Symptom Recovery in Tomato Ringspot Virus Infected Nicotiana

SYMPTOM RECOVERY IN TOMATO RINGSPOT VIRUS INFECTED NICOTIANA

BENTHAMIANA PLANTS: INVESTIGATION INTO THE ROLE OF PLANT RNA

SILENCING MECHANISMS

BASUDEV GHOSHAL

B.Sc., Surendranath College, University of Calcutta, Kolkata, India, 2003 M. Sc., University of Calcutta, Kolkata, India, 2005

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES

(Botany)

THE UNIVERSITY OF BRITISH COLUMBIA

(Vancouver)

August 2014

Symptom recovery in virus-infected plants is characterized by the emergence of asymptomatic leaves after a systemic symptomatic phase of infection and has been linked with the clearance of the viral RNA due to the induction of RNA silencing. However, the recovery of Tomato ringspot virus (ToRSV)-infected Nicotiana benthamiana plants is not associated with viral RNA clearance in spite of active RNA silencing triggered against viral sequences. ToRSV isolate Rasp1-infected plants recover from infection at 27°C but not at

21°C, indicating a temperature-dependent recovery. In contrast, plants infected with ToRSV isolate GYV recover from infection at both temperatures. In this thesis, I studied the molecular mechanisms leading to symptom recovery in ToRSV-infected plants.

I provide evidence that recovery of Rasp1-infected N. benthamiana plants at 27°C is associated with a reduction of the steady-state levels of RNA2-encoded coat protein (CP) but not of RNA2. In vivo labelling experiments revealed efficient synthesis of CP early in infection, but reduced RNA2 translation later in infection. Silencing of Argonaute1-like

(NbAgo1) genes prevented both symptom recovery and RNA2 translation repression at 27°C.

Also, translation repression was compromised in Rasp1-infected wild-type (WT) plants grown at 21°C. NbAgo1 and NbAgo2 mRNAs accumulated to similar levels at 21°C and

27°C in mock-inoculated WT plants. Both genes were induced during Rasp1 infection.

Interestingly, the effect of silencing NbAgo2 on Rasp1 infection was only evident at low temperatures resulting in higher accumulation of CP. Taken together, our results suggest that although both NbAgo1 and NbAgo2 genes are induced, recovery of Rasp1-infected plants at

27°C is associated with an NbAgo1-dependent mechanism that represses the translation of viral RNA2.

In contrast, recovery of GYV-infected plants is associated with a reduction of viral RNA and

CP levels at both temperatures. Moreover, silencing of either NbAgo1 or NbAgo2 did not prevent recovery of GYV-infected plants at 21°C. However, both GYV-infected NbAgo1 and NbAgo2-silenced plants accumulated higher level of CP in recovered leaves compared to control plants. In conclusion, this study identifies translation repression as a novel regulatory mechanism in recovery and suggests that different mechanisms may operate during recovery in an isolate and/or temperature-dependent manner.

iii

Preface

The research work described here is a result of the work done in Dr. Hélène Sanfaçon’s lab from May 2009 to March 2014 by the candidate. Below is a list of manuscripts (published or in preparation) that comprise this thesis. The contribution of the candidate is mentioned below.

Chapter 1: Literature review

The candidate wrote the chapter and Dr. Hélène Sanfaçon provided editorial

support.

Chapter 2: Temperature-dependent symptom recovery in Nicotiana benthamiana

plants infected with tomato ringspot virus is associated with reduced

translation of viral RNA2 and requires ARGONAUTE 1 was modified from

the manuscript:

Ghoshal, B. and Sanfaçon, H. (2014) Temperature-dependent symptom recovery

in Nicotiana benthamiana plants infected with tomato ringspot virus is

associated with reduced translation of viral RNA2 and requires

ARGONAUTE 1. Virology 456-457: 188-197

The candidate designed, performed the research and wrote the manuscript. Dr.

Hélène Sanfaçon supervised the work and manuscript preparation and provided

editorial support.

Chapter 3: Possible involvement of both NbAgo1 and NbAgo2 genes during ToRSV

infection in a temperature-dependent manner , a version of this chapter will

be prepared for publication.

The candidate designed, performed and wrote the chapter. Dr. Hélène Sanfaçon

supervised the work and provided editorial support.

Chapter 4: Symptom recovery of ToRSV-GYV infected plants at 21°C is concomitant

with low accumulation of viral products and is not prevented in NbAgo1-

silenced plants, a version of this chapter will be prepared for publication.

The candidate designed, performed and wrote the chapter. Dr. Hélène Sanfaçon

supervised the work and provided editorial support. The sequencing of the

entire genome was done by Joan Chisholm, Melanie Walker, Ting Wei,

Basudev Ghoshal, and Hélène Sanfaçon.

Chapter 5: General discussion

The candidate wrote the chapter and Dr. Hélène Sanfaçon provided editorial

support.

Table of Contents

Abstract ...... ii

Preface ...... iv

Table of Contents ...... vi

List of Tables ...... ix

List of Figures ...... x

List of Abbreviations ...... xii

Acknowledgments ...... xv

Dedication ...... xviii

Chapter 1: Literature review ...... 1 1.1 Introduction ...... 1 1.2 Multiplication cycle of positive-sense single-strand RNA virus ...... 3 1.3 RNA silencing in plants ...... 7 1.3.1 Description of the pathway ...... 7 1.3.2 Characteristics of the key components in the pathway ...... 10 1.3.2.1 Dicer/Dicer like enzymes ...... 12 1.3.2.2 Argonaute ...... 12 1.3.2.3 RNA dependent RNA Polymerase ...... 13 1.3.2.4 Types of small RNA ...... 15 1.4 RNA Silencing as an antiviral defence response in plants and its counter defence ...... 17 1.4.1 Role of RNA silencing components in antiviral defence response ...... 18 1.4.2 Mode of RISC activity - Cleavage or translation repression of the viral RNA...... 22 1.4.3 Counteracting RNA silencing – Viral suppressors ...... 26 1.5 Symptom development, maintenance and recovery during plant-virus interaction ...... 29 1.5.1 Symptom development, maintenance and RNA silencing ...... 31 1.5.2 Symptom recovery ...... 34 1.5.2.1 Role of RNA silencing in symptom recovery ...... 35 1.5.2.2 Role of suppressors in meristem entry of viruses and symptom recovery ...... 36 1.5.2.3 Effect of temperature on symptom recovery ...... 38 1.5.2.4 Recovery and the nature of host and virus isolate ...... 39 1.6 Overview of Tomato ringspot virus ...... 40 1.6.1 Classification of ToRSV ...... 41 1.6.2 Genome organization and proteins encoded by ToRSV ...... 41

1.6.3 ToRSV multiplication cycle ...... 43 1.6.4 Interaction of ToRSV with herbaceous plants ...... 46 1.7 Thesis objectives ...... 49

Chapter 2: Temperature-dependent symptom recovery in Nicotiana benthamiana plants infected with ToRSV is associated with reduced translation of viral RNA2 and requires ARGONAUTE1 ...... 50 2.1 Introduction ...... 50 2.2 Materials and methods ...... 51 2.2.1 Virus inoculations ...... 51 2.2.2 Isolation and detection of RNA ...... 51 2.2.3 Isolation and detection of proteins ...... 52 2.2.4 In vivo labelling experiments and immunoprecipitation ...... 52 2.2.5 Virus induced gene silencing assays...... 53 2.3 Results ...... 54 2.3.1 Temperature-dependent symptom recovery in ToRSV-infected N. benthamiana plants is associated with reduced viral CP accumulation and increased vsiRNAs levels ...... 54 2.3.2 Reduced rate of translation of viral RNA2 at late stages of infection at 27°C ...... 59 2.3.3 Recovery is compromised by down-regulation of NbAgo1 ...... 63 2.3.4 Translation of RNA2 is partially reactivated in temperature-shift experiments ...... 67 2.4 Discussion ...... 72

Chapter 3: Possible involvement of both NbAgo1 and NbAgo2 genes during ToRSV infection in a temperature-dependent manner ...... 76 3.1 Introduction ...... 76 3.2 Materials and methods ...... 77 3.2.1 Virus inoculations ...... 77 3.2.2 Isolation and detection of RNA ...... 77 3.2.3 Isolation and detection of proteins ...... 77 3.2.4 Virus induced gene silencing assays ...... 77 3.3 Results ...... 78 3.3.1 NbAgo1 and NbAgo2 genes are induced during ToRSV infection at both temperatures ...... 78 3.3.2 ToRSV CP accumulates to higher levels in NbAgo2- silenced plants ...... 81 3.4 Discussion ...... 83

Chapter 4: Symptom recovery of GYV-infected plants at 21°C is concomitant with low accumulation of viral products and is not prevented in NbAgo1-silenced plants ...... 86 4.1 Introduction ...... 86 4.2 Materials and methods ...... 87 4.2.1 Virus inoculations ...... 87

vii

4.2.2 Isolation and detection of RNA ...... 87 4.2.3 Isolation and detection of proteins ...... 87 4.2.4 Virus induced gene silencing assays ...... 88 4.3 Results ...... 89 4.3.1 GYV induces milder symptoms and recovers from infection at 21°C ...... 89 4.3.2 Serial dilution of Rasp1 inoculum does not result in symptom recovery at 21°C ...... 97 4.3.3 Recovery of GYV- infected plants is associated with an early accumulation of vsiRNAs at 21°C ...... 100 4.3.4 Symptoms are associated with induction of PR1a and down regulation of RbcS in GYV-infected plants as observed for Rasp1- infected plants ...... 101 4.3.5 Recovery of GYV- infected plants at 21°C is not compromised by the down regulation of NbAgo1-and NbAgo2- like genes ...... 104 4.3.6 GYV provides cross protection to plants against Rasp1 ...... 106 4.4 Discussion ...... 109

Chapter 5: General Discussion ...... 112 5.1 Introduction ...... 112 5.2 Molecular insight into the mechanism of ToRSV-induced recovery in N. benthamiana plants ...... 113 5.2.1 Role of viral derived siRNA in symptom recovery ...... 113 5.2.2 Reduced rate of translation and symptom recovery- a novel mechanism in recovery...... 115 5.2.3 Symptom recovery and the possible role of a ToRSV encoded suppressor of silencing ...... 121 5.3 Biological relevance of the translation repression mechanism-impact on the virus and on the plants ...... 122 5.3.1 Maintaining the host in order to maintain the virus ...... 122 5.3.2 Maintaining the virus might be beneficial to the host ...... 123 5.4 Model for ToRSV induced recovery ...... 124

Bibliography ...... 129

viii

List of Tables

Table 1.1 Table showing different number of homologs of RNA silencing pathway enzymes identified from different organisms ...... 14

Table 4.1 Table showing percentage of sequence similarity at the nucleotide and amino acid level between Rasp1 and GYV ...... 93

Table 4.3B Table showing percentage of plants that developed symptoms after inoculation with different dilutions of inoculum (6 plants for undiluted inoculum, 18 plants for each of the rest of the inoculum) ...... 99

List of Figures

Figure 1.1 Symptom recovery and functions of RNA silencing ...... 2

Figure 1.2 Diagrammatic sketch of a positive-sense single-strand RNA virus multiplication cycle...... 6

Figure 1.3 Different terms used for RNA silencing and different levels of gene expression where RNA silencing can act...... 9

Figure 1.4 Diagrammatic sketch of simplified RNA silencing mechanism ...... 11

Figure 1.5 Flow chart showing the different types of small RNA involved in RNA silencing pathways in plants ...... 16

Figure 1.6 Flow chart representing some of the changes induced during plant-virus interaction leading to symptom development ...... 33

Figure 1.7 ToRSV genome and its mode of protein synthesis ...... 45

Figure 1.8 Interaction of ToRSV with N. benthamiana plants ...... 48

Figure 2.1 Temperature-dependent recovery of ToRSV-Rasp1 infected plants is associated with a reduction of RNA2-encoded proteins but not of RNA2 ...... 57

Figure 2.2 Reduced translation rate of RNA2 in late stages of infection in ToRSV-infected plants grown at 27°C ...... 61

Figure 2.3 Recovery is compromised by down-regulation of Ago1 ...... 65

Figure 2.4 Partial re-induction of protein synthesis in temperature shift experiments ...... 69

Figure 2.5 Sequential inoculations confirm that symptom induction requires a threshold of viral protein accumulation ...... 70

Figure 3.1 Relative levels of NbAgo1, NbAgo2 and NbAgo4 in mock and Rasp1-infected plants at 21°C and 27°C...... 80

Figure 3.2 Effect of down regulation of NbAgo1, NbAgo2 and NbAgo4 during ToRSV infection at 21°C ...... 82

Figure 4.1 Symptom development and recovery in N. benthamiana plants infected with the ToRSV isolates (Rasp1 or GYV) at 27oC and 21oC ...... 94

Figure 4.2 Accumulation of viral RNA2 and viral CP during the course of infection of Rasp1 and GYV ...... 95

Figure 4.3 Effect of serial dilutions of inoculum on Rasp1 infection ...... 99

Figure 4.4 Induction of host defence responses during Rasp1 and GYV infection at the two temperatures ...... 103

Figure 4.5 Effect of GYV infection on plants silenced for NbAgo1 and NbAgo2 genes at 21°C ...... 105

Figure 4.6 Cross protection of plants infected with GYV against Rasp1 ...... 108

Figure 5.1 Model showing probable pathways for translation repression of the viral RNA2 ...... 119

Figure 5.2 Proposed model for symptom recovery and non-recovery of ToRSV-infected N. benthamiana plants ...... 127

List of Abbreviations

3’ Three prime 5’ Five prime A Adenosine in the context of nucleotide sequence A Alanine in the context of amino acid sequence ACMV African cassava mosaic virus AMV Alfalfa mosaic virus AMP1 Altered meristem program 1 AGO ARGONAUTE A. thaliana Arabidopsis thaliana AT Arabidopsis thaliana BRV Blackcurrant reversion virus C Cytidine in the context of nucleotide sequence CR Chlamydomonas reinhardtii C-terminal Carboxy-terminal CaMV Cauliflower mosaic virus CMV Cucumber mosaic virus Ca-siRNA Cis-acting small interfering RNA CE Caenorhabditis elegans CHLI Magnesium protoporphyrin chelatase subunit I CP Coat Protein CRSV Cymbidium ringspot virus D Aspartic acid Das Days after shifting DCL DICER LIKE DM Drosophila melanogaster DNA Deoxyribonucleic acid Dpi Days post inoculation DRB Double strand RNA binding dsRBD Double strand RNA binding domain dsRNA Double strand RNA DUF Domain of unknown function E Glutamic acid E1Fα Elongation factor-1 alpha EIF4E Eukaryotic initiation factor 4E EIF4G Eukaryotic initiation factor 4G ER Endoplasmic reticulum FHV Flock house virus Fig Figure G Glycine in the context of amino acid sequence G Guanosine in the context of nucleotide sequence GFLV Grapevine fanleaf virus GFP Green fluorescent protein GYV Grape yellow vein

xii

HC-pro Helper component protease HCV Hepatitis C virus HEN1 HUA ENHANCER 1 HIV Human immunodeficicieny virus HR Hypersensitive response HS Homo sapiens IP-CP Immunoprecipitated coat protein kb Kilobase lsiRNA Long small interfering RNA mRNA Messenger RNA miRNA Micro RNA MP Movement Protein MID Middle N. benthamiana Nicotiana benthamiana N terminal Amino terminal Nat-siRNA Natural antisense small interfering RNA NB Nicotiana benthamiana NbAgo1 Nicotiana benthamiana argonaute 1 gene NbAgo2 Nicotiana benthamiana argonaute 2 gene NbAgo4 Nicotiana benthamiana argonaute 4 gene NbSgt1 Nicotiana benthamiana Suppressor of G2 allele of SKP1 gene NC Neurospora crassa nt Nucleotide NTB Nucleoside-triphosphate binding protein OS Oryzae sativa P1 Polyprotein 1 P2 Polyprotein 2 PAZ PIWI-ARGONAUTE-ZWILLE P bodies Processing bodies PEBV Pea early browning virus PIWI P-element induced whimpy testis Poly A Polyadenylate or polyadenylic acid Pre-RISC pre-RNA induced silencing complex Pro Protease PTGS Post transcriptional gene silencing PVX Potato virus X PVY Potato Virus Y PR1a Pathogenesis related protein 1a R gene Resistance gene RbcL Ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit RbcS Ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit RdRP RNA dependent RNA polymerase RISC RNA induced silencing complex RNA Ribonucleic acid RNAi RNA interference RNaseH Ribonuclease H

xiii rRNA Ribosomal RNA RUBISCO Ribulose-1,5-bisphosphate carboxylase/oxygenase RYMV Rice yellow mottle virus S3 Post nuclear fraction [35S]-methionine Radioactive 35S labelled methionine SP Schizosaccharomyces pombe SGS3 Suppressor of gene silencing 3 SGT1 Suppressor of G2 allele of SKP1 siRNA Small interfering RNA SL Solanum lycopersicum SPCSV Sweet potato chlorotic stunt virus SPMMV Sweet potato mild mottle virus T Thymidine in the context of nucleotide sequence Ta-siRNA Trans-acting small interfering RNA TAT Trans-activator of transcription TBRV Tomato black ring virus TBSV Tomato bushy stunt virus TCV Turnip crinkle virus TEV Tobacco etch virus TGS Transcriptional gene silencing TMV Tobacco mosaic virus ToRSV Tomato ringspot virus TRV Tobacco rattle virus TRSV Tobacco ringspot virus tRNA Transfer RNA TSV Tobacco streak virus TuMV Turnip mosaic virus TYMV Turnip yellow mosaic virus VIGS Virus induced gene silencing VPg Viral genome linked protein vsiRNA Viral derived small interfering RNA VSR Viral suppressor of gene silencing UTR Untranslated region W Tryptophan µCi Microcurie µg Microgram

xiv

Acknowledgements

I would first like to thank my Ph.D. supervisor Dr. Hélène Sanfaçon for her guidance, support and criticism throughout my Ph.D. work. She has helped me a lot to grow professionally. In addition I would like to especially thank her for her support during my days of depression.

I am indebted to my committee members Dr. Ljerka Kunst, Dr. Carl Douglas and Dr. Xin Li for their critical analyses that helped me to improve my work. I would also like to thank my external examiners of my comprehensive exam, Dr. Jim Kronstad and Dr. D’Ann Rochon and my graduate advisor Dr. Patrick Martone.

Special thanks to my lab members Joan Chisholm and Melanie Walker. They have provided constant assistance and support in lab techniques. I would also like to thank my lab members

Rajita Karran and Ting Wei. All of them have provided valuable suggestions in my research work. I would like to wish all the best to Dinesh Babu Paudel who will continue to work on this project.

Heartfelt thanks go to Dr. Peter Moffett for pre-reviewing my second chapter before its publication.

I am very thankful to the Pacific Agriculture and Agri-Food Canada (PARC), Summerland for allowing me to use their facilities. I would like to thank Dr. Kenna MacKenzie, Research

Manager. I am also thankful to all the staff at PARC Summerland for their help during my

xv research, especially to the staff involved in maintaining the convirons and to the

Commissonaires.

Many thanks to the other people at PARC especially Dr. David Theilmann, Dr. Guus

Bakkeren, Dr. Paul Wiersma, Michael Weis, Jane Theilmann, Ron Reade, Les Willis and

Rob Linning. Also I would like to thank the staff members of the Department of Botany especially Mrs. Veronica Oxtoby. I think she has made my PhD life easier by her constant help in administrative requirements. I am thankful to my friends and colleagues at the station

– in addition to my lab members, Ajay Maghodia, Shawkat Ali, Nadia Sokal, Yingchao Nie,

Elizabeth Hui, Colleen Harlton, Susan Wahlgreen, Robyn DeYoung, Eunice Randall,

Siddartha Biswas and Syed Benazir Alam.

I am indebted to my teachers especially Dr. Nimai Chandra Barui, Dr. Prabir Kumar

Ganguly and Dr. Biswanath Bhowmick. I am also thankful to Dr. Swapan Kumar Datta and

Dr. Karabi Datta for deepening my interest towards research.

Heartfelt thanks to my friends and their family - Dipak Chindarkar, Vinod Chalhotra, Samita

Guha and Joe Kirk for their help in different aspects of my life in Canada that helped me to focus towards my PhD.

I wish to express my heartfelt appreciation and gratitude to my mother. I am indebted to my two elder brothers and sister-in-laws for their strong support. I would also like to give a

xvi special thanks to my in-laws for their constant motivation, help and encouragement. I am grateful to my uncle Prasanta Dutta and his family for their support.

I am very grateful to Kankana, my wife for her support in every aspect of life. She has been not only my wife but a friend, critic, my support and encouragement.

xvii

Dedication

To my family and friends

xviii

Chapter 1

Literature Review

1.1 Introduction

In this thesis, I have investigated the role of RNA silencing in the symptom recovery of plants infected by a nepovirus. Symptom recovery was first reported in the year 1928 by

Wingard et al. in Tobacco ringspot virus (TRSV, family Secoviridae, genus Nepovirus) - infected tobacco plants (1). In TRSV-infected plants, symptoms initially developed on the inoculated and systemically infected leaves (Fig. 1.1A). However, later in infection new asymptomatic leaves emerged above the symptomatic systemically infected leaves. This phenomenon was called symptom recovery (1, 2). Later, symptom recovery was also reported in plants infected with RNA viruses such as Tobacco rattle virus (TRV, family

Virgaviridae, genus Tobravirus) (3), Alfalfa mosaic virus (AMV, family Bromoviridae, genus

Alfamovirus) (4), Tobacco streak virus (TSV, family Bromoviridae, genus Ilarvirus) (5), some pararetroviruses Cauliflower mosaic virus (CaMV, family Caulimoviridae, genus

Caulimovirus) (6) and some single-stranded DNA viruses (family Geminiviridae) (7).

RNA silencing is defined as a molecular process to regulate the expression of genes and is based on sequence homology between small RNAs and their target (8-15). It is involved in different types of biological processes such as plant development and in maintaining genome integrity (Fig. 1.1B) (16, 17). RNA silencing is also well established as an antiviral defence response in plants (8, 10, 18-25). To counteract this defence response, many viruses have developed counter defence strategies by encoding proteins that can suppress RNA silencing

(26-32). Symptom recovery has been attributed to the induction of RNA silencing (2) but the

Figure 1.1: Symptom recovery and functions of RNA silencing. A) Diagrammatic sketch showing symptom recovery of ToRSV-infected plants. B) Flow chart showing some of the different functions of the RNA silencing pathway.

2 specific molecular mechanisms leading to symptom recovery still remain to be elucidated.

Broadly, this introductory chapter aims at providing a better understanding of the role of

RNA silencing in symptom development and recovery and is divided into six sections. The first section describes the multiplication cycle of positive-sense single-strand RNA viruses.

The second section gives an overview of the RNA silencing pathway with special emphasis on plants. This is followed by a discussion of the role of RNA silencing in antiviral defence and its counter defence by the virus. The fourth section explores the mechanisms suggested to be involved in symptom development and symptom recovery in virus infected plants with special respect to RNA silencing. In the fifth section, the molecular biology of Tomato ringspot virus (ToRSV, genus Nepovirus and the subject of this thesis) and its interaction with various host plants is discussed. Finally, this is followed by the objective of the thesis.

1.2 Multiplication cycle of positive-sense single-strand RNA virus

Viruses are intracellular, ultramicroscopic agents that can only multiply within a living cell

(33). The virus has two basic components: nucleic acid and protein. The nucleic acid, DNA or RNA acts as the genome and is packaged within a protein cover called the capsid. Most plant-infecting viruses identified to date are positive-sense single-strand RNA viruses including ToRSV. For successful infection, viruses must multiply their genome and protect it from the host defence response (32, 34).

To multiply, a virus can utilize the host cellular machinery including the translation apparatus, the secretory pathway, various cellular organelles and their membranes and host

3 proteins (35-37). Briefly, the multiplication cycle of positive-sense single-stranded RNA viruses can be divided into the following seven steps (Fig 1.2) (33)-

1) entry into a new host - Viruses enter into plant cells with the help of vectors such as

insects, nematodes and fungi. Viruses can also be transmitted through seeds, pollen

grains or by mechanical injury.

2) disassembly of the virus particle - After entering the cell, the positive-sense single

-strand RNA genome is released from the capsid.

3) translation of the viral genome- The positive-sense single-strand RNA genome acts as

a template for translation. By utilizing the host translation machinery, new viral

proteins are synthesized. Host eukaryotic mRNAs usually have a cap structure at the

5’end and a poly (A) tail at the 3’ end. Translation of an mRNA is believed to occur

in a closed circular loop structure. The cap structure at the 5’ end of the mRNA binds

to eukaryotic initiation factor eIF4E, which is bound to eIF4G. EIF4G binds to the

poly (A) binding protein, which is bound to the poly (A) tail at the 3’end of the

mRNA leading to the circularisation (36). To utilize the host translation machinery

viral RNAs must compete with the host cellular mRNAs. The majority of positive-

sense single-strand RNA viruses lack the 5’ cap, the poly (A) tail or both. Therefore,

these viruses utilize different strategies to hijack the host translation machinery such

as internal ribosome entry sites or cis-acting elements in the 5’ or 3’ UTRs that

interact with each other to allow the circularisation of the genome. In addition,

viruses use various strategies to encode several proteins from a single RNA

(polyprotein, leaky scanning, readthrough of stop codons or frameshifting) (33, 36,

38).

4) replication of the viral genome - Among the newly synthesized proteins, the viral

RNA dependent RNA polymerase (RdRP) replicates the viral genome via the

formation of double strand RNA (dsRNA) replication intermediates. The replication

takes place in association with intracellular membranes derived from the endoplasmic

reticulum, chloroplast, peroxisome or vacuole. During virus infection, the

membranes may undergo modifications to form specialized compartments, called

spherules, which act as the sites for replication (35, 39, 40).

5) assembly of the virus particles - Viral coat protein synthesized during the

multiplication cycle package the positive-sense single-strand RNA genome to

produce new virus particles.

6) movement/spread of the virus to the other parts of the plant - The cell-to-cell spread

of the virus takes place through the plasmodesmata with the help of the viral

movement protein (MP). The virus can spread as complete virus particles or as

ribonucleoprotein complexes formed by the association of the viral genome with the

MP and/or coat protein (CP). Long distance spread of the virus to the other parts of

the plant takes place mostly through the phloem, following the source to sink flow

(41-43).

7) transmission of the virus to another host - Eventually the virus spreads from one

host to another with the help of vectors as discussed in step one (33).

Figure 1.2: Diagrammatic sketch of a positive-sense single-strand RNA virus multiplication cycle. 1) Initial entry into a plant cell (vector-assisted transmission or infected plant materials), 2) Disassembly of the virus particle, 3) Translation of viral RNA, 4)

Spherule formation and synthesis of viral progeny RNA, 5) Formation of complete virus particles, 6) Cell-to-cell and long distance movement in the form of virus particles or as ribonucleoproteins (viral RNA in association with MP and/or CP) in the plant, 7)

Transmission of the virus to a new host.

During the multiplication cycle, various viral components (e.g. proteins, dsRNA replication intermediates) can induce the plant defence response that can restrict the virus (21, 32, 44-

46). As discussed in section 1.1, RNA silencing has emerged as an effective defence response against viruses (18, 21, 22, 47).

1.3 RNA silencing in plants

In the late 20th century, two research groups observed suppression in the expression of their gene of interest in transgenic plants instead of the expected overexpression (48, 49).

Molecular analysis of the transgenic plants showed a decrease in the accumulation of the mRNA levels of both the transgene and the homologous endogenous gene. This mechanism was termed co-suppression in plants (48). Co-suppression was also observed against viruses

(50-52). Transgenic plants expressing viral genes were found to inhibit the accumulation of the cognate virus upon inoculation. Later, similar observations were also reported in other organisms such as fungi (quelling), insects and worms [RNA interference (RNAi)] (Fig.

1.3A) (15, 53-60). Several studies over the last two decades gave insight into this mechanism, which is now broadly called RNA silencing (15, 20, 59-61). Most of the description of RNA silencing mechanisms mentioned below is based on studies from

Arabidopsis thaliana (A. thaliana), unless otherwise mentioned.

1.3.1 Description of the pathway

Expression of genes involves transcription of DNA to produce a messenger RNA, which is then translated to synthesize proteins. RNA silencing regulates gene expression by either acting at the DNA level (transcriptional gene silencing or TGS) or acting downstream of

7 transcription at the mRNA level (Fig. 1.3B) (post transcriptional gene silencing or PTGS)

(61, 62). Despite its involvement at different levels of gene expression, the basic principle of

RNA silencing seems to be well conserved among different organisms (60).

