Phylogenetic Analysis of Spiroplasmas from Three Freshwater Crustaceans (Eriocheir Sinensis, Procambarus Clarkia and Penaeus Vannamei) in China

Home , Spiroplasma citri, Spiroplasma mirum

Journal of Invertebrate Pathology 99 (2008) 57–65

Contents lists available at ScienceDirect

Journal of Invertebrate Pathology

journal homepage: www.elsevier.com/locate/yjipa

Phylogenetic analysis of Spiroplasmas from three freshwater crustaceans (Eriocheir sinensis, Procambarus clarkia and Penaeus vannamei) in China

Keran Bi, Hua Huang, Wei Gu, Junhai Wang, Wen Wang *

Jiangsu Key Laboratory for Biodiversity & Biotechnology, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China article info abstract

Article history: Disease epizootics in freshwater culture crustaceans (crab, crayfish and shrimp) gained high attention Received 19 December 2007 recently in China, due to intensive developments of freshwater aquacultures. Spiroplasma was identified Accepted 18 June 2008 as a lethal pathogen of the above three freshwater crustaceans in previous studies. Further characteriza- Available online 24 June 2008 tion of these freshwater crustacean Spiroplasma strains were analyzed in the current study. Phylogenetic position was investigated by analysis of partial nucleotide sequences of 16S ribosomal RNA (rRNA), gyrB Keywords: and rpoB genes, together with complete sequencing of 23S rRNA gene and 16S–23S rRNA intergenetic Crustacean spacer regions (ISRs). Phylogenetic analysis of these sequences showed that the above-mentioned three 16S rRNA freshwater crustacean Spiroplasma strains were identical and had a close relationship with Spiroplasma 23S rRNA 16S–23S rRNA intergenetic spacer regions mirum. Furthermore, the genomic size, serological studies and experimental infection characteristics con- (ISRs) firmed that three freshwater crustacean Spiroplasma strains are a single species other than traditional S. gyrB mirum. Therefore, these data suggest that a single species of Spiroplasma infects all three investigated rpoB freshwater crustaceans in China, and is a potential candidate for a new species within the Spiroplasma Genomic size genus. These results provide critical information for the further investigations in fresh aquaculture epi- Western blot zootics related to tremor diseases, caused by this infectious agent. Spiroplasma Ó 2008 Elsevier Inc. All rights reserved. Phylogenetic analysis

1. Introduction occupy multiple habitats, they became able to invade the arthro- pod gut lumen, either as part of their life cycle or incidentally, to The Chinese mitten crab Eriocheir sinensis, red swamp crayfish invade other habitats in the hemolymph, ovaries, fat bodies, hypo- Procambarus clarkii and Pacific white shrimp Penaeus vannamei dermis and salivary glands. With much lower frequency, Spiroplasmas are important species in freshwater aquaculture in China. Disease have also been found in association with ticks and plants (Tully epizootics have occurred concurrently with the development of et al., 1987; Williamson et al., 1989, 1998). Because of their diverse aquaculture of these crustaceans. One of the most devastating dis- hosts, Spiroplasmas may be one of the most abundant groups of eases for the aquaculture was tremor disease of the Chinese mitten microbes on earth (Hackett and Clark, 1989; Hackett et al., crab E. sinensis. A Spiroplasma was previously identified as a poten- 1992). To date, 36 Spiroplasma species have been described and gi- tial causative pathogen of tremor disease in crustaceans (Wang ven binomial names. Hundreds of other isolates have been partially et al., 2003, 2004a, 2004b). Subsequently two other freshwater described, and some of these undoubtedly represent new Spiroplas- crustaceans, P. clarkia (Wang et al., 2005) and P. vannamei, were ma species (Regassa and Gasparich, 2006). Based on the 16S rRNA also found to be infected by Spiroplasmas. These Spiroplasmas gene sequences analysis, Gasparich et al. (2004) demonstrated the caused severe mortalities of E. sinensis, P. clarkia and P. vannamei genus Spiroplasma including 36 Spiroplasma spp. is divided into in southeast China (including Jiangsu, Anhui and Zhejiang three major phylogenetic clades, the Apis clade, the Citri-Chrysopi- provinces). cola-Mirum clade and the Ixodetis clade. The Citri-Chrysopicola- Spiroplasmas are among the smallest self-replicating prokary- Mirum clade is then divided further into the Citri-Poulsonii clade, otes, with genomes ranging in size from approximately 780– the Chrysopicola-Syrphidicola-TAAS-1 clade and the Mirum clade. 2220 kbp (Carle et al., 1995; Williamson et al., 1997). They are heli- The Mirum clade contains only a single member, Spiroplasma mir- cal, motile bacteria that apparently evolved via simplification of um that is the only one Spiroplasma species from rabbit ticks. Re- Gram-positive bacteria, although they lack a cell wall (Woese cently, the causative agent of tremor disease in E. sinensis has et al., 1980; Weisburg et al., 1989). As the organisms radiated to been identified as a member of the genus Spiroplasma that is closely related to S. mirum based on a limited 16S rDNA (less than 800 bp) phylogenetic analysis (Wang et al., 2004b). Subsequently, * Corresponding author. Fax: +86 858915265. E-mail address: [email protected] (W. Wang). the Spiroplasma from P. clarkii has also been identified in close

