Reunion) T−Reu 4588 Cratopus humeralis (Site Dior−Reunion) T−Reu 3554 Cratopus humeralis (Foret de Bebour−Reunion) T−Reu 3587 Cratopus humeralis (Foret de Bebour−Reunion) T−Reu 3175 Cratopus humeralis (Les Makes−Reunion) T−Reu 3173 Cratopus humeralis (Les Makes−Reunion) T−Reu 3218 Cratopus humeralis (Les Makes−Reunion) T−Reu 3170 Cratopus humeralis (Les Makes−Reunion) T−Reu 2004 Cratopus humeralis (Piton Hyacinthe−Reunion) T−Reu 3058 Cratopus humeralis (Plaine des Gregues−Reunion) T−Reu 3067 Cratopus humeralis (Plaine des Gregues−Reunion) T−Reu 4657 Cratopus humeralis (Grande Coude−Reunion) T−Reu 4682 Cratopus humeralis (Grande Coude−Reunion) T−Reu 3675 Cratopus humeralis (Foret du Volcane−Reunion) T−Reu 3671 Cratopus humeralis (Foret du Volcane−Reunion) T−Reu 3672 Cratopus humeralis (Foret du Volcane−Reunion) T−Reu 3673 Cratopus humeralis (Foret du Volcane−Reunion) T−Reu 3674 Cratopus humeralis (Foret du Volcane−Reunion) T−Reu 2831 Cratopus humeralis (Trois Bassins−Reunion) T−Reu 2827 Cratopus humeralis (Trois Bassins−Reunion) T−Reu 2830 Cratopus humeralis (Trois Bassins−Reunion) T−Reu 2829 Cratopus humeralis (Trois Bassins−Reunion) T−Reu 2826 Cratopus humeralis (Trois Bassins−Reunion) T−Reu 3043 Cratopus humeralis (Colorado−Reunion) T−Reu 4028 Cratopus leucophaetus (Les Makes−Reunion) T−Reu 3255 Cratopus humeralis (Etang St Paul−Reunion) T−Reu 3257 Cratopus humeralis (Etang St Paul−Reunion) T−Reu 2411 Cratopus humeralis (Ravine de la Grande Chaloupe−Reunion) T−Reu 2409 Cratopus humeralis (Ravine de la Grande Chaloupe−Reunion) T−Reu 2145 Cratopus leucophaetus (Ravine de la Grande Chaloupe−Reunion) T−Reu 2410 Cratopus humeralis (Ravine de la Grande Chaloupe−Reunion) T−Reu 2412 Cratopus humeralis (Ravine de la Grande Chaloupe−Reunion) T−Reu 3925 Cratopus humeralis (Foret dominale de la cote sous le vent−Reunion) T−Reu 3923 Cratopus humeralis (Foret dominale de la cote sous le vent−Reunion) T−Reu 2141 Cratopus humeralis (Etang du Gol−Reunion) T−Reu 3919 Cratopus humeralis (Foret dominale de la cote sous le vent−Reunion) T−Reu 2161 Cratopus humeralis (Etang du Gol−Reunion) T−Reu 2158 Cratopus humeralis (Etang du Gol−Reunion) T−Reu 2176 Cratopus humeralis (Piton Desforges−Reunion) T−Reu 123 Cratopus humeralis (Bayonne−Reunion) T−Reu 3301 Cratopus humeralis (Bayonne−Reunion) T−Reu 2245 Cratopus humeralis (Etang du Gol−Reunion) T−Reu 3924 Cratopus humeralis (Foret dominale de la cote sous le vent−Reunion) T−Reu 125 Cratopus humeralis (Bayonne−Reunion) T−Reu 3916 Cratopus humeralis (Foret dominale de la cote sous le vent−Reunion) T−Reu 3168 Cratopus humeralis (Le Tampon−Reunion) T−Reu 2843 Cratopus humeralis (Piton de Grande Anse−Reunion) T−Reu 2839 Cratopus humeralis (Piton de Grande Anse−Reunion) T−Reu 3807 Cratopus humeralis (Sentier Trophee Mondial−Reunion) T−Reu 2382 Cratopus humeralis (Foret de Bel Air−Reunion) T−Reu 3825 Cratopus humeralis (Sentier Trophee Mondial−Reunion) T−Reu 3169 Cratopus humeralis (Le Tampon−Reunion) T−Reu 3292 Cratopus humeralis (Bayonne−Reunion) T−Reu 126 