Briefly, RNA silencing mechanisms can be divided into two phases 1) activation/initiation phase and 2) amplification/maintenance phase (Fig. 1.4) (8). The activation phase begins with recognition and cleavage of structured RNAs such as dsRNA (Fig. 1.4, step 1) that are perceived as aberrant or foreign nucleic acids by a class of endoribonuclease III enzymes known as DICER [commonly called DICER like (DCL) enzymes in plants] (59, 63-66) (Fig.

1.4, step 2). These enzymes cleave the dsRNA into 21-24 nt long small RNAs with two nucleotide 3’ overhangs (Fig. 1.4, step 3). The small RNAs undergo 2’-O-methylation at the final ribose sugar. This step is directed by an enzyme called HUA ENHANCER 1 (HEN1)

(especially in plants) that increases the stability of the small RNAs (67, 68). The small RNAs are then loaded onto another class of endoribonuclease enzymes, ARGONAUTE (AGO), and in association with other proteins form a complex called the pre-RNA induced silencing complex (pre-RISC) (69-72). One strand of the small RNA (the passenger strand) is then released. The loaded single strand small RNA is called the guide strand. This state of the guide strand loaded ARGONAUTE (AGO) is called a mature RISC (Fig. 1.4, step 4), which is the main effector complex of the RNA silencing mechanism.

Figure 1.3: Different terms used for RNA silencing (A) and different levels of gene expression where RNA silencing can act (B). For details, see section 1.3.1.

RISC binds to its target (DNA or RNA) by base pairing through the loaded small RNA. If the target is DNA then the expression of that gene is silenced by methylation of the target

(Fig. 1.4, step 5A) (73). If the target is an RNA, then the RISC either cleaves it (RNA slicing) or blocks its translation (translation repression) (Fig. 1.4, step 5B and C, respectively) (12). The activation phase is followed by the amplification phase that involves spread of the RNA silencing signal to the neighbouring cells, and eventually to the whole plant (74-80). This is an important characteristic of the RNA silencing mechanism (80).

Briefly, in the amplification phase cellular RNA dependent RNA polymerase (RdRP) can transform aberrant RNAs such as cleaved products of RNA left after RISC activity, into dsRNA (Fig. 1.4, step 6) (81). These dsRNAs act as substrates for DCLs to produce more small RNAs, called secondary small RNAs. The small RNAs have been shown to be the mobile signals in plants (75-79).

1.3.2 Characteristics of the key components in the pathway

Although the basic mechanism of silencing is conserved, the involvement of different isoforms of enzymes in the silencing pathway gives rise to different classes of small RNAs.

Each class of small RNA is further specialized by their specific involvement in different biological processes (13). Thus, RNA silencing is a highly complex and evolved molecular process, which is probably required for the fine tuning of the expression of the genes. An overview of the key enzymes involved in the RNA silencing pathway in plants is discussed below.

Figure 1.4: Diagrammatic sketch of simplified RNA silencing mechanism. The two main phases of the RNA silencing mechanism are the activation/initiation and amplification/maintenance phase. Steps of the silencing mechanism are numbered from 1-6.

For details, see section 1.3.1.

1.3.2.1 Dicer/Dicer like enzymes (DCL)

DICERs are members of a family of endoribonuclease III enzymes that were first identified in the Drosophila melanogaster RNAi pathway and were named based on their dicing activity (66). In plants, the analogous enzyme DCL cleaves dsRNA to produce 21-24 nt long small RNAs (65). DICERs or DCLs are large proteins with several domains- DEAD box, helicase-C, DUF283 (domain of unknown function), PAZ (PIWI-ARGONAUTE-ZWILLE),

RNase III and dsRBD (dsRNA binding domain) (65). The number of DCLs varies among different organisms (Table 1.1) (65, 66, 82-85). In the model plant A. thaliana, four DCLs have been identified and named DCL1, DCL2, DCL3 and DCL4. It is suggested that DCLs have evolved for the biogenesis of various small RNAs involved in different biological processes such as plant development and defence (77, 86).

1.3.2.2 Argonaute

ARGONAUTEs (AGO) are the core components of the RNA induced silencing complex (71,

87). They were first discovered in A. thaliana in a forward genetic screen to identify genes involved in plant development. The name was derived after a squid “argonaut” because of the deformed shape of the leaves of the mutant (88). The ago1 mutants were compromised in the RNA silencing pathway (89, 90). Similar to DCLs, AGOs are also large multi-domain proteins and the important domains are N terminal, PAZ, MID (Middle) and PIWI (P- element induced whimpy testis) domains (69). The PIWI domain is responsible for the catalytic activity (cleavage) of the argonautes and resembles the RNaseH class of ribonucleases. A catalytic triad has been suggested to be important for the enzyme activity of the PIWI domain. In spite of having the PIWI domain, not all AGOs have RNA slicing

12 activity (87, 91). AGOs can also function by causing translation repression of their targets

(72, 92). However, this activity may depend on several factors (discussed in detail in section

1.4.2). Similar to DCLs, the number of AGOs can also vary among different organisms

(Table 1.1) (71, 72, 92, 93).

1.3.2.3 RNA dependent RNA Polymerase (RdRP)

RNA dependent RNA polymerases synthesize single strand RNA by using RNA as a template. This leads to the formation of dsRNA (81). Plant RdRPs that are involved in the

RNA silencing pathway are not well characterized (94). The first plant RdRP was discovered in tomato (95, 96). Similar homologs have been identified from different organisms such as fungi, worms and insects (96, 97). RdRP from Neurospora crassa has been crystallized and the analysis of the structure indicates that it is a dimeric molecule with several subdomains and has similarity with DNA dependent RNA polymerases (98). RdRPs have been shown to be important in the RNA silencing pathway of plants, worms and fungi (Table 1.1) (83-85,

99, 100).

Apart from the above mentioned proteins, other proteins such as dsRNA binding proteins

(DRB, 5 in A. thaliana) and heat shock proteins are also involved in the RNA silencing pathway (101-103).

Table 1.1. Table showing different number of homologs of RNA silencing pathway enzymes identified from different organisms. (CR = Chlamydomonas reinhardtii, SP=

Schizosaccharomyces pombe, NC= Neurospora crassa, AT= A. thaliana, OS= Oryzae sativa,

SL= Solanum lycopersicum, NB=Nicotiana benthamiana, HS= Homo sapiens, DM=

Drosophila melanogaster, CE= Caenorhabditis elegans).

1.3.2.4 Types of small RNA

Broadly, on the basis of the source of the dsRNA, small RNA pathways in plants can be divided into two main categories : microRNA (miRNA) and small interfering RNA (siRNA)

(Fig. 1.5) (13).

1) miRNA - The biogenesis of these small RNAs begins with the transcription of genes

called MIR genes. The transcribed RNAs form stem loop structures (primary

miRNA), which are recognized and cleaved by DCL1 in plants to produce the 60-70

nt long pre-miRNAs. Thus, in miRNA biogenesis, hairpin RNA structures act as

precursors. DCL1 in association with other proteins cleaves the pre-miRNAs

(precursor miRNAs) to produce miRNA-miRNA* duplexes in the nucleus. These

duplexes are then exported to the cytoplasm and are methylated. The mature

miRNAs are loaded onto AGO1 or AGO7 to form the RISC complex which can bind

the target RNA (13, 104).

2) siRNA– This pathway initiates by the cleavage of double-strand RNA templates into

small RNAs by DCLs (12). Based on the source of the long dsRNA, siRNAs can be

divided into exogenous siRNAs and endogenous siRNAs (13). Exogenous siRNAs

are derived from foreign nucleic acids such as viral RNAs. This is discussed in detail

in section 1.4. Endogenous siRNAs are derived from an endogenous source of

dsRNA that can be mainly of three different types. First, bidirectional or convergent

transcription of the DNA may result in RNA transcripts that will be complementary to

each other, providing the source for dsRNA. Small RNAs formed by the processing

of these transcripts and are called natural antisense RNA (nat - siRNA) (13). Second,

Figure 1.5: Flow chart showing the different types of small RNA involved in RNA silencing pathways in plants. For details see section 1.3.2.4.

endogenous sources of dsRNA can be transposons or repetitive sequences such as 5S

ribosomal RNA genes. These sequences are transcribed by a certain class of DNA

dependent RNA polymerase (Pol IV), and are transformed into dsRNAs by the

activity of plant RDRPs. These dsRNAs are cleaved by DCL3 to produce small

RNAs called cis-acting siRNAs (ca - siRNAs). The third category of endogenous

siRNAs are called transacting siRNAs (ta - siRNAs). The cleaved products of some

miRNA targets are transformed into dsRNA by the activity of RdRP6. These

dsRNAs are further processed by DCL4 to produce 21 nt long small RNAs,

originating from the point of cleavage by the miRNA but eventually getting dispersed

throughout the transcript. In addition to the above mentioned siRNAs, the long

natural antisense transcripts can also give rise to 30-40 nt long siRNAs (lsiRNAs)

(13).

1.4 RNA Silencing as an antiviral defence response in plants and its counter defence

RNA silencing is well established as an antiviral defence response (24, 25, 30, 47, 105).

Most of the information about the role of RNA silencing as an antiviral defence response came from the study of plants. This work has also helped to unravel many steps of the RNA silencing pathway (106). Several lines of evidence indicate the antiviral role of RNA silencing (19, 26, 30, 47, 90, 107-110). First, plants compromised in the RNA silencing pathway are hypersusceptible to virus infection (90, 107, 108). Second, viruses encode proteins that suppress the RNA silencing mechanism (26). Viruses deficient of functional suppressors are unable to cause successful infection in wild type plants (30). However, the same virus mutants can infect plants compromised in the RNA silencing pathway (19). This

17 is probably the most compelling evidence in support of the antiviral role of RNA silencing.

In addition, viral derived small interfering RNAs (vsiRNAs) formed during viral infection guide AGOs to the viral RNA target that cleaves viral RNA sequences (109, 110). A similar antiviral role of RNA silencing has also been reported in worms, insects, and fungi (47, 111-

113). The role of RNA silencing as an antiviral defence response in mammals is controversial. However, two recent studies have demonstrated an antiviral role of RNA silencing in mice and undifferentiated stem cells (114, 115).

1.4.1 Role of RNA silencing components in antiviral defence response

In section 1.3, I have discussed the general mechanism and key components of RNA silencing in plants. Based on our current knowledge, the above mentioned enzymes and small RNAs may have different levels of involvement in the antiviral silencing pathway. In this section, I will discuss their roles in the antiviral defence response more specifically.

The initiation phase begins with the recognition and cleavage of dsRNA and/or secondary structures present on the target RNAs (section 1.3.1, and Fig. 1.4). Similarly, in an antiviral silencing pathway, secondary structures originating from the positive-sense single-strand

RNA viral genome or dsRNA replication intermediates formed during replication act as triggers of RNA silencing against the virus (28, 116-118). Deep sequencing of Cymbidium ringspot virus (CRSV, genus Tombusvirus) and Turnip crinkle virus (TCV, genus

Carmovirus) derived siRNAs (vsiRNAs) indicate that secondary structures on the viral genome are the major source of small RNAs (117). In contrast, vsiRNAs from Turnip mosaic virus (TuMV, genus Potyvirus)-infected plants implicated dsRNA replication

18 intermediates as triggers (118). On the other hand, recent studies also suggest that plant

RdRPs may use the viral RNA as a template to form dsRNA that can initiate the silencing machinery (119, 120).

The viral dsRNAs are cleaved by DCLs to produce viral derived siRNAs. In plants, DCL1 is involved in the production of 18-21 nt long miRNAs and DCL3 mainly regulates antiviral silencing against DNA viruses by the production of 24 nt long small RNAs (107). DCL4 and

DCL2 are the main players against RNA viruses producing 21nt and 22 nt long vsiRNAs, respectively (108). These vsiRNAs are called primary vsiRNAs (121). DCL4 and DCL2 show redundancy in function and the function of DCL2 is only evident after inactivation of

DCL4. Thus, DCL4 seems to be the main antiviral dicer. In addition, Wang et al. 2011 reported that the 22 nt vsiRNAs are less potent in antiviral defence than 21nt vsiRNAs (122).

This supports an earlier study, where an increase in inoculum concentration was able to break the antiviral defence response in dcl4 mutants but not in dcl2 mutants (108). The activity of DCL is further influenced by another class of proteins called double stranded

RNA binding proteins (DRB). There are five DRB proteins in A. thaliana and DRB4 is shown to be important against TCV and Turnip yellow mosaic virus (TYMV, genus

Tymovirus) (123, 124). It would seem that the activity of DCL should be potent enough to restrict the virus infection. However, involvement of additional layers of silencing in antiviral defence response has been suggested based on studies of virus infection on a number of combinations of dcl mutants (23, 108). In this study it was found that different combination of dcl mutants (dcl2dcl3, dcl3dcl4, dcl2dcl4) produced similar levels of vsiRNAs but only the dcl2dcl4 plants were compromised to virus infection.

AGOs also play an important role in antiviral silencing. Several ago mutants are found to be hypersusceptible to virus infection (90, 123, 125). Among the 10 AGOs in A. thaliana

(Table 1.1), AGO1, AGO2, AGO4 and AGO7 have been suggested to be involved in antiviral defence (123, 125-132). AGO1 and AGO2 have been demonstrated to possess antiviral role both in A. thaliana and N. benthamiana plants (126, 131-133). Antiviral activity of AGO1 has been demonstrated against a number of viruses including TCV,

Cucumber mosaic virus (CMV, genus Cucumovirus) and Potato virus X (PVX, genus

Potevvirus) (90, 122, 129, 134-136). AGO2 has been shown to be important against TCV,

Tomato bushy stunt virus (TBSV, genus Tombusvirus) and PVX infection (125, 126, 131).

Both AGO1 and AGO2 demonstrate RNA slicing activity (130, 137), which is the most common identified response of RISC against plant viruses to date (109). AGO1 and AGO2 have also been shown to participate to antiviral silencing in a cooperative manner (122).

Indeed ago1ago2 double mutants accumulate higher levels of viral RNAs than ago1 and ago2 single mutants when challenged with suppressor deficient CMV mutants. The antiviral defence response of AGO2 was found to be functioning in a temperature-dependent manner against TCV (138). Interestingly, AGO4 has been shown to be involved in an antiviral response mediated by the resistance (R) gene pathway against PVX (127). The role of

AGO7 in antiviral defence was observed against TCV (123). In this study, the authors also suggested that AGO1 and AGO7 show preference in binding to their targets based on the degree of secondary structure of the target. AGO1 was shown to tolerate mismatches and could target structured regions. AGO1 and AGO4 also play important role in systemic silencing of a reporter gene i.e. movement of the silencing signal from its site of origin to the whole plant (139), which may have implication in antiviral silencing (140). It is possible that

AGO1 and AGO4 compromised plants show delay in the movement of the vsiRNA to the non-infected parts thereby preventing the priming against the invading virus.

The amplification phase of the RNA silencing pathway is also involved in the antiviral defence response (122). The DCLs cleave the dsRNAs formed by RdRP to produce vsiRNAs, called secondary vsiRNAs (121). RdRP1 and RdRP6 have been implicated to play important roles in antiviral silencing (141-145). It is suggested that RdRP1 and RdRP6 might use different pathways for the antiviral activity (119). In line with this hypothesis,

Wang et al. (2010) found that RdRP1 targets predominantly CMV RNA1 and RNA2, while

RdRP6 targets CMV RNA3 and RNA4 (144). As RdRP6 requires a high concentration of

RNA initiator to become activated, the authors of this study suggested that the difference in targeting of CMV RNAs by RdRP1 and RdRP6 may be due to the high concentration of viral

RNA3 and RNA4 (143, 145). Thus, the activity of RdRP6 is evident when the viral RNA concentrations are very high, while RdRP1 can function on viral RNAs present at low concentration. RdRP6 was also found to be involved in antiviral defence response against

TCV in a temperature-dependent manner (146). RdRPs work in association with other cofactors such as SGS3 (Suppressor of Gene Silencing 3), which has been shown to be important in natural virus resistance although its function is not clear (145, 147). Thus, different components of the RNA silencing pathway are involved in antiviral defence response.

RNA silencing can also exhibit antiviral activity by regulating the expression of genes involved in other host defence responses. Indeed, many small RNAs (miRNAs, nat-siRNAs)

21 have been found to regulate the expression of several R genes (148-153) involved in the resistance gene mediated pathway.

1.4.2 Mode of RISC activity – Cleavage or translation repression of the viral RNA

Silencing of an RNA target can be achieved by its cleavage or translation repression and most likely depends on the components of the RISC complex (Fig. 1.4B and C) (109, 154-

157). siRNA mediated silencing is generally believed to mostly involve cleavage of the target. In contrast, the mode of action of miRNA mediated silencing seems to be dependent on the organism. The miRNA pathway has been shown to direct translation repression in animals and cleavage in plants (158). In addition, animal miRNAs generally target the

3’untranslated regions (UTR) of mRNAs while many plant miRNAs target the coding regions on the mRNAs of regulatory genes or transcriptional factors. Furthermore, animal miRNAs require a near perfect complementarity to act or depend on a shorter seed sequence, while in plants they often have perfect complementarity with their targets. Based on this evidence, it was postulated and experimentally shown that mismatches in nucleotide sequence among miRNA and their targets cause translation repression (158, 159). Studies on the mode of action of miRNA mediated silencing pathway in A. thaliana have shown that translation repression can also function as a regulatory mechanism in plants (155, 160).

These authors also demonstrated that targets of siRNA mediated silencing pathways can also be translationally repressed. A. thaliana mutants having lesions in the microtubule severing enzyme katanin were found to be impaired in translation repression but not cleavage, indicating that repression or cleavage of an RNA target by RISC depends on other factors

(160). In another study using plant cell cultures it was demonstrated that plant AGO1 mutant, lacking the cleavage activity, is able to inhibit the translation of its target (154).

A large body of evidence exists indicating that AGO is a core component of the RISC complex and that it has a key role in determining the processing mechanism (slicing or translation repression) of its target (130, 137, 161, 162). There are several AGOs that exist in different organisms and they may differ in their mode of action. For example, in plants

AGO1, AGO2, AGO4, AGO7 and AGO10 all have slicer activity (130, 137, 161, 162) but miRNA silencing mediated by AGO10 does not require the slicer activity (163). Thus, the type of AGO loaded in the RISC has been proposed to be a determining factor for its mode of action (130). In plants, AGO1 is involved in both cleavage and translation repression of mRNA targets (154, 160). Therefore, the AGO function might be regulated to have different outcomes, either translation repression or cleavage. Several studies have implicated that post translational modification of AGO takes place (164) and they are involved in determining its mode of action (164, 165). First, phosphorylation of human AGO2 has been shown to enhance translation repression of its target instead of cleavage (164). In animal cells, AGOs have been shown to bind with a family of proteins called GW182 that are required for translation repression. These proteins contain a glycine-tryptophan motif that is essential for binding with AGO protein (165, 166). Phosphorylation of human AGO2 increases its association with the GW182 proteins (164). Recently, in plants, a GW182 ortholog has been identified called SUO, which is important for miRNA mediated translation repression (167) although its mode of action is not clear. Second, Hauptmann et al. (2013) showed that inactive human AGO1 and AGO3 can be made catalytically active by introducing mutations,

23 indicating that AGO function can be regulated by the modification of the proteins (168). The study showed that the N terminus is important in regulating the activity of the proteins. In line with this thought, Drosophila melanogaster AGO cleavage activity was shown to be regulated by its N terminal domain (169). Structural analysis of the yeast AGO has suggested the presence of a catalytic tetrad in AGOs instead of a catalytic triad as proposed earlier (170). The authors propose that the fourth amino acid of the tetrad is required only during cleavage and hence a conformational change of the AGO differentiates between cleavage and translation repression.

Apart from structural modifications of AGO, temporal and spatial availability of AGO, small

RNAs and other genetic factors may also determine the activity of the RISC. It has been suggested that AGO1 is present in two different pools, one loaded with siRNAs and the other with miRNAs (171). In line with this thought, recently AMP1 (altered meristem program 1) protein, which localizes to the rough endoplasmic reticulum (ER) in A. thaliana, has been found to be required for miRNA-mediated translation repression (172, 173). The authors demonstrated that the translation repression activity of miRNAs is localized to the ER. More evidence for spatial separation of translation repression and cleavage comes from the observation that translationally repressed mRNAs accumulate in the P bodies (174). P bodies are ribonucleoprotein cytoplasmic complexes. The exact role of P-bodies in translation repression is not yet clear. The translation repressed mRNA in the P bodies may undergo degradation or may be recycled and become translationally active again (175). In conclusion, it seems that determining the mode of action of RISC activity is dependent on a

24 number of factors and that RNA slicing and translation repression activities are not necessarily mutually exclusive.

To date, the only clearly identified mode of action of antiviral silencing in plants is the cleavage of the viral RNA by the RISC (109, 130, 176, 177). Targeting and cleavage of viral

RNAs have been demonstrated using sensor constructs containing viral RNA sequences in plants (109). It has been suggested that the identification of translation repression as a mode of action against viruses may be challenging because viral RNAs require the viral RdRP to multiply (156). Translation repression will inhibit the synthesis of viral RdRPs, eventually leading to a decrease in the level of viral RNAs. Thus, low levels of viral RNA may be due to RNA slicing activity or due to the low level of viral RNA replication (156). However, several lines of evidence, mostly from animal viruses, indicate that translation repression is involved in antiviral silencing. First, translation repression by miRNA has been reported in animal viruses such as Human immunodeficiency virus (HIV, genus Lentivirus) (178, 179).

During HIV infections, miRNAs encoded from the host genome repress the translation of the viral RNA (178, 179). In addition, HIV encodes a suppressor of RNA silencing, the TAT

(trans-activator of transcription) protein, which was found to suppress miRNA mediated translation repression of the viral genome (180), indicating that translation repression can act as an antiviral mechanism. Similar effects were observed for p19, a suppressor encoded by plant virus TBSV, in the miRNA mediated silencing pathway in animal cells (180). Another line of evidence for translation repression, as an antiviral response, comes from the study of

Flock house virus (FHV, genus Alphanodavirus), an insect virus. A mutant of FHV lacking its silencing suppressor (B2) was shown to be translationally repressed and is relieved from

25 this repression in the presence of the suppressor (181). In addition, the authors found localization of the repressed RNA to cytoplasmic granules formed during viral infection.

However, the nature of those granules remains to be elucidated. In plants, AGO4 dependent translation repression has been demonstrated against PVX in relation to the R gene mediated resistance pathway (127). In another study, DRB4 was implied to control TYMV CP accumulation at the translation level, as the viral coat protein accumulated to high levels in drb4 mutant plants without affecting the level of the viral RNA (124). However, the authors did not observe translation repression in in vitro studies. Thus, knowledge about translation repression of viral RNA in antiviral silencing in plants is lacking.

1.4.3 Counteracting RNA silencing – Viral suppressors

Viruses suppress the RNA silencing mechanism for their successful infection (26). This is mostly achieved by encoding proteins that have evolved to suppress the RNA silencing pathway. Both plant and animal viruses encode viral silencing suppressors (VSR). Here, I will focus mostly on suppressors encoded by plant viruses. These are proteins that usually have other important functions in the virus multiplication cycle such as movement, replication and assembly. The suppression activity has evolved independently in different viruses as no homology is observed among the suppressors at the nucleotide or amino acid level (28). Despite their variable nature, the biochemical activities of the suppressors have functional similarities. The suppressors identified so far target almost every step of the silencing pathway. Although suppressors might differ in their strategy of suppression, they can target the same step of the silencing pathway. The following are some of the important strategies used by viruses to suppress or evade the silencing pathway –

1) Structured substrates that are inaccessible for processing by AGO - In some

instances, the viral RNA can be strongly structured making it a weaker

substrate for RISC, as is observed with viroids (182).

2) Impairment of DCL and DRB activity- p6 protein of CaMV impairs DCL4

activity by binding with DRB4 (183).

3) Small RNA inactivation by sequestration - p19 protein of TBSV sequesters

small RNAs and makes them unavailable to the silencing machinery (184,

185). Many other suppressors also bind small RNAs (185), including the

TCV p38 protein. p19 binds to both siRNAs and miRNAs, while p38 only

inactivates siRNAs and not miRNAs (171, 186). In addition, p19 binding to

small RNA is size dependent while p38 binding is size independent (187,

188). It is suggested that the sequestration of siRNAs also makes them

inaccessible for methylation by HEN1 (189).

4) Small RNA inactivation by their degradation - Sweet potato chlorotic stunt

virus (SPCSV, genus Crinivirus) encodes a RNase III enzyme, that cleaves

the vsiRNAs into 14 bp products. These cleaved products are inactive in

function as they cannot be loaded onto AGO (190).

5) Binding to single stranded small RNA - AC4 of African cassava mosaic

virus (ACMV genus, Begomovirus) binds to loaded single stranded small

RNAs and inhibits their activity (191).

6) Binding AGO, the core component of the RISC and manipulating its

function- Three different mechanisms have so far been identified for this

strategy–

a) Targeting AGO for degradation – Suppressors can

subject AGO to different host protein degradation pathways.

For example, p25, a suppressor encoded by PVX, binds to

AGO1 and targets it for degradation by the ubiquitin

proteasome pathway (136). P25 is also able to bind with other

AGOs. On the other hand, p0, the suppressor of poleroviruses

targets the AGO1 for degradation through the autophagy

pathway (192).

b) Inactivating AGO1 by binding to it – CMV 2b suppressor

binds to AGO1 and inhibits its slicer activity (134).

c) Mimicking AGO binding factors – AGO proteins bind with

other proteins to regulate their silencing activity. These

proteins usually bind through a GW rich motif, and a mutation

in this motif abolishes the interaction. Different viral

suppressors such as P1 of Sweet potato mild mottle virus

(SPMMV, genus Ipomovirus) contain GW motifs and bind to

AGO, thus impairing its activity (193). TCV p38 also binds

AGO1 through GW motifs (135). Thus most likely these

suppressors mimic and outcompete host factors that bind to

AGOs and impair the activity of RISC complex

7) Down regulating the expression of AGOs – Expression of some of the Ago

genes has been shown to be post transcriptionally regulated by miRNAs such

as Ago1 by miR168 and Ago2 by miR403. Viral suppressors can down

regulate the expression of the Ago genes by inducing these miRNAs. For

example, the CRSV encoded suppressor p19, induces miR168 accumulation

by upregulating the transcription of the MIR168 gene, which in turn down

regulates AGO1 expression (133). It has also been shown that sequestration

of siRNAs by p19 and the induction of miR168 are independent activities

and are controlled by different domains of p19 (194). The induction of

miR168 has been shown to be a general strategy for many viruses during

virus infection (195).

1.5 Symptom development, maintenance and recovery during plant-virus interaction

Symptoms are an external manifestation of abnormalities taking place within plants caused by disruption of the host physiology due to abiotic or biotic stress (196). At the macroscopic/organismal level, which can be seen by the naked eye, symptoms include stunting, mosaic patterns on leaves, yellowing of leaves, ringspots on leaves and fruits, necrosis on leaves and stems and developmental abnormalities (33). These symptoms are the cumulative effect of changes taking place at the histological, cellular and molecular level. At the histological level, collapse of a group of tissues may be observed as a macroscopic symptom (33). At the cellular level, some of the changes in the symptomatic regions of the plant include organelle modifications such as invagination of the plant membranes, vesicle formation near and in the chloroplast or abnormal thickening of cell wall by callose deposition (33). One of the most drastic effects caused by some viral infections is the death of the cells, which is associated with increased production of reactive oxygen species and ion leakage (33). At the molecular level, gene expression patterns in the symptomatic tissues

29 differ from those in healthy tissues, indicating reprogramming of gene expression takes place during virus infection (Fig. 1.6). For example, expression of certain genes such as photosynthetic genes can be down regulated while genes required to overcome the viral infection (e.g. defence genes) are upregulated. In addition, pathogens may reprogram host gene expression for their benefit (194, 195, 197-199).

