US008715984B2

(12) United States Patent (10) Patent No.: US 8,715,984 B2 Sekine et al. (45) Date of Patent: *May 6, 2014

(54) MODIFIED TRNA CONTAINING OTHER PUBLICATIONS UNNATURAL BASE AND USE THEREOF Tzvetkova et al. Biomimetic Aminoacylation of Ribonucleotides and RNA with Aminoacyl Phosphate Esters and Lanthanum Salts. Jour (75) Inventors: Shun-ichi Sekine, Tokyo (JP); Ryuya nal of the American Chemical Society, vol. 129, pp. 15848-15854.* Fukunaga, Tokyo (JP); Shigeyuki Phelps et al. Modified Nucleotides in thNALys and tRNAVal are Yokoyama, Kanagawa (JP); Ichiro Important for Translocation. 2004. J. Mol. Biol. vol. 338, pp. 439 Hirao, Kanagawa (JP); Yoko Harada, 444. Mitsui et al. An Unnatural Hydrophobic Base Pair with Shape Kanagawa (JP) Complementarity between Pyrrole-2-carbaldehyde and 9-Methylimidazo (4,5)-bipyridine. 2003. JACS. vol. 125, pp. 5298 (73) Assignee: Riken, Saitama (JP) 5307.* Capone et al. Amber, ochre and opal Suppressor tRNA genes derived (*) Notice: Subject to any disclaimer, the term of this from a human serine tRNA gene. The EMBO Journal. vol. 4. No. 1, patent is extended or adjusted under 35 pp. 213-221.* U.S.C. 154(b) by 134 days. SEQ ID No. 2 Sequence Alignment. May 7, 2013. 4 pages.* This patent is Subject to a terminal dis Mitsui, T., et al., “An Efficient Unnatural Base Pair for a Base-Pair claimer. Expanded Transcription System.” J. Am. Chem. Soc., vol. 127, pp. 8652-8658 (2005). Ohtsuki, T., et al., “Unnatural base pairs for specific transcription.” (21) Appl. No.: 12/866,720 PNAS, vol. 98, No. 9, pp. 4922-4925 (2001). Kiga, D., et al., “An engineered Escherichia coli tyrosyl-tRNA (22) PCT Filed: Feb. 3, 2009 Synthetase for site-specific incorporation of an unnatural amino acid into proteins in eukaryotic translation and its application in a wheat (86). PCT No.: PCT/UP2009/051808 germ cell-free system.” PNAS, vol. 99, No. 15, pp. 9715-9720 (2002). S371 (c)(1), Ohno, S., et al., “Changing the Amino Acid Specificity of Yeast (2), (4) Date: Aug. 27, 2010 Tyrosyl-tRNA Synthetase by Genetic Engineering.” J. Biochem, vol. 130, No. 3, pp. 417-423 (2001). (87) PCT Pub. No.: WO2009/099073 Fukunaga, R., et al., “Structural insights into the Second Step of RNA-dependent Cysteine Biosynthesis in Archaea: Crystal Structure PCT Pub. Date: Aug. 13, 2009 of Sep-tRNA:Cys-tRNA Synthase from Archaeoglobus fulgidus,” J. (65) Prior Publication Data Mol. Biol., vol. 370, pp. 128-141 (2007). Breitschopf, K. et al., “The discriminator bases G73 in human US 2010/0323364 A1 Dec. 23, 2010 tRNA and A73 in trNA" have significantly different roles in the recognition of aminoacyl-tRNA synthetases. Nucleic Acids Res., (30) Foreign Application Priority Data vol. 24, No. 3, pp. 405-410 (1996). Fukunaga, R., et al., “Phosphoserine aminoacylation of tRNA bear Feb. 7, 2008 (JP) ...... 2008-027567 ing an unnatural base anticodon. Biochem. Biophy. Res. Comm., vol. 372, pp. 480-485 (2008). Fukunaga, R., et al., “Structural insights into the first step of RNA (51) Int. Cl. dependent cysteine biosynthesis in archaea,” Nature Struc. Molec. CI2N 9/00 (2006.01) Bio., vol. 14, No. 4, pp. 272-279 (2007). CI2P2/06 (2006.01) Grosjean, H., et al., “Enzymatic Formation of Modified Nucleosides (52) U.S. Cl. intRNA: Dependence ontRNA Architecture.” J. Mol. Biol., vol. 255, USPC ...... 435/183:435/68. 1; 435/69.1 pp. 67-85 (1996). (58) Field of Classification Search Hirao, I., et al., “An unnatural base pair for incorporating amino acid None analogs into proteins.” Nat. Biotech., vol. 20, No. 2, pp. 177-182 See application file for complete search history. (2002). (Continued) (56) References Cited Primary Examiner — Anne Gussow U.S. PATENT DOCUMENTS Assistant Examiner — Channing S Mahatan 7,101,992 B1 9, 2006 Hirao et al. (74) Attorney, Agent, or Firm — Birch, Stewart, Kolasch & 2005. O136513 A1 6/2005 Zhang et al. Birch, LLP 2007/011 1193 A1 5/2007 Zhang et al. 2010/0285598 A1* 11/2010 Hirao et al...... 436,94 (57) ABSTRACT 2011/O124080 A1 5/2011 Zhang et al. 2012/0282626 A1 1 1/2012 Zhang et al. In the method for introducing a noncanonical amino acid residue into a desired position in a protein, the structure of FOREIGN PATENT DOCUMENTS tRNA is so modified as to have improved affinity for aminoa cyl-tRNA synthetase or improved specificity to aminoacyl JP 2006180701 A T 2006 JP 38.93.057 B2 3, 2007 tRNA synthetase. An unnatural base is contained at any posi JP 2007061087 A 3, 2007 tion intRNA, whereby the efficiency of aminoacylation of the JP 2007-514447 A 6, 2007 tRNA with a noncanonical amino acid can be improved. WO WO-2004/039989 A1 5, 2004 WO WO-2007O66737 A1 6, 2007 7 Claims, 4 Drawing Sheets US 8,715,984 B2 Page 2

(56) References Cited Sylvers, L. A., et al., “A 2-Thiouridine Derivative in tRNA" is a Positive Determinant for Aminoacylation by Escherichia coli OTHER PUBLICATIONS Glutamyl-tRNA Synthetase.” Biochem... vol. 32, pp. 3836-3841 (1993). Hirao et al., "A Two-Unnatural-Base-Pair System toward the Expan Hirao, I., et al., “An unnatural hydrophobic base pair system: site sion of the Genetic Code.” Journal of the American Chemical Society, specific incorporation of nucleotide analogs into DNA and RNA.” ACS Publications, vol. 126, No. 41, Oct. 20, 2004, pp. 13298-13305. Nat. Meth., vol. 3, No. 9, pp. 729-735 (2006). Office Action issued by the European Patent Office for Application Hirao, I., et al., “Unnatural base pair systems for DNA/RNA-based No. 09709377.7 on Aug. 14, 2013, 10 pages. biotechnology.” Curr. Opin. Chem. Biol., vol. 10, pp. 622-627 Wang et al., “Expanding the Genetic Code of Escherichia coli.” Science, American Association for the Advancement of Science, vol. (2006). 292, Apr. 20, 2001, pp. 498-500. Kimoto, M., et al., “Fluorescent probing for RNA molecules by an Hirao, “Expansion of the genetic code by the creation of unnatural unnatural base-pair system.” Nucl. Acids Res., vol. 35. No. 16, pp. base pairs”, Saitama Kougyou University, 2003, pp. 16-20, not in 5360-5369 (2007). English. Martin, F., et al., “Single amino acid changes in AspRS reveal alter Japanese Office Action dated Dec. 3, 2013 for Application No. 2009 native routes for expanding its tiNA repertoire in vivo.” Nucl. Acids 5524789 pages. English translation. Res., vol. 32, No. 13, pp. 4081-4089 (2004). Yokoyama, 'Jinkouteki na ident saibou jouhou shori system wo Perret, V., et al., “Relaxation of a transfer RNA specificity by removal mezashite'Yokoyama jouhou bunshi Project (Oct. 1996-Sep. 2001) of modified nucleotides.” Nature, vol. 344, pp. 787-789 (1990). kenkyuushuuryou houkokusho, 2002, vol. 1 (main), pp. 213-222, not Senger, B., et al., “The Modified Wobble Base Inosine in Yeast in English. tRNA' is a Positive Determinant for Aminoacylation by Isoleucyl tRNA Synthetase.” Biochem., vol. 36, pp. 8269-8275 (1997). * cited by examiner