0022-2011/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.jip.2008.06.008 58 K. Bi et al. / Journal of Invertebrate Pathology 99 (2008) 57–65 relation to Spiroplasma sp. strain CRAB and S. mirum based on 16S (108 cells/mL) each, respectively. The other five crabs were inocu- rRNA gene sequences (271 bp) similarity in BLAST (Basic Local lated with 0.1 ml vacant R2 medium as a control. The inoculations Alignment Search Tool) searches (Wang et al., 2005). Therefore were made with a 1 ml syringe through the joint between the Wang et al. (2004b, 2005) have provided a hypothesis that the Mir- pereiopod and the thorax of every crab. Each group of crabs were um clade may contain another strain or species, but the relation- cultivated in aquaria (0.250 m3) equipped with a heating system. ship among Spiroplasma strains from three freshwater The water was changed every three days and the temperature crustaceans and S. mirum have not been clearly explained. was controlled at 28 °C and the O2 in water was maintained in In the phylogenetic analysis of the genus of Spiroplasma, several 7–8 mg/L. Blood smears of the crab were collected every five days studies showed that 16S rRNA gene is a widely accepted genetic and were observed with a Hitachi H-600 TEM for Spiroplasma marker for determining Spiroplasma identification and the inter- detection. species or intraspecies evolutionary relationships (Gasparich et al., 2004; Regassa and Gasparich, 2006). However, in some cases 2.2. Genomic DNA extraction the 16S rRNA genetic marker might be insufficient due to the pres- ence of low interspecies polymorphism in closely related species Genomic DNA was extracted from three cloned freshwater crus- within the genus Spiroplasma (Gasparich et al., 2004; Johansson, tacean Spiroplasma strains and S. mirum using the DNeasy Tissue 2000; Regassa and Gasparich, 2006; Stackebrandt et al., 2002). To Kit (Qiagen, Chatsworth, California), according to the manufac- circumvent the limitations of that 16S rRNA is too conserved, we turer’s protocol. Briefly, the density of a Spiroplasma cell achieved performed a phylogenetic study using five phylogenetic markers, approximate 108 cells/mL, cells were then harvested by centrifuga- 16S, 23S, ISRs, gyrB and rpoB sequence, to determine the phyloge- tion at 15,700g for 30 min at 4 °C, resuspended in ultrapure water, netic position of the Spiroplasmas from three freshwater crusta- and lysed with the DNeasy lysis buffer at 56 °C. The lysate was cean hosts. ISRs sequence was a genetic marker which could treated with RNase A (Promega Corporation, Madison, Wisconsin) successfully determine Spiroplasma identification (Volokhov and extracted the genomic DNA. The DNA concentration for each et al., 2006) and the evolutionary relationships among closely re- sample was determined by measuring absorbance at 260 nm, and lated Spiroplasma strains (Regassa et al., 2004; Von der Schulen- the quality of the DNA sample was verified on the basis of the burg et al., 2000). The gyrB gene was identified as a potential A260/A280 ratio. genetic marker for interspecies comparison within the genus Spi- roplasma (Regassa and Gasparich, 2006). The advantages of the 2.3. PCR amplification and sequencing of 16S, 23S, ISRs, gyrB and rpoB 23S rRNA and rpoB genes have been shown in the phylogenetic sequences analysis of other affined bacterial taxa, such as Mycoplasma and Acholeplasma species (Drancourt and Raoult, 2005; Gasparich Three pairs of PCR primers, 16F1/16R1, 16F2/23R1 and 23F1/5R, et al., 2004; Pitulle et al., 2002; Volokhov et al., 2007). were designed using sequences in the 16S, 23S and 5S rRNA genes On the other hand, we also performed genomic size, experimen- conserved for most Mollicutes. All PCR products were amplified for tal infection characteristics and serological studies to further eluci- four Spiroplasma strains using the PCR primer and corresponding date the relationships among Spiroplasmas from three freshwater annealing temperature in Table 1. All PCR products were obtained crustaceans, as well as S. mirum. from the four Spiroplasma strains using 50 ll reactions with the following combination of reagents: 100 ng of genomic DNA, 2. Materials and methods 100 pmol of each primer, 1 Taq polymerase Buffer, 0.2 mmol/L deoxynucleotide triphosphate (dNTPs), 2.5 U Taq polymerase (Pro-