The symptoms can be induced as a sign of a resistance response, or a susceptible interaction and/or a mixture of both (25, 32). For example, during the R protein gene mediated defence response, proteins encoded by plant R genes recognize viral products or cellular changes caused by viral products. These recognitions may lead to the death of the infected cells and the cells in their close vicinity of the infection site in order to restrict virus spread and accumulation. This defence response is called the hypersensitive response (HR) (45). The collapse of cells may be observed as necrotic spots on the inoculated leaves. On the other hand, in susceptible plants, viruses can exhaust the host cellular factors that are required for virus multiplication and accumulate to high levels thereby disrupting host cellular processes that can lead to symptom development and the death of the plant (200). In another scenario, the plant may encode a protein from a weak resistance gene response that can recognize and induce programmed cell death, as observed in HR, but is unable to restrict the spread of the virus to the next uninfected cell. In the newly infected cell, the virus induces a similar HR but again escapes to the next uninfected cells, leading to a repetitive chain of events of induction of defence response followed by virus escape. This is commonly known as systemic necrosis (201-203). It has been reported that a similar set of genes are induced during systemic necrosis and during the HR response including pathogenesis related genes

PR1a (Pathogenesis related protein 1a) (204). Although we have expanded our knowledge about symptom development, still the molecular mechanisms leading to the induction of symptoms are not fully understood. Two models have been proposed for symptom development (196). First, the competition model, according to which the virus multiplies to high level that outcompetes the host cellular processes for cellular factors leading to the disruption in host physiology. The second model (interaction disease model) states that symptoms are induced due to an interaction between host and viral components that may lead to resistance or susceptibility depending on the plant-virus system.

1.5.1 Symptom development, maintenance and RNA silencing

RNA silencing pathways are involved in the proper regulation of plant development and growth (16, 88, 205). During virus infection, viral silencing suppressors inhibit host antiviral silencing pathways by different strategies, as discussed in section 1.4.3, but in doing so, viral suppressors can also impair/modify the endogenous silencing pathway involved in plant development and growth leading to symptom development (25). For example, HC-pro binds to several miRNAs that regulate the expression of genes important for plant development

(206, 207). This binding leads to higher accumulation of the miRNA targets and also to developmental abnormalities. A conserved region in HC-pro is important for binding with miRNAs and mutation of this domain reduces binding of miRNAs and alleviates symptom development. Similarly, TBSV p19, can sequester vsiRNAs to prevent targeting of the viral

RNAs and sequester plant endogenous siRNAs and miRNAs, thus blocking various miRNA dependent biological processes (208). Indeed, transgenic plants expressing p19 and HC-pro display symptoms similar to those observed during virus infection (209). However, the level

31 of suppression activity, e.g. binding to small RNAs, may vary depending on the suppressor or on the virus isolate from which it is encoded and which in turn may influence the severity of the symptoms. CMV 2b encoded from two different isolates (mild and severe) binds to dsRNA and inhibits the siRNA-mediated silencing pathway (134, 210). Interestingly, only the CMV 2b from the severe isolate affects the miRNA-mediated cleavage leading to development of severe symptoms (210). CMV 2b from severe strains was also shown to bind AGO1 and inhibit its silencing activity, leading to developmental abnormalities similar to ago1 mutant plants (134). Plant development is also controlled by responses to hormones such as auxin and gibberellin whose activities are regulated by miRNAs (211). The AUXIN

RESPONSE FACTOR is a family of transcription factors that is activated in response to auxin. AUXIN RESPONSE FACTOR 8 is regulated by miRNA167. Jay et al. (2011) reported a misregulation of miR167 target in transgenic plants expressing viral suppressors of silencing (HC-Pro, p19 and p15) leading to the development of symptoms (212).

Apart from induction of symptoms by the effect of suppressors, virus infection can lead to symptom development by targeting host genes through vsiRNAs (213, 214). The triggers of

RNA silencing present on the viral genome are cleaved by DCLs to produce vsiRNAs. If certain regions of the viral RNA have sequence identity with a host mRNA, vsiRNAs originating from this region of the viral RNA can silence the expression of the host gene. A well-established strategy in plant virology is to silence the expression of host genes by manipulating viruses and incorporating host homologous mRNA sequences in them. This is

Figure 1.6: Flow chart representing some of the changes induced during plant virus interaction leading to symptom development. Both host and the virus may re-program gene expression patterns leading to symptom development.

33 commonly called virus induced gene silencing or VIGS (215, 216). However, until 2011 there were no reports of host mRNAs targeted during natural virus infection. In 2011, two groups reported targeting of a chlorophyll biosynthetic gene ChlI from tobacco during CMV infection (213, 214). They identified a 22 nucleotide sequence that had similarity in sequence between CMV satellite RNA Y and the ChIl gene from tobacco (213). It was shown that yellowing of leaves during CMV infection of tobacco was due to targeting of

ChlI by this small RNA. Interestingly, CMV infection of A. thaliana and tomato did not give rise to yellowing and was correlated to the dissimilarity in the 22 nt region among the

CMV satellite RNA Y and the ChlI gene from these hosts. Infection of A. thaliana and tomato by a satellite RNA Y, manipulated to have sequence similarity with ChlI of the respective hosts, induced yellowing symptoms in these plants. It is suggested that there could be many other similar cases of targeting of host mRNAs by viral siRNAs that are yet to be identified (21). In line with this hypothesis, a recent study using a bioinformatics approach identified several regions of viruses that are homologous to host mRNAs suggesting that vsiRNAs derived from these regions could target corresponding host mRNAs

(120, 217, 218).

1.5.2 Symptom recovery

All the examples in section 1.5 indicate the role of virus infection in symptom development.

On the other hand, recovery from symptoms of virus infected plants is also another important aspect of symptom development and maintenance. The exact mechanism of symptom recovery has remained a mystery for more than seven decades after its first report. Research on symptom recovery for the last fifteen years has identified several factors influencing

34 recovery; still the molecular mechanisms involved in this phenomenon are not clear. In the next subsections different factors suggested to influence symptom recovery are discussed.

1.5.2.1 Role of RNA silencing in symptom recovery

The first hints of the mechanism involved in symptom recovery came from the study of

Lindbo et al. (1993) (51). In this study, transgenic plants expressing viral genome sequences recovered from virus infection after an initial symptomatic phase, as has been exhibited by certain wild type viruses. Molecular analysis revealed low levels of viral RNA and transgene mRNA accumulation in the recovered leaves, in spite of normal levels of transcription of the transgene. The recovery from infection indicated resistance of the transgenic plants against the virus infection. This resistance was different from that conferred by the R gene mediated resistance response, as the recovered plants were resistant to secondary infection only against closely related viruses and unlike R gene mediated resistance, did not show systemic acquired resistance (51). This is similar to the previously described mechanism of cross protection in which primary infection by a mild isolate protects plants against a secondary infection by a severe isolate (219). The findings that the viral RNA and homologous transgene mRNA (viral RNA sequences) levels were reduced in the recovered leaves and cross protection to closely related viruses took place, indicated involvement of a homology dependent resistance mechanism. Similar results were also reported in other studies (52,

220). Further insight on symptom recovery came from the study of Ratcliff et al. (1997) (2).

The authors demonstrated that reduction of viral RNA in the recovered leaves of Tomato black ring virus (TBRV, genus Nepovirus)-infected Nicotiana clevelandii plants was due to targeting of the viral RNA by a homology dependent resistance mechanism (2). This was the

35 first evidence of a direct relationship between RNA silencing and symptom recovery. In the same year, another group independently reported similar results during recovery of CaMV- infected plants (6). RNA silencing was also reported to be involved in recovery of TRV- infected plants (221). Thus, clearance of the viral RNA by RNA silencing emerged as a mechanism for symptom recovery. On the other hand, two independent groups reported that recovery is not always associated with clearance of viral RNA (5, 222). The first report described TSV-infected plants, in which recovery was observed but TSV did not accumulate to low levels in the recovered leaves (5). A second study was on a nepovirus, ToRSV. The authors observed no significant reduction in the level of viral RNA in the recovered leaves in spite of active targeting of the viral RNA by the RNA silencing mechanism (222). These results indicated that clearance of the viral RNA by RNA silencing is not the only prerequisite for recovery. Interestingly, PVX-infected plants that do not recover from infection also showed an induction of RNA silencing (221). The authors suggested involvement of other factors in recovery.

1.5.2.2 Role of suppressors in meristem entry of viruses and symptom recovery

Most plant viruses are excluded from the meristem and this is attributed to RNA silencing

(143). Interestingly, all the recovery type viruses can invade the meristem, as these viruses are commonly seed or pollen transmitted. Based on this observation, Ratcliff et al. (1999) proposed that meristem invasion of the virus might play some role in recovery (221) and that this can be achieved either by evading or suppressing the RNA silencing mechanism in the meristem. In line with this hypothesis, TRV has been shown to encode a weak silencing suppressor, the 16K protein (223). This 16K protein is essential for the transient entry of the

36 virus into the meristem. The authors proposed that this weak suppression activity is important for recovery of TRV-infected plants. A silencing suppressor that has a strong activity would lead to high accumulation of the virus that in turn would damage the plants.

On the other hand, if the virus did not have any suppression activity then the entry of the virus into the meristem would be restricted by the silencing mechanism. Thus, a weak suppressor may help to maintain the equilibrium between the virus and the host defence response, in which the virus can enter into the meristem without damaging it. A similar role was suggested for the CMV 2b silencing suppressor (Pepo strain) in meristem invasion

(224). In certain strains of CMV, infection of tobacco plants is characterized by the cycling of symptomatic phases followed by asymptomatic phases, i.e., a transient recovery state

(106, 225). CMV pepo strain was found to invade the shoot apical meristem, and the infected plants recovered from infection (226). However, 2b mutants of this strain, deficient in the suppression activity were unable to invade the meristem. The role of a suppressor in symptom recovery is also evidenced from experiments with CRSV and TBSV (227). CRSV encodes a strong suppressor of silencing (p19) and the virus induces severe necrosis on infected plants. However, plants infected with a suppressor deficient mutant of CRSV recover from infection. It would be interesting to check the pattern of distribution of the virus in the meristem of the CRSV mutant-infected plants. In another study (228), the authors investigated the effect of ectopically expressed viral suppressors on symptom recovery in TRSV-infected N. tabacum and N. benthamiana plants. They used transgenic plants expressing suppressors from different types of viruses including P1 from Rice yellow mottle virus (RYMV, genus Sobemovirus), p19 from TBSV, p25 from PVX, HC-pro from

Potato virus Y (PVY, genus Potyvirus), AC2 from ACMV and 2b from CMV. All the TRSV-

37 infected transgenic plants accumulated higher levels of viral RNA in comparison to the non- transformed plants. However, recovery was only prevented in HC-pro and p25 transgenic plants indicating a role of RNA silencing in recovery. These results indicate how suppressors from different viruses may have different effects on the recovery phenomenon. Exclusion of the virus from the meristem is attributed to RdRP6 activity, which requires a high concentration of target to be activated (143). To enter into the meristem, viruses can also evade the RNA silencing mechanism by maintaining themselves at very low levels as suggested by Siddiqui et al (2008) (228). Most of the viruses inducing recovery accumulate to low or moderate levels in comparison to viruses that do not show recovery phenomenon.

Probably, this low concentration of the virus helps them to avoid recognition by the RdRP6 activity. This allows the virus to enter into the meristem and invade the host reproductive organs for transmission.

1.5.2.3 Effect of temperature on symptom recovery

Recovery of some viruses has been found to be influenced by temperature. For example, plants infected with a suppressor deficient mutant of CRSV recover from infection at 21°C, but not at lower temperatures, such as 15°C (227). Similarly, plants infected with some isolates of geminiviruses display symptom recovery only at high temperatures but not at lower temperatures (7, 229). This correlated with a greater accumulation of vsiRNAs at the higher temperatures. In contrast, isolates that recovered from infection at both high and low temperatures did not show a significant change in the level of accumulation of the vsiRNAs

(229). In a study on the effect of suppressors on TRSV-infection at different temperatures, transgenic plants expressing viral suppressors did not show significant effects on virus

38 infection at high temperature (228). In contrast, at lower temperatures TRSV-infected transgenic plants expressing suppressors accumulated higher levels of viral RNAs and in some cases did not recover from infection. The authors proposed that certain suppressors such as p25 might be temperature sensitive (228) and hence may not show their suppression activity at higher temperatures. Temperature-dependent effects were also observed with

TCV-infected plants, as recovery of the plants took place only at high temperature (138).

This temperature-dependent recovery of TCV-infected plants required AGO2, HEN1 and

DCL2 activities. Some strains of ToRSV-infected plants showed temperature-dependent recovery, as recovery was observed only in plants at higher temperatures (222). Thus, temperature plays an important role in symptom recovery. However, the molecular mechanisms involved seem to differ with the plant-virus system being studied.

1.5.2.4 Recovery and the nature of host and virus isolate

Recovery is dependent on the host and on the isolate of the virus involved in the interaction.

For example, TRSV invades the shoot and the root meristem of tobacco plants (230). The recovered leaves of TRSV-infected tobacco plants showed a reduction in the levels of the viral RNA and CP (230). Interestingly, TRSV-inoculated N. benthamiana plants recover from infection and do not show such a drastic reduction in the virus CP. ToRSV infection also differed in the pattern of symptom progression and recovery depending on the nature of the host (discussed in detail in section 1.7.4) (222, 231). Martin-Hernandez et al. (2008) proposed that the transient entry of the TRV RNA into the meristem orchestrated by the 16K protein may vary between hosts and even between plants (223). They speculate that in N. benthamiana plants, TRV is not seed transmitted and hence the virus entry into the meristem

39 is only transient. On the other hand, in pea infected with Pea early browning virus (PEBV, genus Tobravirus), a virus closely related to TRV, the virus is seed transmitted and the meristem entry of the virus may be persistent.

Similar to variable effects of host on symptom recovery, virus isolates also influence the outcome during recovery. In line with this thought, plants infected with distinct isolates of

ToRSV and geminiviruses can differ in their ability to recover from infection in a temperature-dependent manner (229, 232). Various isolates of CMV were also found to differ in their ability to infect shoot apical meristem of tobacco infected plants (226, 233).

To conclude, although recovery is invariably associated with an induction of RNA silencing, it is also influenced by several other factors including temperature, the nature of the host and virus isolate and possibly the ability of the virus to enter the meristem. In addition, the exact mechanism leading to symptom recovery remains to be elucidated.

1.6 Overview of ToRSV

Tomato ringspot virus was first described by Price (1936) as Tobacco ringspot virus 2 (234).

ToRSV infects fruits, fruit trees, ornamental and herbaceous plants, and cause serious plant diseases (235, 236). The severe diseases include apple union necrosis and decline disease in apples, stem pitting in peach and plum, and yellow bud mosaic in cherry (235). Since it causes severe damage to economically important plants, it is considered a commercially important pathogen. It is endemic to North America and is also a quarantined plant pathogen. However, it has also been reported in different parts of the world including

Europe and Asia. The long distance spread of the virus is mostly through transport of the infected material. In the field, ToRSV is transmitted by nematodes (Xiphinema americanum) and through seeds and pollen grains. Symptoms on plant during ToRSV infection include ringspots, necrosis, chlorosis and vein clearing symptoms; and depend on the nature of the host, virus isolate and environmental conditions. ToRSV has a wide host range and infects experimental hosts such as N. tabacum, N. benthamiana and N. clevelandii.

1.6.1 Classification of ToRSV

ToRSV is a member of the genus Nepovirus, subfamily Comovirinae, family Secoviridae and order Picornavirales (235, 237). Nepoviruses are generally nematode transmitted polyhedral plant viruses (238), though other modes of transmission such as through seeds and pollen grains are also common. Nepoviruses have a bipartite positive-sense single-strand RNA genome. The genome is linked to a viral genome linked protein at the 5’end and a poly (A) tail at the 3’ end of the RNAs (Fig. 1.7) and encode a single large coat protein (CP) (237).

Each viral RNA encodes a single polyprotein that is processed by the viral protease to produce mature proteins (Fig. 1.7). The genus is further subdivided into three subgroups based on the size of the RNA2 and the specificity of protease cleavage site – subgroup A

(RNA2 - 3,700 to 4,000 nts), subgroup B (RNA2 - 4,400 to 4700 nts), and subgroup C

(RNA2 - of 6,400 to 7,300 nts). The size of RNA1 varies from 6000 to 8000 nts.

1.6.2 Genome organization and proteins encoded by ToRSV

ToRSV is a subgroup C nepovirus and is the type species of this subgroup. The size of

RNA1 is ~8.2 kb and RNA2 is ~7.2 kb (Fig. 1.7). The size of the RNA may vary depending

41 on the isolate. For example, RNA2 of a raspberry isolate (Rasp1), isolated from raspberry plants in Washington is ~7.5 kb while another isolate from peach (peach yellow bud ) is ~7.2 kb (232). RNA1 and RNA2 are encapsidated into separate capsids.

The genome organization of both RNAs includes a polyprotein coding region flanked by 5’ and 3’ untranslated regions (UTRs) (Fig. 1.7). These viruses encode a large polyprotein that is cleaved by the viral protease in an ordered manner to produce functional mature viral proteins (Fig. 1.7). In infected plants, apart from the mature proteins, intermediate polyproteins are also detected that contains two or more protein domains and can have different activities from the mature proteins (Fig. 1.7).

The RNA1 encoded polyprotein is processed by the viral protease to produce the mature X1,

X2, NTB (nucleoside-triphosphate binding protein), VPg (viral genome linked protein), Pro

(protease) and Pol (RNA dependent RNA polymerase) proteins (239-242). NTB, VPg, Pro and Pol are involved in replication and are called the replication block. NTB and X2 are membrane bound proteins and a role for these proteins in anchoring the replication complex was proposed (243-247). The exact function of X1 is not yet known.

The RNA2 encoded polyprotein is also processed by the viral protease to produce four mature proteins (248-250). MP and CP are involved in virus assembly, and cell-to-cell and systemic movement of the virus throughout the plant (251, 252). X3 has some similarity with the 2A protein of Grapevine fanleaf virus (GFLV, genus Nepovirus, subgroup A), which is required for the replication of RNA2 (253). Hence, X3 is proposed to play a role in

RNA2 replication (237). X4 is a unique protein and has no similarity with other proteins found in the database (232). Its function is not yet clear. In GFLV, RNA1 and RNA2 are both required for the successful infection of the virus in whole plants. RNA1 can replicate alone in protoplasts but does not form any virus particles (254).

ToRSV RNA1 and RNA2 3’ UTRs are very large while the 5’ UTRs are rather small. There are extensive regions of sequence identity between 5’ UTR-X1 regions of RNA1 and

5’UTR-X3 regions of RNA2. Similarly, the 3’UTRs of RNA1 and RNA2 also exhibit extensive regions of sequence identity. The UTRs of Blackcurrant reversion virus (BRV, genus Nepovirus, subgroup C), have been shown to be important for the viral RNA translation (237, 255, 256). Based on similarity in the genome organization, and in the sequence of the 3’UTR between BRV and other nepoviruses, the 3’UTRs are proposed to be important for viral RNA translation of this genus (257).

1.6.3 ToRSV multiplication cycle

Based on the available information on ToRSV and related viruses, a model for the ToRSV multiplication cycle has been proposed (235). On successful entry into a plant cell, the virus particle disassembles and releases its RNA genome in the cell. These positive-sense single- strand RNA molecules act as templates for translation to synthesize two large polyproteins

P1 and P2 from RNA1 and RNA2, respectively. As discussed in section 1.2, translation of an mRNA is believed to take place in a circularised form, mediated by protein-protein and

RNA-protein interaction between the 5’cap and the 3’end poly (A) tail (36). ToRSV RNA has a VPg instead of a cap at the 5’ end so it must utilize another strategy for translation. The

VPg-Pro intermediate protein from ToRSV was found to interact with the isoform of eIF4E in vitro (258). However, the exact role of this interaction in translation is not yet known.

The proteolytic processing of the two polyproteins is a highly regulated mechanism as the cleavage sites are not cleaved randomly instead they show priorities in their cleavage. For example, although the mature protease efficiently cleaves the cleavage site between the CP and the MP, a protease present in the VPg-Pro precursor is less efficient in cleaving this site

(259). This is probably a regulatory mechanism to release the mature CP later in infection.

The membrane-bound proteins (X2, NTB) associate with the membranes of the endoplasmic reticulum (243, 245), which are the sites of viral RNA replication. These membrane-bound proteins may also bring the viral RNA and Pol (247) to the site of replication by protein- protein or protein-RNA interaction. The replication protein Pol synthesizes negative-sense single-stranded RNA and through dsRNA replication intermediates, finally synthesizes new positive-sense single-stranded RNA.

The progeny RNA are packaged into the capsid formed by coat proteins to form complete virus particles. In nepoviruses, some particles do not contain RNA and are called empty virus particles. The virus particles move through the plasmodesmata of the plant by forming tubular structures using the MP. Tubules formed by the MP are found in association with the plasmodesmata in electron microscopy studies (252). Long distance movement of the virus takes place through the phloem. Finally, ToRSV is transmitted from one host to the other by nematodes, seeds or pollen grain where it again starts a new multiplication cycle.

Figure 1.7 : ToRSV genome and its mode of protein synthesis. Genome of ToRSV is bipartite positive-sense single-strand RNA. The genome encodes polyproteins that are cleaved by the viral protease to form mature proteins. For details see section 1.6.2.

1.6.4 Interaction of ToRSV with herbaceous plants

ToRSV infection in herbaceous plants is characterized by the phenomenon of recovery (Fig.

1.8) (222, 231). However, the pattern of recovery and symptom development varies in N. benthamiana and N. tabacum plants. Symptoms develop on the inoculated leaves followed by extensive vein clearing symptoms on the upper non-inoculated leaves in ToRSV-infected

N. benthamiana plants (222). After this symptomatic phase of infection new leaves emerge that do not show symptoms. In ToRSV-infected N. tabacum plants, symptoms develop on the inoculated leaves (231). Upper non-inoculated leaves develop systemic symptoms but instead of extensive vein clearing, chlorotic line patterns that enclose green tissues are observed. The development of systemic symptoms occurs in 10-60% of the infected N. tabacum plant, while 100% of N. benthamiana-infected plants exhibit systemic symptoms. In both N. tabacum and N. benthamiana young leaves emerge later in infection that are free of symptoms (222, 231). At the molecular level, recovery of ToRSV-infected N. benthamiana plant is not necessarily associated with a significant reduction of the viral RNA. In contrast, viral RNA is undetected in asymptomatic upper leaves of ToRSV infected-N. tabacum plant.

ToRSV-infection in both hosts induces a HR like response and an RNA silencing mechanism but they differ in the nature of their spread to the other parts of the plant. In N. benthamiana plants, both the virus and the resistance response seem to spread to the upper non-inoculated leaves. In contrast, infected N. tabacum plants, exhibit a restriction of the spread of the virus and vsiRNAs.

Recovery of N. benthamiana plants from ToRSV-infection is intriguing, because in spite of active RNA silencing mechanisms targeting the virus, the viral RNA levels are maintained at

46 similar levels as that in symptomatic systemically infected leaves (222). Jovel et al (2007) proposed that ToRSV can evade or suppress the RNA silencing mechanism (222). In line with this proposition, they demonstrated a weak hindrance of systemic silencing in ToRSV- infected plants. However, the exact mechanism for this hindrance was not identified at that time I initiated my work. Recent evidence from our lab has shown that the CP acts as a suppressor of silencing (260). This will be discussed in more details in the general discussion (Chapter 5).

Symptom recovery of ToRSV infected- N. benthamiana plants is temperature and isolate dependent, as discussed in section 1.6.2. Two isolates of ToRSV differ in their outcome of infection in relation to temperature (232). Rasp1 (an isolate from infected raspberry plants obtained from Washington state)-inoculated plants recover from infection only at higher temperatures (27ºC) and succumb to infection at lower temperature (21ºC). GYV (grape yellow vein, an isolate from infected grapevines obtained from California)-infected plants show recovery at both high (27ºC) and low temperature (21ºC). However, the mechanism underlying this difference remains to be elucidated.

Figure 1.8: Interaction of ToRSV with N. benthamiana plants. A) Photographs showing symptomatic (inoculated-left panel, systemically infected-middle panel) recovered leaves

(right panel) of ToRSV (isolate Rasp1)-infected N. benthamiana plants. Insets show enlarged views of ringspots and vein clearing symptoms (Photographs reprinted with permission from Jovel et al. 2007) (222). For details see section 1.6.4.

1.7 Thesis objectives

Recovery in N. benthamiana plants infected with ToRSV is not associated with a significant reduction in the viral RNA concentration in spite of the presence of active vsiRNAs targeting viral RNA sequences (222). Thus the role of RNA silencing involved in recovery of ToRSV- infected N. benthamiana plant is unclear. Therefore, my first objective is to elucidate the molecular mechanism underlying recovery of ToRSV-infected N. benthamiana plants.

To address this question I mainly focussed on the Rasp1 isolate and used the temperature- dependent recovery observed with this isolate as a tool for the investigation.

Symptom recovery for many viruses has been demonstrated to depend on the isolate used.

ToRSV isolates, Rasp1 and GYV show differences in their outcomes at 21°C (232, 261).

The molecular mechanisms involved in the different outcomes remains to be elucidated for

ToRSV. Therefore, the second objective of the thesis is to investigate the molecular mechanism involved in symptom recovery of GYV-infected plants at 21°C. To investigate this question, accumulation of Rasp1 and GYV viral products and defence responses were compared at this temperature.

Chapter 2

Temperature-dependent symptom recovery in Nicotiana benthamiana plants infected with ToRSV is associated with reduced translation of viral

RNA2 and requires ARGONAUTE 1

2.1 Introduction

As discussed in Chapter 1, symptom recovery in TBRV-infected N. clevelandii plants results in reduced levels of viral RNAs in the recovered leaves (2). Consistent with the idea that

RNA silencing directs viral RNA clearance, recovery from TRSV-infection is prevented in transgenic lines expressing various suppressors of silencing and this is concomitant with increased viral RNA accumulation (228). In contrast, recovery of ToRSV-infected N. benthamiana plants is not associated with viral RNA clearance in spite of active RNA silencing triggered against viral sequences (222). Thus, the molecular mechanisms that lead to symptom recovery are not well-established for the ToRSV-N. benthamiana interaction. In this chapter, I show that recovery of ToRSV-infected plants is associated with a reduction in the steady-state levels of viral proteins and decreased rate of translation of the corresponding viral RNA. I also show that the recovery does not occur in plants silenced for NbAgo1 or in wild type plants grown at lower temperatures and that translation of the viral RNA remains active under these conditions.

2.2 Material and methods

2.2.1 Virus inoculations

Experiments were performed in conviron climatic chambers with a 16-h day length. N. benthamiana seedlings were initially grown at 27°C. One day prior to inoculation, plants were shifted to 21°C or kept at 27°C. Virus inoculations were as described (222) using

Rasp1isolate of ToRSV, an isolate from a raspberry field in Washington state, USA (232,

261).

2.2.2 Isolation and detection of RNA

Total RNA extraction and Northern experiments were performed as described (222), with the exception that hybridization and washes were conducted at 60°C. Ethidium bromide staining of rRNAs is shown as load controls for all blots using total RNAs. For detection of low copy number transcripts (e.g., Ago genes), mRNAs were purified from 75 µg of total RNA using oligodT-bound magnetic beads (NEB). One μg of the purified mRNA was loaded on each well. E1Fα was used as a loading control for the quantification of Ago genes as it was previously reported to be a stable reference gene for TRV-directed VIGS experiments in N. benthamiana (262). Probes for viral RNA2 and PR1a mRNA (222), e1Fα mRNA (127) and

RbcS mRNA (263) were previously described. For other probes, cDNA fragments were amplified using the following forward (F) and reverse (R) primers: Ago1-F (5’ aagagacttccagcatatgatgg 3’), Ago1-R (5’ aatgcagtggaagacatatcg 3’), Ago2-F (5’ aagagacttccagcatatgatgg 3’), Ago2-R (5’ aatgcagtggaagacatatcg 3’), Ago4-F (5’ gagcatattgtaatattcagggat 3’), Ago4-R (5’ accaccatggcttgacgatgtctct 3’), Sgt1-F (5’ atgtccaccaaaattgagatc 3’), Sgt1-R (5’ tagatctcccatttcttcagc 3’). For siRNA detection, 15 µg

51 of total leaf RNA was separated on a 15% denaturing polyacrylamide gel by electrophoresis and transferred to Hybond-N- membranes by electroblotting. The RNAs were chemically cross-linked to the membrane and hybridization with radiolabeled probes was performed as described (264). Probes for vsiRNA were previously described (222).

2.2.3 Isolation and detection of proteins

Preparation of S3 extracts from leaf tissues and immunoblotting were carried out as described (243). Rabbit polyclonal antibodies produced against a peptide

(PARLPDILDDKSEV) corresponding to the central region of the ToRSV CP were used to detect the CP in immunoblots. Immunoblots to detect MP were conducted using rabbit polyclonal antibodies raised against a previously described recombinant MP protein (252).