Cratopus humeralis (Bayonne−Reunion) T−Reu 3822 Cratopus humeralis (Sentier Trophee Mondial−Reunion) T−Reu 3463 Cratopus humeralis (Piton Hyacinthe−Reunion) T−Reu 3819 Cratopus humeralis (Sentier Trophee Mondial−Reunion) T−Reu 2841 Cratopus humeralis (Piton de Grande Anse−Reunion) T−Reu 3171 Cratopus leucophaetus (Les Makes−Reunion) T−Reu 3405 Cratopus humeralis (Piton Mahot−Reunion) T−Reu 3152 Cratopus humeralis (Les Makes−Reunion) T−Reu 2116 Cratopus humeralis (Ravine de la Grande Chaloupe−Reunion) T−Reu 3021 Cratopus humeralis (Piton Textor−Reunion) T−Reu 2386 Cratopus humeralis (Foret de Bel Air−Reunion) T−Reu 2380 Cratopus humeralis (Foret de Bel Air−Reunion) T−Reu 2838 Cratopus humeralis (Piton de Grande Anse−Reunion) T−Reu 2846 Cratopus humeralis (Piton de Grande Anse−Reunion) T−Reu 2383 Cratopus fulvescens (Foret de Bel Air−Reunion) T−Reu 2381 Cratopus humeralis (Foret de Bel Air−Reunion) T−Reu 2385 Cratopus humeralis (Foret de Bel Air−Reunion) T−Reu 2415 Cratopus ditissimus (Ravine de la Grande Chaloupe−Reunion) T−Reu 2416 Cratopus ditissimus (Ravine de la Grande Chaloupe−Reunion) T−Reu 2923 Cratopus ditissimus (Mare Longue−Reunion) T−Reu 2913 Cratopus ditissimus (Mare Longue−Reunion) T−Reu 3343 Cratopus ditissimus (Bayonne−Reunion) T−Reu 3640 Cratopus ditissimus (Vallee Heureuse−Reunion) T−Reu 2000 Cratopus ditissimus (Basse Vallee−Reunion) T−Reu 3616 Cratopus nanus (Foret de Bebour−Reunion) T−Reu 3610 Cratopus nanus (Foret de Bebour−Reunion) T−Reu 3546 Cratopus nanus (Foret de Bebour−Reunion) T−Reu 3612 Cratopus nanus (Foret de Bebour−Reunion) T−Reu 3789 Cratopus nanus (Plaine des Fougiers−Reunion) T−Reu 3795 Cratopus nanus (Plaine des Fougiers−Reunion) T−Reu 482 Cratopus nanus (Ravine de la Grande Chaloupe−Reunion) T−Reu 2209 Cratopus nanus (Plaine d'Affouches−Reunion) T−Reu 4848 Cratopus nanus (Plaine des Chicots−Reunion) T−Reu 4844 Cratopus nanus (Plaine des Chicots−Reunion) T−Reu 4846 Cratopus nanus (Plaine des Chicots−Reunion) T−Reu 4849 Cratopus nanus (Plaine des Chicots−Reunion) T−Reu 3071 Cratopus nanus (Piton Enchaing−Reunion) T−Reu 3070 Cratopus nanus (Piton Enchaing−Reunion) T−Reu 2142 Cratopus nanus (Plaine d'Affouches−Reunion) T−Reu 2024 Cratopus nanus (Plaine d'Affouches−Reunion) T−Reu 4842 Cratopus nanus (Plaine des Chicots−Reunion) T−Reu 2157 Cratopus nanus (Plaine d'Affouches−Reunion) T−Reu 2123 Cratopus nanus (Plaine d'Affouches−Reunion) T−Reu 3217 Cratopus nanus (Les Makes−Reunion) T−Reu 3176 Cratopus nanus (Les Makes−Reunion) T−Reu 3178 Cratopus nanus (Les Makes−Reunion) T−Reu 3219 Cratopus nanus (Les Makes−Reunion) T−Reu 3192 Cratopus nanus (Les Makes−Reunion) T−Reu 2113 Cratopus nanus (Ravine de la Grande Chaloupe−Reunion) T−Reu 3439 Cratopus nanus (Piton Mahot−Reunion) T−Reu 3454 Cratopus nanus (Piton Mahot−Reunion) T−Reu 2069 Cratopus nanus (Piton Desforges−Reunion) T−Reu 2001 Cratopus nanus (Piton Desforges−Reunion) T−Reu 2108 Cratopus nanus (Ravine de la Grande Chaloupe−Reunion) T−Reu 2073 Cratopus nanus (Piton Desforges−Reunion) T−Reu 2115 Cratopus