2.1. Spiroplasmas strains and experimental infection mega), 1.5 mmol/L MgCl2, and ultrapure water to a final volume of 50 ll. Amplification cycles were completed as follows: denatur- Spiroplasma mirum was purchased from the American Type Cul- ation at 94 °C for 5 min; 35 cycles at 94 °C for 30 s, annealing tem- ture Collection (ATCC 29335) and grown in R2 medium (Moulder perature in Table 1 for 1 min, 72 °C for 90 s; and 1 cycle at 72 °C for et al., 2002)at37°C. Spiroplasmas from E. sinensis and P. clarkii 10 min. PCR products were separated on a 1.5% agarose gel and were cultured in the R2 medium at 30 °C. The Spiroplasma from purified using a BioSpin Gel extraction kit (BioFLUX). Amplified freshwater P. vannamei was first isolated from the moribund freshwater cultured P. vannamei using the methods described by Wang et al. (2004a). To obtain pure cultures of strains from E. sinensis, P. Table 1 clarkii and P. vannamei, a dilution cloning technique was used Primers and their anneal temperature (Whitcomb and Hackett, 1987). Actively growing Spiroplasma cul- Gene Primer type Primer Sequence 50–30 Fragment Anneal tures were serially diluted in R2 medium containing phenol red region size (bp) temperature indicator. Culture dilutions of 103–102 cells/mL were distributed 16S on 96-well microtitre plates with 100 ll per well. As cultures grew 16F1 PCR and CTAATACATGCAAGTCGAACG 16F1/16R1 65 °C and acidified, the media changed from red to yellow. The plates sequencing 1300 were observed daily for color change. Organisms growing within 16F2 PCR and GGTGCATGGTTGTCGTCAG 16F2/23R1 56 °C a single, isolated yellow well at the lowest possible dilution were sequencing 1000 subcultured after microscopic confirmation of their identity as 16R1 PCR and TTGCTGATTCGCGATTACTAG sequencing Spiroplasma. This cloning process was repeated three times. The 23S cloned strains from Spiroplasma sp. strain CRAB, Spiroplasma sp. 23F1 PCR and GAATGGGGAAACCCGGTGAG 23F1/5R 65 °C strain CRAYFISH, Spiroplasma sp. strain SHRIMP and the purchased sequencing 3000 S. mirum were used to infect the healthy E. sinensis by experimental 23R1 PCR and TTCGCTCGCCGCTACTAAG sequencing infection method described by Wang et al. (2003), respectively, i.e., 23F2 Sequencing GTAGACCCGAAACCAGGTGA 60 crabs taken from the markets or aquafarms were used for arti- 23F3 Sequencing CCGTGAGGACTGCTGGACTG ficial infection. Healthy crabs (n = 56) were chosen for experimen- 23R2 Sequencing GGATCACTAAGCCCAGCTTT tal infection and divided into four groups, 10 crabs in each group 5S: were inoculated with S. sp. strain CRAB, S. sp. strain CRAYFISH, 5R: PCR and TCGGGATGGGAACGGGTG sequencing S. sp. strain SHRIMP and S. mirum by injecting them with 0.1 ml K. Bi et al. / Journal of Invertebrate Pathology 99 (2008) 57–65 59 products were sequenced by an ABI 3700 system (Invitrogen) using (Promega) at 37 °C, and cast into 1.6 5 5 mm blocks. The blocks the PCR primers and internal primers described in Table 1. The 16S were treated with 0.5 M EDTA/0.01 M Tris/1% Sarkosyl/2 mg ml1 rRNA, 23S rRNA and ISRs sequences have been deposited in proteinase K for 48 h at 42 °C and stored at 4 °C. Before electropho- GenBank. resis the blocks were cut into 1.6 1.0 5 mm trips, soaked in The universal PCR primers for amplification of rpoB and gyrB 0.5 Tris–borate–EDTA (TBE) for 1 h and then inserted into the genes of Mollicutes: forward PCR primers rpoB-FMYC (AGTTATCA slots of a 1.2% agarose gel in 0.5 TBE and sealed into the slots with CAATTTATGGATCAAA), gyrB–FMYC (AAAACGWCCAGGKATGTATA 1% low-gelling agarose. Electrophoresis was performed with a TTGG) and reverse primers rpoB-RMYC (GCTCAHACTTCCATTTCHC Gene Navigator System (Amersham) by using a transverse alter- CAAA), gyrB-RMYC (GGATCCATTGTTGTTTCTCATAATTG), designed nating field electrophoresis system and 0.5 TBE as the running by Volokhov et al. (2007) were used in this study. Two pairs of buffer. The genomic linear molecules were separated under the fol- primers efficiently amplified the rpoB and gyrB genes from three lowing electrophoresis conditions: 220 V; two steps: pulse times of freshwater crustacean Spiroplasma strains and S. mirum. The PCR 70 s (15 h) and 120 s (11 h) at 8–15 °C. The sizes of the resulting reactions (50 ll) were carried out as described above using the fol- genome were evaluated by comparing them with Saccharomyces lowing cycling conditions; initial activation at 95 °C for 6 min, 45 cerevisiae (strain YPH80, New England Biolabs) chromosomal cycles of 95 °C for 1 min, 56 °C for 1 min and 68 °C extension for DNA fragments ranging in size from 215 to 1900 kbp. 2 min, and a final extension at 68 °C for 10 min. The PCR products of gyrB and rpoB genes were purified and directly sequenced 2.6. Western blotting with monoclonal antibody against Spiroplasma employing an ABI 3700 system with their bi-directional PCR prim- sp. strain CRAB ers, respectively. The sequences have also been deposited in GenBank. Spiroplasma cultures (3 ml), S. sp. strain CRAB, S. sp. strain CRAYFISH, S. sp. strain SHRIMP and S. mirum, at the approximate 2.4. Phylogenetic analysis

All sequences of above four Spiroplasma strains were edited and assembled in SeqMan 4.0 (DNASTAR Inc.). DNA sequences of all available Spiroplasma strains in GenBank were aligned using Clus- tal X 1.8 program (Thompson et al., 1997), respectively. Highly divergent regions within sequences were not discarded in these analyses due to interstrains phylogenies. Interspecies/interstrain similarity for each gene was generated using MEGA 3.0 (Kumar et al., 2004). Phylogenetic analyses were performed using maximum parsimony (MP) and Bayesian (BI) methods. MP analyses were carried out with PAUP 4.0b10 (Swofford, 2002). Bootstrap proportions (BPMP) were obtained from 1000 replicates by using 10 replicates of random stepwise-addition of taxa. Bayesian analyses were performed using MrBayes 3.0b4 (Huel- senbeck and Ronquist, 2001). Modeltest 3.06 (Posada and Crandall, 1998) was used for choosing the best model ﬁt to the data by using the Akaike Information Criterion (AIC), rather than the ‘‘hierarchi- cal likelihood ratio tests’’, because Posada and Buckley (2004) have recently shown that AIC approach presents several important advantages. The best model chosen is the GTR + I + G model (for 16S and rpoB) and the GTR + G model (for ISRs, 23S and gyrB). The –lnL values is 6518.4546, 20638.3418, 3873.6602, 6763.9204 and 11563.2393 for 16S, rpoB, ISRs, 23S and gyrB, respectively. For all Bayesian analyses, each search was starting from random trees, for 106 generations, each with four simultaneous Markov chains (three heated using the default value of 0.2), sampling every 100 generations. Base frequencies and a gamma distribution were estimated for each run. Generations sampled before the chain reached stationarity (‘‘burn-in’’) were discarded. After excluding the burn-in, a majority-rule consensus tree was constructed showing relative occurrences (i.e., the posterior probabilities) of all nodes in the tree.

2.5. Pulsed-ﬁeld gel electrophoresis (PFGE)

Four Spiroplasma cultures at the approximate 108 cells/mL concentration phase were incubated with 100 mg of chloramphenicol per ml for 90 min at their respective growth temperature in order to complete ongoing rounds of replication and to prevent the initi- ation of new rounds. The cells were then collected by centrifugation at 15700g for 30 min at 4 °C. The pelleted cells were resuspended in STE (100 mM NaCl, 10 mM Tris–HCl, 1 mM pH Fig. 1. Negatively stained electron micrograph of Spiroplasmas from the diseased 8 8.0 EDTA). The resuspended cells, approximate 6 10 cells/mL, freshwater Paciﬁc white shrimp Penaeus vannamei (a) and the infected Eriocheir were added to an equal volume of molten 2% low-gelling agarose sinensis (b), showing their helical structure. Scale bar, 1 lM. 60 K. Bi et al. / Journal of Invertebrate Pathology 99 (2008) 57–65