Ponceau S staining of the large RUBISCO subunit (RbcL) is shown as load controls for all immunoblots.

2.2.4 In vivo labelling experiments and immunoprecipitation

In vivo labelling of detached leaves was performed by placing the petioles in an aqueous solution (800 µl) containing 20 µCi of [35S]-methionine for 2 h at room temperature.

Preparation of leaf extracts and immunoprecipitations were conducted as described (171) using polyclonal rabbit antibodies raised against a peptide (TLETNNPVGRPPENVD) located in the C-terminal region of the CP.

2.2.5 VIGS assays

VIGS assays were performed as described (127) with minor changes. Three week old N. benthamiana plants were agro-infiltrated with TRV vectors targeting NbAgo1, NbAgo2,

NbAgo4 or NbSgt1 (132, 139, 265). Plants were kept at 21°C for ten days to establish the

VIGS and then transferred to 27°C. Plants were acclimatized for one day and then inoculated with ToRSV.

2.3 Results

2.3.1 Temperature-dependent symptom recovery in ToRSV-infected N. benthamiana plants is associated with reduced viral CP accumulation and increased vsiRNAs levels

RNA silencing is highly regulated and environmental conditions such as elevated temperature have been shown to enhance silencing efficiency against viruses, often resulting in decreased symptomatology or enhanced recovery (138, 227, 229, 266). Symptom recovery was previously described in ToRSV-infected N. benthamiana plants grown under greenhouse conditions (222). In this study, I re-examined the kinetics of viral infection in controlled environmental growth chambers at two different temperatures (21°C and 27°C). At 27°C, ringspot symptoms developed on the inoculated leaves 2-3 days post-inoculation (dpi, Fig

2.1A-1). At 4 dpi, young leaves above the inoculated leaf developed vein clearing symptoms

(Fig. 2.1 A-2). By 8 dpi, newly emerging leaves were asymptomatic and the plant recovered from infection (Fig. 2.1A-3 and -7). In contrast, symptom recovery was not observed at

21°C. At this temperature, the infection progressed slower and the first symptoms appeared at 4 dpi. Ringspot symptoms developed on inoculated leaves but were less prominent than those observed in plants grown at 27°C (Fig. 2.1A-4). Symptoms developed on upper non- inoculated leaves at 5 dpi and progressed to severe necrosis (Fig 2.1A -5-7). At late stages of infection, although some young leaves remained non-necrotic, they were highly symptomatic

(Fig. 2.1A-7). Thus, the outcome of ToRSV infection was influenced by the temperature.

Accumulation of viral RNA and proteins was evaluated during the course of infection. I focussed my attention on the accumulation of the MP and CP, for which high affinity specific antibodies were available, and of RNA2, which encodes these proteins. Pools of 18-

25 leaves were taken from 9-10 plants at each time point. Leaves were collected from different plants from the same batch for each time point to ensure that collection of leaves at an earlier time point did not affect the progress of infection. Experiments were repeated 3-5 times with consistent results. Accumulation of RNA2 increased rapidly at 27°C (Fig. 2.1B).

As previously shown (222), the level of RNA2 was high in symptomatic and in recovered leaves. At 5 dpi, MP and CP also accumulated to high levels in young systemically-infected symptomatic leaves (Fig. 2.1B-C). The steady-state levels of these proteins declined later in infection and were very low in recovered leaves (Fig. 2.1B-C). At 21°C, RNA2 accumulation progressed slower (compare levels of RNA2 in systemically infected leaves at

5 dpi at 21°C and 27°C) but attained a high steady-state level by 8 dpi. The accumulation of

CP and MP progressively increased during the course of infection at 21°C. These results indicate that symptoms are associated with accumulation of viral proteins while symptom recovery is concomitant with a reduction in viral protein concentration.

I next examined the induction of host defence responses. At 27°C, vsiRNAs accumulated earlier in infection and reached higher levels when compared to their accumulation at 21°C

(Fig. 2.1D), suggesting that the antiviral RNA silencing machinery was less active at lower temperature, possibly in part due to the slower accumulation of viral RNAs. Temperature- dependent activation of RNA silencing has been described by others (138, 227). The results also confirm the previous observation that ToRSV-specific RNA silencing is active in recovered leaves (222). ToRSV also induces a hypersensitive-like (HR-like) response in N. benthamiana, which is characterized by the induction of PR1a (coding for the pathogenesis- related protein 1a) expression, reactive oxygen species, cell death and transport blockage but

55 does not prevent virus movement to non-inoculated leaves (222). Expression of PR1a was induced in symptomatic leaves at both temperatures (Fig. 2.1E). In contrast, PR1a mRNAs were only detectable at low levels in recovered leaves. Symptomatic infection of N. benthamiana by ToRSV has been shown to be associated with the down-regulation of photosynthetic genes, such as RbcS (coding for the small subunit of RUBISCO) (198).

Consistently, my results show a reduction of RbcS expression in symptomatic leaves at both temperatures (Fig. 2.1E). However, RbcS mRNAs were readily detected in recovered leaves at 27°C. These results suggest that the HR-like response activated by ToRSV in symptomatic leaves is not maintained in recovered leaves in spite of the high concentration of viral RNAs. I hypothesize that ToRSV-induced symptoms are at least in part related to the induction of the HR-like response and that a viral protein (rather than viral RNA) is responsible for the induction and maintenance of this response.

Figure 2.1: Figure legend on next page.

Figure 2.1: Temperature-dependent recovery of Rasp1 infected plants is associated with a reduction of RNA2-encoded proteins but not of RNA2. (A) Symptom development in inoculated leaves (panels 1, 4) and upper non-inoculated leaves (panels 2-3, 5-6) of

ToRSV-infected N. benthamiana plants. White bars represent 1 cm. Pictures of entire plants at 20 dpi (panel 7). (B-E) Accumulation of RNA2 and CP (B), MP (C), vsiRNAs (D), PR1a and RbcS mRNAs (E) during the course of infection. Samples were taken from mock- inoculated plants (M) or from inoculated leaves (I), upper symptomatic leaves (S) and upper recovered leaves (R) of ToRSV-infected plants as indicated above each lane. (B, C, D and

E): all lanes shown are from a single gel and a single exposure.

2.3.2 Reduced rate of translation of viral RNA2 at late stages of infection at 27°C

The decreasing steady-state levels of CP and MP observed in recovered leaves at 27°C could be explained by a reduced rate of translation of RNA2. A standard method used to investigate the translational state of an mRNA is to perform polysome profiling. However, the presence of encapsidated viral RNA in infected plant extracts complicated this analysis.

The viral particle peak partially overlaps with the monosome and early polysome peaks in the gradient, preventing accurate measurements of the relative ratio of viral RNAs associated with monosomes or polysomes (data not shown). Therefore, I adopted an alternative approach and measured the rate of synthesis of CP using in vivo labelling experiments followed by immunoprecipitation of the CP. To do this, the petioles of detached leaves were submerged in a solution of [35S]-methionine for 2 h. To provide a meaningful comparison of the rate of translation at various stages of infection, inoculations of a single batch of plant were staggered so that leaves representing different stages of infection could be labelled in parallel on a single day. The experiment was repeated three times with similar results and a typical result is shown (Fig. 2.2). At 3 dpi, symptoms were just starting to develop on upper non-inoculated leaves. In spite of the low steady-state levels of viral RNA2 and CP (Fig.

2.2A) present in these leaves, labelling of newly synthesized CP was evident (Fig.2.2B). At 4 dpi, symptoms were fully developed on the leaves and high steady-state levels of RNA2 and

CP were present (Fig. 2.2A). The CP was efficiently immunoprecipitated (see Coomassie blue stained gel, lower IP-CP panel, Fig. 2.2B). However, labelling of the CP was drastically reduced (upper IP-CP panel, Fig. 2.2B). Similarly, in recovered leaves (10 dpi), labelling of

CP was barely detectable. These results demonstrate active translation of RNA2 early in infection and reduced translation of this RNA in later stages of infection. In contrast,

59 although labelling of host proteins was possibly reduced early in infection, it was as efficient in recovered leaves as in mock-inoculated leaves (see unbound fractions, Fig. 2.2B). Thus, the reduced translation of RNA2 in recovered leaves was not due to a reduced uptake of

[35S]-methionine.

Since reduction of CP steady-state levels was not observed during ToRSV infection at 21°C,

I also examined the rate of translation of RNA2 at this temperature. Because I had observed reduced translation of RNA2 as early as 4 dpi in ToRSV-infected systemic leaves at 27°C, I compared the rate of translation at 6 dpi at 21°C and 27°C. It would be technically challenging to go beyond this time point at 21°C as the petioles become necrotic, thereby preventing efficient uptake of the labelled methionine. As mentioned above, RNA2 accumulated at later time points at 21°C and was not detectable in upper non-inoculated leaves at 3 dpi (Fig. 2.2C). At 6 dpi, the steady-state levels of RNA2 and CP are similar at

21°C and 27°C (Fig. 2.2C). Staining of the immunoprecipitated fractions confirmed efficient pull-down of the CP (Fig. 2.2D, lower panel). However, efficient labelling of CP was only observed in leaves grown at 21°C (Fig. 2.2D, upper panel). Thus, active translation of RNA2 was observed at 6 dpi in ToRSV-infected systemic leaves at 21°C, while at this stage translation of this RNA was drastically reduced at 27°C.

Figure 2.2: Figure legend on next page.

Figure 2.2: Reduced translation rate of RNA2 in late stages of infection in ToRSV-

o infected plants grown at 27 C. (A) Steady-state levels of RNA2, CP and vsiRNAs in upper

o symptomatic (S) or recovered (R) leaves of ToRSV-infected plants grown at 27 C. (B) In vivo labelling and CP immunoprecipitation. Systemically infected and recovered leaves were

35 detached from the batch of plants analyzed in A and were labelled with [ S]-methionine.

The immunoprecipitated (IP-CP) and unbound fractions were separated by SDS-PAGE.

Exposure of the gel to a phosphorimager screen (upper panels) shows newly-synthesized CP

(IP-CP) and host proteins (unbound). Coomassie blue staining of the gels are shown on the bottom panels. Black arrow-heads and circles point to CP monomers and dimers, respectively. (C) Steady-state levels of RNA2, CP and vsiRNAs in upper non-inoculated leaves (S) of ToRSV-infected plants grown at 27°C and 21°C. (D) Rate of synthesis of CP in upper symptomatic leaves of plants grown at 27°C and 21°C. Leaves were detached at 6 dpi and in vivo labelling and CP immunoprecipitation were conducted as in (B). For (B) and

(D), all lanes shown are from a single gel and a single exposure.

2.3.3 Recovery is compromised by down-regulation of NbAgo1

The reduced translation rates of RNA2 observed at 27°C was accompanied by an apparent increase in RNA silencing (as shown by the increased accumulation of siRNAs at 27°C compared to 21°C, Fig. 1D, 2.2C). This raised the possibility that RNA silencing is involved in a temperature-dependent mechanism that represses the translation of ToRSV RNA2. I used the TRV vector to silence Ago genes, which are the main components of the RISC complex. N. benthamiana encodes two Ago1-like genes (NbAgo1-1 and NbAgo1-2) and two

Ago4-like genes (NbAgo4-1 and NbAgo4-2) (139). I used TRV constructs targeting NbAgo1,

NbAgo2 and NbAgo4, which have previously been shown to efficiently silence all copies of the corresponding genes (132, 139). I also used a TRV vector that targets NbSgt1

(Suppressor of G2 allele of SKP1), a gene coding for a co-chaperone required for R gene function (265, 267). Specific silencing of each target gene was confirmed by Northern blots of enriched mRNA fractions (Fig. 2.3A). As reported previously (132, 139, 265), plants silenced for NbAgo1 or NbSgt1 were stunted while plants silenced for NbAgo2 or NbAgo4 were morphologically indistinguishable from plants treated with the TRV:00 control vector

(Fig. 2.3E-1-5, mock-inoculated plants shown on the left of each panel). ToRSV-infection was observed in all treated plants, resulting in the accumulation of viral RNAs (Fig. 2.3B and

C). Although a delay in the establishment of ToRSV infection was observed in NbAgo1- silenced plants, by 7 dpi the accumulation of viral RNA and CP was similar in NbAgo1- silenced plants and control plants (Fig.2.3C). This initial delay was not solely due to the stunted growth of the NbAgo1-silenced plants as it was not observed in NBSgt1-silenced plants (Fig. 2.3B). Establishment of ToRSV infection was also not delayed in plants silenced for NbAgo2 or NbAgo4 (Fig. 2.3B). ToRSV infection did not interfere with the silencing of

63 the target gene, as shown for NbAgo1-silenced plants (Fig. 2.3D, compare levels of NbAgo1 mRNAs in mock-inoculated plants or upper systemically-infected leaves of ToRSV-infected plants).

Symptom recovery of ToRSV-infected plants grown at 27°C was not affected by silencing of

NbAgo2, NbAgo4 or NbSgt1 (Fig. 2.3E-1-4). In contrast, NbAgo1-silenced plants did not recover from ToRSV-infection at 27°C (Fig. 2.3E-5-6). As observed in wild-type plants grown at 21°C (Fig. 2.1A-7), some leaves remained non-necrotic in NbAgo1-silenced plants grown at 27°C, but were otherwise symptomatic (Fig. 2.3E-6). CP levels were low in recovered leaves from control plants or from plants silenced for NbAgo2, NbAgo4 and

NbSgt1 while NbAgo1-silenced plants displayed higher steady-state levels of CP late in infection (16 dpi) (Fig. 2.3F). Accumulation of vsiRNAs was lower in NbAgo1-silenced plants compared to the other plants (Fig. 2.3F-G). Next, I studied the rate of synthesis of CP in systemically infected symptomatic leaves in NbAgo1-silenced and control plants. I conducted these experiments at 6 dpi, before the onset of necrosis in NbAgo1-silenced plants.

At this time point, the steady-state levels of RNA2 and CP were similar in control plants and in NbAgo1-silenced plants (Fig. 2.3G). Although, immunoprecipitation of CP was efficient in both cases (see stained gels, Fig. 2.3H), CP labelling was more efficient in NbAgo1- silenced plants than in control plants, suggesting that the reduced rate of translation of RNA2 is associated with symptom recovery at 27°C and that this process is dependent directly or indirectly on AGO1.

Figure 2.3: Figure legend on next page.

Figure 2.3: Recovery is compromised by down-regulation of Ago1. TRV vectors were used to silence NbAgo1, NbAgo2, NbAgo4 and NbSgt1. An empty TRV vector (TRV:00) was used as a control. Once silencing was established, plants were inoculated with ToRSV and grown at 27oC (A) Confirmation of efficient silencing of target genes. mRNAs were purified from a pool of leaves from plants inoculated with TRV:00 or with TRV:Ago1,

TRV:Ago2, TRV:Ago4 and TRV:Sgt1 as indicated above each lanes and were hybridized with specific probes as indicated on the right. E1Fα was used as a reference gene. (B)

Accumulation of RNA2 and CP is compared in plants silenced for NbAgo1, NbAgo2,

NbAgo4 or NbSgt1 or in control plants (TRV:00) at 5 dpi. (C) Kinetics of ToRSV infection in control plants (TRV:00) or plants silenced for NbAgo1. Accumulation of RNA2 and CP in inoculated (I) or symptomatic systemic (S) leaves are shown at 4 and 7 dpi. (D)

Confirmation of NbAgo1 silencing following ToRSV infection in TRV:Ago1 plants. mRNAs were purified from a pool of upper non-inoculated leaves from TRV:00 or TRV:Ago1 plants that were ToRSV-infected (S, 5 dpi) or mock-inoculated (M) and were probed for NbAgo1 or

E1Fα. (E-1-5) Symptomatology of ToRSV-infected plants (right of each panel) or mock- inoculated plants (left of each panel) at 16 dpi. (E-6) Close-up of a ToRSV-infected

TRV:Ago1 plant at 16 dpi (F) Accumulation of RNA2, CP and vsiRNAs in plants shown in

E (analyzed at 16 dpi). (G) Steady-state levels of RNA2, CP and vsiRNA in mock- inoculated control plants (M), ToRSV-infected control plants (00) or ToRSV-infected

NbAgo1-silenced plants analyzed at 6 dpi. (H) In vivo labelling and CP immunoprecipitation using the batch of plants analyzed in G. Labelling were conducted for 2 or 8 h as indicated above each lane.

2.3.4 Translation of RNA2 is partially reactivated in temperature-shift experiments

In mammalian cells, miRNA-mediated translation repression is reversible under certain stress conditions, allowing responsive regulation to environmental conditions (268). I investigated whether translation of ToRSV RNA2 can be reactivated by shifting recovered plants from 27°C to 21°C. Plants were inoculated with ToRSV and allowed to grow at 27°C until recovery was well-established (10 dpi, Fig. 2.4A). A batch of plants was moved to

21°C and another batch was kept at 27°C. Plants shifted to 21°C showed a slight increase in

CP levels 10 days after shifting (20 dpi), while plants kept at 27°C showed a further decrease in CP levels (Fig. 2.4B). The shift to 21°C was also accompanied with a decrease in the accumulation of vsiRNAs compared to plants kept at 27°C (Fig. 2.4B). This suggests that

RNA2 translation was partially reactivated after the shift to 21°C and that this occurs in association with a reduction in RNA silencing activity. Levels of PR1a mRNAs decreased steadily in ToRSV-infected plants that were kept at 27°C, but were reinduced although to low levels in plants shifted at 21°C (Fig. 2.4C). This induction of PR1a expression was concomitant with increased levels of viral CP, indicating a reactivation of the HR-like response. However, this response was weaker than that initially observed in younger plants and new symptoms were not observed after the temperature shift.

The low levels of viral proteins observed after the temperature shift may be below the threshold required to initiate a symptomatic HR-like response, as previously shown for other plant-virus interactions (269). Alternatively, it may be related to a reduced susceptibility of older plants to ToRSV infection. To test this, ToRSV-infected or equivalent mock- inoculated plants were reinoculated with ToRSV at the time of temperature shift (Fig. 2.5A).

Reinoculation of ToRSV-infected plants did not result in increased accumulation of CP or increased symptoms compared to plants that received only the first inoculation (Fig 2.5B and

2.5C), confirming that recovered leaves are resistant to secondary inoculation. In contrast, plants that only received the second inoculation showed the typical progression of ToRSV- infection observed in younger plants (Fig. 2.5B). Accumulation of CP and induction of PR1a mRNAs was higher in plants that received only the second inoculation than in similar-aged plants that had undergone initial recovery from ToRSV infection at 27°C (Fig. 2.5C). Taken together, these results suggest that older plants are able to support new ToRSV infection and to sustain vigorous translation of RNA2. Thus, the re-induction of viral RNA2 translation after a temperature shift in ToRSV-infected plants (plants that only received the first inoculation) is partial.

Figure 2.4: Partial re-induction of protein synthesis in temperature shift experiments.

(A) Steady-state levels of RNA2 and CP in upper symptomatic leaves (S) or recovered (R) leaves of ToRSV-infected plants grown at 27°C prior to the temperature shift. (B) Steady- state levels of RNA2, CP and vsiRNAs after the temperature shift. At 10 dpi, plants analyzed in A were either transferred to 21°C or kept at 27oC. Samples were collected at 12, 14, 16 and 20 days following the initial ToRSV-inoculation. (C) Accumulation of PR1a mRNAs before or after temperature shift. Total RNA samples shown in A and B were used for the analysis.

Figure 2.5: Sequential inoculations confirm that symptom induction requires a threshold of viral protein accumulation. (A) Inoculation scheme. Plants were inoculated with ToRSV at the 3-leaf stage and were allowed to grow at 27°C for 10 days until recovery took place. Plants are depicted at that stage with the arrow and the number 1 indicated the leaf inoculated in the first round of inoculation. Recovered leaves of ToRSV-infected plants

(diagram in the centre) or equivalent leaves of healthy plants (diagram on the right) were reinoculated with ToRSV for a second time (2). A portion of the plants only received the first inoculation (left diagram). At the time of reinoculation, plants were transferred to 21°C. (B)

Apical leaves from plants receiving only the first inoculation inoculation (left), both inoculations (middle) or only the second inoculation (right) are shown 10 days after the second inoculation. These apical leaves are above the leaves that received the second inoculation in the new-growth of the plant following the temperature shift. (C) Steady-state levels of CP and RNA2 in plants collected 6 and 10 days after the second inoculation (das) and temperature shift. For all time points, apical leaves from several plants (as defined in B) were collected and pooled together prior to extraction. Inoculation scheme for each sample was as indicated above each lane.

2.4 Discussion

In this study, I have examined the temperature-dependent symptom recovery in ToRSV- infected N. benthamiana plants. It was previously shown that viral RNA clearance is not a pre-requirement for symptom recovery in ToRSV-infected plants (222). In this study, I show that in spite of the similar steady-state levels of viral RNA2, the accumulation of two RNA2- encoded proteins (CP and MP) is significantly reduced in recovered leaves compared to young symptomatic systemic leaves (Fig. 2.1). In vivo labelling experiments demonstrated that under conditions that ultimately lead to symptom recovery, translation of viral RNA2 is robust at early stages of infection (3 dpi), but is drastically reduced later on (Fig. 2.2). It is not known at this time, whether this phenomenon is specific to RNA2 or whether translation of RNA1 is also arrested in plants that recover from infection. Reduced translation of RNA2 was observed as early as 4 dpi in symptomatic systemic leaves of plants grown at 27°C, but did not result in reduced steady-state levels of viral proteins in young systemic symptomatic leaves collected at 5 dpi, probably because RNA2 was actively translated in these leaves at earlier time points (Fig. 2.1B). By 8 dpi, some degradation of the viral CP was observed in older systemic symptomatic leaves (Fig. 2.1B). In contrast, low levels of viral proteins were observed in recovered leaves (young or older leaves, Fig. 2.1 and 2.4), suggesting that the

RNA2 was never efficiently translated in these leaves.

What causes the reduction in RNA2 translation rate? The replication cycle of positive-strand

RNA viruses consists of distinct phases in which the viral RNA is first translated, then replicated and eventually encapsidated. Thus, viral RNAs serve both as mRNAs and as template for (-)-strand RNA synthesis. Viral RNAs that are actively translated cannot be

72 efficiently replicated by the viral polymerase (270), implying that a switch from translation to replication is necessary. In mammalian cells infected with picornaviruses several mechanisms have been shown to regulate this switch, including the binding of viral proteins to the viral RNA to actively arrest translation (270, 271) or the cleavage of translation factors by viral proteins (272). Although I cannot exclude the possibility that similar mechanisms contribute to the reduced translation of ToRSV RNA2 at late stages of infection, they imply an initial accumulation of viral proteins in the infected cells prior to the translational arrest, which is not consistent with the low steady-state levels of viral proteins observed in recovered leaves. Rather, the apparent lack of efficient translation of viral RNA2 in recovered leaves suggests the induction of a non-cell autonomous mechanism, such as

RNA silencing, that could either directly target the viral RNAs or indirectly target cellular factors that specifically enhance the translation of the viral RNAs. In agreement with this suggestion, the reduction in translation rate of RNA2 was not observed under conditions in which RNA silencing was less active, i.e. in plants grown at lower temperatures or in plants that were silenced for NbAgo1 (Fig. 2.2 and 2.3). Given the known function of AGO1 in directing the translation repression of plant mRNAs using miRNAs or siRNAs (155), I would like to propose that AGO1 is implicated in an RNA silencing mechanism that directly or indirectly arrests the translation of ToRSV RNA2. However, my results do not exclude the possibility that AGO1 influences other aspects of the N. benthamiana-ToRSV interaction leading to the recovery. AGO1 regulates the expression of defence-related genes through the miRNA pathway and silencing or mutation of NbAgo1 can result in enhanced R gene responses (127) and constitutive expression of defence related-genes (148, 153, 273, 274).

Such enhanced defence responses in NbAgo1-silenced plants may explain the initial delay in

ToRSV infection observed in these plants, although the plants became systemically infected at later stages of infection. The enhanced defence responses may also contribute to the increased severity of symptoms and the absence of recovery in NbAgo1-silenced plants.

Results presented here and earlier (222) indicate that symptoms develop concomitantly with an HR-like response, while this response is apparently inactive in recovered leaves. The results of the temperature-shift experiment also indicated that symptom intensity is correlated with the strength of the HR-like response (as measured by the up-regulation of PR1a mRNA) and the steady-state levels of viral proteins (Fig. 2.4 and 2.5). This suggests that one or several viral proteins act as an elicitor for the HR-like response in a dose-dependent manner.

Symptom recovery in virus-infected plants has been compared to the latency phase of retrovirus-infected mammalian cells (61, 179). In both cases, the virus persists at low levels and although it is targeted by RNA silencing mechanisms, it remains undetected by other defence responses, protecting host cells from catastrophic apoptotic or necrotic responses. In the case of HIV, a cellular miRNA directs translation repression of the viral genome allowing the maintenance of viral RNAs while preventing accumulation of viral proteins

(180). The case has been made that miRNA-directed translation repression of retroviruses should be viewed as a promoter of persistent infection rather than an antiviral defence (178).

As discussed above, in ToRSV-infected plants, activation of the necrotic response requires a minimal threshold of viral protein accumulation. The reduced translation rate of RNA2 would allow the virus to remain undetected by the necrotic response and to invade meristematic tissues, allowing for seed transmission of the virus. Because the translation

74 repression mechanism is at least partially reversible under some conditions (e.g., lower temperature) viral proteins would accumulate to higher concentration leading to a more acute phase of infection. In conclusion, our results identify translation repression as a responsive mechanism regulating symptom development and maintenance in ToRSV-infected plants.

Combined with earlier studies that established a link between viral RNA clearance and recovery in other plant-nepovirus interactions (2, 228), my results also indicate that several distinct mechanisms can cause the onset of symptom recovery in nepovirus-infected plants.

Chapter 3

Possible involvement of both NbAgo1 and NbAgo2 genes during ToRSV

infection in a temperature-dependent manner

3.1. Introduction

Temperature has been shown to influence plant-virus interactions (138, 146, 227, 275). One of the factors involved in the temperature-dependent variability in plant virus interaction is the plant defence response (227, 275, 276). For example, RNA silencing is found to be more efficient at higher temperature (227). In line with this thought, AGO2, RDR6 and HEN1 have been shown to have a temperature-dependent antiviral activity (138, 146). Consistent with these studies, ToRSV-infected plants do not recover from infection at 21°C (Chapter 2).

I have also shown that recovery is compromised in NbAgo1-silenced plants at 27°C. This raised the possibility that the activity of NbAgo genes may be different at the two temperatures. In this study, I evaluated the role of the NbAgo1, NbAgo2 and NbAgo4 genes on ToRSV infection at 21°C and examined the expression of NbAgo genes during the course of ToRSV infection at both temperatures. I observed that NbAgo1 and NbAgo2 genes are induced during ToRSV infection. ToRSV-infected control plants and NbAgo-silenced plants all became severely necrotic at 21°C. In addition, I show that down-regulation of NbAgo2 resulted in increased accumulation of CP at this temperature.

3.2. Materials and methods

3.2.1 Virus inoculations

Experiments were performed as described previously in Chapter 2. The Rasp1 isolate of

ToRSV was used for inoculation in experiments of this chapter.

3.2.2 Isolation and detection of RNA

Total RNA extraction, mRNA purification using oligo dT columns and Northern experiments were performed as described in Chapter 2.

3.2.3 Isolation and detection of proteins

Preparation of S3 extracts from leaf tissues and immunoblotting were carried out as described in Chapter 2.

3.2.4 VIGS assays

VIGS assays were as described as in Chapter 2.

3.3 Results

3.3.1 NbAgo1 and NbAgo2 genes are induced during ToRSV infection at both temperatures

Since ToRSV-infected plants recovered from infection at higher temperatures but not at

21°C or in NbAgo1-silenced plants at 27°C, I hypothesized that the level of NbAgo1 expression may vary at the two temperatures. To test this, I compared the levels of NbAgo1,

NbAgo2 and NbAgo4 mRNA from mock and ToRSV-infected plants at both temperatures.

N. benthamiana plants were inoculated with ToRSV and maintained at 21°C or 27°C. Leaf samples (systemically infected symptomatic and recovered leaves) were collected from 3, 5 and 8 dpi mock-inoculated plants and ToRSV-infected plants. mRNAs were purified and

Northern blots were probed for NbAgo1, NbAgo2 and NbAgo4. E1Fα was used as a loading control. Symptoms on the systemically infected leaves at 21°C did not develop until 4 dpi.