U.S. Patent May 6, 2014 Sheet 2 of 4 US 8,715,984 B2

-----€œSori----- U.S. Patent May 6, 2014 Sheet 3 of 4 US 8,715,984 B2

8."SO|- U.S. Patent May 6, 2014 Sheet 4 of 4 US 8,715,984 B2

s 3 S. 3 8 3 s old) petitioWN-das US 8,715,984 B2 1. 2 MODIFIED TRNA CONTAINING bases is Suppressed by using Y-amidotriphosphate to form a UNNATURAL BASE AND USE THEREOF selective base pair between Ds and Pa. On the other hand, in the transcription reaction, it is possible to synthesize RNA by The present application is a National Stage filing under 35 standard T7 RNA polymerase reaction based on complemen U.S.C. S371 of PCT International Application No. PCT/ 5 tary property of the DS-Pabase pair. JP2009/051808 filedon Feb. 3, 2009, which claims priority of However, the conventional technique relating to these Japanese patent application No. 2008-027567, filed on Feb. 7, unnatural bases has been studied about a recognition of 2008 under 35 U.S.C. S 119 (a)-(d), the disclosure of which is unnatural bases by DNA polymerase or RNA polymerase and incorporated herein in its entirety by reference thereto. also about a specific complementary property and a stability 10 between unnatural base pairs, whereas studies about various TECHNICAL FIELD factors to act on in a translation stage, for example, an influ ence onto interaction between tRNA and aminoacyl-tRNA The present invention is related to a modified tRNA con synthetase have not been studied yet. taining an unnatural base and the use thereof, and in more On the other hand, the genetic codes can be extended by detail, a combination of the modified tRNA having the 15 assigning the noncanonical amino acid to nonsense codons unnatural base at a specific site with an aminoacyl-tRNA that are UAA (ochre), UGA (opal) or UAG (amber). The synthetase which can activate this modified tRNA, and a suppressortRNA (tRNA, tRNAP', and tRNA") cor method for efficiently introducing a noncanonical amino acid responding to these nonsense codons have nonsense antic into a desired position in a protein using Such a combination. odons, UUA, UCA and CUA, respectively, and they are used with a mutant aminoacyl-tRNA synthetase which can attach BACKGROUND the noncanonical amino acid to these Suppressor tRNA for an extension of the genetic codes. A/T and G/C within double-stranded natural DNA form For example, the phosphorylation at a side chain of serine “exclusive' base pairs, respectively, via specific hydrogen in a protein is a post-translational modification, relating to bonds, respectively. However, the fact that natural nucleic 25 many important biological phenomena Such as signal trans acid has 4 kinds of bases (2 kinds of base pairs) provides a duction and the like. If phosphoserine can be introduced into limitation to the chemical and physical variety of nucleic a desired position in a protein by extending genetic codes, it acid. If the genetic codes can be extended due to unnatural will be a very important tool for study of a role of the phos base pairs (artificial base pairs), it is beneficial to introduce phorylation at a serine residue of a protein. Phosphoseryl various functional elements into desired positions into 30 tRNA synthetase (SepRS) is a noncanonical aaRS, which nucleic acids or proteins. So far, in the research of the unnatu recognizes phosphoserine in several archaebacterium and ral base pairs, searches have been directed to those which ligates it to thNA with anticodon GCA. Inventors of the could be antagonistic to natural base pairs in each process of present invention have already analyzed the three-dimen replication, transcription and translation based on the combi sional structure of SepRS/tRNA/phosphoserine complex nation utilizing the hydrogen bonds between the bases or the 35 derived from Archaeroglobus fulgidus. And then, based on combination utilizing the hydrophobicity of the bases. the structure of the complex, the SepRS was modified to Inventors of the present invention have developed various recognize a mutant tRNA having UCA and CUA at antic kinds of unnatural base pairs which have a different hydrogen odon, thereby it was shown that phosphoserine can be intro bond type compared to natural base pairs and can exclude a duced into nonsense codon using such a mutant SepRS/tRNA pairing with a natural base due to the steric hindrance. For 40 pair (for example, see Non-Patent Document 3). example, 2-amino-6-dimethylaminopurine (X) and 2-amino Patent Document 1 Japanese Patent No. 3893.057 6-thienylpurine (s) introducing a bulky substituted group at Non-Patent Document 1 Hirao, I. et al. An unnatural pair position 6 of purine and pyridine-2-on (y) having a hydrogen for incorporating amino acid analogs into proteins, Nature atom at a site complementary to the bulky Substituted group Biotechnology, Vol. 20, pp. 177-182 (2002) have been designed. When they have investigated an incor 45 Non-Patent Document 2 Hirao, I. etal. An unnatural hydro poration into DNA by Klenow fragment and an incorporation phobic base pair system: site-specific incorporation of into RNA by T7 RNA polymerase regarding these x-y and s-y nucleotide analogs into DNA and RNA, Nature Methods, base pairs formation, the unnatural base pairs-y utilizing the Vol. 3, pp. 729-735 (2006) steric hindrance showed an extremely high selectivity for Non-Patent Document 3 Fukunaga, R. & Yokoyama, S., transcription reaction, and a RNA, in which y is site-specifi 50 Structural insights into the first step of RNA-dependent cally incorporated at a site complementary to S within a tem cysteine biosynthesis in archaea, Nature Structural & plate DNA, was able to be synthesized (for example, see Molecular Biology, Vol. 14, pp. 272-279, (2007) Patent Document 1). And then, the genetic code was extended using this s-y base pair to create a new codon-anticodon pairs SUMMARY corresponding to the noncanonical amino acid, thereby they 55 have succeeded in Synthesizing a protein incorporating the The entire disclosures of the above Patent Document 1 and noncanonical amino acid site-specifically in vitro (for Non-Patent Documents 1-3 are incorporated herein by refer example, see Non-Patent Document 1). However, its selec ence thereto. In the following, an analysis of related technique tivity between unnatural base pairs in replication reaction has by this invention will be given. not been so high compared to that in transcription reaction. 60 In the method of introducing noncanonical amino acids Recently, inventors of the present invention have devel using nonsense codons, in the case where translation termi oped an unnatural base pair, 7-(2-thienyl)-imidazo 4,5-b]py nator recognizes a nonsense codon within a protein coding ridine (Ds) and pyrrole-2-carboaldehyde (Pa), having high region, the translation reaction is terminated at its recognition selectivity and incorporation efficiency for replication and site and a truncated form of the protein is produced. Further, transcription reactions based on the formation of base pairs 65 the noncanonical amino acid is introduced not only into a due to hydrophobic interactions (for example, see Non-Patent targeted nonsense codon within a target gene but also into Document 2). In the replication reaction, a self-pairing of DS natural stop codons of non-target genes, thereby a US 8,715,984 B2 3 4 readthrough of these proteins occurs. As a result, there is a rating a noncanonical amino acid characterized in that the problem that the efficiency of the protein synthesis incorpo following (a) (b) and (c) are expressed in a cell or in a cell rating the targeted noncanonical amino acid falls. extract Solution under existence of unnatural bases and non In addition, the aminoacyl-tRNA synthetase recognizes a canonical amino acids: specific nucleotide of the cognate tRNA, and distinguishes it (a) an aminoacyl-tRNA synthetase which can activate the from other tRNA. Hence, it could be that the efficiency of noncanonical amino acid; synthesis (recognition) of the suppressor tRNA by the tar (b) a modified tRNA of the present invention recognized by geted aminoacyl-tRNA synthetase falls because the aminoa said aminoacyl-tRNA synthetase; and cyl-tRNA synthetase recognizing the anticodon of cognate (c) a mRNA coding a desired protein having a nonsense tRNA cannot recognize the anticodon corresponding to the 10 codon or a codon including an unnatural base at a desired nonsense codon. In Such a case, it is beneficial that not only position(s). In a preferred mode, as the noncanonical the aminoacyl-tRNA synthetase structure is modified but also amino acid, phosphoserine, pyrolysine, lysine derivative or an affinity with and a specificity for the aminoacyl-tRNA tyrosine derivative and the like are listed. synthetase can be improved by modifying the structure of According to the present invention, it is possible to synthe tRNA at a position interacting with the above modified ami 15 size a new combination of the modified tRNA introducing the noacyl-tRNA synthetase. unnatural base into a specific position(s) in tRNA with the The present invention was made to solve the above prob mutant aminoacyl-tRNA synthetase, which specifically rec lem, and the present invention provides a method that an ognizes the modified tRNA and also can activate the nonca unnatural base is site-specifically introduced at a specific site nonical amino acid. As for the combination, it is possible to of tRNA, and that a noncanonical amino acid is efficiently provide a combination that not only a production yield of the attached to a modified tRNA containing an unnatural base, aminoacyl-tRNA with the noncanonical amino acid is and a method that a protein containing the noncanonical increased but also specificity to the noncanonical amino acid amino acid at a desired position is synthesized (site-)specifi is high. That is, it is beneficial for a synthesis of a protein cally and efficiently using a combination of Such a modified incorporating the noncanonical amino acid with high speci tRNA with the aminoacyl-tRNA synthetase. 25 ficity by Suppressing a background caused by unwanted That is, according to a first aspect of the present invention, incorporation of standard amino acid. a modified tRNA of the present invention is characterized by In addition, according to the method of the present inven a modified tRNA for introducing a noncanonical amino acid tion, it is possible to synthesize a new combination which is into a desired position(s) in a protein; wherein the modified specific to respective of various different kinds of the nonca tRNA comprises unnatural bases at any position(s) of said 30 nonical amino acids. Thereby, it is also easy to produce a tRNA, thereby improving efficiency of aminoacylation reac protein introducing a plurality of (or several) kinds of nonca tion thereof with the noncanonical amino acid. It is preferred nonical amino acids into various positions, then a protein that said aminoacylation reaction is catalyzed by a mutant having new function(s) which can not be produced in the aminoacyl-tRNA synthetase. It is also preferred that the conventional method is synthesized, and these can be pre unnatural base is comprised at any position(s) other than 35 pared with ease. conserved residues of tRNA. In a more preferred mode, the unnatural base is at a position(s) interacting with the aminoa BRIEF DESCRIPTION OF THE DRAWINGS cyl-tRNA synthetase, and included in at least one position selected from the class consisting of first three base pairs of FIG. 1 It is a schematic view showing a secondary struc accepter stem, anticodon, discriminator, whole extra arm in 40 ture of a standard tRNA. the case of type II tRNA, position 20, position 32, position 37 FIG. 2. It shows the unnatural base pairs system for the and position 38. gene code extension. (A) Structures of natural A-T(U) and According to other aspect of the present invention, there is G-C base pairs, and the unnatural DS-Pa base pair. (B) It provided a method of screening a