Table 2 The length and accession number of the DNA sequences

Strain name Sequence length Accession no: 16S rRNA ISRs 23S rRNA gyrB rpoB 16S rRNA ISRs 23S rRNA gyrB rpoB S. sp. strain CRAB 1430 bp 310 bp 2917 bp 1705 bp 1736 bp DQ917753 EU014291 EU031652 S. sp. strain CRAYFISH DQ917754 EU014292 EU031653 S. sp. strain SHRIMP DQ917755 EU014294 EU031654 S. mirum DQ917756 EU014293 EU031655

108 cells/mL concentration phase were collected by centrifugation Samples (15 lL) were electrophoresed on 10% sodium dodecyl at 15700g for 30 min at 4 °C, respectively. The pelleted cells were sulfate–polyacrylamide gel electropheresis (SDS–PAGE) and then suspended and washed two times in 500 lL 0.01 M pH 7.4 phos- transferred to PVDF membranes (Roche Molecular Biochemicals, phate-buffer saline (PBS) and were ﬁnally suspended in 200 lL Quebec, Canada), blocked in 0.5% skim milk powder in TBS PBS buffer. Protein content was assessed by the Bradford assay. (50 mmol/L Tris, 150 mM NaCl, pH 7.4) and immunoreacted with Protein solution (1 lg) was mixed with the same volumes of the monoclonal antibody against S. sp. stain CRAB which was pro- loading buffer (0.1 M Tris, 4% w/v SDS, 0.2% v/v Bromophenol duced by a collaborating group in Southeast University Medical Blue, 20% v/v glycerol, 0.1 M DTT) and boiled at 100 °C for 3 mins. School. Membranes were then incubated with HRP-conjugated

a M. hominis (AF443616) Clade S. helicoides (AY189132)

99 S. gladiatoris (M24475) 1.00 92 S. sp. BARC (AY189320) 0.97 S. lineolae (DQ860100) 93 S. velocicrescens (AY189311) 1.00 S. chinense (AY189126) 97 S. culicicola (AY189126) 1.00 S. sp. BIUS-1 (AY189319) 0.77 S. sp. W115 (AY189317) 90 S. monobiae (M24481) 0.98 S. diminutum (AY189130) 83 1.00 S. sp. CB-1 (AY189315) 90 80 0.74 0.5955 S. cantharicola (DQ861914) Apis 0.96 0.66 S. sp. AR 1357 (DQ861916) 86 S. floricola (AY189131) 0.98 S. diabroticae (M24482) S. taiwanense (M24476)

100 S. litorale (AY189306) 1.00 S. corruscae (AY189128) 91 86 1.00 52 S. turonicum (AY189310) 1.00 0.61 99 S. apis (M23937) 1.00 S. montanense (AY189307) S. clarkii (M24474) 81 S. lampyridicola (AY189134) 0.56 0.90 S. leptinotarsae (AY189305) 0.73 S. sp. TIUS1 (AY189318) 61 0.73100 S. sabaudiense (AY189308) 1.00 S. alleghenense (AY189125) S. mirum ATCC29335 (DQ917756) 100 S. sp. strain CRAYFISH (DQ917754) Mirum 1.00 S. sp. strain CRAB (DQ917753) S. sp. strain SHRIMP (DQ917755) 100 S. syrphidicola (AY189309) 1.00 100 1.00 S. chrysopicola (AY189127) Chrysopicola-Syrphidicola-TASS-1 S. sp. TAAS (AY189314) 87 S. sp. LB-12 (AY189313) 0.83 S. phoeniceum (AY772395) 91 98 S. kunkelii (DQ319086) 1.00 1.00 0.58 S. citri (X63781) 86 0.85 S. melliferum (AY325304) Citri-Poulsonii 0.96 63 S. penaei (AY771927) 0.91 50 S. insolitum (AY189133) 0.59 S. sp. 277F (AY189312) 50 0.81 S. poulsonii (M24483) 0.76 S. sp. N525 (DQ186642) S. ixodetis (M24477) 100 Ixodetis 1.00 S. platyhelix (DQ860101)

Fig. 2. The maximum parsimony (MP) and Bayesian (BI) tree based on the 16S (a) and 16S–23S rRNA ISRs (b) datasets. Mycoplasma hominis was used as outgroup. Numbers above branches in each tree are bootstrap values and the numbers below branches in each tree represent the posterior probability values of the Bayesian analysis. K. Bi et al. / Journal of Invertebrate Pathology 99 (2008) 57–65 61

b M hominis (AY738737) Clade S. ixodetis (DQ004911) Ixodetis S. platyhelix (DQ860101) S. phoeniceum (DQ004940)

99 S. citri (X63781) 55 1.00 S. melliferum (DQ004905) Citri-Poulsonii 61 S. kunkelii (DQ319068) 93 0.73 90 S. insolitum (DQ004918) 0.99 1.00 S. poulsonii (AY973574) S. chrysopicola (AY549216) 100 S. sp. TAAS (AY549215) Chrysopicola-Syrphidicola-TASS-1 1.00 100 89 S. syrphidicola (DQ439673)

1.00 1.00 S. mirum strain GT48 (DQ439671)

76 S. mirum strain SMCA (439670) 0.78 S. mirum strain TP2 (DQ439672) 100 S. mirum ATCC29335 (DQ917756) Mirum 1.00 S. sp. stain CRAB (DQ917753) 58 S. sp. strain CRAYFISH (DQ917754) 0.77 S. sp. strain SHRIMP (DQ917755) S. leptinotarsae (AY772216) S. lampyridicola (AY770625) 97 S. clarkii (AY772218) 1.00 S. helicoides (DQ004903) 54

54 0.60 69 S. gladiatoris (DQ004895) 0.87 S. lineolae (DQ860100) S. culicicola (AY780799) S. velocicrescens (DQ439666) 62 S. taiwanense (DQ439667) 54 0.57 S. floricola (AY974061) Apis 73 0.53 52 S. monobiae (DQ004914) 62 0.53 0.99 0.52 S. diminutum (DQ004921) 95 90 S. cantharicola (DQ861914) 0.93 0.99 S. sp. AR 1357 (DQ861916)

100 S. apis (AY736030) 0.95 S. montanense (DQ004925) S. turonicum (DQ439669) 85 0.97 93 S. corruscae (DQ004943) 0.99 S. litorale (AY973575)