For this reason, no 3 dpi samples were collected from the plants kept at 21°C.

This experiment was repeated three times and a typical result is shown. Although relative levels of the NbAgo mRNAs varied slightly from one experiment to the other (data not shown), and from one time point to another (Fig 3.1 lanes 1, 2, 4, 5, 7, 8), no significant trends of differential expression of any of the NbAgo genes tested were noted in the mock- inoculated plants at the two temperatures.

Next, I investigated the levels of expression of NbAgo genes during ToRSV infection.

NbAgo1 and NbAgo2 mRNA levels were induced early during ToRSV infection at both temperatures (Fig. 3.1 A compare lane 4 & 5 to lane 12 & 13). NbAgo1 mRNA levels

78 accumulated to higher levels during ToRSV-infection in systemically infected symptomatic leaves compared to mock-inoculated plants of the same age (Fig. 3.1 A compare lane 4 & 5 to lane 12 & 13). At 27°C, in the recovered leaves the level of NbAgo1 mRNA was similar to that of mock inoculated plants (Fig. 3.1 A compare lane 8 & 17). A similar trend was observed with NbAgo2 mRNA. NbAgo2 was relatively more strongly induced than NbAgo1 mRNA (Fig 3.1A), although this induction was very transient. NbAgo4 mRNA levels followed the same trend as the E1Fα, and was apparently not induced by ToRSV infection.

Figure 3.1: Relative levels of NbAgo1, NbAgo2 and NbAgo4 in mock and ToRSV- infected plants at 21°C and 27°C. A) Northern blot showing accumulation of NbAgo1,

NbAgo2 and NbAgo4 mRNA in mock and ToRSV-infected plants. E1Fα was used as a reference gene. B) Northern and Western blots showing accumulation of viral RNA2 and CP.

Samples were taken from mock-inoculated plants (M) or from upper symptomatic leaves (S) and upper recovered leaves (R) of ToRSV-infected plants as indicated above each lane.

3.3.2 ToRSV CP accumulates to higher levels in NbAgo2-silenced plants

As the outcome of plant-virus interactions is influenced by temperature, similarly, the activity of specific NbAgo gene on virus infection may also vary with temperature (138,

146). At 27°C, NbAgo1-silenced plants accumulated higher levels of CP indicating that the reduction in the translation rate of viral RNA2 is dependent on AGO1 (Chapter 2). Here, I investigated whether the silencing of NbAgo1, NbAgo2 and NbAgo4 genes had an effect on

ToRSV infection at 21°C. Plants were silenced for each NbAgo gene as described in Chapter

2. NbAgo1-and NbAgo2-silenced plants were inoculated with ToRSV and monitored at

21°C. Experiments were repeated twice with similar results and a typical result is shown.

All ToRSV-infected control and silenced plants became severely necrotic (Fig. 3.2A right panel). This severe necrosis was associated with high accumulation of CP (Fig. 3.2B).

Down regulation of NbAgo1 did not lead to a significant increase in the accumulation of viral

CP compared to control plants. Interestingly, NbAgo2-silenced plants accumulated higher levels of CP in comparison to the other silenced and control plants (Fig 3.2B). This result indicates that NbAgo2 might be restricting the accumulation of CP at 21°C during ToRSV infection.

Figure 3.2: Effect of down regulation of NbAgo1, NbAgo2 and NbAgo4 during ToRSV infection at 21°C. TRV vectors were used to silence NbAgo1, NbAgo2 and NbAgo4 genes in

N. benthamiana. An empty TRV vector (TRV:00) was used as a control. Once silencing was established, plants were inoculated with ToRSV. A) Symptomatology of ToRSV- infected (plant on the right of each panel) or mock-inoculated plants (plant on the left of each panel) at 18 dpi. B) Western blot showing CP levels in ToRSV-infected plants at 18 dpi.

3.4 Discussion

RNA silencing has been shown to be more efficient at higher growth temperature in plants

(227). This higher efficiency of RNA silencing could be caused by an increased expression of RNA silencing enzymes. In this chapter, no significant difference in the mRNA level of the NbAgo genes tested in healthy plants at the two different temperatures was observed.

Similar results were also found in another study (138). RNA silencing is involved in different biological processes of plants such as plant development and growth (16).

Therefore, maintaining proper levels of the proteins involved in the RNA silencing pathways may be important for the plant, and hence may explain their similar expression levels at the two temperatures. However, we cannot rule out the possibility that these genes might be regulated at later stages of gene expression. For example, NbAgo1 and NbAgo2 gene expression are regulated at the post transcriptional level by miRNAs miR168 and miR403, respectively (126, 205). Therefore, although I observed similar levels of mRNA, this does not indicate that the proteins are present at the same levels. This needs to be further tested.

During several virus infections, Ago1 and Ago2 genes are induced and play important roles in the antiviral defence response (126, 133), in a cooperative manner (122). Consistent with these studies, during ToRSV infection both NbAgo1 and NbAgo2 genes were induced irrespective of the temperature. This indicates a possible involvement of both genes during

ToRSV infection. Although, NbAgo1 and NbAgo2 were induced at 21°C and 27°C, the outcomes of infection were completely different at the two temperatures indicating more complex layers of regulatory mechanisms in the ToRSV- N. benthamiana interaction.

At 27°C, NbAgo1 silencing prevented recovery and also higher CP levels accumulated in the non-recovered plants in comparison to control plants (Chapter 2). Therefore, I expected that silencing of NbAgo1 at 21°C would lead to higher accumulation of viral CP in comparison to control plants. Both control and NbAgo1-silenced plants became severely necrotic and accumulated high levels of CP at 21°C. However, there was no significant difference in the

CP levels in the control and NbAgo1-silenced plants raising the possibility that either ToRSV infection does not involve NbAgo1 at 21°C or that ToRSV itself is able to counteract the

NbAgo1 activity at this temperature. Our lab has recently shown that the ToRSV CP is a suppressor of silencing that interacts with, and destabilizes AGO1 and is capable of counteracting the translation repression of a transgene mRNA (260). It is possible that at low temperatures the ToRSV CP is able to destabilize AGO1, thereby masking the effect of silencing NbAgo1 on virus infection. At higher temperatures, the virus may be unable to inhibit RNA silencing and therefore the effect of down-regulating NbAgo1 on the virus infection is more evident. This could be due to either a lower activity of the suppressor at higher temperature as shown for HC-pro from papaya ringspot virus (277) or to the higher activity of the silencing pathway (146).

The role of AGO2 in antiviral defence has been reported in other studies (126, 131, 132,

138). However the effect of AGO2 seems to depend on the plant-virus interaction studied.

For example, ago2 mutants showed increased symptom severity compared to wild type plants when infected with TCV but this was not associated with an increase in the accumulation of viral RNA levels (126). The authors also showed that down regulation of

Ago1 leads to the induction of AGO2, thus acting as a second line of defence. On the other

84 hand, during PVX infection, the virus accumulated to higher levels only in ago2 mutants and not in ago1 mutants indicating that AGO2 does not function as a secondary line of defence against PVX in the absence of AGO1 (131). The results presented in this chapter also suggest a role for Ago2 in ToRSV infection. NbAgo2 silenced plants accumulated higher levels of CP in comparison to the control, NbAgo1 and NbAgo4-silenced plants at 21°C. The exact mechanism and involvement of NbAgo2 during ToRSV infection remains to be elucidated. Further work testing the viral RNA levels in the ToRSV-infected NbAgo1 and

NbAgo2-silenced plants will determine whether the increased accumulation of CP in NbAgo2 silenced plant is concomitant with increased levels of RNA2 and hence will provide more insight into the mechanism involved. ToRSV-infected plants show an induction of NbAgo1 and NbAgo2 mRNA levels although the steady state levels of AGO1 and AGO2 proteins are not known. Hence, further experiments aimed at determining the levels of these AGO proteins will provide more insight into this mechanism. Interestingly, Ago2 was found to be functional against TCV in a temperature-dependent manner (138), where Ago2 was observed to be required for restricting TCV accumulation at high temperatures only. In contrast, in this study a role of NbAgo2 in restricting ToRSV CP accumulation at low temperatures (this chapter) but not at high temperatures (Chapter 2) was observed. Taken together, these results indicate a complex mechanism involving NbAgo1, NbAgo2 and temperature during ToRSV infection.

Chapter 4

Symptom recovery of GYV-infected plants at 21°C is concomitant with low

accumulation of viral products and is not prevented in NbAgo1-silenced

plants

4.1. Introduction

I have shown in Chapter 2 that symptom recovery of plants infected with the Rasp1 isolate of

ToRSV is associated with reduced rate of translation of RNA2 and is dependent on AGO1 indicating a role for RNA silencing in the observed translation repression. This was further supported by the observation that Rasp1-infected plants recovered from infection at higher temperatures (27°C) where RNA silencing is known to be more efficient but not at lower temperatures (21°C). Unlike Rasp1-infected plant, GYV (Grape yellow vein), another isolate of ToRSV, infected plants recovered from infection at both temperatures (232, 261).

In this chapter, I tried to extend the findings on symptom recovery in Rasp1-infected plants to GYV-infected plants and investigate how GYV-infected plants recover from infection at

21°C. I observed that GYV is a milder isolate than Rasp1 at 21°C and that it also accumulates to lower levels compared to Rasp1. Symptom recovery of GYV-infected plants was associated with a reduction in the levels of viral RNAs and CP. In addition, it was also observed that NbAgo1-silencing did not prevent the symptom recovery of GYV-infected plants at 21°C.

4.2. Materials and methods

4.2.1 Virus inoculations

Experiments were performed as described previously in Chapter 2. Virus inoculations were as described (222) in Chapter 2 using Rasp1 isolate from a raspberry field in Washington state, USA and GYV (grape yellow vein) isolate from infected grapevines in California,

USA (261).

4.2.2 Isolation and detection of RNA

Total RNA extraction and Northern experiments were performed as described (222) in

Chapter 2. For detection of viral RNA in Rasp1 and GYV comparison experiments, short oligonucleotide ToRSV 389 (5’GTTGTGAGGGCAACTCGACCGTATCCGAGTAGAC

3’) was end labelled by T4 Kinase (Invitrogen) following the manufacturer’s protocol.

Briefly, for end labelling 10 picomoles of template was incubated with gamma-P32 ATP radioactive isotopes and T4 kinase for 1 hour at 37°C. siRNA detection was performed as described in Chapter 2 or by using oligonucleotide probes ToRSV 389, ToRSV 387

(5’CGGACCAACAAAACCCTGCGAAAACAACGTCCT3’), ToRSV 385 (5’

GTTCGACACTACGAAAGCAATAAAAC 3’).

4.2.3 Isolation and detection of proteins

Preparation of S3 extracts from leaf tissues and immunoblotting were carried out as described in Chapter 2.

4.2.4 VIGS assays

VIGS assays were as described as in Chapter 2.

4.3 Results

4.3.1 GYV induces milder symptoms and recovers from infection at 21°C

Some regions of the GYV genome were sequenced earlier (232, 261) and currently, our lab is sequencing the entire genome of GYV and Rasp1 (unpublished data, Joan Chisholm,

Melanie Walker, Ting Wei, Basudev Ghoshal and Hélène Sanfaçon). Based on the available sequence data, it seems that the GYV sequence is quite different from the Rasp1 sequence.

An earlier study comparing the nucleotide sequence of the VPg, Pro, Pol and CP showed approximately 80% similarity between these regions of the two isolates, which is very similar to our new sequencing data (Table 4.1) (unpublished data, Joan Chisholm, Melanie

Walker, Ting Wei, Basudev Ghoshal and Hélène Sanfaçon) (232, 261). Although, the differences are present at both the amino acid and nucleotide level, they are more significant at the nucleotide level than at the amino acid level (Table 3.1).

To get insight into the recovery of GYV-infected plants, I investigated the kinetics of symptom development and viral product accumulation in GYV-infected plants at 21°C and

27°C. Unlike Rasp1-infected plants (as discussed in Chapter 2 and shown in Fig. 4.1A and

Fig. 4.1B), GYV-infected plants recover from infection at both temperatures (21°C and

27°C) (Fig. 4.1A panel 9 and Fig. 4.1B panel 9).

At 27°C, GYV-infected plants developed symptoms on the inoculated leaves after 2-3 dpi

(Fig. 4.1A panel 5). Upper non-inoculated leaves showed vein clearing symptoms which were prominent by 4 to 5 dpi (Fig. 4.1A panel 6). By 8 dpi, new leaves emerged that were symptomless (recovered leaves) (Fig. 4.1A panel 7, 8).

At 21°C, symptoms developed on the inoculated leaves by 3 to 4 dpi (Fig. 4.1B panel 5) followed by symptoms on the upper non-inoculated leaves by 5 dpi (Fig. 4.1B panel 6, 7).

With the progress of the GYV-infection, new symptomless leaves emerged (Fig 4.1B panel

8) and plants recovered from infection. Although, GYV-infected plants recovered from infection at both temperatures, new asymptomatic leaves did not emerge on GYV-infected plants until 15 dpi at 21°C as opposed to 8 dpi at 27°C. Out of the three independent repeats of this experiment, in one repeat the symptoms on the upper inoculated leaves did not become prominent until 8 dpi at 27°C and 14 dpi at 21°C.

I next examined the accumulation of viral products (viral RNAs and CP) during viral infection in GYV-infected plants at both temperatures. The peptide used to raise the CP- antibody against the central region of the CP as described in Chapter 2 is based on the Rasp1 sequence (Fig 4.2A). The peptide sequence is conserved among the two isolates except at position ten: the GYV CP has an aspartic acid at this position while the Rasp1 CP has a glutamic acid (Fig. 4.2A). As this is a conserved amino acid change it is not predicted to significantly alter the recognition of the antibody epitope, although this remains to be further tested. The RNA probes used in Chapter 2 to detect viral RNA2 were also designed against

Rasp1 and showed only ~75% homology to the cognate GYV sequence. Therefore, I redesigned oligonucleotide probes against a region in the 3’UTR that was conserved among the two isolates (Fig. 4.2B). These sequences are also conserved between RNA1 and RNA2 due to high regions of sequence identity in the two 3’ UTR’s of ToRSV RNA1 and RNA2

(Fig. 4.2 B) (239, 248, 278). Therefore, in contrast to the probe used in Chapter 2 that detected only RNA2, this new probe was predicted to detect both RNAs. However, because

90 of the similar size of the two RNAs (RNA1 ~ 8.2 kb, RNA2 ~ 7.2 kb) they did not clearly separate from each other in agarose gels and both RNAs were usually observed as a single band (Fig 4.2C). At both temperatures, viral CP and RNA accumulated to higher levels early in infection and showed reduced levels of accumulation at late stages of infection. At 27°C, viral RNA accumulated to the highest levels in the symptomatic systemically infected leaves at 5 dpi. Levels of viral RNA decreased starting at 8 dpi and were at their lowest levels in recovered leaves at 15 and 20 dpi. The viral CP also followed the same trend; CP level decreased drastically in systemically infected symptomatic and recovered samples starting at

8 dpi.

At 21°C, similar to 27°C, viral RNAs and CP accumulated to high levels in the systemically infected symptomatic leaves in GYV-infected plants at 5 dpi (Fig. 4.2C). In contrast to

27°C, levels of viral RNA and CP were maintained at similar levels in systemically infected symptomatic leaves at 8 dpi. By 15 dpi, the level of viral RNAs and CP were drastically decreased. The reduction in the accumulation of viral products at 15 dpi was concomitant with the emergence of the recovered leaves.

Since Rasp1-infected plants do not recover from infection at 21°C and show accumulation of viral products throughout the course of infection (Chapter 2), I compared the levels of viral

RNA in the Rasp1-infected plants and GYV-infected plants at 21°C using the probe described above that should recognize both Rasp1 and GYV with equal efficiency. Rasp1 viral RNAs accumulated to similar levels as those of GYV viral RNAs at 5 dpi inoculated leaves (Fig. 4.2D). By 8 dpi Rasp1 viral RNA accumulated to higher levels than GYV. This

91 trend was also observed in Rasp1 and GYV-infected samples at 15 dpi. Taken together, these results indicate that Rasp1 is a more severe isolate than GYV at 21°C and this may be due at least in part to the increased accumulation of viral products in Rasp1-infected plants at this temperature.

GYV/Rasp1 X2 NTB VPg Pro Pol RNA1 MP CP RNA2 3’UTR 3’UTR

Nucleotide 71.5 76.6 79.0 79.1 79.9 68.0 75.2 73.6 71.3

Amino acid 74.1 85.6 96.3 86.6 89.0 - 87.6 84.2 -

Table 4.1: Table showing percentage of sequence similarity at the nucleotide and amino acid level between Rasp1 and GYV.

Figure 4.1: Symptom development and recovery in N. benthamiana plants infected with the ToRSV isolates (Rasp1 or GYV) at 27oC (A) and 21oC (B). Inoculated leaves were photographed 5 dpi (A-1, 5 & B-1, 5). Symptoms on upper non-inoculated leaves are shown at 5 dpi (A- 2, 6 & B- 2, 6), 8 dpi (B- 3, 7) and 20 dpi (B -4); recovered leaves are shown at 8 dpi (A- 3, 7) and 20 dpi (A- 4, 8 & B- 8) for both temperatures. Pictures of entire plants were taken at 20 dpi showing recovery for both GYV- and Rasp1-infected plants at

27°C (panel A-9) and systemic necrosis of Rasp1-infected plants and recovery of GYV- infected plants at 21oC (panel B-9). White bars in the pictures represent a 1cm of a scale.

A Rasp1 - PARLPDILDDKSEV GYV - PARLPDILDEKSEV

Figure 4.2: Accumulation of viral RNA2 and viral CP during the course of infection of

Rasp1 and GYV (A) Sequence alignment of the Rasp1 and GYV CPs in the region of the peptide used to raise the CP-middle antibody. (B) A portion of the 3’ UTR of Rasp1 and

GYV RNA1 and RNA2 that is highly similar among the two RNAs and the two isolates. The red box indicates the region specific to the probe used to detect viral RNA. According to vector NTI sequence pane settings red text on yellow background indicates “identical” nucleotides, black text on a light green background indicates “blocks of similar” nucleotides, dark blue on a light blue background indicates “conservative” nucleotides. C) Northern and

Western blots showing viral RNA and CP accumulation at 27°C and 21°C of GYV-infected plants. D) Northern blots showing viral RNA accumulation at 21°C in Rasp1-and GYV- infected plants. Ethidium bromide staining of rRNAs is shown as loading control for the viral

RNA. Samples were taken from mock-inoculated plants (M) or from inoculated leaves (I), upper systemically infected symptomatic leaves (S) and upper recovered leaves (R) of Rasp1 or GYV-infected plants as indicated above each lane.

4.3.2 Serial dilution of the Rasp1 inoculum does not result in symptom recovery at 21°C

Initial inoculum concentration has been suggested to influence virus accumulation and severity of symptoms in some plant virus interactions (33, 279). Higher concentration of inoculum has also been shown to lead to higher virus titre after infection (279). Rasp1- infected plants developed severe necrosis at 21°C, which is associated with a continuous accumulation of viral CP. At 21°C, RNA silencing is less efficient against Rasp1 than at

27°C as is shown by the low levels of vsiRNA accumulation. It is possible that the Rasp1 inoculum concentration used in my experiments overwhelms the RNA silencing, allowing continued accumulation of the virus. This might in turn lead to severe necrosis and death of the plant. To test this theory, I examined the effect of diluting the initial Rasp1 inoculum during virus infection at 21°C. The initial inoculum was diluted in 5-fold steps: undiluted,

1:5, 1:25, 1:125, 1:625, 1:3125 and inoculated on plants. Symptoms were only observed in plants inoculated with the undiluted inoculum and with the 1:5 and 1:25 dilutions (Fig. 4.3A panel 4, 6, 8). However, the percentage of plants that developed symptoms decreased with increase in the dilution i.e. 100% of plants developed symptoms with undiluted inoculum,

83% of plants with the 1:5 dilution and only 22% with the 1:25 dilution (Table in Fig. 4.3B).

Plants inoculated with further dilutions did not develop symptoms (Fig. 4.3A panel 1, 2, 3).

Analysis of the viral RNA2 accumulation from symptomatic and asymptomatic plants revealed that RNA2 was only detected in symptomatic plants (Fig. 4.3C). This suggested that plants that did not develop symptoms did not get infected. The inverse proportional relationship between the numbers of plants getting infected and the inoculum dilution indicated that a minimum inoculum concentration is required for successful infection.

Interestingly, plants that become infected developed symptoms on the inoculated and

97 systemically infected leaves followed by severe necrosis and high levels of viral RNA2 accumulation (Fig. 4.3A panels 4, 6, 8 and Fig. 4.3C). Symptom recovery was not observed in any of the plants inoculated with diluted Rasp1 inoculum, which initially developed symptoms. These results indicated that the severe necrosis and the death of the plants at

21°C are not solely due to a higher initial concentration of the inoculum compared to GYV.

Figure 4.3: Effect of serial dilution of inoculum on Rasp1 infection. (A) Symptom development in plants infected with different concentrations of Rasp1 inoculum (1:3125,

1:625, 1:125, 1:25, 1:5 and undiluted (UD)). Apical leaves of inoculated plants were photographed at 20 dpi. Plants that developed symptoms on the inoculated and upper non- inoculated leaves eventually become severely necrotic (panel 4, 6, 8). Apical leaves of plants that did not develop symptoms throughout the time period of the experiment (panel 1-3, 5,

7). (B) Table showing percentage of plants that developed symptoms after inoculation with the different dilutions of inoculum (6 plants for undiluted inoculum, 18 plants for each inoculum dilution). (C) Accumulation of viral RNA2 in plants inoculated with different dilutions of inoculum at 20 dpi. Samples described in (A) were processed for viral RNA analysis. Ethidium bromide staining of rRNAs is shown as loading control for the viral RNA

Northern blots. Samples were taken from mock-inoculated plants (M) or from inoculated plants that were symptomatic (S) and asymptomatic (A) as indicated above each lane.

4.3.3 Recovery of GYV-infected plants is associated with an early accumulation of vsiRNAs at 21°C

As discussed in Chapter 2, temperature-dependent recovery of Rasp1-infected plants is associated with a higher accumulation of vsiRNAs. Next, I examined the levels of accumulation of viral derived siRNA in GYV-infected plants at both temperatures. In an attempt to conduct a meaningful comparison of the vsiRNA levels in the plants infected with

GYV or Rasp1, I first used three short oligonucleotide (26-35nt long) sequences complementary to the regions of the 3’UTR identical in both isolates (Fig. 4.2B) as probes.

However, the possibility of detecting vsiRNAs using these probes was very low because these oligonucleotides will bind to a very small group of vsiRNAs derived from the 3’UTR of the viral RNA. As expected, no vsiRNAs were detected using these probes (data not shown). Therefore, to detect vsiRNAs I used the 1 kb long probes designed against the MP and the CP regions of the Rasp1 isolate of ToRSV as used in Chapter 2 and earlier (222).

These regions were found to generate more vsiRNAs in comparison to the other parts of the genome (222). Since the percentage of similarity between the two isolates at the nucleotide level is quite different (Table 4.1) (261), I was not able to compare the relative concentration of vsiRNAs in GYV and Rasp1-infected plants. However, the patterns of siRNA generation during GYV infection at 21°C and 27°C can be compared. VsiRNAs were detected in GYV- infected plants at 27°C and 21°C (Fig. 4.4 A). At 21°C, vsiRNA accumulation initiated earlier (5 dpi) in GYV-infected plants (Fig. 4.4A lane 10, 11) than in Rasp1-infected plants

(Chapter 2, Fig. 2.1D) in spite of the low levels of GYV RNA2 (Fig. 4.2D). These results suggest that at 21°C, RNA silencing is more active against GYV than Rasp1.

100

4.3.4 Symptoms are associated with induction of PR1a and down regulation of RbcS in

GYV-infected plants as observed for Rasp1-infected plants

The induction of other host defence responses during viral infection can vary with the severity of virus isolates as shown for Pepino mosaic virus (PepMV, genus Potexvirus) (201,

204). This difference in the induction of other host defence responses may also explain the difference in outcome of GYV and Rasp1 infection at 21°C. To address this, I examined the levels of induction of PR1a, a host defence gene, during GYV infection. At both temperatures and with both isolates, PR1a was detected only in symptomatic leaves (Fig

4.4B lane 5, 6, 8, 10, 17-21) and not in recovered leaves (Fig 4.4B lane 9, 11, 12, 22 and 23).

At 21°C, there were no significant differences in the levels of PR1a accumulation in GYV and Rasp1-infected plants in symptomatic leaves (Fig. 4.4C).

During virus infection, many host genes are down regulated as a host defence or a viral multiplication strategy as discussed in Chapter 2 (199, 204). RbcS, an important gene of the photosynthetic pathway, was shown to be down-regulated during ToRSV infection, as discussed in Chapter 2 and in another study (198). Levels of RbcS mRNA were down- regulated in GYV-infected plants in the symptomatic leaves (Fig. 4.4B lanes 5-8, 10, 17-21) but RbcS was expressed to similar levels as in mock equivalent plants in recovered leaves

(Fig. 4.4B lanes 9, 11, 12, 22 and 23).

The induction of PR1a and down-regulation of RbcS indicated activation of plant defence responses at both temperatures during GYV infection. Although the levels of expression of

PR1a were similar during Rasp1 and GYV infection at 21oC, the possibility that a small

101 difference in the expression of defence genes can be significant enough to lead to severe necrosis with one isolate and recovery with the other cannot be ruled out. In addition, other host defence genes may show more significant differences in their level of accumulation between Rasp1 and GYV-infected plants.

102

Figure 4.4: Induction of host defence responses during Rasp1 and GYV infection at the two temperatures. Northern blots showing accumulation of viral derived siRNAs (A) PR1a mRNAs and RbcS mRNAs (B) during the course of GYV infection at 27°C and 21°C. C)

Northern blot showing levels of PR1a and RbcS mRNA in Rasp1- and GYV-infected plants at 21°C. Samples were taken from mock-inoculated plants (M) or from inoculated leaves (I), upper symptomatic leaves (S) and upper recovered leaves (R) of GYV-infected plants as indicated above each lane. rRNA is shown as a loading control.

103

4.3.5 Recovery of GYV-infected plants at 21°C is not compromised by the down regulation of NbAgo1- and NbAgo2- like genes

Silencing of NbAgo1 and NbAgo2 genes have been shown to affect Rasp1 infection of N. benthamiana plants in a temperature-dependent manner. It was demonstrated (Chapter 2) that recovery of Rasp1-infected plants is dependent on NbAgo1 at 27°C as NbAgo1-silenced plants did not recover from infection. In contrast, silencing of NbAgo2 and NbAgo4 genes did not affect the recovery from Rasp1-infected plants at 27°C. At 21°C, silencing of

NbAgo2 resulted in increased accumulation of CP (Chapter 3).

Next, I investigated the effect of silencing of NbAgo1 and NbAgo2 in symptom recovery of

GYV-infected plants at 21°C. Plants were silenced for NbAgo1 or NbAgo2 using a TRV vector as described in Chapter 2. These silenced plants as well as control plants were inoculated with GYV and monitored for symptom recovery. All GYV-infected control and silenced plants recovered from infection by 18 dpi (Fig. 4.5A). Although, GYV-infected plants recovered from infection, the level of CP was higher in GYV-infected NbAgo1 and

NbAgo2-silenced plants than in control plants (Fig. 4.5B).

104

Figure 4.5: Effect of GYV infection on plants silenced for NbAgo1 and NbAgo2 genes at

21°C. TRV vectors were used to silence NbAgo1 gene in N. benthamiana. An empty TRV vector (TRV:00) was used as a control. Once silencing was established, plants were inoculated with GYV. A) Symptomatology of GYV-infected (plant on the right of each panel), or mock-inoculated plants (plant on the left of each panel) at 18 dpi. B) Western blot showing CP levels in GYV-infected plants at 18 dpi.

105

4.3.6 GYV provides cross protection to plants against Rasp1

The resistance provided to a plant by a primary infection with a mild isolate to a secondary infection by a closely related severe isolate is known as cross protection (280). RNA silencing is suggested to be the most likely explanation underlying this phenomenon and is dependent on sequence identity between the isolates (2, 221). During virus infection, vsiRNAs are derived from the virus genome of the virus by RNA silencing. These vsiRNAs can guide RISC complex to bind with targets having perfect or near perfect complementarity.