modified tRNA for improv represents base pairs of codon-anticodon of tRNAs used in ing aminoacylation reaction of tRNA by a noncanonical 45 Example. amino acid. The method comprises: FIG. 3. It shows the specific T7 transcription reaction via (a) preparing a Suppressor tRNA recognized by an aminoa the DS-Pabase pair formation for tRNA and tRNA cyl-tRNA synthetase which can activate the noncanonical synthesis. (A) Structure of tRNA used in Example. (B) amino acid; Schemes of tRNA and tRNA synthesis, and nucle (b) synthesizing the modified tRNA introducing an unnatural 50 otide component analysis. (C) A result of two dimensional base at any position(s) of said tRNA; TLC analysis of labeled nucleotide after RNaseT2 treatment (c) measuring an aminoacylation activity of the modified of a transcript production. tRNA under existence of standard and noncanonical amino FIG. 4. It shows a phosphoserine aminoacylation activity acids, and the aminoacyl-tRNA synthetase for these amino with various SepRS enzymes against teNA and acids; and 55 tRNAc-4. (d) selecting the modified tRNA, in which an incorporating amount of the noncanonical amino acid is increased or an PREFERRED MODES incorporating rate of the noncanonical amino acid is improved compared to that of the standard amino acid. It is In the present invention, the terms “unnatural is used in a preferred that a tRNA gene including the unnatural base is 60 context explaining an nucleobase and it means any base other prepared and the transcription reaction is performed with than natural adenine (A), guanine (G), cytosine (C), tymine said tRNA gene as a template DNA in the synthesis of the (T), urasil (U) and modified bases existing in natural tRNA. modified tRNA in the above step (b). It is also preferred that The term "noncanonical' is used in a context explaining said tRNA gene is capable of being amplified by poly amino acids and the "noncanonical amino acid(s) means merase chain reaction. 65 amino acid(s) other than 20 kinds of Standard amino acids According to a still other aspect of the present invention, defined in the genetic code dictionary. The term “nucleoside' there is provided a production method of a protein incorpo means a glycoside compound in which a nucleobase and a US 8,715,984 B2 5 6 reducing group of carbohydrate are bound via a glycoside More preferably, it is possible that an interaction site binding. The term “nucleotide' is a compound in which a regarding a pair of a targeted aaRS and tRNA is determined carbohydrate portion of the above nucleoside forms an ester and one or more base(s) at these sites of tRNA is/are replaced with phosphoric acid, and preferably mono, di, or triphos with (an) unnatural base(s). The residue related to amino acid phate. specificity of tRNA is at least one position selected from a tRNA Including Unnatural Bases and Preparation Method class consisting of the first three base pairs (positions 1 and Thereof 72, positions 2 and 71, positions 3 and 70) of the acceptor tRNA widely exists in all living organisms and it is one of stem, a base pair of position 73 and the residue at position -1 non-translated RNAs (non-coding RNAs) whose structure in the case where a nucleotide at position -1 exists, the anti and function are most clear. A tRNA is composed of 76-90 10 codon, the discriminator, the entire extra arm in the case of nucleosides, and its secondary structure comprising three type II tRNAs, position 20, position 32, position 37, and stem loops (D stem loop, anticodon stem loop, and TPC stem position 38. loop) and one stem (acceptor stem), and forms cloverleaflike The unnatural base which is introduced into a desired posi structure. Of these, the acceptor stem and the TPC stem loop tion of these tRNAs is not particularly restricted; however, it 15 is necessary to have a high selectivity in transcription reaction (TIC arm) form a continuous double helix; on the other with RNA polymerase and to incorporate the unnatural base hand, the anticodon loop (anticodon arm) and the D stem loop site-specifically at a position complementary to a specific (Darm) also form a continuous double helix likewise, thereby base in a template DNA for synthesis by transcription reac these two helix are orthogonal oriented to form a L-shaped tion from a gene coding tPNA containing the unnatural base. tertiary structure. This L-shaped structure has a region called In addition, in the case where these unnatural base are intro an anticodon consisting of three bases at one end, and this duced into the anticodon in tRNA, it is important to be region forms a hydrogen bonds base-specifically with the capable of specifically binding with a codon in mRNA. More codon in the mRNA. On the other hand, a region called CCA over, it is preferred that the tRNA gene defined in the present 3' terminal end exists at the other end of the L-shaped struc invention can be amplified by PCR, therefor it is desired to ture, and an amino acid is bound to a hydroxyl group of ribose 25 have a high selectivity in a replication reaction by DNA of adenosine residue at this CCA 3' terminal end. polymerase. FIG. 1 shows a secondary structure of the standard tRNA. Therefore, in a preferred mode of the present invention, any Positions where the kind of the base is specified are “con unnatural base selected from the following unnatural base served residues' conserved in all of the tRNAs. In order to fix pairs are listed. As a Such unnatural base pair, it is a base pair the number of these conserved residues, nucleotide residues 30 of any one selected from a class consisting of 2-oxo-1H in tRNA are numbered as shown in FIG.1. The “anticodon’ pyridine-3-yl (y) group which may have a substituted group at corresponds to positions 34-36 and the “discriminator” cor position 5, 2-oxo-1H-imidazole-3-yl (Z) group, 2-formyl-1H responds to position 73. Only for histidine tRNA, a nucleotide pyrrole-1-yl (Pa) group which may have a Substituted group exists at position-1 and this nucleotide forms a base pair with at position 4 and 2-mitro-1H-pyrrole-1-yl (Pn) group which the discriminator. In the present description, it is understood 35 may have a substituted group at position 4; and any one that the terms indicating the structure of tRNA mean general selected from a class consisting of 2-amino-6-(2-thienyl)-9H technical terms in the technical field. 'A' indicates adenine, purine-9-yl (s) group, 7-(2-thienyl)-imidazo 4,5-b]pyridine “G” guanine, “C” cytosine, “T” thymine, “U” urasil, “Y” 3-yl (Ds) group, and 9H-purine-9-yl group substituted at pyrimidine and “R” purine residues, respectively. The num position 6 or at positions 2 and 6. ber of residues included in the portion represented by the solid 40 Further explaining some of these unnatural bases in more line is different depending on molecular species of tRNA. In detail, the 2-formyl-1H-pyrrole-1-yl group which may have a the type II tRNA, over 10 residues of nucleotides are included Substituted group at position 4 has the following structure in the solid line portion represented by E, and they form a expressed as general formula (I). stem-loop structure (it is also called as extra arm). A specificity of pairing between codon and anticodon is 45 Supported by a base-specific hydrogen bonds; on the other Chemical Formula 1 hand, there exists no physical and chemical interaction to determine a specificity between tRNA and amino acid. It is (I) understood that the aminoacyl-tRNA synthetase (aaRS) to be R hereinafter described is prepared for each amino acid and this 50 enzyme presumably recognizes precise combination of amino acid with tirNA. It is suggested that the anticodon and discriminator are recognized by the aaRS for many tRNAs based on a crystal structure analyses of a complex with the aaRS and tRNA. In addition, it is understood that a unique 55 position(s) other than the anticodon and discriminator is rec In the formula (I), the R at position 4 in pyrrole ring is ognized in each tRNA, and these positions act on identifica hydrogen atom; alternatively, the R may be replaced with a tion with other tRNAS. Substituted group selected from a class consisting of a Sub Therefore, in the present invention, the unnatural base is stituted or non-substituted C1-C3 alkyl group, a substituted or introduced into any position(s) of tRNA, preferably any posi 60 non-Substituted C2-C3 alkenyl group, or a Substituted or non tion(s) other than conserved residue, thereby the modified substituted C2-C3 alkynyl group. The above alkyl group, tRNA, in which an efficiency of aminoacylation reaction is alkenyl group, or alkynyl group and the like may be further improved compared to original tRNA, can be synthesized. replaced with one or more groups independently selected Here, the term “an improvement of the efficiency of aminoa from a class consisting of lower alkyl group, halogen group, cylation reaction” may be either that a reaction efficiency with 65 hydroxyl group, amino group, alkylamino group and het a targeted noncanonical amino acid rises or that a reaction eroaromatic ring. The 2-formyl-1H-pyrrole-1-yl group which efficiency with 20 kinds of standard amino acids falls. may have a Substituted group at position 4 of the present US 8,715,984 B2 7 8 invention is called “Pa” or “Pa derivative' depending on the More preferably, it is 2-amino-6-(2-thienyl)-9H-purine-9-yl context in the present description. group. Concretely, the 2-formyl-1H-pyrrole-1-yl group which “9H-purine-9-yl group substituted with position 6, or posi may have a substituted group at position 4 may be selected tions 2 and 6' of the present invention, and nucleoside and from a class consisting of: nucleotide having it can be synthesized using known meth 1) 2-formyl-1H-pyrrole-1-yl (Pa) group; ods. For example, a method of synthesizing 2-amino-6-(2- 2) 2-formyl-4-(1-propyne-1-yl)-1H-pyrrole-1-yl group; thienyl)-9-(1-B-D-ribofranosyl)purine5'-triphosphate(sTP) 3) 2-formyl-4-methyl-1H-pyrrole-1-yl group; and from 2-N-phenoxyacetyl-6-(2-thienyl)-9-(2,3-di-O-acetyl 4) 2-formyl-4-ethinyl-1H-pyrrole-1-yl group. 10 1-B-D-ribofranosyl)purine is disclosed in Example 1 of Japa More preferably, it is 2-formyl-1H-pyrrole-1-yl group. nese Patent Kokai No. 2007-61087 (reference document 1). A nucleoside and a nucleotide having "2-formyl-1H-pyr The disclosure of the reference document 1 is incorporated role-1-yl group which may have a Substituted group at posi herein by reference thereto. tion 4” of the present invention can be synthesized using In addition, for example, a synthesis of the “s” is described known methods. For example, pyrrole-2-carboaldehyde as its 15 starting material can be purchased from Aldrich 1003-29-8 in the second paragraph of the second page of Bioorg. Med. or Merck 807574. Also, Pa derivative can be synthesized Chem. Lett., 11, p. 2221-2223 (2001) (reference document basically by derivatizing from Pa. For example, a derivative 2). Also, a synthesis of “v' is disclosed in WO2005/026187 introduced propyne at position 4 in Pais described at Bioorg. (reference document3), at paragraphs 0026,0027, FIGS. 5-6, Med. Chem. Lett., 13, p. 4515-4518 (2003). and the like, for example. Alternatively, it is disclosed in J. On the other hand, as the unnatural base which can form a Am. Chem. Soc., 127, p. 8652-8658 (2005) (reference docu base pair based on a specific hydrogenbond(s) with the above ment 4), paragraph in right column of page 2. The disclosures Pa or Pa derivative, a 9H-purine-9-yl group substituted at of the reference documents 2-4 are incorporated herein by position 6 or positions 2 and 6 is listed, and it is expressed as reference thereto. the following formula (II). 25 In a further preferred mode, as the unnatural base which Chemical Formula 2) can form a base pair with the above Pa or Pa derivative based on a hydrophobic interaction, there is 7-(2-thienyl)-imidazo (II) R2 4,5-b]pyridine-3-yl (Ds) group. These interactions can be expressed as follows. 'N1SN 30 Chemical Formula 3