100 S. sabaudiense (DQ004907) 1.00 S. alleghenense (DQ004922)

Fig. 2 (continued) goat anti-mouse IgG secondary antibody (Sigma–Aldrich). Detec- shape, whose length ranges from 3–12 lm, and diameter ranges tion was accomplished by 3,5,30,50-tetramethyl benzidine (TMB, from 0.1 to 0.2. The particles were clearly detectable with trans- Sigma–Aldrich) staining. mission electron microscopic analysis (TEM) by negative staining (Fig. 1a). The pathogens move forward in a helical manner without 3. Results any visible ﬂagellum. We further examined these three strains on their infection 3.1. Morphological characteristics of P. vannamei pathogen and properties, together with a close species S. mirum. All together, experimental infection of Spiroplasma strains 45 healthy crabs were inoculated with three different freshwater crustacean Spiroplasma strains and S. mirum from ATCC. Among In order to characterize the pathogen from these freshwater these crabs, 10 were inoculated with S. mirum and 5 crabs were crustaceans, we analyzed the morphological characteristics from inoculated with R2 medium, all 15 crabs remained healthy and the strains S. sp. strain CRAB, S. sp. strain CRAYFISH and S. sp. strain no symptoms, such as tremor, were detected for more than 3 SHRIMP. These strains were all able to pass through a membrane months. TEM analysis showed no observable agent in the hemo- ﬁlter with an average pore diameter of 220 nm and were cultivat- lymph of these crabs. However, in the other three groups, inocu- able in R2 medium. The growth curves of the three pathogens were lated with three freshwater crustacean Spiroplasma strains, all very similar. Doubling time of pathogens were slow (approxi- developed typical signs of tremor disease (tremor of pereiopods) mately 7 days) in the early passages (1–3 passages); In later pas- within 7–14 days and died within 23 days. Typical Spiroplasma sages, these organisms showed improved growth rate, with their particles could be detected by electron microscopy in hemolymph doubling tome close to 2 days. These pathogens present a helical samples (Fig. 1b). 62 K. Bi et al. / Journal of Invertebrate Pathology 99 (2008) 57–65

3.2. Sequencing of ISRs, 16S rRNA, 23S rRNA, gyrB and rpoB genes length = 862, Consistency index [CI] = 0.5812, Retention index [RI] = 0.8399) and BI trees based on ISRs sequences further showed To further characterize these strains, we ampliﬁed and se- three freshwater crustacean Spiroplasma strains and four S. mirum quenced several genes in these strains, including the complete strains (GT48, SMCA, TP2 and ATCC 29335) were divided into two ISRs, 23S rRNA sequences and partial 16S rRNA, gyrB, rpoB se- separate subclade, and had a sister relationship between the two quences. The sequence lengths and Accession numbers were subclades (Fig. 2b); Further more, the phylogenetic analysis of both showed in Table 2. By pairwise comparison, interspecies or inter- gyrB and rpoB datasets supported the result from ISRs analysis with strains sequence similarity of ISRs, 16S, 23S, gyrB and rpoB were 100% bootstrap value (MP) and 1.00 posterior probability (BI) analyzed within the genus Spiroplasma, respectively (data not (Fig. 3a and b); The phylogenetic tree based on 23S rRNA gene se- shown). The result showed that the Spiroplasmas from three fresh- quences of six Spiroplasma taxa also strongly supported that three water crustaceans have identical DNA sequences and they showed freshwater crustacean Spiroplasma strains grouped a separate higher similarity to S. mirum than other Spiroplasma species or subclade and had a sister relationship to S. mirum with a 100% strains within the Spiroplasma genus. bootstrap value (MP) and 1.00 posterior probability (BI) (Phyloge- netic trees not shown). 3.3. Phylogenetic analyses 3.4. PFGE and Western blotting with monoclonal antibody against MP and BI trees based on 16S, ISRs, gyrB and rpoB sequences Spiroplasma sp. stain CRAB analyses are shown in Figs. 2 and 3a, b. On the one hand, 16S rRNA tree (Fig. 2a), as well as all trees constructed for other three genetic In order to conﬁrm that these three strains belong to a separate loci analyzed (Figs. 2b and 3a and b), strongly supported the subclade, we examined the genomic size of these strains together Spiroplasmas from three freshwater crustaceans belong to the with of S. mirum. The genomic sizes of three freshwater crustacean Mirum clade. On the other hand, both MP tree (Tree length = 993, strains are similar, and all of them have a larger genome than that Consistency index [CI] = 0.5841, Retention index [RI] = 0.8437) of S. mirum. The genomic size of Spiroplasmas from freshwater and Bayesian tree based on 16S rRNA datasets strongly supported crustaceans are all close to 1900 + 1640 kbp, while, the genome three Spiroplasma strains from freshwater crustacean and S. mirum size of S. mirum is close to 1120 + 1100 kbp (Fig. 4). were sister relationship one another with a 100% bootstrap value We raised monoclonal antibody according to the epitopes from (MP) and 1.00 posterior probability (BI); The MP tree (Tree S. sp. stain CRAB particle protein. These antibodies recognize all

a M. hominis Clade S. m irum (EU014293)

100 S. sp. strain CRAYFISH (EU014292) 1.00 Mirum

100 1.00 S. sp. strain SHRIMP (EU014294)

S. sp. strain CRAB (EU014291)

S. insolitum (DQ863270)

S. citri Z19108 100 100 1.00 1.00 S. melliferum (DQ514612)

100 Citri-Poulsonii 1.00 S. phoeniceum (DQ514609)

100 95 1.00 S. phoeniceum (DQ514610) 0.99 62 0.96 S. phoeniceum (DQ514611)

S. alleghenense (DQ863261)

99 1.00 S. gladiatoris (DQ863272)

100 Apis 1.00 S. culicicola (DQ485322) 66 0.91 S. montanense (DQ863262)

Fig. 3. The maximum parsimony (MP) tree and Bayesian (BI) tree based on the nucleotide sequence data for the partial gyrB gene (a) and the partial rpoB gene (b). Mycoplasma hominis was used as outgroup. Numbers above branches in each tree are bootstrap values and the numbers below branches in each tree represent the posterior probability values of the Bayesian analysis. K. Bi et al. / Journal of Invertebrate Pathology 99 (2008) 57–65 63