Closely related virus isolates may have similarity in their nucleotide sequence and some parts may be identical. Hence, vsiRNAs generated after a primary infection by a milder isolate can target homologous parts of the viral genome of a severe isolate introduced by secondary infection. As discussed earlier in section 4.2.1, the GYV and Rasp1 sequences are quite different from each other. However, there are regions in the genome of GYV and Rasp1 that are 100% identical, for example some portions of the 3’UTR (Fig. 4.2.B). Therefore, vsiRNAs derived from these identical regions of GYV may provide cross protection to the plants against Rasp1. To investigate whether GYV-infected plants are resistant to Rasp1 infection, plants were first inoculated with GYV, grown at 21oC and allowed to recover.

Control mock-inoculated plants and GYV-recovered plants were then inoculated with Rasp1 and kept at 21oC. After Rasp1 inoculation, plants were monitored for symptom development and coat protein accumulation. Severe necrotic symptoms developed after 13 dpi on control plants (Fig. 4.6A middle panel). In contrast, no symptoms developed in the GYV-recovered plants re-infected with Rasp1 (Fig. 4.6A right panel) during this time period. In accordance with the symptoms, lower levels of CP accumulated in GYV-recovered Rasp1-infected plants (Fig. 4.6B lane 3) than in mock-Rasp1 infected plants (Fig. 4.6B lane 2). These

106 results demonstrate that GYV provides cross protection against Rasp1 and suggest that the defence mechanism (most likely RNA silencing) activated by GYV, is active against Rasp1.

107

Figure 4.6: Cross protection of plants infected with GYV against Rasp1. (A) Symptom development in GYV-recovered and mock control plants 13 days after inoculation with

Rasp1. Apical leaves from plants receiving no inoculation (left), only Rasp1 inoculation

(middle) or both GYV and Rasp1 inoculation (right) are shown. These apical leaves are above the leaves that received the second inoculation in the new-growth of the plant. (B)

Western blots showing steady-state levels of CP in leaves collected 13 days after Rasp1 inoculation. For all time points, apical leaves from several plants were collected and pooled together prior to extraction. Ponceau S staining of RbcL is shown as loading control for the

CP.

108

4.4 Discussion

In this study, I explored the role of RNA silencing in the recovery of GYV-infected plants at

21°C. Consistent with the results of Chapter 2 on symptom recovery of Rasp1-infected plants at 27oC (Fig. 2.1), recovery of GYV-infected plants at 21°C was associated with a reduction in the level of coat protein (Fig. 4.2). However, GYV-infected plants also showed a reduction in the level of the viral RNA. This indicates that unlike Rasp1, GYV viral RNA is not protected, as it accumulates to low levels in the recovered leaves.

Severe necrosis of Rasp1-infected plants at 21°C was associated with a delay in the accumulation of vsiRNA (Fig 2.1D). In contrast, recovery of GYV-infected plants at 21°C was associated with an early accumulation of vsiRNA (Fig. 4.4A). At 21°C, the silencing machinery is less efficient than at 27°C and was predicted to target the viral RNAs less efficiently. However, this explanation alone does not account for the differences observed between GYV and Rasp1 at lower temperature. Indeed, in spite of the lower initial levels of

GYV viral RNA compared to Rasp1, GYV derived vsiRNAs accumulated earlier in infection indicating that Rasp1 can escape or suppress the host silencing machinery at 21°C. As discussed in Chapter 3, the ToRSV CP was recently shown to be a suppressor of silencing that binds to AGO1 and suppresses the translation repression mechanism (260). The Rasp1 and GYV CP may have different efficiency in suppressing silencing and this might be in part responsible for the different outcome of infection at 21°C. Indeed, differences in the activity of silencing suppressors encoded by different isolates of a virus have been reported in other studies (210, 281). For example, the activity of CMV 2b, one of the most well studied suppressors, was found to depend on the strain from which it was encoded. In addition, the

109 suppression activity from the mild and severe strain also correlated with severity of symptoms (210). The difference in suppression activity may also explain the early accumulation of vsiRNA. In plants infected with a suppressor deficient mutant of CMV

(pepo), vsiRNA accumulated earlier in comparison to the wild type virus infected plants

(224).

Unlike Rasp1-infected plants at 27°C, GYV-infected NbAgo1-silenced plants recovered from infection at 21°C. However, similar to Rasp1-infected NbAgo1-silenced plants at 27°C, CP levels accumulated to higher levels in recovered GYV-infected NbAgo1-silenced plants in comparison to control plants. In GYV-infected NbAgo1-silenced plants, although there is a higher level of CP accumulation in comparison to the control plants, the levels of CP present may still be below the threshold level that is required to induce symptoms. Indeed, in temperature shift experiments in Chapter 2, I showed that low levels of accumulation of CP do not induce symptoms. A direct comparison of the CP levels in plants infected with GYV and Rasp1 using antibodies that recognize both isolates with equal efficiency will provide more insight into the mechanism.

Although silencing of NbAgo1 did not prevent recovery of GYV-infected plants at 21°C, it is possible that silencing of NbAgo1 may prevent recovery in GYV-infected plant at 27°C, as observed for Rasp1-infected plants. The higher accumulation of CP in GYV-infected

NbAgo1-silenced plants grown at 21°C indicates that GYV is restricted by NbAgo1, as shown for Rasp1. In addition, NbAgo2-silenced plants also showed higher levels of CP suggesting a role for NbAgo2 in GYV infection, and is consistent with the observation that

110

NbAgo2 restricts Rasp1 accumulation at 21°C. In the silencing experiments, I concentrated on comparing the levels of CP; a comparison of the levels of viral RNAs would be useful to investigate whether GYV RNA is targeted primarily by RNA cleavage or translation repression.

GYV provides cross protection to plants against Rasp1 indicating that a plant defence response (most likely antiviral RNA silencing) is activated against Rasp1 in these plants (Fig

4.6) (221). The cross protection experiment also indicates that Rasp1 is unable to suppress the pre-established antiviral defence initiated by the primary infection of GYV. This is in accordance with an earlier study, where ToRSV was unable to revert pre-established silencing of Green fluorescent protein (GFP) (222).

Taken together, the results indicate that ToRSV-induced symptom recovery is dependent on temperature and ToRSV isolate, as observed in other studies(229). The results of this chapter also raise the possibility that different mechanisms operate in the recovery of Rasp1- infected plants at 27°C or GYV-infected plants at 21°C, although in both cases recovery was accompanied with a reduction in the accumulation of CP.

111

Chapter 5

General discussion

5.1 Introduction

In this research work, I investigated the molecular mechanisms involved in symptom recovery of ToRSV-infected N. benthamiana plants. From this study, it was found that symptom recovery in Rasp1 infected plants grown at 27°C 1) is associated with a drastic reduction in the levels of the RNA2-encoded proteins (MP and CP) but not of the viral

RNA2, 2) is associated with reduced level of translation of viral RNA2, 3) is directly or indirectly dependent on NBAgo1, and 4) is associated with early accumulation of vsiRNAs.

Symptoms were correlated to a HR-like response and PR1a mRNAs were induced in symptomatic leaves but not in the recovered leaves. The temperature-dependent translation repression was partially reversible, and enhanced accumulation of viral CP after a temperature shift was concomitant with a partial re-induction of the HR-like response.

Taken together, these results also suggest that viral proteins rather than viral RNAs induce symptoms in host plants. Further analysis of the expression levels of the silencing pathway genes also showed the induction of NbAgo1 and NbAgo2 in the symptomatic leaves. A possible role of NbAgo2 in Rasp1-infection was evident at 21°C but not at 27°C, as shown by the higher accumulation of CP in NbAgo2-silenced plants at low temperature.

Investigation of symptom recovery of GYV-infected plants at 21°C indicated that recovery can be isolate dependent. Analysis of recovered leaves of GYV-infected plants showed a decrease in the levels of both viral RNA and CP. Furthermore, silencing of NbAgo1 and

NbAgo2 resulted into higher CP accumulation but did not prevent recovery. Therefore, the

112 molecular mechanisms involved in recovery of GYV-infected plants at 21°C may be different from the recovery of Rasp1-infected plants at 27°C. The molecular mechanisms of symptom recovery in light of these results are discussed in the next few sections.

5.2 Molecular insight into the mechanism of ToRSV-induced recovery in N. benthamiana plants

5.2.1 Role of viral derived siRNA in symptom recovery

As observed in other studies, temperature-dependent symptom recovery of Rasp1-infected plants is associated with an increase in the concentration of vsiRNAs at high temperature

(Fig. 2.1, 3.2) (227, 229, 277). VsiRNAs are formed by the action of DCLs on the viral

RNA. vsiRNAs may also be formed by the action of DCLs on dsRNA formed by the activity of host and viral RdRPs on single-strand RNA (122). The increased accumulation of vsiRNAs at high temperature may help increase the efficiency of the silencing mechanism in at least two ways. First, a higher concentration of vsiRNAs will most likely lead to an increased concentration of AGO1 loaded with vsiRNAs that can target the viral RNA (282).

Second, the higher accumulation of vsiRNA also implies a better and faster transport of the silencing signal to uninfected parts of the plant before the virus reaches these cells (i.e. more efficient systemic silencing), which in turn prepares the uninfected cells for antiviral defence response (76, 79, 140). AGO1, RdRP1 and RdRP6 have been shown to be involved in the systemic silencing (119, 139, 140, 142, 143, 283). Plants compromised in RdRP6 and

RdRP1 had no effect on recovery of ToRSV-infected plants (222). In the work of this thesis,

NbAgo1-silenced plants did not recover from Rasp1 infection at 27°C (Fig. 2.3). It is possible that in NbAgo1-silenced plants the AGO1 dependent systemic silencing pathway is

113 inhibited, allowing the virus to reach new leaves ahead of the vsiRNA. This may enable the virus to accumulate to high levels, which might lead to development of severe symptoms.

Silencing of NbAgo1 did not prevent recovery of GYV-infected plants but viral CP accumulated to higher levels than in control plants. As discussed in Chapter 3, the recovery of NbAgo1-silenced plants may be due to the overall low levels of accumulation of GYV CP compared to Rasp1. Alternatively, it is possible that the mechanism of recovery fundamentally differs in response to each isolate or as a function of the temperature. Further experiments studying the effect of silencing NbAgo genes on GYV infection at 27°C will help distinguish between these possibilities.

The accumulation of viral derived small RNAs was found to be temperature and isolate dependent. Rasp1-infected plants showed an increase in the vsiRNA levels at higher temperature and this was associated with recovery (Fig. 2.1). The higher accumulation of vsiRNAs at elevated temperatures in Rasp1-infected plants may be due to an increased activity of RNA silencing enzymes. In many plant-virus interactions, it has been observed that silencing of a host RNA silencing enzyme enhance virus susceptibility more significantly at higher temperatures than at a lower temperature (138, 146). For example,

DCL2, AGO2 and HEN1 were shown to be involved in milder infection of TCV at high temperatures (138). The authors compared the mRNA levels of silencing pathway genes at high and low temperature. However, no difference in the expression levels of these genes was observed. Consistent with this study, work in this thesis (Chapter 3) on the investigation of the mRNA levels of NbAgo1, NbAgo2 and NbAgo4 at 21°C and 27°C did not show significant differences in their level of accumulation. However, we cannot rule out the

114 possibility that other host silencing enzymes may be important during Rasp1 infection. On the other hand, GYV-infected plants that show recovery at both high and low temperatures did not show significant differences in the level of vsiRNA with a rise in temperature (Fig.

4.4). This has also been reported in other plant virus interaction (229).

The timing of accumulation of vsiRNAs can also influence the outcome of virus infection.

For example, CMV (Pepo)-infected plants invade shoot apical meristems and induce severe symptoms. On the other hand, their suppressor deficient mutants induce milder infections

(226). A comparison of vsiRNA accumulation in plants infected with the wild type and mutant CMV (Pepo) viruses showed earlier accumulation of vsiRNA in the mutants (224).

Similarly, GYV-infected plants at 21°C that recover from infection showed early accumulation of vsiRNAs in comparison to Rasp1-infected plants that do not recover from infection. Therefore, both early and higher accumulation of vsiRNA may be important for symptom recovery.

5.2.2 Reduced rate of translation and symptom recovery - a novel mechanism in recovery

Translation repression of Rasp1 RNA2 is associated with symptom recovery and is relieved in RNA silencing compromised conditions (see Chapter 2 section 2.3.3 for more details). In this study, I was not able to provide direct evidence of AGO1 binding with viral RNA leading to translation repression because of the unavailability of antibodies with strong affinity or specificity to NbAgo1. However, the higher rate of translation of Rasp1 RNA2 in the NbAgo1-silenced plants compared to that in control plants indicates a role of RNA

115 silencing in this repression. AGO1 has been shown to mediate both RNA slicing and translation repression in plants (137, 160). However, the exact mechanism determining the mode of activity of AGO1 is not yet clear.

Several possible explanations have been put forward for the regulation of AGO1 cleavage and repression activity (discussed in details in section 1.4.2), which may be extended to the translation repression of Rasp1 RNA2 (Fig 2.2). First, AGO1 activity can be regulated by post-translational modification (164). An intriguing hypothesis is that AGO1 may be structurally modified during Rasp1 infection resulting in translation repression instead of cleavage of the target. A second possible explanation is that the spatial distribution of AGO1 influences its activity. Plant AGO1 has been suggested to be present in two pools- one loaded with miRNAs and the other with siRNAs (171). Hence, different isoforms of AGO1 may be located in different subcellular locations loaded with different types of small RNA and that may vary in their activity. In N. benthamiana plants, two different isoforms of

AGO1 exist (139). These two isoforms of AGO1 may have different subcellular localization and different modes of function. However, this needs to be experimentally verified. In this study, I used a VIGS vector that targeted both AGO1 isoforms. Future work using VIGS vectors targeting each isoform will give us more insight into their mechanism of action.

Translation repression of miRNA mediated silencing in plants was shown to occur in association with the endoplasmic reticulum (172), which was suggested to be the site for translation repression. Interestingly, studies on membrane bound proteins of ToRSV indicate that the site for ToRSV RNA replication is the endoplasmic reticulum (243, 246, 247).

Combining this data, it is tempting to hypothesize that after being released from the ER

116 membrane bound replication complex, the ToRSV(Rasp1) RNA2 is targeted and bound by

AGO1 present in the close vicinity of the ER (site for translation repression) (Fig. 5.1). This

AGO1 bound viral RNA may become translationally repressed and may be unavailable to the

AGO1 pool present in the cytoplasm, where cleavage of the target is predominant (172). It is also possible that AGO1 bound viral RNA is sequestered in cytoplasmic granules (most likely P bodies) and hence may not be available for cleavage, as is observed with FHV (181).

In animal cells, mRNAs undergoing miRNA mediated translation repression due to environmental stress can be relieved of translation repression and are released from the cytoplasmic P bodies upon the removal of the stress (175, 268). Similarly, in temperature shift experiments in Chapter 2, a slight increase in the level of CP was observed indicating a partial relief of translation repression (Fig. 2.4). Further experiments, such as localization studies of viral RNA undergoing translation repression in protoplasts may provide more insight into this mechanism.

Apart from its possible direct interaction with viral RNA2 during translation repression, there can be at least one more explanation for AGO1 activity. AGO1 regulates the expression of different types of defence response genes such as R genes using small RNAs (148, 149, 151,

153). Therefore, AGO1 might regulate the expression of defence related genes during Rasp1 infection. It is possible that such defence related genes are also induced during virus infection leading to translation repression of the viral RNA. Indeed translation repression of

PVX has been demonstrated in association with an R gene mediated defence response (127), although the translation repression of PVX was dependent on NbAgo4 and not on NbAgo1.

In this thesis, I show that Rasp1-infected NbAgo4-silenced plants recovered from infection

117 and showed reduction of viral CP similar to that observed in control plants (Fig. 2.3). Thus the translation repression of Rasp1 at 27°C seems to be fundamentally different from that observed for PVX following induction of the R gene pathway. Also silencing of NbSgt1 did not prevent the translation repression, or the recovery, of Rasp1-infected plants. NbSgt1 is involved in the R gene mediated defence response and was shown to be essential for the R gene mediated translation repression of PVX (265, 284). .

The vsiRNAs may play a role in translation repression, as they may regulate the activity of

RISC complexes by either having mismatches with their target or by inducing structural changes in the AGO1 (69, 159). It is possible that some of the vsiRNAs originate from the imperfect secondary stem loop structures in the viral genome. vsiRNAs derived from such stem loops are predicted to have mismatches with their target and hence could cause translation repression (156). However, at this time, this is only a speculation. Sequencing of vsiRNAs and identifying specific vsiRNA(s) involved in targeting of Rasp1-genome will give us better insight on the translation repression mechanism involved in the Rasp1 induced symptom recovery. Another interesting possibility is that a plant-genome encoded microRNA targets the ToRSV RNA leading to translation repression. In animal cells, miRNA encoded from the host genome have been identified that target viral genomes, such as HCV and HIV, which harbour the miRNA targets. These viruses have a latent or persistent phase of infection and the host encoded miRNAs target the viral genomes to repress virus replication and also keep viral accumulation to low levels. This in turn allows the virus to reside within the cell without activating the interferon response (178, 179).

118

Fig. 5.1 Model showing probable pathways for translation repression of the viral

RNA2. ToRSV viral RNA progeny are formed in spherules on the ER and positive-sense single-strand viral RNA2 is released after its synthesis (1). At this stage, viral RNA can be targeted by AGO1 present in close vicinity of ER (2) and/or post translationally modified

AGO1 (3). The translationally repressed viral RNA bound to RISC complex may be present in the P bodies (4). This action separates the viral RNA2 from AGO1 present in the cytoplasm that is most likely responsible for cleavage of the targeted RNA (5).

119

The reduced rate of translation observed in the Rasp1-infected recovered leaves raises the question as to how the virus is maintained in the recovered leaves. The partial increase in the level of CP after temperature shift without induction of visual symptoms (Fig 2.4) indicates that a minimum threshold of viral CP is required before it can cause severe damage to the host. For maintenance of the viral RNA, replication proteins are required but only in low levels for viral RNA replication (285). Hence, the replication proteins may be in sufficient concentration to synthesize viral RNA without reaching the threshold level that could induce symptoms. In this study, I concentrated mostly on the translation state of viral RNA2 and CP accumulation. Hence, further experiments on the translation state of the viral RNA1 (when good antibodies against replication proteins become available) will increase our understanding of this mechanism.

The RNA2 encoded proteins are required for assembly and movement of the virus. ToRSV produces two different types of virus particles – full and empty. Full virus particles are packaged with viral RNA while the empty virus particles do not contain any viral RNA. A decrease in the level of CP will most likely lead to an increase in the ratio of RNA to CP and thus increase the number of complete virus particles. Indeed, in preliminary studies to determine the ratio of full to empty virus particles in symptomatic and recovered leaves using immune-capture and transmission electron microscopy of virus particles, I observed that that there is a higher full to empty virus particle ratio in recovered leaves then in symptomatic leaves (data not shown). Thus it seems that translation repression of the viral RNA2 may be beneficial for the virus.

120

5.2.3 Symptom recovery and the possible role of a ToRSV encoded suppressor of silencing

Weak silencing suppressors and their transient activities have been suggested to be important for meristem entry of the virus and in recovery of virus infected plants (223, 224). Recently, our lab has shown that ToRSV CP is a suppressor of RNA silencing (260). ToRSV CP was found to inhibit the translation repression of the GFP reporter gene but did not prevent slicing of this RNA. The CP was also shown to destabilize a subpopulation of AGO1. The silencing suppression and the destabilization of AGO1 were shown to be dependent on a GW motif present in the CP. The GW motif of ToRSV CP is predicted to be exposed only in the

CP subunits but not in the assembled virus particles (260). Hence, the silencing suppression activity of CP may only be transient during ToRSV infection. This is consistent with the observation that ToRSV is able to partially hinder the systemic silencing but is unable to completely prevent it (222). Similar to other studies, it is tempting to speculate that this transient activity of ToRSV CP may play a role in symptom recovery. Karran and Sanfaçon

(2014) performed their experiments at 21°C, under these conditions Rasp1-infected plants do not recover from infection. Examining the silencing suppression activities of ToRSV in conditions (27°C) in which plants recover from infection will be helpful in dissecting the role of ToRSV suppressor in symptom recovery. In addition, in this study, a CP sequence from

PYB (Peach yellow bud) isolate of ToRSV was used. At the amino acid level, all three isolates (GYV, PYB and Rasp1) have a conserved GW motif in their CP; with PYB CP showing 84.5% and 97.7% sequence similarity with GYV and Rasp1 CP, respectively

(unpublished data Melanie Walker and Hélène Sanfaçon). A comparison of the suppression activity of CP from the three isolates at 27°C and 21°C will increase our understanding of the

121 differences in outcomes observed in the interaction between various ToRSV-isolates and N. benthamiana.

5.3 Biological relevance of the translation repression mechanism-impact on the virus and on the plant

5.3.1 Maintaining the host in order to maintain the virus

Viruses are obligate parasites and rely on the host for their multiplication (36, 38, 286, 287).

Within the host, viruses may be targeted by the host defence response and need to evade or suppress this response, for their successful infection (19, 26, 45, 288-291). It has been already proposed that excessive suppression/evasion of the defence response may lead to over accumulation of the virus causing severe damage to the host (223). On the other hand, inefficiency in suppression activity may lead to clearance of the virus. Therefore, an appropriate balance between the suppression/evasion and induction of host defence response, leading to minimal damage caused to the host without clearance of the virus would seem to be the ideal condition for symptom recovery. This balancing act may function as a driving force for virus evolution during symptom recovery. In addition, viruses also evolve to make their biological processes more efficient. The findings of this thesis are discussed below in light of these concepts.

ToRSV is transmitted by seeds, pollen grains and by nematodes (235). For efficient transmission through seeds and pollen grains, the virus needs to enter the shoot apical meristem and maintain itself without inducing defence responses or causing damage to the plant. Two possible scenarios can be envisioned that might help viruses enter and

122 accumulate in the meristem. First, it has been proposed that the virus may maintain itself at very low levels and hence escape recognition by the plant defence response (228). This might be the case during recovery of TBRV and TRV and GYV-infected plants as there is a drastic decrease in the level of the viral RNA (2, 223). The second scenario is that viral RNA is present in the meristem but is not translated into proteins that may trigger HR. This may be the case during recovery of Rasp1-infected plants. Indeed the repression and induction of

PR1a expression was in correlation with the low levels of viral proteins in the recovered leaves and their partial increase after the temperature shift. Thus, Rasp1 may have adapted to its host by becoming susceptible to translation repression as a novel mechanism(s) to escape the induction of HR-like response. In addition, the high level of viral RNA in recovered leaves, and most likely in the meristem, may increase the chance of seed or pollen grain transmission, which would decrease with viral RNA clearance.

On the other hand, in non-recovery type conditions such as low temperature, the death of the plant will be harmful for the transmission of the virus through the seeds and the pollen grains. In these conditions, nematode transmission may be the most likely mode of virus transmission.

5.3.2 Maintaining the virus might be beneficial to the host

From the above sections, it seems that translation repression of the viral RNA might be beneficial to the virus. This mechanism may also be beneficial to the host plants. Symptom recovery is associated with cross protection of recovered plants, which is most likely due to the silencing mechanism. For the maintenance of an efficient RNA silencing mechanism, the

123 target must be available for the production of small RNAs. In ToRSV- infected plants, maintenance of the viral RNA provides a constant source for the synthesis of vsiRNA. It might also increase the chance of transmission of the viral RNA and the siRNA through seeds and pollens, thus providing resistance (cross protection) to the newly germinating seedlings. These infected seeds may germinate in early spring under low temperature conditions. In this situation, infection by a severe isolate (Rasp1) would cause severe necrosis on host plants that has never seen the virus before. However, in ToRSV-infected seedlings, the viral RNA may act as a source of vsiRNA that prime the plants for antiviral defence against closely related viruses. Indeed, in virus induced gene silencing studies it has been reported that the silencing of host genes can be passed on and maintained in the next generation (292). Apart from providing cross protection, some virus infected-plants are found to be tolerant to different types of stresses such as drought, cold, heat and this tolerance has been attributed to the presence of the virus in these plants (293).

5.4 Model for ToRSV induced recovery

This study increases our understanding of symptom recovery of ToRSV-infected N. benthamiana plants and provides evidence for translation repression, most likely by the RNA silencing mechanism, as a contributor to recovery. Based on the above information, it seems that recovery is probably a result of a combination of events. A model is proposed for symptom recovery and non-recovery condition (Fig. 5.2) of ToRSV-infected plants.

During recovery, e.g. at 27°C, ToRSV multiplies in the inoculated leaves and then moves to the other parts of the plant (Fig. 5.2 step 1, 4). Viral products induce host defence responses

124 and symptoms develop (Fig. 5.2 step 1). RNA silencing mechanism targets the viral genome to form vsiRNAs, which are also transported to the other parts of the plant (Fig. 5.2 step 2).

The ToRSV CP may initially help the virus enter into the meristem as well as regulate the level of RNA silencing so that the virus is not cleared away (Fig. 5.2 step 3). In the systemically infected leaves, the virus multiplies to high levels (Fig. 5.2 step 5). In accordance, the vsiRNAs are also produced at high levels and are transferred to the other parts of the plant (Fig. 5.2 step 6). In the upper recovered leaves, AGO1 is most likely already loaded with vsiRNAs. The virus is unable to synthesize its proteins (Fig. 5.2 step 9) due to AGO1 activity (Fig. 5.2 step 10) leading to low levels of viral protein accumulation.

The low levels of viral protein do not induce symptom (Fig. 5.2 step 11). On the other hand, at 21°C, the RNA silencing mechanism is less efficient. ToRSV CP is able to inhibit this weak RNA silencing mechanism more efficiently and suppress translation repression. The suppressor may also block the movement of the silencing signal. Perhaps a cumulative effect of these actions prevents the upper non-inoculated leaves from being primed for the antiviral defence response, as is observed at 27°C. This leads to continuous accumulation of the viral proteins, which in turn induces defence responses leading to symptom development and death of the plant (Fig. 5.2 step 16, 20). Recovery of GYV-infected plants at this temperature may be explained by the presence of a weaker suppressor that is not able to counteract RNA silencing at 21°C, although this will need to be tested. In conclusion, our results identify translation repression as a responsive mechanism regulating symptom development and maintenance in ToRSV-infected plants. Combined with earlier studies that established a link between viral RNA clearance and recovery in other plant-nepovirus

125 interactions (2, 228), the results also indicate that several distinct mechanisms can cause the onset of symptom recovery in nepovirus-infected plants.

126

Figure 5.2: Figure legend on next page.

127

Figure 5.2: Proposed model for symptom recovery and non-recovery of ToRSV- infected N. benthamiana plants. Top three panels show model for symptom recovery at

27°C and bottom three panels show ToRSV infection at 21°C. 1) Viral protein accumulation and induction of defence responses leading to symptom development, 2) production of siRNA and their transport, 3) partial suppression of RNA silencing shown by dotted red lines by CP, 4) transport of virus to other parts of the plant via plasmodesmata, 5-8) repeat of steps

1-4 in the upper symptomatic leaves, 9) translation of the viral RNA2, 10) inhibition of translation, 11) low levels of viral protein accumulation and no symptom development. At

21°C, 12) viral protein lead to symptom development, 13) low levels of vsiRNA and less efficient transport of vsiRNA, 14) strong suppression of the weak RNA silencing mechanism by CP, 15) transport of virus to other plant parts of the plant, 16-23) repeat of steps 12-15 but in the upper symptomatic leaves. Continuous accumulation of viral proteins in the upper non- inoculated leaves leads to continuous induction of symptoms.

128

Bibliography

1. Wingard SA. 1928. Hosts and symptoms of ring spot, a virus disease of plants. J.

Agric. Res. 37:127-153.

2. Ratcliff F, Harrison BD, Baulcombe DC. 1997. A similarity between viral defense

and gene silencing in plants. Science 276:1558-1560.

3. Cadman CH. 1959. Studies on the properties of soil-borne viruses of the tobacco-

rattle type occurring in Scotland. Ann. appl. Biol. 47:542-546.

4. Ross AF. 1941. The concentration of alfalfa-mosaic virus in tobacco plants at

different periods of time after inoculation. Phytopathology 31:410-421.

5. Xin HW, Ding SW. 2003. Identification and molecular characterization of a naturally

occurring RNA virus mutant defective in the initiation of host recovery. Virology

317:253-262.