nanus (Ravine de la Grande Chaloupe−Reunion) T−Reu 2074 Cratopus nanus (Piton Desforges−Reunion) T−Reu 2225 Cratopus nanus (Piton Hyacinthe−Reunion) T−Reu 2205 Cratopus nanus (Piton Desforges−Reunion) T−Reu 2111 Cratopus nanus (Ravine de la Grande Chaloupe−Reunion) T−Reu 3437 Cratopus nanus (Piton Mahot−Reunion) T−Reu 3438 Cratopus nanus (Piton Mahot−Reunion) T−Reu 2107 Cratopus nanus (Piton Hyacinthe−Reunion) T−Reu 4510 Cratopus nanus (Foret Dominale Notre Dame de la Paix−Reunion) T−Reu 2106 Cratopus nanus (Piton Hyacinthe−Reunion) T−Reu 4540 Cratopus nanus (Foret Dominale Notre Dame de la Paix−Reunion) T−Reu 4506 Cratopus nanus (Foret Dominale Notre Dame de la Paix−Reunion) T−Reu 2364 Cratopus nanus (Foret de Bel Air−Reunion) T−Reu 4605 Cratopus nanus (Site Dior−Reunion) T−Reu 388 Cratopus nanus (Hell Bourg−Reunion) T−Reu 4595 Cratopus nanus (Site Dior−Reunion) T−Reu 4546 Cratopus nanus (Site Dior−Reunion) T−Reu 4609 Cratopus nanus (Site Dior−Reunion) T−Reu 3719 Cratopus nanus (Takamaka−Reunion) T−Reu 3723 Cratopus nanus (Takamaka−Reunion) T−Reu 3732 Cratopus nanus (Takamaka−Reunion) T−Reu 4601 Cratopus nanus (Site Dior−Reunion) T−Reu 3608 Cratopus nanus (Foret de Bebour−Reunion) T−Reu 2766 Cratopus nanus (Grand Etang−Reunion) T−Reu 3728 Cratopus nanus (Takamaka−Reunion) T−Reu 3730 Cratopus nanus (Takamaka−Reunion) T−Reu 3741 Cratopus nanus (Grand Etang−Reunion) T−Reu 3839 Cratopus nanus (Grand Etang−Reunion) T−Reu 2762 Cratopus nanus (Grand Etang−Reunion) T−Reu 3837 Cratopus nanus (Grand Etang−Reunion) T−Reu 4920 Cratopus nanus (Le Block−Reunion) T−Reu 4937 Cratopus nanus (Le Block−Reunion) T−Reu 4919 Cratopus nanus (Le Block−Reunion) T−Reu 4340 Cratopus nanus (Plaine des Gregues−Reunion) T−Reu 2398 Cratopus nanus (Foret de Bel Air−Reunion) T−Reu 4703 Cratopus nanus (Grande Coude−Reunion) T−Reu 4659 Cratopus nanus (Grande Coude−Reunion) T−Reu 4654 Cratopus nanus (Grande Coude−Reunion) T−Reu 4687 Cratopus nanus (Grande Coude−Reunion) T−Reu 4339 Cratopus nanus (Plaine des Gregues−Reunion) T−Reu 3285 Cratopus nanus (Bayonne−Reunion) T−Reu 3291 Cratopus nanus (Bayonne−Reunion) T−Reu 2366 Cratopus nanus (Foret de Bel Air−Reunion) T−Reu 2032 Cratopus nanus (Vallee Heureuse−Reunion) T−Reu 2535 Cratopus nanus (Vallee Heureuse−Reunion) T−Reu 4347 Cratopus nanus (Cap Blanc−Reunion) T−Reu 4331 Cratopus nanus (Plaine des Gregues−Reunion) T−Reu 3287 Cratopus nanus (Bayonne−Reunion) T−Reu 3289 Cratopus nanus (Bayonne−Reunion) T−Reu 130 Cratopus nanus (Bayonne−Reunion) T−Reu 4328 Cratopus nanus (Plaine des Gregues−Reunion) T−Reu 4338 Cratopus nanus (Plaine des Gregues−Reunion) T−Reu 4698 Cratopus nanus (Grande Coude−Reunion) T−Reu 4365 Cratopus nanus (Cap Blanc−Reunion) T−Reu 2378 Cratopus nanus (Foret de Bel Air−Reunion) T−Reu 4342 Cratopus nanus (Cap Blanc−Reunion) T−Reu 4350 Cratopus nanus (Cap Blanc−Reunion) T−Reu 2390 Cratopus nanus (Foret de Bel Air−Reunion) T−Reu 4369 Cratopus nanus (Cap Blanc−Reunion) T−Reu 2520 Cratopus nanus (Vallee Heureuse−Reunion) T−Reu 2561 Cratopus nanus (Vallee Heureuse−Reunion) T−Reu 2172 Cratopus nanus (Basse Vallee−Reunion) T−Reu 3092 Cratopus nanus (Basse Vallee−Reunion) T−Reu 2083 Cratopus nanus (Vallee Heureuse−Reunion) T−Reu 2173 Cratopus nanus (Basse Vallee−Reunion) T−Reu 3093 Cratopus nanus (Basse Vallee−Reunion)