s ll. (III) 35 In the formula (II), R' is hydrogenatom oramino group, R is a Substituted or non-substituted 2-thienyl group or 2-thia Zolyl group. The thienyl group or thiazolyl group of R is non-Substituted; alternatively, it may have one or more Sub 40 stituted groups at position 4 and/or position 5 independently selected from a class consisting of methyl group, amino group, nitro group, and hydroxy group. Among 9H-purine-9- yl group substituted with position 6, or positions 2 and 6 of the present invention, those whose R is a substituted or non 45 substituted 2-thienyl group is called “s' or “s analog accord Although the above DS-Papair has a specific complemen ing to a context of the present description. Among 9H-purine tation in in vitro or in vivo transcription and replication reac 9-yl group substituted with position 6, or positions 2 and 6 of tions, there is a problem that Ds themselves form a pair to the present invention, those whose R is a substituted or form DS-DS pairs in the case of using usual DS triphosphate as non-substituted 2-thiazolyl group is called “v' or “v analog 50 a substrate. Thus, it is preferable to use Y-amido triphosphate according to a context of the present description. which is a modulatory nucleotide as a substrate of Ds in the Concretely, the 9H-purine-9-yl group substituted with replication reaction. An incorporation rate of the y-amido position 6 or positions 2 and 6 may be selected from a class triphosphate of Ds into a position facing Ds falls, but that of consisting of the following: into complementary strand of Padoes not fall in the replica 1) 2-amino-6-(2-thienyl)-9H-purine-9-yl group (s): 55 tion reaction. More preferably, the y-amido triphosphate of 2) 6-(2-thienyl)-9H-purine-9-yl group (s'); adenine may be used for decreasing a misincorporation rate 3) 2-amino-6-(4-methyl-2-thienyl)-9H-purine-9-yl group: of adenine into complementary Strand of Pa. Thus, according 4) 6-(4-methyl-2-thienyl)-9H-purine-9-yl group: to use of a combination of usual nucleotide triphosphate of 5) 2-amino-6-(5-methyl-2-thienyl)-9H-purine-9-yl group; Pa, G, C and Twith the y-amido triphosphate of Ds and A, the 6) 6-(5-methyl-2-thienyl)-9H-purine-9-yl group: 60 7) 2-amino-6-(2-thiazolyl)-9H-purine-9-yl group (v); replication reaction by DNA polymerase is advanced specifi 8) 6-(2-thiazolyl)-9H-purine-9-yl group: cally, thereby it is possible to amplify DNA fragment having 9) 2-amino-6-(4-methyl-2-thiazolyl)-9H-purine-9-yl group; the DS-Papair by PCR. 10) 6-(4-methyl-2-thiazolyl)-9H-purine-9-yl group: In a further more preferred mode, 2-nitro-1H-pyrrole-1-yl 11) 2-amino-6-(5-methyl-2-thiazolyl)-9H-purine-9-yl 65 (Pn) group is listed as the unnatural base forming a base pair group; and in the replication reaction more specifically than the above Pa. 12) 6-(5-methyl-2-thiazolyl)-9H-purine-9-yl group. Its hydrophobic interaction can be expressed as follows. US 8,715,984 B2 10 aaRSS (for example, a Suppressor tRNA corresponding to Chemical Formula 4 stop codon). So far, it has been reported that tyrosyl-tRNA