6. Covey SN, Al-Kaff NS, Langara A, Turner DS. 1997. Plants combat infection by

gene silencing. Nature 385:781-782.

7. Chellappan P, Vanitharani R, Pita J, Fauquet CM. 2004. Short interfering RNA

accumulation correlates with host recovery in DNA virus-infected hosts, and gene

silencing targets specific viral sequences. J. Virol. 78:7465-7477.

8. Baulcombe D. 2004. RNA silencing in plants. Nature 431:356-363.

9. Tang G, Zamore PD. 2004. Biochemical dissection of RNA silencing in plants.

Methods Mol. Biol. 257:223-244.

10. Voinnet O. 2002. RNA silencing: small RNAs as ubiquitous regulators of gene

expression. Curr. Opin. Plant Biol. 5:444-451.

129

11. Neilson JR, Sharp PA. 2008. Small RNA regulators of gene expression. Cell

134:899-902.

12. Brodersen P, Voinnet O. 2006. The diversity of RNA silencing pathways in plants.

Trends Genet. 22:268-280.

13. Ghildiyal M, Zamore PD. 2009. Small silencing RNAs: an expanding universe. Nat.

Rev. Genet. 10:94-108.

14. Eamens A, Wang MB, Smith NA, Waterhouse PM. 2008. RNA silencing in plants:

yesterday, today, and tomorrow. Plant Physiol. 147:456-468.

15. Hannon GJ. 2002. RNA interference. Nature 418:244-251.

16. Meins F, Si-Ammour A, Blevins T. 2005. RNA silencing systems and their

relevance to plant development. Annu. Rev. Cell Dev. Biol. 21:297-318.

17. van Wolfswinkel JC, Ketting RF. 2010. The role of small non-coding RNAs in

genome stability and chromatin organization. J. Cell Sci. 123:1825-1839.

18. Pelaez P, Sanchez F. 2013. Small RNAs in plant defense responses during viral and

bacterial interactions: similarities and differences. Front Plant Sci 4:343.

19. Pumplin N, Voinnet O. 2013. RNA silencing suppression by plant pathogens:

defence, counter-defence and counter-counter-defence. Nat. Rev. Microbiol. 11:745-

760.

20. Voinnet O. 2001. RNA silencing as a plant immune system against viruses. Trends

Genet. 17:449-459.

21. Agius C, Eamens AL, Millar AA, Watson JM, Wang MB. 2012. RNA silencing

and antiviral defense in plants. Methods Mol. Biol. 894:17-38.

130

22. Pantaleo V. 2011. Plant RNA silencing in viral defence. Adv. Exp. Med. Biol.

722:39-58.

23. Ding SW, Voinnet O. 2007. Antiviral immunity directed by small RNAs. Cell

130:413-426.

24. Ding SW. 2010. RNA-based antiviral immunity. Nat Rev Immunol 10:632-644.

25. Wang MB, Masuta C, Smith NA, Shimura H. 2012. RNA silencing and plant viral

diseases. Mol. Plant-Microbe Interact. 25:1275-1285.

26. Burgyan J, Havelda Z. 2011. Viral suppressors of RNA silencing. Trends plant sci.

16:265-272.

27. Moissiard G, Voinnet O. 2004. Viral suppression of RNA silencing in plants. Mol

Plant Pathol. 5:71-82.

28. Diaz-Pendon JA, Ding SW. 2008. Direct and indirect roles of viral suppressors of

RNA silencing in pathogenesis. Annu. Rev. Phytopathol. 46:303-326.

29. Voinnet O. 2005. Induction and suppression of RNA silencing: insights from viral

infections. Nat. Rev. Genet. 6:206-220.

30. Csorba T, Pantaleo V, Burgyan J. 2009. RNA silencing: an antiviral mechanism.

Adv. Virus Res. 75:35-71.

31. Voinnet O, Pinto YM, Baulcombe DC. 1999. Suppression of gene silencing: a

general strategy used by diverse DNA and RNA viruses of plants. Proc. Natl. Acad.

Sci. USA 96:14147-14152.

32. Pallas V, Garcia JA. 2011. How do plant viruses induce disease? Interactions and

interference with host components. J. Gen. Virol. 92:2691-2705.

33. Hull R. 2002. Matthew's plant virology, 4th ed. Academic Press, San Diego.

131

34. Maule A, Leh V, Lederer C. 2002. The dialogue between viruses and hosts in

compatible interactions. Curr. Opin. Plant Biol. 5:279-284.

35. Laliberte JF, Sanfacon H. 2010. Cellular remodeling during plant virus infection.

Annu Rev Phytopathol 48:69-91.

36. Dreher TW, Miller WA. 2006. Translational control in positive strand RNA plant

viruses. Virology 344:185-197.

37. Patarroyo C, Laliberte JF, Zheng H. 2012. Hijack it, change it: how do plant

viruses utilize the host secretory pathway for efficient viral replication and spread?

Front Plant Sci 3:308.

38. Walsh D, Mathews MB, Mohr I. 2013. Tinkering with translation: protein synthesis

in virus-infected cells. Cold Spring Harbor perspectives in biology 5:a012351.

39. Sanfacon H. 2005. Replication of positive-strand RNA viruses in plants: Contact

points between plant and virus components. Can. J. Bot. 83:1529-1549.

40. Miller S, Krijnse-Locker J. 2008. Modification of intracellular membrane structures

for virus replication. Nat. Rev. Microbiol. 6:363-374.

41. Harries PA, Schoelz JE, Nelson RS. 2010. Intracellular transport of viruses and

their components: utilizing the cytoskeleton and membrane highways. Mol. Plant-

Microbe Interact. 23:1381-1393.

42. Schoelz JE, Harries PA, Nelson RS. 2011. Intracellular transport of plant viruses:

finding the door out of the cell. Mol. Plant 4:813-831.

43. Benitez-Alfonso Y, Faulkner C, Ritzenthaler C, Maule AJ. 2010. Plasmodesmata:

gateways to local and systemic virus infection. Mol. Plant-Microbe Interact. 23:1403-

1412.

132

44. Mandadi KK, Scholthof KB. 2013. Plant immune responses against viruses: how

does a virus cause disease? Plant Cell 25:1489-1505.

45. Soosaar JL, Burch-Smith TM, Dinesh-Kumar SP. 2005. Mechanisms of plant

resistance to viruses. Nat. Rev. Microbiol. 3:789-798.

46. Zvereva AS, Pooggin MM. 2012. Silencing and innate immunity in plant defense

against viral and non-viral pathogens. Viruses 4:2578-2597.

47. Ding SW, Li H, Lu R, Li F, Li WX. 2004. RNA silencing: a conserved antiviral

immunity of plants and animals. Virus Res. 102:109-115.

48. Napoli C, Lemieux C, Jorgensen R. 1990. Introduction of a Chimeric Chalcone

Synthase Gene into Petunia Results in Reversible Co-Suppression of Homologous

Genes in trans. Plant Cell 2:279-289.

49. Matzke MA, Primig M, Trnovsky J, Matzke AJ. 1989. Reversible methylation and

inactivation of marker genes in sequentially transformed tobacco plants. EMBO J.

8:643-649.

50. Lindbo JA, Dougherty WG. 1992. Untranslatable transcripts of the tobacco etch

virus coat protein gene sequence can interfere with tobacco etch virus replication in

transgenic plants and protoplasts. Virology 189:725-733.

51. Lindbo JA, Silva-Rosales L, Proebsting WM, Dougherty WG. 1993. Induction of

a highly specific antiviral state in transgenic plants: implications for regulation of

gene expression and virus resistance. Plant Cell 5:1749-1759.

52. Dougherty WG, Lindbo JA, Smith HA, Parks TD, Swaney S, Proebsting WM.

1994. RNA-mediated virus resistance in transgenic plants: exploitation of a cellular

133

pathway possibly involved in RNA degradation. Mol. Plant-Microbe Interact. 7:544-

552.

53. Cullen BR. 2005. RNAi the natural way. Nat. Genet. 37:1163-1165.

54. Chang SS, Zhang Z, Liu Y. 2012. RNA interference pathways in fungi: mechanisms

and functions. Annu. Rev. Microbiol. 66:305-323.

55. Ambros V. 2003. MicroRNA pathways in flies and worms: growth, death, fat, stress,

and timing. Cell 113:673-676.

56. Elbashir SM, Lendeckel W, Tuschl T. 2001. RNA interference is mediated by 21-

and 22-nucleotide RNAs. Genes Dev. 15:188-200.

57. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. 2001.

Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian

cells. Nature 411:494-498.

58. Svoboda P, Stein P, Hayashi H, Schultz RM. 2000. Selective reduction of dormant

maternal mRNAs in mouse oocytes by RNA interference. Development 127:4147-

4156.

59. Tang G, Reinhart BJ, Bartel DP, Zamore PD. 2003. A biochemical framework for

RNA silencing in plants. Genes Dev. 17:49-63.

60. Lindbo JA. 2012. A historical overview of RNAi in plants. Methods Mol. Biol.

894:1-16.

61. Baulcombe D. 2005. RNA silencing. Trends Biochem. Sci. 30:290-293.

62. Fagard M, Vaucheret H. 2000. (Trans)Gene silencing in plants: how many

mechanisms? Annu. Rev. Plant Physiol. Plant Mol. Biol. 51:167-194.

134

63. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. 1998. Potent

and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.

Nature 391:806-811.

64. Zamore PD, Tuschl T, Sharp PA, Bartel DP. 2000. RNAi: double-stranded RNA

directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell

101:25-33.

65. Liu Q, Feng Y, Zhu Z. 2009. Dicer-like (DCL) proteins in plants. Funct. Integr.

Genomics 9:277-286.

66. Bernstein E, Caudy AA, Hammond SM, Hannon GJ. 2001. Role for a bidentate

ribonuclease in the initiation step of RNA interference. Nature 409:363-366.

67. Li J, Yang Z, Yu B, Liu J, Chen X. 2005. Methylation protects miRNAs and

siRNAs from a 3'-end uridylation activity in Arabidopsis. Curr. Biol. 15:1501-1507.

68. Yu B, Yang Z, Li J, Minakhina S, Yang M, Padgett RW, Steward R, Chen X.

2005. Methylation as a crucial step in plant microRNA biogenesis. Science 307:932-

935.

69. Cenik ES, Zamore PD. 2011. Argonaute proteins. Curr. Biol. 21:R446-449.

70. Kaya E, Doudna JA. 2012. Biochemistry. Guided tour to the heart of RISC. Science

336:985-986.

71. Hutvagner G, Simard MJ. 2008. Argonaute proteins: key players in RNA silencing.

Nat. Rev. Mol. Cell Biol. 9:22-32.

72. Poulsen C, Vaucheret H, Brodersen P. 2013. Lessons on RNA silencing

mechanisms in plants from eukaryotic argonaute structures. Plant Cell 25:22-37.

135

73. Aufsatz W, Mette MF, van der Winden J, Matzke AJ, Matzke M. 2002. RNA-

directed DNA methylation in Arabidopsis. Proc. Natl. Acad. Sci. USA 99 Suppl

4:16499-16506.

74. Voinnet O. 2008. Use, tolerance and avoidance of amplified RNA silencing by

plants. Trends Plant Sci. 13:317-328.

75. Molnar A, Melnyk CW, Bassett A, Hardcastle TJ, Dunn R, Baulcombe DC. 2010.

Small silencing RNAs in plants are mobile and direct epigenetic modification in

recipient cells. Science 328:872-875.

76. Molnar A, Melnyk C, Baulcombe DC. 2011. Silencing signals in plants: a long

journey for small RNAs. Genome Biol. 12:215.

77. Melnyk CW, Molnar A, Baulcombe DC. 2011. Intercellular and systemic

movement of RNA silencing signals. EMBO J. 30:3553-3563.

78. Dunoyer P, Brosnan CA, Schott G, Wang Y, Jay F, Alioua A, Himber C, Voinnet

O. 2010. An endogenous, systemic RNAi pathway in plants. Embo J. 29:1699-1712.

79. Dunoyer P, Schott G, Himber C, Meyer D, Takeda A, Carrington JC, Voinnet O.

2010. Small RNA duplexes function as mobile silencing signals between plant cells.

Science 328:912-916.

80. Voinnet O. 2005. Non-cell autonomous RNA silencing. FEBS letters 579:5858-5871.

81. Willmann MR, Endres MW, Cook RT, Gregory BD. 2011. The functions of RNA-

dependent RNA polymerases in Arabidopsis, The Arabidopsis Book, vol. 9.

82. Casas-Mollano JA, Rohr J, Kim EJ, Balassa E, van Dijk K, Cerutti H. 2008.

Diversification of the core RNA interference machinery in Chlamydomonas

reinhardtii and the role of DCL1 in transposon silencing. Genetics 179:69-81.

136

83. Nakasugi K, Crowhurst RN, Bally J, Wood CC, Hellens RP, Waterhouse PM.

2013. De novo transcriptome sequence assembly and analysis of RNA silencing

genes of Nicotiana benthamiana. PloS one 8:e59534.

84. Kapoor M, Arora R, Lama T, Nijhawan A, Khurana JP, Tyagi AK, Kapoor S.

2008. Genome-wide identification, organization and phylogenetic analysis of Dicer-

like, Argonaute and RNA-dependent RNA Polymerase gene families and their

expression analysis during reproductive development and stress in rice. BMC

Genomics 9:451.

85. Bai M, Yang GS, Chen WT, Mao ZC, Kang HX, Chen GH, Yang YH, Xie BY.

2012. Genome-wide identification of Dicer-like, Argonaute and RNA-dependent

RNA polymerase gene families and their expression analyses in response to viral

infection and abiotic stresses in Solanum lycopersicum. Gene 501:52-62.

86. Mukherjee K, Campos H, Kolaczkowski B. 2012. Evolution of animal and plant

dicers: early parallel duplications and recurrent adaptation of antiviral RNA binding

in plants. Mol. Biol. Evol. 30:627-641.

87. Mallory A, Vaucheret H. 2010. Form, function, and regulation of ARGONAUTE

proteins. Plant cell 22:3879-3889.

88. Bohmert K, Camus I, Bellini C, Bouchez D, Caboche M, Benning C. 1998. AGO1

defines a novel locus of Arabidopsis controlling leaf development. EMBO J. 17:170-

180.

89. Fagard M, Boutet S, Morel JB, Bellini C, Vaucheret H. 2000. AGO1, QDE-2, and

RDE-1 are related proteins required for post-transcriptional gene silencing in plants,

137

quelling in fungi, and RNA interference in animals. Proc. Natl. Acad. Sci. USA

97:11650-11654.

90. Morel JB, Godon C, Mourrain P, Beclin C, Boutet S, Feuerbach F, Proux F,

Vaucheret H. 2002. Fertile hypomorphic ARGONAUTE (ago1) mutants impaired in

post-transcriptional gene silencing and virus resistance. Plant Cell 14:629-639.

91. Jinek M, Doudna JA. 2009. A three-dimensional view of the molecular machinery

of RNA interference. Nature 457:405-412.

92. Meister G. 2013. Argonaute proteins: functional insights and emerging roles. Nature

reviews. Genetics 14:447-459.

93. Vaucheret H. 2008. Plant ARGONAUTES. Trends Plant Sci. 13:350-358.

94. Ng KK, Arnold JJ, Cameron CE. 2008. Structure-function relationships among

RNA-dependent RNA polymerases. Curr. Top. Microbiol. Immunol. 320:137-156.

95. Schiebel W, Haas B, Marinkovic S, Klanner A, Sanger HL. 1993. RNA-directed

RNA polymerase from tomato leaves. I. Purification and physical properties. J. Biol.

Chem. 268:11851-11857.

96. Schiebel W, Pelissier T, Riedel L, Thalmeir S, Schiebel R, Kempe D, Lottspeich

F, Sanger HL, Wassenegger M. 1998. Isolation of an RNA-directed RNA

polymerase-specific cDNA clone from tomato. Plant Cell 10:2087-2101.

97. Qin C, Shi N, Gu M, Zhang H, Li B, Shen J, Mohammed A, Ryabov E, Li C,

Wang H, Liu Y, Osman T, Vatish M, Hong Y. 2012. Involvement of RDR6 in short-

range intercellular RNA silencing in Nicotiana benthamiana. Sci Rep 2:467.

138

98. Salgado PS, Koivunen MR, Makeyev EV, Bamford DH, Stuart DI, Grimes JM.

2006. The structure of an RNAi polymerase links RNA silencing and transcription.

PLoS biology 4:e434.

99. Smardon A, Spoerke JM, Stacey SC, Klein ME, Mackin N, Maine EM. 2000.

EGO-1 is related to RNA-directed RNA polymerase and functions in germ-line

development and RNA interference in C. elegans. Curr. Biol. 10:169-178.

100. Cogoni C, Macino G. 1999. Gene silencing in Neurospora crassa requires a protein

homologous to RNA-dependent RNA polymerase. Nature 399:166-169.

101. Iwasaki S, Kobayashi M, Yoda M, Sakaguchi Y, Katsuma S, Suzuki T, Tomari Y.

2010. Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of

small RNA duplexes. Mol. Cell 39:292-299.

102. Iki T, Yoshikawa M, Nishikiori M, Jaudal MC, Matsumoto-Yokoyama E,

Mitsuhara I, Meshi T, Ishikawa M. 2010. In vitro assembly of plant RNA-induced

silencing complexes facilitated by molecular chaperone HSP90. Mol. Cell 39:282-

291.

103. Curtin SJ, Watson JM, Smith NA, Eamens AL, Blanchard CL, Waterhouse PM.

2008. The roles of plant dsRNA-binding proteins in RNAi-like pathways. FEBS

letters 582:2753-2760.

104. Naqvi AR, Sarwat M, Hasan S, Roychodhury N. 2012. Biogenesis, functions and

fate of plant microRNAs. J Cell Physiol 227:3163-3168.

105. Omarov RT, Scholthof HB. 2012. Biological chemistry of virus-encoded

suppressors of RNA silencing: an overview. Methods Mol Biol 894:39-56.

139

106. Palukaitis P. 2011. The Road to RNA Silencing is Paved with Plant-Virus

Interactions. Plant Pathol. J. 27:197-206.

107. Blevins T, Rajeswaran R, Shivaprasad PV, Beknazariants D, Si-Ammour A,

Park HS, Vazquez F, Robertson D, Meins F, Jr., Hohn T, Pooggin MM. 2006.

Four plant Dicers mediate viral small RNA biogenesis and DNA virus induced

silencing. Nucleic Acids Res. 34:6233-6246.

108. Deleris A, Gallego-Bartolome J, Bao J, Kasschau KD, Carrington JC, Voinnet O.

2006. Hierarchical action and inhibition of plant dicer-like proteins in antiviral

defense. Science 313:68-71.

109. Pantaleo V, Szittya G, Burgyan J. 2007. Molecular bases of viral RNA targeting by

viral small interfering RNA-programmed RISC. J. Virol. 81:3797-37806.

110. Hamilton AJ, Baulcombe DC. 1999. A species of small antisense RNA in

posttranscriptional gene silencing in plants. Science 286:950-952.

111. Segers GC, Zhang X, Deng F, Sun Q, Nuss DL. 2007. Evidence that RNA silencing

functions as an antiviral defense mechanism in fungi. Proc. Natl. Acad. Sci. USA

104:12902-12906.

112. Li H, Li WX, Ding SW. 2002. Induction and suppression of RNA silencing by an

animal virus. Science 296:1319-1321.

113. Schott DH, Cureton DK, Whelan SP, Hunter CP. 2005. An antiviral role for the

RNA interference machinery in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA

102:18420-18424.

114. Maillard PV, Ciaudo C, Marchais A, Li Y, Jay F, Ding SW, Voinnet O. 2013.

Antiviral RNA interference in mammalian cells. Science 342:235-238.

140

115. Li Y, Lu J, Han Y, Fan X, Ding SW. 2013. RNA interference functions as an

antiviral immunity mechanism in mammals. Science 342:231-234.

116. Tenllado F, Diaz-Ruiz JR. 2001. Double-stranded RNA-mediated interference with

plant virus infection. J. Virol. 75:12288-12297.

117. Molnar A, Csorba T, Lakatos L, Varallyay E, Lacomme C, Burgyan J. 2005.

Plant virus-derived small interfering RNAs originate predominantly from highly

structured single-stranded viral RNAs. J. Virol. 79:7812-7818.

118. Donaire L, Wang Y, Gonzalez-Ibeas D, Mayer KF, Aranda MA, Llave C. 2009.

Deep-sequencing of plant viral small RNAs reveals effective and widespread

targeting of viral genomes. Virology 392:203-214.

119. Qu F. 2010. Antiviral role of plant-encoded RNA-dependent RNA polymerases

revisited with deep sequencing of small interfering RNAs of virus origin. Mol. Plant-

Microbe Interact. 23:1248-1252.

120. Qi X, Bao FS, Xie Z. 2009. Small RNA deep sequencing reveals role for Arabidopsis

thaliana RNA-dependent RNA polymerases in viral siRNA biogenesis. PloS one

4:e4971.

121. Mlotshwa S, Pruss GJ, Vance V. 2008. Small RNAs in viral infection and host

defense. Trends Plant Sci. 13:375-382.

122. Wang XB, Jovel J, Udomporn P, Wang Y, Wu Q, Li WX, Gasciolli V, Vaucheret

H, Ding SW. 2011. The 21-nucleotide, but not 22-nucleotide, viral secondary small

interfering RNAs direct potent antiviral defense by two cooperative argonautes in

Arabidopsis thaliana. Plant cell 23:1625-1638.

141

123. Qu F, Ye X, Morris TJ. 2008. Arabidopsis DRB4, AGO1, AGO7, and RDR6

participate in a DCL4-initiated antiviral RNA silencing pathway negatively regulated

by DCL1. Proc. Natl. Acad. Sci. USA 105:14732-14737.

124. Jakubiec A, Yang SW, Chua NH. 2012. Arabidopsis DRB4 protein in antiviral

defense against Turnip yellow mosaic virus infection. Plant J. 69:14-25.

125. Alvarado VY, Scholthof H. 2012. AGO2: a new Argonaute compromising plant

virus accumulation. Frontiers in plant science 2: 1-6.

126. Harvey JJ, Lewsey MG, Patel K, Westwood J, Heimstadt S, Carr JP, Baulcombe

DC. 2011. An antiviral defense role of AGO2 in plants. PloS one 6:e14639.

127. Bhattacharjee S, Zamora A, Azhar MT, Sacco MA, Lambert LH, Moffett P.

2009. Virus resistance induced by NB-LRR proteins involves Argonaute4-dependent

translational control. Plant J. 58:940-951.

128. Takeda A, Iwasaki S, Watanabe T, Utsumi M, Watanabe Y. 2008. The mechanism

selecting the guide strand from small RNA duplexes is different among argonaute

proteins. Plant Cell Physiol. 49:493-500.

129. Schuck J, Gursinsky T, Pantaleo V, Burgyan J, Behrens SE. 2013. AGO/RISC-

mediated antiviral RNA silencing in a plant in vitro system. Nucleic Acids Res.

41:5090-5103.

130. Carbonell A, Fahlgren N, Garcia-Ruiz H, Gilbert KB, Montgomery TA, Nguyen

T, Cuperus JT, Carrington JC. 2012. Functional analysis of three Arabidopsis

ARGONAUTES using slicer-defective mutants. Plant Cell 24:3613-3629.

142

131. Jaubert M, Bhattacharjee S, Mello AF, Perry KL, Moffett P. 2011.

ARGONAUTE2 Mediates RNA-Silencing Antiviral Defenses against Potato virus X

in Arabidopsis. Plant Physiol. 156:1556-1564.

132. Scholthof HB, Alvarado VY, Vega-Arreguin JC, Ciomperlik J, Odokonyero D,

Brosseau C, Jaubert M, Zamora A, Moffett P. 2011. Identification of an

ARGONAUTE for antiviral RNA silencing in Nicotiana benthamiana. Plant Physiol.

156:1548-1555.

133. Varallyay E, Valoczi A, Agyi A, Burgyan J, Havelda Z. 2010. Plant virus-mediated

induction of miR168 is associated with repression of ARGONAUTE1 accumulation.

Embo J. 29:3507-3519.

134. Zhang X, Yuan YR, Pei Y, Lin SS, Tuschl T, Patel DJ, Chua NH. 2006. Cucumber

mosaic virus-encoded 2b suppressor inhibits Arabidopsis Argonaute1 cleavage

activity to counter plant defense. Genes Dev. 20:3255-3268.

135. Azevedo J, Garcia D, Pontier D, Ohnesorge S, Yu A, Garcia S, Braun L, Bergdoll

M, Hakimi MA, Lagrange T, Voinnet O. 2010. Argonaute quenching and global

changes in Dicer homeostasis caused by a pathogen-encoded GW repeat protein.

Genes Dev. 24:904-915.

136. Chiu MH, Chen IH, Baulcombe DC, Tsai CH. 2010. The silencing suppressor P25

of Potato virus X interacts with Argonaute1 and mediates its degradation through the

proteasome pathway. Mol. Plant Pathol. 11:641-649.

137. Baumberger N, Baulcombe DC. 2005. Arabidopsis ARGONAUTE1 is an RNA

Slicer that selectively recruits microRNAs and short interfering RNAs. Proc. Natl.

Acad. Sci. USA 102:11928-11933.

143

138. Zhang X, Singh J, Li D, Qu F. 2012. Temperature-dependent survival of Turnip

crinkle virus-infected arabidopsis plants relies on an RNA silencing-based defense

that requires dcl2, AGO2, and HEN1. J. Virol. 86:6847-6854.

139. Jones L, Keining T, Eamens A, Vaistij FE. 2006. Virus-induced gene silencing of

Argonaute genes in Nicotiana benthamiana demonstrates that extensive systemic

silencing requires Argonaute1-like and Argonaute4-like genes. Plant Physiol.

141:598-606.

140. Xie Q, Guo HS. 2006. Systemic antiviral silencing in plants. Virus Res. 118:1-6.

141. Xie Z, Fan B, Chen C, Chen Z. 2001. An important role of an inducible RNA-

dependent RNA polymerase in plant antiviral defense. Proc. Natl. Acad. Sci. USA

98:6516-6521.

142. Garcia-Ruiz H, Takeda A, Chapman EJ, Sullivan CM, Fahlgren N, Brempelis

KJ, Carrington JC. 2010. Arabidopsis RNA-Dependent RNA Polymerases and

Dicer-Like Proteins in Antiviral Defense and Small Interfering RNA Biogenesis

during Turnip Mosaic Virus Infection. Plant Cell 22:481-496.

143. Schwach F, Vaistij FE, Jones L, Baulcombe DC. 2005. An RNA-Dependent RNA

Polymerase Prevents Meristem Invasion by Potato Virus X and Is Required for the

Activity But Not the Production of a Systemic Silencing Signal. Plant Physiol.

138:1842-1852.

144. Wang XB, Wu Q, Ito T, Cillo F, Li WX, Chen X, Yu JL, Ding SW. 2010. RNAi-

mediated viral immunity requires amplification of virus-derived siRNAs in

Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA 107:484-489.

144

145. Mourrain P, Beclin C, Elmayan T, Feuerbach F, Godon C, Morel JB, Jouette D,

Lacombe AM, Nikic S, Picault N, Remoue K, Sanial M, Vo TA, Vaucheret H.

2000. Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene

silencing and natural virus resistance. Cell 101:533-542.

146. Qu F, Ye X, Hou G, Sato S, Clemente TE, Morris TJ. 2005. RDR6 has a broad-

spectrum but temperature-dependent antiviral defense role in Nicotiana benthamiana.

J. Virol. 79:15209-15217.

147. Kumakura N, Takeda A, Fujioka Y, Motose H, Takano R, Watanabe Y. 2009.

SGS3 and RDR6 interact and colocalize in cytoplasmic SGS3/RDR6-bodies. FEBS

letters 583:1261-1266.

148. Shivaprasad PV, Chen HM, Patel K, Bond DM, Santos BA, Baulcombe DC.

2012. A microRNA superfamily regulates nucleotide binding site-leucine-rich repeats

and other mRNAs. Plant Cell 24:859-874.

149. Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z,

Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ,

Meyers BC. 2011. MicroRNAs as master regulators of the plant NB-LRR defense

gene family via the production of phased, trans-acting siRNAs. Genes Dev. 25:2540-

2553.

150. He XF, Fang YY, Feng L, Guo HS. 2008. Characterization of conserved and novel

microRNAs and their targets, including a TuMV-induced TIR-NBS-LRR class R

gene-derived novel miRNA in Brassica. FEBS letters 582:2445-2452.