Figure S1.5.1: A maximum likelihood tree generated in RAxML version 7.7.1. Stars mark samples of C. caliginosus that are recovered as part of the C. murinus morphospecies group. Red samples are from Mauritius, blue samples are from Réunion and green samples are from Rodrigues. Page 35 of 45 Journal of Biogeography
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Outgroup Naupactus xanthographus (GenBank (GU176345.1)) 27 28 29 Scaevinus dombayae (Mauritius) 30 31 32 33 34 35 Scaevinus subtruncatus (Mauritius) 36 37 38 39 40 Cratopus bernei (Réunion) 41 42 43 44 45 46 Cratopus armatus (Mauritius) 47 48 49 50 51 52 53 Cratopus nigridorsis OTU 54 Cratopus nigridorsis (Réunion) 55 56 Cratopus circumcinctus (Réunion) 57 Cratopus marmoreus (Réunion) 58 59 60
Cratopus viridilimbatus (Mauritius)
Cratopus frapieri OTU
Cratopus frapieri (Réunion) Cratopus tristis (Réunion)
Cratopus septemvittatus (Réunion)
Cratopus melancephalus (Mauritius)
Cratopus exquisitus (Réunion)
Cratopus carei (Mauritius) Cratopus fasciger (Mauritius) Cratopus mundulus (Mauritius) Cratopus viridipunctatus (Mauritius)
Cratopus virescens (Mauritius)
Mauritian Cratopopsis group
Cratopopsis impressus (Mauritius) Cratopopsis mauritianus (Mauritius) Cratopopsis bistigma (Réunion) Cratopus striga (Mauritius)
Cratopus aeneoniger OTU
Cratopus aeneoniger (Mauritius) Cratopus brunnipes (Réunion) Cratopus confusus (Mauritius) Cratopus deceptus (Mauritius) Cratopus emarginatus (Mauritius) Cratopus stigmaeus (Mauritius) Cratopus vulgaris (Mauritius)
For Peer Review
Cratopus caliginosus (Mauritius)
Cratopus molitor (Mauritius) Cratopus psittacus (Mauritius)
Cratopus ovalis (Mauritius)
Cratopus murinus group
Cratopus murinus (Mauritius) Cratopus murinus (Réunion) Cratopus tigratus (Mauritius) Cratopus viridulus (Mauritius) Cratopus caliginosus (Mauritius)
Cratopus nigrogranatus (Mauritius) Cratopus variegatus (Mauritius)
Cratopus rocki (Rodrigues)
Cratopopsis pauliani (Rodrigues)
Cratopus punctum (Réunion) Cratopus punctum (Mauritius)
Réunion Cratopopsis group
Cratopopsis alluaudi (Réunion) Cratopopsis coquereli (Réunion) Cratopopsis cribatus (Réunion) Cratopopsis fulvicornis (Réunion) Cratopopsis nitidifrons (Réunion) Cratopopsis obscurus (Réunion) Cratopopsis villosulus (Réunion)
Cratopus humeralis group
Cratopus humeralis (Réunion) Cratopus fulvescens (Réunion) Cratopus leucophaetus (Réunion)
Cratopus ditissimus (Réunion)
Cratopus nanus (Réunion)
Figure S1.5.2: A maximum likelihood tree generated in RAxML version 7.7.1. Coloured rectangles represent the defined OTUs. Red rectangles contain samples from Mauritius, blue rectangles contain samples from Réunion and green rectangles contain samples from Rodrigues. Bicoloured rectangles contain samples from two islands. Journal of Biogeography Page 36 of 45