synthetase (TyrRS) of E.coli was modified to various mutant TyrRSS for recognizing specifically various tyrosine deriva 5 tives and amber-suppressor tRNA which are unrecognizable with the wild-type enzyme (please see, for example, Kiga, D. et al., Proc. Natl. Acad. Sci. USA, 23, 9715-9720 (2002) (reference document 5)). In addition, pyrolysyl-tRNA syn thetase (PylRS) derived from archaebacterium and a mutant 10 enzyme thereof can introduce pyrolysine and its derivative into a protein (please see Japanese Patent Kokai No. 2007 037445 (reference document 6)). The disclosures of the ref erence documents 5 and 6 are incorporated herein by refer A nitro group at position 2 of Pn can efficiently Suppress a ence thereto. mismatch with adenine (A) which is a natural base in the 15 Phosphoseryl-tRNA synthetase (SepRS) and its mutant replication reaction. Accordingly, in PCR amplification reac enzyme obtained from anarchaebacterium, especially metha tion, it is possible to synthesize the DS-Pn pair efficiently and nogenic archaebacterium can be used for introducing phos specifically by usingy-amido triphosphate of DS, usual triph phoserine in E.coli or eukaryotic cell. For example, the wild type SepRS can be obtained from Methanosarcina mazei, osphate of Pn and other natural bases. 20 Methanococcus maripaludis and Methanocaldococcus jann As the preparation method of the modified tRNA of the aschii as methanogenic archaebacterium or Archaeoglobus present invention, it is preferable that transcription, reverse fiulgidus as Sulfur reduction archaebacterium and the like, but transcription or replication is performed from a template it is not restricted to these. Many bacterial genomic DNA DNA including the above unnatural base pair and then the sequences including these archaebacterium are known, it is modified tRNA is synthesized by incorporating a nucleotide 25 possible to obtain other homologous gene by performing a including other specific unnatural base into a complementary homology search of DNA sequence from a public database position of a template nucleotide including one unnatural like as GenBank and the like, for example. As a typical base, without particular restriction to chemical synthesis example, SepRS derived from Methanosarcina mazei is reg method, enzymatic synthesis method and a method using the istered with GenBank accession no. NC 003901, SepRS both and the like. It is possible to include one or several 30 derived from Methanococcus maripaludis is registered with unnatural base(s) in the modified tRNA molecule. GenBank accession no. NC 005791, SepRS derived from As the complementary unnatural base pair, unnatural base Methanocaldococcus jannaschii is registered with GenBank pairs as the above DS-Pa, DS-Pn, s-y, S-Z, X-y, V-y and the like accession no. NC 000909, and SepRS derived from are listed, without particular restriction. Among them, par Archaeoglobus filgidus is registered with GenBank acces ticularly preferred base pairs are the DS-Papair and the DS-Pn 35 sion no. NC 000917 (GeneID: 1483322). The base sequence pair, and a template DNA including these base pairs are of SepRS gene derived from the above Archaeoglobus filgi amplified by DNA replication reaction to synthesize tRNA by dus is shown in SEQ ID 1, the amino acid sequence of the transcription reaction using the amplified template DNA. protein is shown in SEQID 2. These SepRS sequences are Aminoacyl-tRNA Synthetase (aaRS) well-conserved, for example, the amino acid sequence There are 20 kinds of aaRSs corresponding to naturally 40 homology is about 70% or above. existing 20 kinds of amino acids, and each aaRS recognizes Based on the wild-type aaRS structure, various mutant only one amino acid and one set of tRNAs (there is a case of enzymes can be designed by replacing, deleting or adding the presence in plurality). The recognition of amino acid and amino acid residues at a desired position(s). For example, a tRNA with aaRS is extremely strict, it has been said that the ternary complex structure of SepRS-tRNA'-phosphoserine probability of mistake of protein synthesis is around 1/10000 45 is known. The atomic coordinate obtained from respective 2.6 per one amino acid. According to the difference in ATP Aand 2.8 Aresolutions of SepRS-tRNA-Sep ternary com binding motif, 20 kinds of aaRSs are classified into two plex and SepRS-tRNA binary complex are registered with classes (class I and class II) with 10 kinds each. Between these the code numbers as respective 2DU3 and 2DU4 in the pro two classes, structures or catalytic mechanisms of catalytic tein data bank (PDB, Protein Data Bank, managed by The domains are different. The class I aaRSs transfer an amino 50 Research Collaboratory for Structual Bioinformatics acid to the 2'OH of the ribose of the adenosine residue at the (RCSB), (reference document 7)). The disclosure of the ref 3' terminal end of the corresponding tRNA; on the other hand, erence document 7 is incorporated herein by reference the class II enzymes bind an amino acid to the 3'OH. It has thereto. been said for the recognition mechanism of tRNA that the Inventors of the present invention have already obtained a class II aaRSs strongly recognize the acceptor stem of tRNA; 55 mutant SepRS, in which a binding affinity against the amber on the other hand, the class I aaRSS recognize a wider portion suppressor and the opal suppressor tRNA of tRNA is including the Darm on the tRNA. increased based on the above structure (for example, please The aaRS(s) used in the present invention may be any see the above non-patent document 4). The disclosure of the naturally existing aaRS, but preferably it is a mutant enzyme reference document 4 is incorporated herein by reference which can activate the noncanonical amino acid. A protein 60 thereto. containing the noncanonical amino acid (allo-protein) is use In a preferred mode of the present invention, a triple mutant ful for protein function and structure analysis, and further it SepRS (E418N, E420N, T423V), in which glutamic acid at provides very important technical base for synthesizing new positions 418 and 420 in amino acid sequence shown as SEQ bioactive Substance or high-performance nano-device. In ID 2 are replaced with asparagine and threonine at position order to produce Such an allo-protein, it is necessary to Syn 65 423 in the amino acid sequence is replaced with Valine, can be thesize aaRS Such that recognizes the noncanonical amino used for the allo-protein synthesis in combination with trNA acid and also recognizes tRNA unrecognizable with other containing the above unnatural base. Various known methods US 8,715,984 B2 11 12 for a person skilled in the art can be used for a method to Synthesis of a Protein Incorporating the Noncanonical synthesize such a mutant. For example, by using a primer in Amino Acid which a base sequence coding a position of targeted amino A production method of a protein containing a noncanoni acid is replaced with a base sequence coding the amino acid to cal amino acid according to the present invention is charac be modified, a DNA coding the full length mutant SepRS is terized by: the following expressions (a)(b) and (c) in a cell(s) obtained by PCR amplification with the DNA having a sub or in a cell extract solution under existence of unnatural bases stituted base sequence coding the amino acid to be modified, and noncanonical amino acids: thereby an expression is possible from this DNA using a host (a) an aminoacyl-tRNA synthetase which can activate the cell like E.coli and the like. Alternatively, it can be performed noncanonical amino acid; with the known site-specific mutagenesis method Such as 10 (b) a modified tRNA of the present invention recognized by Kunkel method or Gapped duplex method and the like, and the aminoacyl-tRNA synthetase; and the mutagenesis kit (for example, Mutan-K or Mutan-G (c) an mRNA coding a desired protein having a codon includ (TAKARA) and the like) using these methods can be used. ing a nonsense codon or the unnatural base at a desired Screening Method of the Modified tRNA position(s). Further, according to the present invention, there is pro 15 Here, as a synthetic system of the aaRS or the modified vided a method of screening a modified tRNA for improving tRNA related to the present invention, any expression system aminoacylation reaction of tRNA by a noncanonical amino can be used, without particular restriction. For example, a acid. This method comprises: cell-free protein synthesizing system and a protein synthesiz (a) preparing a Suppressor tRNA recognized by an aminoa ing system in eubacterium cells, or an eukaryote cell, prefer cyl-tRNA synthetase which can activate the noncanonical ably an animal cell, especially preferably a mammalian cell amino acid; are listed. (b) synthesizing the modified tRNA containing an unnatural The cell-free protein synthesizing system is a system that base at any position(s) in the tRNA; takes out the protein factor which is necessary for translation (c) measuring an aminoacylation activity of the modified of the protein as cell extract solution, and synthesizes an tRNA under existence of standard and noncanonical amino 25 aimed protein by re-constituting this reaction in a test tube. acids and the aminoacyl-tRNA synthetase corresponding The cell-free system can be constituted by using an extract to these amino acids; and derived from various biological species, for example, extracts (d) selecting the modified tRNA, in which an incorporation can be prepared from bacterium like E.coli and thermophilic amount of the noncanonical amino acid is increased or an bacteria and the like, wheat germ agglutinin, rabbit reticulo incorporation rate of the noncanonical amino acid is 30 cyte, mouse L-cell, Ehrlich ascites tumor cell, HeLa cell, improved compared to that of the standard amino acid. CHO cell and budding yeast, and the like by using well Here, in the case of designing into which position(s) of known techniques. Among them, it is preferred to use an tRNA the unnatural base(s) is introduced, as mentioned the extract from E.coli, for example, an S30 extract prepared by above, the interaction position is determined about a pair of a methods described in Zubay et al. (Zubay et al., Ann. Rev. targeted aaRS and RNA, and then it is possible to replace one 35 genet. Vol. 7, pp. 267-287 (1973) (reference document 8)) and or more bases for these positions of tRNA into unnatural Pratt et al. (Pratt, J. M. et al., Transcription and Transla base(s). A residue relating to amino acid specificity of tRNA tion—A Practical Approach, (1984), pp. 179-209, Henes, B. is at least one position selected from the first three base pairs D. et al. eds. IRL Press, Oxford (reference document 9)) can (positions 1 and 72, positions 2 and 71, positions 3 and 70) of be used. Note, the contents of reference documents 8 and 9 are the acceptor stem, (in the case of existence of nucleotide at 40 incorporated herein by reference thereto. position -1) a base pair of this residue (position -1) and When the synthesis reaction of the protein incorporating position 73, the anticodon, the discriminator, the entire extra noncanonical amino acid is performed, a DNA or mRNA arm regarding type II tRNA, position 20, position 32, position coding a desired protein having a nonsense codon or a codon 37 and position 38. including the unnatural base at a desired positionina template It is preferred for the synthesis of the modified tRNA in the 45 of transcription/translation is added to the above cell extract above process (b) to prepare a tRNA gene including the Solution. In addition, the noncanonical amino acid, the ami unnatural base pair and to perform replication and transcrip noacyl-tRNA synthetase which can activate the noncanonical tion reactions with the tRNA gene as a template DNA. As the amino acid, the modified tRNA of the present invention and unnatural base pair which can be used for such a modified nucleotide triphosphate including the unnatural base tRNA synthesis, it is preferred for the base pair of any one 50 included in the modified tRNA are added. Furthermore, it is selected from 2-oxo-1H-pyridine-3-yl (y) group which may possible to include an energy source, various ion, buffer solu have a Substituted group at position 5, 2-oxo-1H-imidazole tions, ATP regenerating system, nuclease inhibitor, tRNA, 3-yl (Z) group, 2-formyl-1H-pyrrole-1-yl (Pa) group which reducing agent, polyethylene glycol, cAMP, folic acid or the may have a Substituted group at position 4 and 2-mitro-1H like, antibiotic, substrate for RNA synthesis in the case of pyrrole-1-yl (Pn) group which may have a Substituted group 55 using DNA as a template, and RNA polymerase and the like. at position 4, and any one of 7-(2-thienyl)-imidazo 4.5-b These are appropriately selected depending on the targeted pyridine-3-yl (Ds) group and 9H-purine-9-yl group. Among protein or kinds of protein synthesizing system for using, and them, especially preferred is the DS-Papair or the DS-Pn pair. to be prepared. For example, in the case of E.coli S30 extract, Alternatively, a gene library of tRNA, in which the unnatu a part of or all of the following is added: Tris-acetate, DTT, ral base is introduced at any positions randomly other than 60 NTPs(ATP, CTP, GTP and UTP), phosphoenolpyruvate, related positions interacting to the above aaRS, is synthe pyruvate kinase, amino acids(phosphoserine is added in addi sized, and then the above Screening may be performed using tion to 20 kinds of natural amino acids), polyethylene glycol this modified tRNA library. This is because that tRNA has a (PEG), folic acid, cAMP, tRNA, ammonium acetate, potas folded structure and its bases are involved in a three-dimen sium acetate, potassium glutamate, and magnesium acetate sionally interaction network, so that an effect of the base 65 with optimum concentration and the like. substitution extends to a remote position even without a direct Next, for explaining the present invention in more detail, interaction with the aaRS. the following examples, in which phosphoserine is linked to US 8,715,984 B2 13 14 the modified tRNA including Pa group at a position of anti alcohol:HCl:water (volume ratio 70:15:15)). A product on the codon with using the unnatural base pair of the DS-Pa pair TLC plate was analyzed with Image analyzer BAS2500 (Fuji shown in FIG. 2, will be indicated. However, the present film). A quantification of each spot was calculated to obtain invention is not particularly restricted by these examples. an average of 3-9 data sets. (3) Result In order to investigate aminoacylation by a series of mutant EXAMPLE1 SepRSs having 1-3 point mutations within the anticodon recognition site, two tRNA molecules: thNA and Synthesis of tRNA and tRNA tRNA, including Pal JA or CPaA sequences in its antic (1) Preparation of tRNA Molecule Including the Unnatural odon by a transcription reaction via the above described Base 10 unnatural DS-Pabase pair were synthesized (refer to FIG. 2B With Applied Biosystems 392 DNA synthesizer, a DNA and FIG.3A). Compared to tRNA", the first or the second fragment as a template was chemically synthesized using DS nucleotide in the anticodon triplets was replaced with Pa for and phosphoamidite (Applied Biosystems) as a natural base these two tRNA molecules. and 2'-O-methylribonucleosidoamidite (Glen Research). Its tRNA and tRNA, (75 bases each) were prepared base sequence of the DNA fragment is as follows. 15 with T7RNA polymerase using Pa substrate (PaTP) and a template DNA including Ds. As shown in FIG. 3B, the tem plate DNA (94 base pairs) of mRNA was constructed through 5'-non-template DNA fragment (71 bases) : (SEQ ID 3) a primer extension reaction of a partial double-stranded DNA 5 - GATAATACGACT CACTATAGCCAGGGTGGCAGAGGGGCTATGC formed of 5'-non-template DNA fragment (71 bases) and 5'-template DNA fragment (60 bases). Two nucleotides (G GGCGGACTCTAGATCCGCTTTACCCCGG-3' and T) at the 5' terminal end of the template strand were 5'-template DNA fragment (tRNA, 6Obases) : replaced with 2'-O-methylribonucleoside thereof (Gm and (SEQ ID 4) Tm). This can decrease an addition of one or more non TimCimCAGCCAGGGCCCGGATTCGAACCGGGGTAAAGCGGATCTADs template nucleotide(s) at the 3' terminal end of a new tran 25 Script. The transcription reaction was performed using 3 mM AGTCCGCCGCATAGCCC-3 PaTP 1 mM natural NTPs and 10 mM GMP and 0.5 uM 5'-template DNA fragment (tRNA, 6Obases) : template. The concentration of PaTP was increased to 3 mM (SEQ ID 5) because an incorporation of PaTP is somewhat less efficient TimCimCAGCCAGGGCCCGGATTCGAACCGGGGTAAAGCGGATCTDSG compared to that of natural NTPs. 30 It was confirmed by the nucleotide composition analysis of AGTCCGCCGCATAGCCC-3 the transcription product with internal label that Pa was incor Here, Tm represents 2'-O-methylthymidine, Gm repre porated into the tRNA transcript at a position facing to Ds in sents 2'-O-methylguanosine. A double-stranded DNA tem the template DNA with high selectivity. Its result is shown in plate (94 base pairs) was prepared such that the 5'-non-tem FIG. 3C and Table 1. In the analysis of tRNA, a spot plate DNA fragment (SEQ ID 3) and the 5'-template DNA 35 corresponding to a radiolabeled ribonucleoside 3' phosphate fragment (SEQ ID 4 or 5) were annealed, then a primer equivalent to Pa appeared on the two-dimensional TLC extension reaction was performed with Klenow fragment obtained from the transcript labeled with C-'PUTP, but (Takara Bio). A tRNA transcript including Pa was synthe there was no spot in the case of using C-PATP. This result sized at 37° C. with T7RNA polymerase (2.5 units/ul) for 6 indicates a correct incorporation of Painto the position facing hours using 0.5 M template in a solution including 40 mM 40 to Ds. This is because that 3'-phosphate of Pa is radiolabeled TrishC1, 24 mM MgCl, 0.01% Triton, 2 mM spermidine, 5 only in the case of using IO-PIUTP in the transcriptional mM dithiothreitol, 3 mM PaTP, 1 mM natural NTPs and 10 reaction when a neighboring base at the 3' side of Pais U in the mM GMP. The transcript was purified with polyacrylamide tRNA sequence. On the other hand, since no spot of Pa has gel electrophoresis. been detected on the TLC of the transcriptional product of the (2) Nucleotide composition analysis of T7 transcript 45 tRNA labeled with IC-PATP, it is indicated that a A transcription reaction was performed under existence of misincorporation of Pa into a complementary position of a C-32PATP (2 uCi) or C-32PUTP(2 uCi) for analyzing. natural base hardly happen in the transcription reaction using The transcript was digested at 37°C. with RnaseT2 (0.75-1.5 3 mM PaTP and 1 mM natural NTPs. Similarly, in the analy units/ul) for 1-2 hours in a solution (10 ul) including 15 mM sis of tRNA, a spot of phosphorylated Pais recognized on sodium acetate buffer (pH 4.5). Using Merck I-IPTLC plate 50 the TLC obtained from the transcription product labeled with (100x100 mm) (Merck), the digested material was analyzed C-‘PIATP, but it was not detected in the case of labeling with two-dimensional TLC using a one-dimensional devel O-PIUTP. This is because that a neighboring base at the 3' oping solvent (isobutyl acid: HCl: water (volume ratio 66:1: side of Pa is A in the tRNA and radiolabeled only with 33)) and a two-dimensional developing solvent (isopropyl C-PATP. TABLE 1. nucleotide composition incorporated at 5' side of U or A item number tRNA C-2P NTP Ap Gp Cp Up Pap 1 tRNA ATP 1.021° 4.046 2.889 3.032 0.012 1. 4 3) 3) O (0.035) (0.042) (0.044) (0.021) (0.002) 2 tRNA UTP 2.901 1996 4.936 3.183 0.984 3) 2 5 3) 1. (0.023) (0.038) (0.030) (0.021) (0.006) US 8,715 984 B2 15 16 TABLE 1-continued nucleotide composition incorporated at 5' side of U or A item number tRNA C-2P NTP Ap Gp Cp Up Pap 3 tRNA ATP 1.042 3.937 2.962 2.081 O.978 1. 4 3) 2 1. (0.029) (0.059) (0.059) (0.052) (0.010) 4 tRNA UTP 2.977 1969 4.994 3.049 O.O11 3) 2 5 3) O (0.098) (0.035) (0.048) (0.109) (0.001)