M. hominis (DQ530430) b Clade 96 S. ixodetis (DQ313832) Ixodetis 1.00 S. platyhelix (DQ307063) S. lampyridicola (DQ313831) S. sabaudiense (DQ313830)

98 S. helicoides (DQ310574) 98 1.00 S. gladiatoris (DQ310573) 1.00 96

1.00 100 S. tabanidicola (DQ310571) 89 1.00 0.90 S. lineolae (DQ310570) S. culicicola (DQ310569) 91

1.00 99 S. velocicrescens (DQ310568) 1.00 Apis 70 S. chinense (DQ310567) 0.59 99 S. turonicum (DQ313822) 1.00 S. litorale (DQ313821)

99 S. montanense (DQ313817) 1.00 S. apis (DQ313815) 78 S. taiwanense (DQ313828) 0.79 51 S. floricola (DQ287927)

95 S. monobiae (DQ313826) 0.98 99 S. sp. AR1357 (DQ313825) 1.00 S. cantharicola (DQ313823)

99 S. insolitum (DQ307064) 1.00 S. poulsonii (DQ307058) 93 1.00 S. phoeniceum (DQ307057) Citri-Poulsonii 100 1.00 S. melliferum (DQ307052) 67 100 1.00 1.00 S. citri (AM285302)

100 S. syrphidicola (DQ307062) 100 Chrysopicola-Syrphidicola-TASS-1 1.00 1.00 S. chrysopicola (DQ307061) S. mirum ATCC29335 (EU031655) 100 S. sp. strain CRAB (EU031652) 1.00 Mirum 100 S. sp. strain CRAYFISH (EU031653) 1.00 S. sp. strain SHRIMP (EU031654)

Fig. 3 (continued) three freshwater crustacean Spiroplasma strains at approximate isolated and identified Spiroplasma species or strains, most of 42 KD, but do not recognize anything from the S. mirum extract Spiroplasmas were associated with insects, ticks and plants. How- (Fig. 5). This suggests that these three strains share similar or iden- ever, Spiroplasmas were recently identified as the causative agents tical particle structures, which are different from those of S. mirum. of diseases for fresh water aquaculture species. Spiroplasma sp. All these experiments confirmed that a single unknown species strain CRAB was the first aquatic crustacean Spiroplasma found from the Mirum clade infected and caused the tremor disease from in E. sinensis, associated with tremor disease and was characterized these freshwater aquacultures, and is a potential candidate for a to be closely related to S. mirum by 16S rDNA sequence phyloge- novel species. netic reconstruction (Wang et al., 2004b). Spiroplasma sp. strain CRAYFISH and Spiroplasma sp. strain SHRIMP were also isolated 4. Discussion from the diseased P. clarkia and P. vannamei. Spiroplasma sp. strain CRAYFISH showed 0.999 similarity coefficient with S. sp. strain Taxonomically, Spiroplasmas belong to the domain Bacteria, CRAB 16S rDNA (Wang et al., 2005). In the current research, we phylum Firmicutes, class Mollicutes, order Entomoplasmatales, adequately identified that three freshwater crustacean Spiroplasma family Spiroplasmataceae and genus Spiroplasma. The first Spiroplasma strains are a single species. First, the length of 16S rDNA (1430 bp) strain was isolated and characterized as the causative agent of of all three isolates are more than 1300 bp, which is consistent citrus stubborn disease Spiroplasma citri (Saglio et al., 1973). More with Spiroplasma species descriptive standard (Stackebrandt than 30 Spiroplasma species have been completely described and et al., 2002); Second, ISR, 23S, gyrB and rpoB sequences confirmed given binomial names so far, as 100’s of other isolates were the 16S rDNA result, and circumvented several limitations of the partially described (Regassa and Gasparich, 2006). Among these 16S rDNA sequencing. These rigorous phylogenetic analysis based 64 K. Bi et al. / Journal of Invertebrate Pathology 99 (2008) 57–65

need be prove whether the freshwater crustacean Spiroplasma species also exists other aquatic animals. On the other hand, we demonstrated three freshwater crustacean Spiroplasma strains were a new species which was strikingly different with S. mirum on molecular and immunological properties. The kinship between the Spiroplasma strain from three freshwater crustaceans and S. mirum was received strongly support in current phylogenetic analysis. However, in the study of infection characteristics, the Spiroplasma strain from three freshwater crustaceans could not only infect freshwater crustacean, such as Chi- nese mitten crab, and cause the tremor disease, but also experimentally infect suckling mice and induce the cataract inci- dence (unpublished data); S. mirum only could experimentally infect immunocompromised vertebrates, such as chick embryos and suckling mice, rats, Syrian hamsters and rabbits (Jesus et al., 1974; Kirchhoff et al., 1981a, 1981b; Tully, 1982; Bastian and Foster, 2001; Bastian et al., 2004). This showed the Spiroplasma strains in freshwater crustaceans might share a similar infection mecha- nism with S. mirum. Further investigations for epizootics and enzo- otics in fresh water aquaculture in relation to the novel Spiroplasma will provide key information to prevent such diseases and provide novel method for eradication of the related diseases, such as tremor disease. In summary, the Spiroplasmas from the three freshwater crusta- Fig. 4. Pulsed-ﬁeld gel electrophoresis of S. mirum and Spiroplasmas from three ceans were a single species and the species showed a sister relation- freshwater crustaceans. Lane 1: S. mirum; Lane 2: Spiroplasma sp. strain CRAB; Lane 3: Spiroplasma sp. strain CRAYFISH; Lane 4: Spiroplasma sp. strain SHRIMP; Lane M: ship with S. mirum with the genus Spiroplasma. ISRs, 23S rDNA, gyrB Saccharomyces cerevisiae chromosomes PFG marker. and rpoB sequence analysis, in combination with other methods provides a rapid, economical method for identiﬁcation of closely related Spiroplasma strains. Serological tests using monoclonal antibodies are also powerful tools for the study of interspecies relationships in Spiroplasmas. It will provide critical information for the further investigation on the role of Spiroplasmas in the ongoing epizootics of aquatic species in natural environments.