1 2 3 S1.6: DNA extraction, PCR amplification and sequencing of nuclear loci 4 5 Based on clustering of COII sequences, individuals were chosen for the amplification and DNA 6 sequencing of three additional loci: Arginine Kinase (ArgK), Histone 3 and the ribosomal gene 7 28S. Both ArgK and Histone 3 were amplified with a nested PCR. For ArgK a first amplification 8 was performed with the primers ArgKforB2 and ArgKrevB1 [both attributed to Danforth et al. 9 (2005) in McKenna et al. (2009)] with 0.5 mM of each primer, 5 mM MgCl2 and a thermal profile 10 of: 95°C for 60s, 50°C for 60s and 72°C for 120s, 37 cycles. 1 µl of the PCR product was then used 11 as template for a second PCR with the primers ArgK_F1_semidg and ArgK_R2_fulldg with 0.5 12 13 mM of each primer, 4.3 mM MgCl2 and a thermal profile of: 95°C for 60s, 57°C for 60s and 72°C 14 for 120s, 37 cycles, and PCR products were sequenced with ArgK_F1_semidg. For Histone 3 a 15 first amplification was performed with M13REVH3AF and M13(-21)H3AR, primers modified 16 from Colgan et al. (1998), these are the primers listed in with M13 tails to improve PCR yield 17 (Regier & Shi 2005). The thermal profile for Histone 3 employed a touchdown protocol (Don et 18 al. 1991) of 94°C for 60s, 60°C for 60s and 72°C for 120s (touched down by 1°C per cycle), 5 19 cycles, followed by 35 cycles with an annealing temperature of 55°C with 0.5 mM of each 20 primer, 5 mM MgCl and PCR products were separated on an agarose gel and a target band of 21 2 For Peer Review 22 approximately 330bp sampled with a pipette tip. Tips were then soaked in 10 µl of H2O for 20 23 minutes to release PCR product, and 1 µl of the resulting solution used as the template for a 24 second PCR with the primers H3AF and H3AR, and the thermal profile of the first PCR. 25 Sequencing was carried out in both directions using H3AF and H3AR. 28S was amplified using 26 the primers 28SDD and 28SFF (Ahrens et al. 2007) with 0.5 mM of each primer, 2 mM MgCl2 and 27 a thermal profile of: 94°C for 60s, 50°C for 30s and 72°C for 30s, 31 cycle, and PCR products 28 were then sequenced with 28SDD. Sequences for all primers used can be found in Table S1.6.1. 29 DNA sequences were read on a 3730XL sequencer (Applied Biosystems). 30 31 All sequences were checked, and in the case of reverse sequencing, consensus sequences 32 generated with Geneious Pro version 5.6 (Drummond et al. 2012). Sequences were aligned 33 using MAFFT v6.814b (Katoh et al. 2002) with the following parameter values: scoring matrix 34 1PAM/k=2, Gap open penalty = 1.53, Offset value = 0.123, and then checked by eye. The aligned 35 sequences were tested for saturation using the entropy-based index of substitution saturation 36 (Xia et al. 2003) as implemented in DAMBE v5.2.78 (Xia & Xie 2001). This was performed on 37 two data sets, one comprised of the first and second codon positions and the second comprised 38 of the third codon positions, with the exception of 28S which was not partitioned. 