Note As shown in FIG, 3, it shows nucleotide composition incorporated at 5' neighboring base of A(item numbers 1 and 3) or U (item numbers 2 and 4). The values were determined by a calculating formula as follows: (radioactivity of each nucleotide), all radioactivity of all nucleotide (3'-phosphate) x (all numbers of 5' neighboring base of o-PINTP) Theoretical value of each nucleotide is shown in each parenthesis. Standard deviation is shown in each parenthesis (),

According to the quantification result of these spots on ing respective phosphoseryl-tRNA amount produced under TLC, a selectivity of the incorporation of Painto a position 20 the same reaction conditions, contrary to about 60 pmol of facing DS was about 98% in both of tRNA and tRNA Sep-tRNA produced by the wild-type SepRS, Sep (see Table 1, item numbers 2 and 3). On the other hand, a tRNA produced by the SepRS (E418N, E420N, T423V) misincorporation value of PaTP facing a natural base was was about 15 pmol, that of Sep-tRNA" was about 30 pmol, 1.1-1.2% (see Table 1, item numbers 1 and 4). These values that of Sep-tRNA" was about 25 pmol, that of Sep indicate that the misincorporation of Pa in the tRNA tran- 2s tRNA was about 60 pmol, that of Sep-tRNA was script by the following calculating formula is 0.08–0.11% per about 7 pmol. Therefore, the activity of the SepRS (E418N, each position of transcript: E420N. T423V) was relatively high at tRNA and rela Pa composition total number of neighboring base at tively low at tRNA, compared to tRNA" and 5' side of A regarding tRNA, or total number tRNAamber. of neighboring base at 5' side of U regarding 30 tRNA)x100(%) In order to introduce site-specifically the noncanonical amino acid into a protein using the mutantaaRS, it is required Accordingly, by increasing PaTP concentration (3 mM) com that the aaRS recognizes only exogenous tRNA specifically pared with natural NTPs concentration (1 mM), it was pos sible to introduce Painto a position in tRNA anticodon facing but does not recognize endogenous tRNA. In this regard, the template Ds with high selectivity and efficiently, without 35 because there was no indication for the SepRS (E418N, the misincorporation of Painto other position in the transcrip E420N. T423V) about a detectable activity against an endog tion product. enous tRNA mixtures of E.coli, wheat germ and yeast, it is Enzyme Screening for Introducing Phosphoserine into conceived that tRNA is highly specifically aminoacy tRNA and tRNA lated. Various mutant SepRSs in which one or more mutations 40 Measurement of Enzymatic Activity and Kinetic Analysis was/were introduced into amino acid residue(s) involved in The kinetic analysis of the phosphoserine binding reaction relating to an interaction with the first and second anticodon was performed in a 100 mM HEPES-NaOH buffer solution bases were designed based on a ternary complex structure of (pH7.6) (15ul) including 20 mM MgCl, 150 mM. NaCl, 5 SepRS-tRNA'-phosphoserine of A. fulgidus. A phospho mM ATP 100 uMC phosphoserine, 1,2,5,10.20.40,80 or serine binding reaction with various mutant SepRSs was per- 45 100 IM tRNA (tRNA-3, tRNAOP', tRNA "e, tRNA formed in 100 mM HEPES-NaOH buffer solution (pH7.6) or tRNA) and SepRS enzyme at 50° C. In order to deter (10 ul) including 20 mM MgCl, 150 mM NaCl, 5 mM ATP, mine the kinetic parameter of tRNA, 1 uM wild-type 60 uM'Ciphosphoserine, 1 M SepRS enzyme and 20M SepRS or 2 uM SepRS (E418N, E420N, T423V) was used; tRNA, or tRNA at 50° C. After 10 minutes reaction, and 2 uM SepRS (E418N, E420N, T423V) was used for a reaction mixture Solution (7 Jul) was extracted, the reaction 50 determining the kinetic parameter of tRNA", tRNA" was terminated on a filter paper (Whatman, 3 mm) equili and tRNA; and 5 uM SepRS (E418N, E420N, T423V) brated with 10% trichloroacetic acid (TCA). The filter paper was used for determining the kinetic parameter of tRNA. was washed three times with 5% ice-cold TCA solution, then When 30 seconds and 60 seconds passed after starting the it was washed once with 100% ethanol. A radioactivity of reaction, a certain amount (6 ul) of a reaction mixture Solution CISep-tRNA precipitated on the filter paper was measured 55 was extracted and the produced 'CISep-tRNA was quanti with a scintillation counter. Each experiment was repeated fied using the same method in the above. The kinetic param three times, the results were indicated by averages thereof. eter was calculated using Eadie-Hofstee plot. The results were shown in FIG. 4. Its result is shown in the following Table 2. Compared to As shown in FIG. 4, for most of the wild-type and mutant the kcat/Km of the wild-type SepRS against tRNA, the SepRSS having one or two point mutations, there was no 60 kcat/Km value of SepRS (E418N, E420N, T423V) against indication of any measurable activity toward either tRNA was decreased only to about a half, which was tRNA or tRNA. Contrary to this, there was an indi almost 2 fold greater than those values of SepRS (E418N, cation of an actual activity against tRNA for the triple E420N, T423V) against tRNAP and tRNA". In addi mutant as the SepRS (E418N, E420N, T423V). This mutant tion, compared to the original tRNA, it is understood that enzyme also shows a detectable activity against tRNA. It 65 the kcat/Km value of SepRS (E418N, E420N, T423V) is understood for this mutant enzyme that tRNA" and against the tRNA after the modification is increased to tRNA" are aminoacylated with phosphoserine. Compar almost 9 fold. US 8,715,984 B2 17 18 TABLE 2