Acknowledgments

We thank Dr. Yi Wen, Ms. Linda Nunan and PhD Jeffrey Shields for correcting the manuscript. We also thank Yonghua Gai for her valuable discussions and technical assistance. This work was supported by grants from the National Natural Sciences Foundation of China (NSFC No. 30771649), the Research Program of Jiangsu Province of China (No.BE2007343) and the Natural Science Foun- dation of the Jiangsu Higher Education Institutions of China (No. 07KJD240105).

References

Fig. 5. Western blot analysis of the complete protein of four Spiroplasma strains Bastian, F.O., Foster, J.W., 2001. Spiroplasma sp. 16S rDNA in Creutzfeldt–Jakob with the monoclonal antibody against S. sp. strain CRAB. S.mirum: S. mirum; S.crab: disease and scrapie as shown by PCR and DNA sequence analysis. J. S. sp. strain CRAB; S.crayfish: S. sp. strain CRAYFISH; S.shrimp: S. sp. strain SHRIMP; Neuropathol. Exp. Neurol. 60, 613–620. M: Marker. Molecular mass markers (kDa) are indicated on the left. Bastian, F.O., Dash, S., Garry, R.F., 2004. Linking chronic wasting disease to scrapie by comparison of Spiroplasma mirum ribosomal DNA sequences. Exp. Mol. Pathol. 77, 49–56. Brown, D.R., Farley, J.M., Zacher, L.A., Carlton, J.M.-R., Clippinger, T.L., Tully, J.G., on 16S, ISRs, 23S rRNA, gyrB and rpoB datasets were performed for Brown, M.B., 2001. Mycoplasma alligatoris sp. nov., from American alligators. Int. J. Syst. Evol. Microbiol. 51, 419–424. the accurate analysis of the phylogenetic characterization; Third, Brown, D.R., Demcovitz, D.L., Plourdé, D.R., Potter, S.M., Hunt, M.E., Jones, R.D., the phylogenetic results were further confirmed by the serological Rotstein, D.S., 2006. Mycoplasma iguanae sp nov., from a green iguana (Iguana testing using monoclonal antibody, which was shown to be useful iguana) with vertebral disease. Int. J. Syst. Evol. Microbiol. 56, 761–764. for the study of interspecies relationship (Yoshida et al., 2000; Brown, D.R., Whitcomb, R.F., Bradbury, J.M., 2007. Revised minimal standards for description of new species of the class Mollicutes (division Tenericutes). Int. J. Brown et al., 2001, 2006, 2007). Serological investigation com- Syst. Evol. Microbiol. 57, 2703–2719. pletely supported the phylogenetic results from ISRs, 23S rDNA, Carle, P., Laigret, F., Tully, J.G., Bové, J.M., 1995. Heterogeneity of genome sizes gyrB and rpoB datasets. Other results, such as experimental infec- within the genus Spiroplasma. Int. J. Syst. Bacteriol. 45, 178–181. Drancourt, M., Raoult, D., 2005. Sequence-based identification of new bacteria: a tion of the Spiroplasma pathogenicity, morphological observation proposition for creation of an orphan bacterium repository. J. Clin. Microbiol. with TEM and genomic size, all indicate that three freshwater crus- 43, 4311–4315. tacean Spiroplasma strains were identical. Therefore we conclude Gasparich, G.E., Whitcomb, R.F., Dodge, D., French, F.E., Glass, J., Williamson, D.L., 2004. The genus Spiroplasma and its non-helical descendants: phylogenetic that a single Spiroplasma species widely exists in freshwater crus- classification, correlation with phenotype and roots of the Mycoplasma mycoides taceans and may disseminate among freshwater crustaceans. It clade. Int. J. Syst. Bacteriol. 54, 893–918. K. Bi et al. / Journal of Invertebrate Pathology 99 (2008) 57–65 65