39 40 41 Table S1.6.1: Primers used in this study. 42 Primer Direction Locus Sequence (5'-3') 43 COIICraF Forward COII TAATATGGCAGAWTAGTGCAATGGA 44 45 COIICraR Reverse COII TGCTTTCAGTCATCTAATGATCTRTTTACAGA 46 ArgKforB2 Forward ArgK GAYTCCGGWATYGGWATCTAYGCTCC 47 ArgKrevB1 Reverse ArgK TCNGTRAGRCCCATWCGTCTC 48 49 ArgK_F1_semidg Forward ArgK (nested) GATCCCATCATHGARGAYTARCA 50 ArgK_R2_fulldg Reverse ArgK (nested) GTNCCYAARTTNGTNGGRCARAA 51 M13REVH3AF Forward H3 CAGGAAACAGCTATGACCATGGCTCGTACCAAGCAGACVGC 52 53 M13(-21)H3AR Reverse H3 TGTAAAACGACGGCCAGTATATCCTTRGGCATRATRGTGAC 54 H3AF Forward H3 (nested) ATGGCTCGTACCAAGCAGACVGC 55 H3AR Reverse H3 (nested) ATATCCTTRGGCATRATRGTGAC 56 57 28SDD Forward 28S GGGACCCGTCTTGAAACAC 58 28SFF Reverse 28S TTACACACTCCTTAGCGGAT 59 60 Page 37 of 45 Journal of Biogeography
1 2 3 References 4 5 Ahrens, D., Monaghan, M.T. & Vogler, A.P. (2007). DNA-based taxonomy for associating adults 6 and larvae in multi-species assemblages of chafers (Coleoptera: Scarabaeidae). Mol. 7 8 Phylogenet. Evol., 44, 436–449. 9 Colgan, D.J., McLauchlan, A., Wilson, G.D.F., Livingston, S.P., Edgecombe, G.D., Macaranas, J., et al. 10 (1998). Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. 11 Aust. J. Zool., 46, 419–437. 12 Danforth, B.N., Lin, C.-P. & Fang, J. (2005). How do insect nuclear ribosomal genes compare to 13 protein-coding genes in phylogenetic utility and nucleotide substitution patterns? Syst. 14 Entomol., 30, 549–562. 15 Don, R.H., Cox, P.T., Wainwright, B.J., Baker, K. & Mattick, J.S. (1991). “Touchdown” PCR to 16 circumvent spurious priming during gene amplification. Nucleic Acids Res., 19, 4008. 17 Drummond, A.J., Ashton, B., Buxton, S., Cheung, M., Cooper, A., Duran, C., et al. (2012). Geneious 18 v5.6, available from http://www.geneious.com/. 19 Ferragu, M. & Richard, R. (1990). Trois nouveaux Curculionides de Madagascar et de l’Île de la 20 Réunion (Coleoptera). Nouv. Rev. Entomol., 12, 105–110. 21 For Peer Review 22 Ferragu, M. & Richard, R. (1993). Etude portant sur les Cratopus de l’Ile de la Réunion 23 (Coleoptera: Curculionidae). Revue Française d’Entomologie (N.S.), 14, 111–116. 24 Galman, G., Matyot, P. & Voisin, J.-F. (2011). Le genre Cratopus aux îles Seychelles (Coleoptera: 25 Curculionidae). Annales de la Société entomologique de France (N.S.), 47, 229–240. 26 Hustache, A. (1919). Synopsis des Curculionides de la faune malgache. I. Brachydérides et 27 Otiorrhynchides. Ann. Soc. Entomol. Fr., 87, 441–520. 28 Hustache, A. (1920). Curculionides des Iles Mascareignes. Extrait des Annales de la Societe 29 Entomologique de France, 89, 113–203. 30 Katoh, K., Misawa, K., Kuma, K.-I. & Miyata, T. (2002). MAFFT: a novel method for rapid multiple 31 sequence alignment based on fast Fourier transform. Nucleic Acids Res., 30, 3059–3066. 32 McKenna, D.D., Sequeira, A.S., Marvaldi, A.E. & Farrell, B.D. (2009). Temporal lags and overlap in 33 the diversification of weevils and flowering plants. Proc. Natl. Acad. Sci. U. S. A., 106, 7083– 34 7088. 