kcat Km (relative Km (IM) kcat (s) kcat/Km value) SepRS(wild-type):tRNA 26.9 O.115 O.0043 1 SepRS(E418N E42ONT423V):tRNA 37.2 O.OO8 O.OOO2 O.OS3 SepRS(E418N E42ONT423V):tRNAOP 73.3 OO67 O.OOO9 O.215 SepRS(E418N E42ONT423V):tRNA-er 116.6 O.123 O.OO11 O.247 SepRS(E418N E42ONT423V):tRNA 47.1 O.151 O.OO20 O.476 SepRS(E418N E42ONT423V):tRNA 48.0 O.O13 O.OOO2 O.O38

INDUSTRIAL APPLICABILITY in their entireties by reference thereto. It should be noted that changes and modifications of the modes or examples may be It is applicable for wide variety of applications and practi- 15 done within the entire disclosure (inclusive of the claims) of cal use not only in basic study but also in medical, in agricul- the present invention and on the basis of the basic technical tural, further in industrial fields as a new material and the like concept thereof. Also, it should be noted that a variety of to produce a protein containing the noncanonical amino acid. combinations or selections of various elements as disclosed The present invention provides new combinations of the may be made within the scope of the claims of the present modified tRNA with aminoacyl-tRNA synthetase for this pur- 20 invention. That is, it should be noted that the present invention pose. also includes various changes and modifications which can be Here, it is to be noted that the disclosures of the above made by a person skilled in the art on the basis of the entire mentioned Patent Documents etc. are all incorporated herein disclosure (inclusive of the claims) and technical concept.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 5

<21 Os SEQ ID NO 1 &211s LENGTH: 16 O5 212. TYPE: DNA <213> ORGANISM: Archaeoglobus fulgidus 22 Os. FEATURE: <221s NAME/KEY: CDS <222s. LOCATION: (1) . . (1605) 223 OTHER INFORMATION:

<4 OOs SEQUENCE: 1 atgaaa titc gaC cct cag aag tac aga gag ctit gca gag aag gaC titc 48 Met Llys Phe Asp Pro Gln Lys Tyr Arg Glu Lieu Ala Glu Lys Asp Phe 1. 5 1O 15

gala gct gca tog aag gcc gga aag gaa att ctg gct gag aga agt cc.g 96 Glu Ala Ala Trp Lys Ala Gly Lys Glu Ile Lieu Ala Glu Arg Ser Pro 2O 25 3 O

aac gag Ctt tat coc aga gtg ggt titc agc titt ggit aag gag cac cct 144 Asn Glu Lieu. Tyr Pro Arg Val Gly Phe Ser Phe Gly Lys Glu. His Pro 35 4 O 45

Cta titt gcc aca att cag aga titg agg gag gct tac Ct c ticc at a gga 192 Lieu. Phe Ala Thir Ile Glin Arg Lieu. Arg Glu Ala Tyr Lieu. Ser Ile Gly SO 55 60

ttt t ct gag gtt gtgaat cog Ctg att gtt gag gat gtC Cac gtt aaa 24 O Phe Ser Glu Val Val Asn Pro Lieu. Ile Val Glu Asp Wal His Val Lys

aag cag titc gga agg gag gCt ttg gcc gtc. Ct c gac agg tec titc tac 288 Lys Glin Phe Gly Arg Glu Ala Lieu Ala Val Lieu. Asp Arg Cys Phe Tyr 85 90 95

citt gcc aca ct c ccc aag ccc aat gtg gigt at c tot gcg gag aaa atc 336 Lieu Ala Thr Lieu Pro Llys Pro Asn Val Gly Ile Ser Ala Glu Lys Ile 1OO 105 110

agg cag att gag gcc at a aca aag agg gag gtt gat tca aag CCC ctg 384 Arg Glin Ile Glu Ala Ile Thr Lys Arg Glu Val Asp Ser Llys Pro Lieu. 115 12O 125

cag gag att tt C cac cqc tac aag aag ggt gag att gaC gga gac gat 432 Glin Glu Ile Phe His Arg Tyr Llys Lys Gly Glu Ile Asp Gly Asp Asp

US 8,715,984 B2 21 22 - Continued

450 45.5 460 atc. gac ggc titt gcc tac tat gca gca agg aag gtt gag gag gct gcg 44 O Ile Asp Gly Phe Ala Tyr Ala Ala Arg Lys Wall Glu Glu Ala Ala 465 470 47s 48O atg agg gala cag gag gag gtg aag gtg a.a.a. gct agg att gta gag aac 488 Met Arg Glu Glin Glu Glu Wall Lys Wall Lys Ala Arg Ile Wall Glu Asn 485 490 495 citc. tog gac at a aac citt tac at C CaC gala aac gtc agg agg tac att 536 Lell Ser Asp Ile Asn Lell Ile His Glu ASn Wall Arg Arg Ile SOO 505 citc. tgg aag aag 999 aag ata gac gt C aga gga C Ca Ctg ttic gtt acc 584 Lell Trp Lys Lys Gly Lys Ile Asp Wall Arg Gly Pro Lell Phe Wall Thir 515 52O 525 gtt aag gcc gala att gag tag 605 Wall Lys Ala Glu Ile Glu 53 O

<210s, SEQ ID NO 2 &211s LENGTH: 534 212. TYPE : PRT &213s ORGANISM: Archaeoglobus fulgidus

<4 OOs, SEQUENCE: 2

Met Llys Phe Asp Pro Glin Arg Glu Luell Ala Glu Asp Phe 1. 15

Glu Ala Ala Trp Lys Ala Gly Glu Ile Luell Ala Glu Arg Ser Pro 25 3O

Asn Glu Luell Pro Arg Wall Gly Phe Ser Phe Gly Lys Glu His Pro 35 4 O 45

Lell Phe Ala Thir Ile Glin Arg Luell Arg Glu Ala Tyr Lell Ser Ile Gly SO 55 6 O

Phe Ser Glu Wall Wall Asn Pro Luell Ile Wall Glu Asp Wall His Wall Lys 65 70

Glin Phe Gly Arg Glu Ala Luell Ala Wall Luell Asp Arg Phe Tyr 85 90 95

Lell Ala Thir Luell Pro Pro Asn Wall Gly Ile Ser Ala Glu Ile 105 11 O

Arg Glin Ile Glu Ala Ile Thir Lys Arg Glu Wall Asp Ser Pro Luell 115 12 O 125

Glin Glu Ile Phe His Arg Tyr Gly Glu Ile Asp Gly Asp Asp 13 O 135 14 O

Lell Ser Luell Ile Ala Glu Wall Luell Asp Wall Asp Asp Ile Thir Ala 145 150 155 160

Wall Ile Luell Asp Glu Wall Phe Pro Glu Phe Glu Luell Lys Pro 1.65 17O 17s

Ile Ser Ser Thir Lell Thir Lell Arg Ser His Met Thir Thir Gly Trp Phe 18O 185 19 O

Ile Thir Luell Ser His Ile Ala Asp Luell Pro Lell Pro Ile Luell 195

Phe Ser Ile Asp Arg Phe Arg Arg Glu Glin Gly Glu Asp Ala Thir 21 O 215 22O

Arg Luell Thir Tyr Phe Ser Ala Ser Wall Lell Wall Asp Glu Glu 225 23 O 235 24 O

Lell Ser Wall Asp Asp Gly Ala Wall Ala Glu Ala Lell Luell Arg Glin 245 250 255

Phe Gly Phe Glu Asn Phe Arg Phe Arg Asp Glu Arg Ser Lys 26 O 265 27 O US 8,715,984 B2 23 24 - Continued