Hackett, K.J., Clark, T.B., 1989. Ecology of Spiroplasma. In: Whitcomb, R.F., Tully, J.G. Tully, J.G., 1982. Spiroplasma mirum, has new species from the rabbit tick (Eds.), The mycoplasmas, vol. 5. Academic Press, San Diego, California, pp. 113– (Haemaphysalis leporipalustris). Int. J. Syst. Bacteriol. 32, 92–100. 200. Tully, J.G., Rose, D.L., Clark, E., Carle, P., Bové, J.M., Henegar, R.B., Whitcomb, R.F., Hackett, K.J., Whitcomb, R.F., Tully, J.G., Lloyd, J.E., Anderson, J.J., Clark, T.B., Henegar, Colflesh, D.E., Williamson, D.L., 1987. Revised group classification of the genus R.B., Rose, D.L., Clark, E.A., Vaughn, J.L., 1992. Lampyridae (Coleoptera): a Spiroplasma (class Mollicutes), with proposed new groups XII to XXIII.. Int. J. plethora of mollicute associations. Microb. Ecol. 23, 181–193. Syst. Bacteriol. 37, 357–364. Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference of phylogenetic Volokhov, D.V., George, J., Liu, S.X., Ikonomi, P., Anderson, C., Chizhikov, V., 2006. trees. Bioinformatics 17, 754–755. Sequencing of the intergenic 16S–23S rRNA spacer (ITS) region of Mollicutes Jesus, W.B., David, O., Robert, H.B., 1974. Biological and physical properties of the species and their identification using microarray-based assay and DNA suckling mouse cataract agent grown in chicken embryos. Infect. Immun. 9, sequencing. Appl. Microbiol. Biotechnol. 71, 680–698. 444–451. Volokhov, D.V., Neverov, A.A., George, J., Kong, H., Liu, S.X., Anderson, C., Davidson, Johansson, K.E., 2000. International committee on systematic bacteriology M.K., Chizhikov, V., 2007. Genetic analysis of housekeeping genes of members of subcommittee on the taxonomy of Mollicutes. Minutes of the meetings, 21 and the genus Acholeplasma: phylogeny and complementary molecular markers to 28 July 1998, Sydney, Australia.. Int. J. Syst. Evol. Microbiol. 50, 1393–1397. Pt. 3. the 16S rRNA gene. Mol. Phylogenet. Evol. 44, 699–710. Kirchhoff, H., Kuwabara, T., Barile, M.F., 1981a. Pathogenicity of Spiroplasma sp. Von der Schulenburg, J.H.G., Majerus, T.M.O., Dorzhu, C.M., Zakharov, I.A., Hurst, strain SMCA in Syrian hamsters: clinical, microbiological, and histological G.D.D., Majerus, M.E.N., 2000. Evolution of male-killing Spiroplasma aspects. Infect. Immun. 31, 445–452. (Procaryotae: Mollicutes) inferred from ribosomal spacer sequences. J. Gen. Kirchhoff, H., Heitmann, J., Trautwein, G., 1981b. Pathogenicity of Spiroplasma sp. Appl. Microbiol. 46, 95–98. strain SMCA in rabbits: clinical, microbiological, and histological aspects. Infect. Wang, W., Rong, L.W., Du, K.H., Chen, J.X., 2003. Study on experimental infections of Immun. 33, 292–296. Spiroplasma from the Chinese mitten crab in crayfish, mice and embryonated Kumar, S.K., Tamura, K., Nei, M., 2004. MEGA3: an integrated software for molecular chickens. Res. Microbiol. 154, 677–680. evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5, Wang, W., Chen, J.X., Du, K.H., Xu, Z.K., 2004a. Morphology of Spiroplasmas in the 150–163. Chinese mitten crab Eriocheir sinensis associated with tremor disease. Res. Moulder, R.W., French, F.E., Chang, C.J., 2002. Simplified media for Spiroplasmas Microbiol. 155, 630–635. associated with tabanid flies. Can. J. Microbiol. 48, 1–6. Wang, W., Wen, B.H., Gasparich, G.E., Zhu, N.N., Rong, L.W., Chen, J.X., Xu, Z.K., Pitulle, C., Strehse, C., Brown, J.W., Breitschwerdt, E.B., 2002. Investigation of the 2004b. A Spiroplasma associated with tremor disease in the Chinese mitten phylogenetic relationships within the genus Bartonella based on comparative crab (Eriocheir sinensis). Microbiology 150, 3035–3040. sequence analysis of the rnpB gene, 16S rDNA and 23S rDNA. Int. J. Syst. Evol. Wang, W., Gu, W., Ding, Z.F., Ren, Y.L., Chen, J.X., Hou, Y.Y., 2005. A novel Spiroplasma Microbiol. 52, 2075–2080. pathogen causing systemic infection in the crayfish Procambarus Clarkii Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution. (Crustacea: Decapod), in China. FEMS Microbiol. Lett. 249, 131–137. Bioinformatics 14, 817–818. Weisburg, W.G., Tully, J.G., Rose, D.L., Petzel, J.P., Oyaizu, H., Yang, D., Mandelco, L., Posada, D., Buckley, T.R., 2004. Model selection and model averaging in Sechrest, J., Lawrence, T.G., Van Etten, J., Maniloff, J., Woese, C.R., 1989. A phylogenetics: advantages of Akaike information criterion and Bayesian phylogenetic analysis of the mycoplasmas: basis for their classification. J. approaches over likelihood ratio tests. Syst. Biol. 53, 793–808. Bacteriol. 171, 6455–6467. Regassa, L.B., Stewart, K.M., Murphy, A.C., French, F.E., Lin, T., Whitcomb, R.F., 2004. Whitcomb, R.F., Hackett, K.J., 1987. Cloning by limiting dilution in liquid media: an Differentiation of group VIII Spiroplasma strains with sequences of the 16S–23S improved alternative for cloning mollicute species. Isr. J. Sci. 23, 517. rDNA intergenic spacer region. Can. J. Microbiol. 50, 1061–1067. Williamson, D.L., Tully, J.G., Whitcomb, R.F., 1989. The genus Spiroplasma. In: Regassa, L.B., Gasparich, G.E., 2006. Spiroplasmas: evolutionary relationships and Whitcomb, R.F., Tully, J.G. (Eds.), The Mycoplasmas. Academic Press CA. biodiversity. Front. Biosci. 11, 2983–3002. Williamson, D.L., Adams, J.R., Whitcomb, R.F., Tully, J.G., Carle, P., Konai, M., Bove, Saglio, P., Hospital, M.L’., Lafliche, D., Dupont, G., Bové, J.M., Tully, J.G., Freudt, E.A., J.M., Henegar, J.M., 1997. Spiroplasma platyhelix sp. nov., a new mollicute with 1973. Spiroplasma citri gen. and sp. N.: A mycoplasma-like organism associated unusual morphology and genome size from the dragonfly Pachydiplax with‘‘stubborn” disease of citrus. Int. J. Syst. Biol. 23, 191–204. longipennis. Int. J. Syst. Bacteriol. 47, 763–766. Stackebrandt, E., Frederiksen, W., Garrity, G.M., Grimont, P.A., Kampfer, P., Nesme, Williamson, D.L., Whitcomb, R.F., Tully, J.G., Gasparich, G.E., Rose, D.L., Bove, X., Rossello-Mora, R., Swings, J., Truper, H.G., Vauterin, L., Ward, A.C., Whitman, J.M., Hackett, K.J., Adams, J.R., Henegar, R.B., Konai, M., Chastel, C., French, W.B., Maiden, M.C., 2002. Report of the ad hoc committee for the re-evaluation F.E., 1998. Revised group classification of the genus Spiroplasma. Int. J. of the species definition in bacteriology. Int. J. Syst. Evol. Microbiol. 52, 1043– Bacteriol. 48, 1–12. 1047. Woese, C.R., Maniloff, J., Zablen, L.B., 1980. Phylogenetic analysis of the Swofford, D.L., 2002. PAUP*: Phylogenetic Analysis Using Parsimony (* and Other mycoplasmas. Proc. Natl. Acad. Sci. USA 77, 494–498. Methods), Version 4.0b10. Sinauer Associates, Sunderland, MA. Yoshida, S., Fujisawa, A., Tsuzaki, Y., Saitoh, S., 2000. Identification and expression of Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The a Mycoplasma gallisepticum surface antigen recognized by a monoclonal Clustal X windows interface: flexible strategies for multiple sequence antibody capable of inhibiting both growth and metabolism. Infect. Immun. alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. 68, 3186–3192.