35 36 Poussereau, J. & Voisin, J.-F. (2009). Cratopus francki, espèce nouvelle de la Réunion (Coleoptera, 37 Curculionidae). Bull. Soc. Entomol. France, 114, 361–364. 38 Regier, J.C. & Shi, D. (2005). Increased yield of PCR product from degenerate primers with 39 nondegenerate, nonhomologous 5’ tails. Biotechniques, 38, 34, 36, 38. 40 Richard, R. (1957). Coléoptères Curculionidae de La Réunion. Mémoires de l’Institut Scientifique 41 de Madagascar, (E), 8, 59–94. 42 Richard, R. (1958). Curculionides nouveaux ou mal connus des Comores, ile Glorieuse, ile 43 Europa New or little known Curculionidae from the Comoro Islands, Glorioso Island and 44 Europa Island. Mémoires de l’Institut Scientifique de Madagascar, (E), 10, 41–63. 45 Richard, R. (1961). Notes sur quelques Curculionides de l’ile Rodriguez. The Mauritius Institute 46 Bulletin, 5, 213–220. 47 Richard, R. (1977). Nouveaux Curculionides des iles Europa et de la Réunion. Bull. Soc. Entomol. 48 France, 82, 125–127. 49 Richard, R. (1995a). Description de deux Cratopini nouveaux de la région Malgache [Coleoptera: 50 51 Curculionidae]. Nouv. Rev. Entomol., 17, 63–65. 52 Richard, R. (1995b). Note sur l’apparition brusque d'une variation importante de la 53 squamulation de Cratopus humeralis Boheman (Coleoptera: Curculionidae). Bull. Soc. 54 Entomol. France, 100, 303–306. 55 Stamatakis, A., Hoover, P. & Rougemont, J. (2008). A rapid bootstrap algorithm for the RAxML 56 Web servers. Syst. Biol., 57, 758–771. 57 Vinson, J. (1967). Liste Chorologique des Coleopteres des Mascareignes. The Mauritius Institute 58 Bulletin, 4, 299–357. 59 Voisin, J.-F. & Poussereau, J. (2007a). Charactérisation de Cratopus frappieri Deyrolle, 1862 60 (Coleoptera, Curculionidae). Nouv. Rev. Entomol., 24, 329–334. Journal of Biogeography Page 38 of 45
1 2 3 Voisin, J.-F. & Poussereau, J. (2007b). L’identité de Cratopus sumptuosus Boheman, 1834, de 4 Cratopus exquisitus Boheman, 1840, et de Cratopus sandi Deyrolle, 1862, espèces 5 endémiques de l’île de la Réunion (Coleoptera, Curculionidae). Nouv. Rev. Entomol., 24, 6 279–283. 7 8 Voisin, J.-F. & Poussereau, J. (2009). A propos de Cratopus nanus et de Cratopus parvus de l’île de 9 la Réunion (Coleoptera, Curculionidae). Nouv. Rev. Entomol., 26, 59–65. 10 Williams, J.R. & Cox, M.L. (2003). A contribution to the study of Mascarene Weevils of the genus 11 Cratopus Schonherr (Coleoptera: Curculionidae: Entiminae: Cratopini): The species of 12 Mauritius and Rodrigues. The Mauritius Institute Bulletin, 12, 1–67. 13 Xia, X. & Xie, Z. (2001). DAMBE: software package for data analysis in molecular biology and 14 evolution. J. Hered., 92, 371–373. 15 Xia, X., Xie, Z., Salemi, M., Chen, L. & Wang, Y. (2003). An index of substitution saturation and its 16 application. Mol. Phylogenet. Evol., 26, 1–7. 17 18 19 20 21 For Peer Review 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 39 of 45 Journal of Biogeography