Tyr Tyr Ile Pro Asp Thr Glin Thr Glu Val Phe Ala Phe His Pro Llys 27s 28O 285 Lieu Val Gly Ser Ser Thr Llys Tyr Ser Asp Gly Trp Ile Glu Ile Ala 29 O 295 3 OO Thr Phe Gly Ile Tyr Ser Pro Thr Ala Leu Ala Glu Tyr Asp Ile Pro 3. OS 310 315 32O Tyr Pro Wal Met Asn Lieu. Gly Lieu. Gly Val Glu Arg Lieu Ala Met Ile 3.25 330 335 Lieu. Tyr Gly Tyr Asp Asp Val Arg Llys Met Val Tyr Pro Glin Ile His 34 O 345 35. O Gly Glu Ile Llys Lieu. Ser Asp Lieu. Asp Ile Ala Arg Glu Ile Llys Val 355 360 365 Lys Glu Val Pro Glin Thr Ala Val Gly Lieu Lys Ile Ala Glin Ser Ile 37 O 375 38O Val Glu Thir Ala Glu Lys His Ala Ser Glu Pro Ser Pro Cys Ser Phe 385 390 395 4 OO Lieu Ala Phe Glu Gly Glu Met Met Gly Arg Asn Val Arg Val Tyr Val 4 OS 41O 415 Val Glu Glu Glu Glu Asn. Thir Lys Lieu. Cys Gly Pro Ala Tyr Ala Asn 42O 425 43 O Glu Val Val Val Tyr Lys Gly Asp Ile Tyr Gly Ile Pro Llys Thr Lys 435 44 O 445 Lys Trp Arg Ser Phe Phe Glu Glu Gly Val Pro Thr Gly Ile Arg Tyr 450 45.5 460 Ile Asp Gly Phe Ala Tyr Tyr Ala Ala Arg Llys Val Glu Glu Ala Ala 465 470 47s 48O Met Arg Glu Glin Glu Glu Val Llys Wall Lys Ala Arg Ile Val Glu Asn 485 490 495 Lieu. Ser Asp Ile Asn Lieu. Tyr Ile His Glu Asn Val Arg Arg Tyr Ile SOO 505 51O Lieu. Trp Llys Lys Gly Lys Ile Asp Val Arg Gly Pro Lieu. Phe Val Thr 515 52O 525 Val Lys Ala Glu Ile Glu 53 O

<210s, SEQ ID NO 3 &211s LENGTH: 71 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: 5'-nontemplate DNA fragment

<4 OOs, SEQUENCE: 3 gataatacga ct cactatag ccagggtggC agaggggcta ticggcggac totagat CC9 ctitt accc.cg g

<210s, SEQ ID NO 4 &211s LENGTH: 60 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: 5'-template DNA fragment for tRNA (PauA) 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (1) . . (1) <223> OTHER INFORMATION: t is modified as 2'-O-methylthimidine 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (2) ... (2) US 8,715,984 B2 25 26 - Continued <223> OTHER INFORMATION: g is modified as 2'-O-methylguanosine 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (43) . . (43) <223 is OTHER INFORMATION: n stands for Ds

<4 OOs, SEQUENCE: 4 tggagcCagg gcc.cggattic galaccggggit aaag.cggatc tanagtc.cgc cqCatagcc C 6 O

<210s, SEQ ID NO 5 &211s LENGTH: 60 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: 5'-template DNA fragment for tRNA (CPaA) 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (1) . . (1) <223> OTHER INFORMATION: t is modified as 2'-O-methylthimidine 22 Os. FEATURE: <221 > NAMEAKEY: modified base <222s. LOCATION: (2) ... (2) <223> OTHER INFORMATION: g is modified as 2'-O-methylguanosine 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (42) ... (42) <223 is OTHER INFORMATION: n stands for Ds

<4 OOs, SEQUENCE: 5 tggagcCagg gcc.cggattic galaccggggit aaag.cggatc tngagtc.cgc cqCatagcc C 6 O

The invention claimed is: (c) selecting the modified tRNA, in which an incorporating 1. A method of screening a modified tRNA for improving amount of the noncanonical amino acid(s) is increased aminoacylation reaction of a tRNA by a noncanonical amino or an incorporating rate of the noncanonical amino acid acid, comprising: 35 is improved compared to that of the standard amino (a) preparing a modified Suppressor tRNA comprising an acid(s), as a modified tRNA having improved aminoa unnatural base at the first or the second position of the cylation activity with a noncanonical amino acid. anticodon of a Suppressor tRNA, wherein said unnatural 2. The method of claim 1, wherein said modified tRNA in base comprises a 2-oxo-1H-pyridine-3-yl (y) group (a) is synthesized Such that a tRNA gene including the which may have a Substituted group at position 5, a 40 unnatural base is prepared and a transcription reaction is 2-oxo-1H-imidazole-3-yl (Z) group, a 2-formyl-1H-pyr performed with said tRNA gene as a template DNA. role-1-yl (Pa) group which may have a Substituted group 3. The method of claim 1, wherein said unnatural base pair at position 4 or a 2-nitro-1H-pyrrole-1-yl (Pn) group is a DS-Papair, a DS-Pn pair or a s-y pair. which may have a substituted group at position 4; 4. A method for producing a protein incorporating a non (b) measuring an aminoacylation activity of the modified 45 canonical amino acid, comprising expressing in a cell(s) or tRNA with standard and noncanonical amino acids, and providing in a cell extract the following (a), (b) and (c) a mutant aminoacyl-tRNA svnthetase that is: together with an unnatural base(s) and the noncanonical a mutant aminoacyl-tRNA synthetase having the amino amino acid(s): acid sequence of SEQID NO: 2 in which the glutamic (a) a mutant aminoacyl-tRNA synthetase that is: acid at position 418 is replaced with aspartic acid, aspar 50 agine or glutamine; a mutant aminoacyl-tRNA synthetase having the amino a mutant aminoacyl-tRNA synthetase having the amino acid sequence of SEQID NO: 2 in which the glutamic acid sequence of SEQID NO: 2 in which the glutamic acid at position 418 is replaced with aspartic acid. aspar acid at position 420 is replaced with aspartic acid, aspar agine or glutamine; agine, glutamine, lysine or arginine; 55 a mutant aminoacyl-tRNA synthetase having the amino a mutant aminoacVl-tRNA synthetase having the amino acid sequence of SEQID NO: 2 in which the glutamic acid sequence of SEQID NO: 2 in which the glutamic acid at position 420 is replaced with aspartic acid, aspar acid at position 418 is replaced with aspartic acid, aspar agine, glutamine, lysine or arginine; agine or glutamine, and the glutamic acid at position 420 a mutant aminoacyl-tRNA synthetase having the amino is replaced with aspartic acid, asparagine or glutamine: 60 acid sequence of SEQID NO: 2 in which the glutamic O acid at position 418 is replaced with aspartic acid. aspar a mutant aminoacVl-tRNA synthetase having the amino agine or glutamine, and the glutamic acid at position 420 acid sequence of SEQ ID NO:2 in which the glutamic is replaced with aspartic acid, asparagine or glutamine: acid at position 418 is replaced with asparagine, the O glutamic acid at position 420 is replaced with asparagine 65 a mutant aminoacyl-tRNA synthetase having the amino and the threonine at position 423 is replaced with valine: acid sequence of SEQID NO: 2 in which the glutamic and acid at position 418 is replaced with asparagine, the US 8,715,984 B2 27 28 glutamic acid at position 420 is replaced with asparagine comprises a 2-oxo-1 H-pyridine-3-yl (y) group which may and the threonine at position 423 is replaced with valine: have a substituted group at position5, a 2-oxo-1H-imidazole (b) a modified suppressor tRNA comprising an unnatural 3-yl (Z) group, a 2-formyl- 1-1H-pyrrole-1-yl (Pa) group base at the first or the second position of the anticodon of which may have a substituted group at position 4 or a 2-nitro a Suppressor tRNA, wherein said unnatural base com 5 1H-pyrrole-1-yl (Pn) group which may have a substituted prises a 2-oxo-1 H-pyridine-3-yl (y) group which may group at position 4; and have a substituted group at position 5, a 2-oxo-1H-imi a mutant aminoacyl-tRNA synthetase which can aminoa dazole-3-yl (Z) group, a 2-formyl-1H-pyrrole-1-yl (Pa) cylate the modified suppressor tRNA with a noncanoni group which may have a substituted group at position 4 cal amino acid(s), and wherein said mutant aminoacyl or a 2-nitro-1H-pyrrole-1-yl (Pn) group which may have 10 tRNA synthetase is: a substituted group at position 4 and that is recognized a mutant aminoacyl-tRNA synthetase having the amino by said mutant aminoacyl-tRNA synthetase; and acid sequence of SEQID NO. 2 in which the glutamic (c) an mRNA coding for a desired protein and having a acid at position 418 is replaced with aspartic acid, aspar nonsense codon or a codon including an unnatural base agine or glutamine; at a desired position(s), wherein said unnatural base 15 a mutant aminoacyl-tRNA synthetase having the amino comprises a 2-oxo-1 H-pyridine-3-yl (y) group which acid sequence of SEQID NO: 2 in which the glutamic may have a substituted group at position 5, a 2-oxo-1H acid at position 420 is replaced with aspartic acid, aspar imidazole-3-yl (z) group, a 2-formyl-1H-pyrrole-1-yl agine, glutamine, lysine or arginine; (Pa) group which may have a substituted group at posi a mutant aminoacyl-tRNA synthetase having the amino tion 4 or a 2-nitro-1H-pyrrole-1-yl (Pn) group which acid sequence of SEQID NO: 2 in which the glutamic may have a substituted group at position 4. acid at position 418S replaced with aspartic acid, aspar 5. The method of claim 4, wherein said noncanonical agine or glutamine, and the glutamic acid at position 420 amino acid is phosphoserine, pyrrolidine, lysine derivative or is replaced with aspartic acid, asparagine or glutamine: tyrosine derivative. O 6. The method of claim 4, wherein said aminoacyl-tRNA 25 a mutant aminoacyl-tRNA synthetase having the amino Synthetase is a mutant phosphoseryl-tRNA synthetase, and a acid sequence of SEQID NO: 2 in which the glutamic codon in mRNA including said unnatural base is UADs. acid at position 418 is replaced with asparagine, the 7. A combination of a modified suppressor tRNA compris glutamic acid at position 420 is replaced with asparagine ing an unnatural base at the first or the second position of the and the threonine at position 423 is replaced with valine. anticodon of a suppressor tRNA, wherein said unnatural base