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 For Peer Review 22 23 24 25 26 27 28 29 30 31 32 33 34 Fig S2.3: A Bayesian inference tree generated by MrBayes using an alignment of Cratopine COII 35 sequences. Values placed on nodes represent Bayesian posterior probabilities for that node. 36 Cratopopsis bistigma and Cratopopsis mauritianus are highlighted to show incongruence 37 38 between nuclear loci and COII. 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Journal of Biogeography Page 40 of 45
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 For Peer Review 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 Fig S2.4: A Bayesian inference tree generated by Mr Bayes using an alignment of Cratopine ArgK 43 sequences. Values placed on nodes represent Bayesian posterior probabilities for that node. 44 Cratopopsis bistigma and Cratopopsis mauritianus are highlighted to show incongruence 45 between nuclear loci and COII. 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 41 of 45 Journal of Biogeography
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 For Peer Review 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 Fig S2.5: A Bayesian inference tree generated by MrBayes using an alignment of Cratopine 46 Histone 3 sequences. Values placed on nodes represent Bayesian posterior probabilities for that 47 node. Cratopopsis bistigma and Cratopopsis mauritianus are highlighted to show incongruence 48 49 between nuclear loci and COII. 50 51 52 53 54 55 56 57 58 59 60 Journal of Biogeography Page 42 of 45
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 For Peer Review 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 Fig S2.6: A Bayesian inference tree generated by Mr Bayes using an alignment of Cratopine 28S 37 sequences. Values placed on nodes represent Bayesian posterior probabilities for that node. 38 Cratopopsis bistigma and Cratopopsis mauritianus are highlighted to show incongruence 39 between nuclear loci and COII. 40 41
42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 43 of 45 Journal of Biogeography
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 For Peer Review 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 Fig S2.7: A Bayesian inference chronogram generated by BEAST2 using all four loci. Values 57 placed on nodes represent Bayesian posterior probabilities for that node, blue bars on nodes 58 represent the 95% HPD interval on node heights. 59 60 Journal of Biogeography Page 44 of 45
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 For Peer Review 20 21 22 23 24 25 26 27 28 29 30 31 Twitter image 32 33 288x216mm (180 x 180 DPI) 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 45 of 45 Journal of Biogeography
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 For Peer Review 20 21 22 23 24 25 26 Cirque de Mafate on Reunion Island as seen from Col de Boeufs inset with examples of the species rich 27 Cratopine weevils found throughout the Mascarene islands. From left to right: Cratopus marmoreus 28 (Reunion), Scaevinus dombayae (Reunion), Cratopus fasciger (Mauritius) 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60