151. Ruiz-Ferrer V, Voinnet O. 2009. Roles of plant small RNAs in biotic stress

responses. Annu. Rev. Plant Biol. 60:485-510.

145

152. Katiyar-Agarwal S, Jin H. 2010. Role of small RNAs in host-microbe interactions.

Annu. Rev. Phytopathol. 48:225-246.

153. Li F, Pignatta D, Bendix C, Brunkard JO, Cohn MM, Tung J, Sun H, Kumar P,

Baker B. 2012. MicroRNA regulation of plant innate immune receptors. Proc. Natl.

Acad. Sci. USA 109:1790-1795.

154. Iwakawa HO, Tomari Y. 2013. Molecular insights into microRNA-mediated

translational repression in plants. Mol. Cell 52:591-601.

155. Brodersen P, Sakvarelidze-Achard L, Bruun-Rasmussen M, Dunoyer P,

Yamamoto YY, Sieburth L, Voinnet O. 2008. Widespread translational inhibition by

plant miRNAs and siRNAs. Science 320:1185-1190.

156. Dunoyer P, Voinnet O. 2005. The complex interplay between plant viruses and host

RNA-silencing pathways. Curr. Opin. Plant Biol. 8:415-423.

157. Brodersen P, Voinnet O. 2009. Revisiting the principles of microRNA target

recognition and mode of action. Nat. Rev. Mol. Cell Biol. 10:141-148.

158. Huntzinger E, Izaurralde E. 2011. Gene silencing by microRNAs: contributions of

translational repression and mRNA decay. Nat. Rev. Genet. 12:99-110.

159. Doench JG, Petersen CP, Sharp PA. 2003. siRNAs can function as miRNAs. Genes

Dev. 17:438-442.

160. Lanet E, Delannoy E, Sormani R, Floris M, Brodersen P, Crete P, Voinnet O,

Robaglia C. 2009. Biochemical evidence for translational repression by arabidopsis

microRNAs. Plant Cell 21:1762-1768.

146

161. Qi Y, He X, Wang XJ, Kohany O, Jurka J, Hannon GJ. 2006. Distinct catalytic

and non-catalytic roles of ARGONAUTE4 in RNA-directed DNA methylation.

Nature 443:1008-1012.

162. Ji L, Liu X, Yan J, Wang W, Yumul RE, Kim YJ, Dinh TT, Liu J, Cui X, Zheng

B, Agarwal M, Liu C, Cao X, Tang G, Chen X. 2011. ARGONAUTE10 and

ARGONAUTE1 regulate the termination of floral stem cells through two microRNAs

in Arabidopsis. PLoS genetics 7:e1001358.

163. Zhu H, Hu F, Wang R, Zhou X, Sze SH, Liou LW, Barefoot A, Dickman M,

Zhang X. 2011. Arabidopsis Argonaute10 specifically sequesters miR166/165 to

regulate shoot apical meristem development. Cell 145:242-256.

164. Horman SR, Janas MM, Litterst C, Wang B, MacRae IJ, Sever MJ, Morrissey

DV, Graves P, Luo B, Umesalma S, Qi HH, Miraglia LJ, Novina CD, Orth AP.

2013. Akt-mediated phosphorylation of argonaute 2 downregulates cleavage and

upregulates translational repression of MicroRNA targets. Mol. Cell 50:356-367.

165. Pfaff J, Meister G. 2013. Argonaute and GW182 proteins: an effective alliance in

gene silencing. Biochem. Soc. Trans. 41:855-860.

166. Braun JE, Huntzinger E, Izaurralde E. 2013. The role of GW182 proteins in

miRNA-mediated gene silencing. Adv. Exp. Med. Biol. 768:147-163.

167. Yang L, Wu G, Poethig RS. 2012. Mutations in the GW-repeat protein SUO reveal a

developmental function for microRNA-mediated translational repression in

Arabidopsis. Proc. Natl. Acad. Sci. USA 109:315-320.

147

168. Hauptmann J, Dueck A, Harlander S, Pfaff J, Merkl R, Meister G. 2013. Turning

catalytically inactive human Argonaute proteins into active slicer enzymes. Nat.

Struct. Mol. Biol. 20:814-817.

169. Hur JK, Zinchenko MK, Djuranovic S, Green R. 2013. Regulation of Argonaute

slicer activity by guide RNA 3' end interactions with the N-terminal lobe. J. Biol.

Chem. 288:7829-7840.

170. Nakanishi K, Weinberg DE, Bartel DP, Patel DJ. 2012. Structure of yeast

Argonaute with guide RNA. Nature 486:368-374.

171. Schott G, Mari-Ordonez A, Himber C, Alioua A, Voinnet O, Dunoyer P. 2012.

Differential effects of viral silencing suppressors on siRNA and miRNA loading

support the existence of two distinct cellular pools of ARGONAUTE1. EMBO J.

31:2553-2565.

172. Li S, Liu L, Zhuang X, Yu Y, Liu X, Cui X, Ji L, Pan Z, Cao X, Mo B, Zhang F,

Raikhel N, Jiang L, Chen X. 2013. MicroRNAs inhibit the translation of target

mRNAs on the endoplasmic reticulum in Arabidopsis. Cell 153:562-574.

173. Kim YJ, Maizel A, Chen X. 2014. Traffic into silence: endomembranes and post-

transcriptional RNA silencing. EMBO J. 33:968-980.

174. Decker CJ, Parker R. 2012. P-bodies and stress granules: possible roles in the

control of translation and mRNA degradation. Cold Spring Harb. Perspect. Biol.

4:a012286.

175. Bhattacharyya SN, Habermacher R, Martine U, Closs EI, Filipowicz W. 2006.

Relief of microRNA-mediated translational repression in human cells subjected to

stress. Cell 125:1111-1124.

148

176. Omarov RT, Ciomperlik JJ, Scholthof HB. 2007. RNAi-associated ssRNA-specific

ribonucleases in Tombusvirus P19 mutant-infected plants and evidence for a discrete

siRNA-containing effector complex. Proc. Natl. Acad. Sci. USA 104:1714-1719.

177. Ciomperlik JJ, Omarov RT, Scholthof HB. 2011. An antiviral RISC isolated from

Tobacco rattle virus-infected plants. Virology 412:117-124.

178. Mahajan VS, Drake A, Chen J. 2009. Virus-specific host miRNAs: antiviral

defenses or promoters of persistent infection? Trends Immunol. 30:1-7.

179. Saumet A, Lecellier CH. 2006. Anti-viral RNA silencing: do we look like plants?

Retrovirology 3:3.

180. Qian S, Zhong X, Yu L, Ding B, de Haan P, Boris-Lawrie K. 2009. HIV-1 Tat

RNA silencing suppressor activity is conserved across kingdoms and counteracts

translational repression of HIV-1. Proc. Natl. Acad. Sci. USA 106:605-610.

181. Petrillo JE, Venter PA, Short JR, Gopal R, Deddouche S, Lamiable O, Imler JL,

Schneemann A. 2013. Cytoplasmic granule formation and translational inhibition of

nodaviral RNAs in the absence of the double-stranded RNA binding protein B2. J.

Virol. 87:13409-13421.

182. Itaya A, Zhong X, Bundschuh R, Qi Y, Wang Y, Takeda R, Harris AR, Molina C,

Nelson RS, Ding B. 2007. A structured viroid RNA serves as a substrate for dicer-

like cleavage to produce biologically active small RNAs but is resistant to RNA-

induced silencing complex-mediated degradation. J. Virol. 81:2980-2994.

183. Haas G, Azevedo J, Moissiard G, Geldreich A, Himber C, Bureau M, Fukuhara

T, Keller M, Voinnet O. 2008. Nuclear import of CaMV P6 is required for infection

and suppression of the RNA silencing factor DRB4. EMBO J. 27:2102-2112.

149

184. Silhavy D, Molnar A, Lucioli A, Szittya G, Hornyik C, Tavazza M, Burgyan J.

2002. A viral protein suppresses RNA silencing and binds silencing-generated, 21- to

25-nucleotide double-stranded RNAs. EMBO J. 21:3070-3080.

185. Lakatos L, Csorba T, Pantaleo V, Chapman EJ, Carrington JC, Liu YP, Dolja

VV, Calvino LF, Lopez-Moya JJ, Burgyan J. 2006. Small RNA binding is a

common strategy to suppress RNA silencing by several viral suppressors. EMBO J.

25:2768-2780.

186. Thomas CL, Leh V, Lederer C, Maule AJ. 2003. Turnip crinkle virus coat protein

mediates suppression of RNA silencing in Nicotiana benthamiana. Virology 306:33-

41.

187. Vargason JM, Szittya G, Burgyan J, Hall TM. 2003. Size selective recognition of

siRNA by an RNA silencing suppressor. Cell 115:799-811.

188. Merai Z, Kerenyi Z, Kertesz S, Magna M, Lakatos L, Silhavy D. 2006. Double-

stranded RNA binding may be a general plant RNA viral Strategy to suppress RNA

silencing. J. Virol. 80:5747-5756.

189. Csorba T, Bovi A, Dalmay T, Burgyan J. 2007. The p122 subunit of Tobacco

Mosaic Virus replicase is a potent silencing suppressor and compromises both small

interfering RNA- and microRNA-mediated pathways. J. Virol. 81:11768-11780.

190. Kreuze JF, Savenkov EI, Cuellar W, Li X, Valkonen JP. 2005. Viral class 1 RNase

III involved in suppression of RNA silencing. J. Virol. 79:7227-7238.

191. Bisaro DM. 2006. Silencing suppression by geminivirus proteins. Virology 344:158-

168.

150

192. Derrien B, Baumberger N, Schepetilnikov M, Viotti C, De Cillia J, Ziegler-Graff

V, Isono E, Schumacher K, Genschik P. 2012. Degradation of the antiviral

component ARGONAUTE1 by the autophagy pathway. Proc. Natl. Acad. Sci. USA

109:15942-15946.

193. Giner A, Lakatos L, Garcia-Chapa M, Lopez-Moya JJ, Burgyan J. 2010. Viral

protein inhibits RISC activity by argonaute binding through conserved WG/GW

motifs. PLoS pathogens 6:e1000996.

194. Varallyay E, Olah E, Havelda Z. 2014. Independent parallel functions of p19 plant

viral suppressor of RNA silencing required for effective suppressor activity. Nucleic

Acids Res. 42:599-608.

195. Varallyay E, Havelda Z. 2013. Unrelated viral suppressors of RNA silencing

mediate the control of ARGONAUTE1 level. Mol. Plant Pathol. 14:567-575.

196. Culver JN, Padmanabhan MS. 2007. Virus-induced disease: altering host

physiology one interaction at a time. Annu. Rev. Phytopathol. 45:221-243.

197. Bilgin DD, Zavala JA, Zhu J, Clough SJ, Ort DR, DeLucia EH. 2010. Biotic

stress globally downregulates photosynthesis genes. Plant Cell Environ. 33:1597-

1613.

198. Dardick C. 2007. Comparative expression profiling of Nicotiana benthamiana leaves

systemically infected with three fruit tree viruses. Mol. Plant-Microbe Interact.

20:1004-1017.

199. Havelda Z, Varallyay E, Valoczi A, Burgyan J. 2008. Plant virus infection-induced

persistent host gene downregulation in systemically infected leaves. Plant J. 55:278-

288.

151

200. Culver JN, Padmanabhan MS. 2007. Virus-induced disease: altering host

physiology one interaction at a time. Annual Review of Phytopathology 45:221-243.

201. Komatsu K, Hashimoto M, Ozeki J, Yamaji Y, Maejima K, Senshu H, Himeno

M, Okano Y, Kagiwada S, Namba S. 2010. Viral-induced systemic necrosis in

plants involves both programmed cell death and the inhibition of viral multiplication,

which are regulated by independent pathways. Mol. Plant-Microbe Interact. 23:283-

293.

202. Lorang JM, Sweat TA, Wolpert TJ. 2007. Plant disease susceptibility conferred by

a "resistance" gene. Proc. Natl. Acad. Sci. USA 104:14861-14866.

203. Dinesh-Kumar SP, Tham WH, Baker BJ. 2000. Structure-function analysis of the

tobacco mosaic virus resistance gene N. Proc. Natl. Acad. Sci. USA 97:14789-14794.

204. Hanssen IM, Peter van Esse H, Ballester AR, Hogewoning SW, Parra NO,

Paeleman A, Lievens B, Bovy AG, Thomma BP. 2011. Differential tomato

transcriptomic responses induced by pepino mosaic virus isolates with differential

aggressiveness. Plant Physiol. 156:301-318.

205. Vaucheret H, Vazquez F, Crete P, Bartel DP. 2004. The action of ARGONAUTE1

in the miRNA pathway and its regulation by the miRNA pathway are crucial for plant

development. Genes Dev. 18:1187-1197.

206. Kasschau KD, Xie Z, Allen E, Llave C, Chapman EJ, Krizan KA, Carrington

JC. 2003. P1/HC-Pro, a viral suppressor of RNA silencing, interferes with

Arabidopsis development and miRNA function. Developmental cell 4:205-217.

207. Shiboleth YM, Haronsky E, Leibman D, Arazi T, Wassenegger M, Whitham SA,

Gaba V, Gal-On A. 2007. The conserved FRNK box in HC-Pro, a plant viral

152

suppressor of gene silencing, is required for small RNA binding and mediates

symptom development. J. Virol. 81:13135-13148.

208. Omarov R, Sparks K, Smith L, Zindovic J, Scholthof HB. 2006. Biological

relevance of a stable biochemical interaction between the tombusvirus-encoded P19

and short interfering RNAs. J. Virol. 80:3000-3008.

209. Siddiqui SA, Sarmiento C, Truve E, Lehto H, Lehto K. 2008. Phenotypes and

functional effects caused by various viral RNA silencing suppressors in transgenic

Nicotiana benthamiana and N. tabacum. Mol. Plant-Microbe Interact. 21:178-187.

210. Lewsey M, Robertson FC, Canto T, Palukaitis P, Carr JP. 2007. Selective

targeting of miRNA-regulated plant development by a viral counter-silencing protein.

Plant J. 50:240-252.

211. Mallory AC, Bartel DP, Bartel B. 2005. MicroRNA-directed regulation of

Arabidopsis AUXIN RESPONSE FACTOR17 is essential for proper development

and modulates expression of early auxin response genes. Plant Cell 17:1360-1375.

212. Jay F, Wang Y, Yu A, Taconnat L, Pelletier S, Colot V, Renou JP, Voinnet O.

2011. Misregulation of AUXIN RESPONSE FACTOR 8 Underlies the

Developmental Abnormalities Caused by Three Distinct Viral Silencing Suppressors

in Arabidopsis. PLoS pathogens 7:e1002035.

213. Shimura H, Pantaleo V, Ishihara T, Myojo N, Inaba J, Sueda K, Burgyan J,

Masuta C. 2011. A viral satellite RNA induces yellow symptoms on tobacco by

targeting a gene involved in chlorophyll biosynthesis using the RNA silencing

machinery. PLoS pathogens 7:e1002021.

153

214. Smith NA, Eamens AL, Wang MB. 2011. Viral small snterfering RNAs target host

genes to mediate disease symptoms in plants. PLoS pathogens 7:e1002022.

215. Bachan S, Dinesh-Kumar SP. 2012. Tobacco rattle virus (TRV)-based virus-induced

gene silencing. Methods Mol. Biol. 894:83-92.

216. Lu R, Martin-Hernandez AM, Peart JR, Malcuit I, Baulcombe DC. 2003. Virus-

induced gene silencing in plants. Methods 30:296-303.

217. Moissiard G, Voinnet O. 2006. RNA silencing of host transcripts by cauliflower

mosaic virus requires coordinated action of the four Arabidopsis Dicer-like proteins.

Proc. Natl. Acad. Sci. USA 103:19593-19598.

218. Miozzi L, Gambino G, Burgyan J, Pantaleo V. 2013. Genome-wide identification

of viral and host transcripts targeted by viral siRNAs in Vitis vinifera. Mol. Plant

Pathol. 14:30-43.

219. Fulton RW. 1986. Practices and Precautions in the Use of Cross Protection for Plant

Virus Disease Control. Ann. Rev. Phytopathol. 24:67-81.

220. Smith HA, Swaney SL, Parks TD, Wernsman EA, Dougherty WG. 1994.

Transgenic plant virus resistance mediated by untranslatable sense RNAs: expression,

regulation, and fate of nonessential RNAs. Plant Cell 6:1441-1453.

221. Ratcliff FG, MacFarlane SA, Baulcombe DC. 1999. Gene silencing without DNA.

RNA-mediated cross-protection between viruses. Plant Cell 11:1207-1216.

222. Jovel J, Walker M, Sanfacon H. 2007. Recovery of Nicotiana benthamiana plants

from a necrotic response induced by a nepovirus is associated with RNA silencing but

not with reduced virus titer. J. Virol. 81:12285-12297.

154

223. Martin-Hernandez AM, Baulcombe DC. 2008. Tobacco rattle virus 16-kilodalton

protein encodes a suppressor of RNA silencing that allows transient viral entry in

meristems. J. Virol. 82:4064-4071.

224. Sunpapao A, Nakai T, Dong F, Mochizuki T, Ohki ST. 2009. The 2b protein of

cucumber mosaic virus is essential for viral infection of the shoot apical meristem

and for efficient invasion of leaf primordia in infected tobacco plants. J. Gen. Virol.

90:3015-3021.

225. Gal-On A, Kaplan I, Palukaitis P. 1995. Differential effects of satellite RNA on the

accumulation of cucumber mosaic virus RNAs and their encoded proteins in tobacco

vs zucchini squash with two strains of CMV helper virus. Virology 208:58-66.

226. Mochizuki T, Ohki ST. 2004. Shoot meristem tissue of tobacco inoculated with

Cucumber mosaic virus is infected with the virus and subsequently recovers from

infection by RNA silencing. J. Gen. Plant Pathol. 70:363-366.

227. Szittya G, Silhavy D, Molnar A, Havelda Z, Lovas A, Lakatos L, Banfalvi Z,

Burgyan J. 2003. Low temperature inhibits RNA silencing-mediated defence by the

control of siRNA generation. EMBO J. 22:633-640.

228. Siddiqui SA, Sarmiento C, Kiisma M, Koivumaki S, Lemmetty A, Truve E,

Lehto K. 2008. Effects of viral silencing suppressors on tobacco ringspot virus

infection in two Nicotiana species. J. Gen. Virol. 89:1502-1508.

229. Chellappan P, Vanitharani R, Ogbe F, Fauquet CM. 2005. Effect of temperature

on geminivirus-induced RNA silencing in plants. Plant Physiol. 138:1828-1841.

155

230. Dong F, Mochizuki T, Ohki ST. 2009. Tobacco ringspot virus persists in the shoot

apical meristem but not in the root apical meristem of infected tobacco. Eur. J. Plant

Pathol. 126:117-122.

231. Jovel J, Walker M, Sanfacon H. 2011. Salicylic acid-dependent restriction of

tomato ringspot virus spread in tobacco is accompanied by a hypersensitive response,

local RNA silencing, and moderate systemic resistance. Mol. Plant-Microbe Interact.

24:706-718.

232. Jafarpour B, Sanfacon H. 2009. Insertion of large amino acid repeats and point

mutations contribute to a high degree of sequence diversity in the X4 protein of

tomato ringspot virus (genus Nepovirus). Arch. Virol. 154:1713-1717.

233. Mochizuki T, Ohki ST. 2005. Amino acid 129 in the coat protein of Cucumber

mosaic virus primarily determines invasion of the shoot apical meristem of tobacco

plants. J. Gen. Plant Pathol. 71:326-332.

234. Price WC. 1936. Specificity of acquired immunity from tobacco-ring-spot diseases.

Phytopathol. 26:665-675.

235. Sanfacon H, Zhang G, Chisholm J, Jafarpour B, Jovel J. 2006. Molecular biology

of Tomato ringspot nepovirus, a pathogen of ornamentals, small fruits and fruit trees,

p. 540-546. In Teixeira da Silva J (ed.), Floriculture, Ornamental and Plant

Biotechnology: Advances and Topical Issues (1st Edition), vol. III. Global Science

Books, London, UK.

236. Stace-Smith R. 1984. Tomato ringspot virus. CMI/AAB Descriptions of Plant

Viruses 290.

156

237. Sanfacon H, Iwanami T, Karasev A, Van der Vlugt R, Wellink J, Wetzel T,

Yoshikawa N. 2011. Family Secoviridae, p. 881-899. In King AMQ, Adams MJ,

Carstens EB, Lefkowitz EJ (ed.), Virus Taxonomy: Classification and Nomenclature

of Viruses. Ninth Report of the International Committee on the Taxonomy of

Viruses. Elseviers, San Diego.

238. Forer IB, Stouffer RF. 1982. Xiphinema spp. associated with tomato ringspot virus

infection of Pennsylvania fruit crops. Plant Disease 66:735-736.

239. Rott ME, Gilchrist A, Lee L, Rochon D. 1995. Nucleotide sequence of tomato

ringspot virus RNA1. J. Gen. Virol. 76:465-473.

240. Wang A, Carrier K, Chisholm J, Wieczorek A, Huguenot C, Sanfacon H. 1999.

Proteolytic processing of tomato ringspot nepovirus 3C-like protease precursors:

definition of the domains for the VPg, protease and putative RNA-dependent RNA

polymerase. J. Gen. Virol. 80:799-809.

241. Wang A, Sanfacon H. 2000. Proteolytic processing at a novel cleavage site in the N-

terminal region of the tomato ringspot nepovirus RNA-1-encoded polyprotein in

vitro. J. Gen. Virol. 81:2771-2781.

242. Hans F, Sanfacon H. 1995. Tomato ringspot nepovirus protease: characterization and

cleavage site specificity. J. Gen. Virol. 76:917-927.

243. Han S, Sanfacon H. 2003. Tomato ringspot virus proteins containing the nucleoside

triphosphate binding domain are transmembrane proteins that associate with the

endoplasmic reticulum and cofractionate with replication complexes. J. Virol.

77:523-534.

157

244. Wang A, Han S, Sanfacon H. 2004. Topogenesis in membranes of the NTB-VPg

protein of Tomato ringspot nepovirus: definition of the C-terminal transmembrane

domain. J. Gen. Virol. 85:535-545.

245. Zhang G, Sanfacon H. 2006. Characterization of membrane-association domains

within the Tomato ringspot nepovirus X2 protein, an endoplasmic reticulum-targeted

polytopic membrane protein. J. Virol. 80:10847-10857.

246. Zhang SC, Zhang G, Yang L, Chisholm J, Sanfacon H. 2005. Evidence that

insertion of Tomato ringspot nepovirus NTB-VPg protein in endoplasmic reticulum

membranes is directed by two domains: a C-terminal transmembrane helix and an N-

terminal amphipathic helix. J. Virol. 79:11752-11765.

247. Chisholm J, Zhang G, Wang A, Sanfacon H. 2007. Peripheral association of a

polyprotein precursor form of the RNA-dependent RNA polymerase of Tomato

ringspot virus with the membrane-bound viral replication complex. Virology

368:133-144.

248. Rott ME, Tremaine JH, Rochon DM. 1991. Nucleotide sequence of tomato

ringspot virus RNA-2. J. Gen. Virol. 72:1505-1514.

249. Carrier K, Xiang Y, Sanfacon H. 2001. Genomic organization of RNA2 of Tomato

ringspot virus: processing at a third cleavage site in the N-terminal region of the

polyprotein in vitro. J. Gen. Virol. 82:1785-1790.

250. Carrier K, Hans F, Sanfacon H. 1999. Mutagenesis of amino acids at two tomato

ringspot nepovirus cleavage sites: effect on proteolytic processing in cis and in trans

by the 3C-like protease. Virology 258:161-175.

158

251. Sanfacon H, Wieczorek A, Hans F. 1995. Expression of the tomato ringspot

nepovirus movement and coat proteins in protoplasts. J. Gen. Virol. 76:2299-2303.

252. Wieczorek A, Sanfacon H. 1993. Characterization and subcellular localization of

tomato ringspot nepovirus putative movement protein. Virology 194:734-742.

253. Gaire F, Schmitt C, Stussi-Garaud C, Pinck L, Ritzenthaler C. 1999. Protein 2A

of grapevine fanleaf nepovirus is implicated in RNA2 replication and colocalizes to

the replication site. Virology 264:25-36.

254. Viry M, Serghini MA, Hans F, Ritzenthaler C, Pinck M, Pinck L. 1993.

Biologically active transcripts from cloned cDNA of genomic grapevine fanleaf

nepovirus RNAs. J. Gen. Virol. 74:169-174.

255. Karetnikov A, Keranen M, Lehto K. 2006. Role of the RNA2 3' non-translated

region of Blackcurrant reversion nepovirus in translational regulation. Virology

354:178-191.

256. Karetnikov A, Lehto K. 2008. Translation mechanisms involving long-distance base

pairing interactions between the 5' and 3' non-translated regions and internal

ribosomal entry are conserved for both genomic RNAs of Blackcurrant reversion

nepovirus. Virology 371:292-308.

257. Lehto K, Lemmetty A, Keranen M. 2004. The long 3' non-translated regions of

Blackcurrant reversion virus RNAs are highly conserved between virus isolates

representing different phenotypes and geographic origins. Arch. Virol. 149:1867-

1875.

258. Leonard S, Chisholm J, Laliberte JF, Sanfacon H. 2002. Interaction in vitro

between the proteinase of Tomato ringspot virus (genus Nepovirus) and the

159

eukaryotic translation initiation factor iso4E from Arabidopsis thaliana. J. Gen. Virol.

83:2085-2089.

259. Chisholm J, Wieczorek A, Sanfacon H. 2001. Expression and partial purification of

recombinant tomato ringspot nepovirus 3C-like proteinase: comparison of the activity

of the mature proteinase and the VPg-proteinase precursor. Virus Res. 79:153-164.

260. Karran R, Sanfacon H. 2014. Tomato ringspot virus coat protein binds to

ARGONAUTE 1 and suppresses the translation repression of a reporter gene. Mol.

Plant-Microbe Interact. (in press).

261. Wang A, Sanfacon H. 2000. Diversity in the coding regions for the coat protein,

VPg, protease and putative RNA-dependent RNA polymerase among tomato ringspot

nepovirus isolates. Can. J. Plant Pathol. 22:145-149.

262. Liu D, Shi L, Han C, Yu J, Li D, Zhang Y. 2012. Validation of reference genes for

gene expression studies in virus-infected Nicotiana benthamiana using quantitative

real-time PCR. PLoS One 7:e46451.

263. Moore CJ, Sutherland PW, Forster RL, Gardner RC, MacDiarmid RM. 2001.

Dark green islands in plant virus infection are the result of posttranscriptional gene

silencing. Mol. Plant-Microbe Interact. 14:939-946.

264. Pall GS, Hamilton AJ. 2008. Improved northern blot method for enhanced detection

of small RNA. Nat. Protoc. 3:1077-1084.

265. Peart JR, Lu R, Sadanandom A, Malcuit I, Moffett P, Brice DC, Schauser L,

Jaggard DA, Xiao S, Coleman MJ, Dow M, Jones JD, Shirasu K, Baulcombe

DC. 2002. Ubiquitin ligase-associated protein SGT1 is required for host and nonhost

disease resistance in plants. Proc. Natl. Acad. Sci. USA 99:10865-10869.

160

266. Velazquez K, Renoveli A, Cornellas M, Serra P, Garcia ML, Pina JA, Navarro L,

Moreno P, Guerri J. 2010. Effect of temperature on RNA silencing of a negative-

stranded RNA plant virus: Citrus psorosis virus. Plant Pathol. 59:982-990.

267. Wang K, Uppalapati SR, Zhu X, Dinesh-Kumar SP, Mysore KS. 2010. SGT1

positively regulates the process of plant cell death during both compatible and

incompatible plant-pathogen interactions. Mol. Plant Pathol. 11:597-611.

268. Bhattacharyya SN, Habermacher R, Martine U, Closs EI, Filipowicz W. 2006.

Stress-induced reversal of microRNA repression and mRNA P-body localization in

human cells. Cold Spring Harb Symp Quant Biol 71:513-521.

269. Komatsu K, Hashimoto M, Maejima K, Shiraishi T, Neriya Y, Miura C, Minato

N, Okano Y, Sugawara K, Yamaji Y, Namba S. 2011. A necrosis-inducing elicitor

domain encoded by both symptomatic and asymptomatic Plantago asiatica mosaic

virus isolates, whose expression is modulated by virus replication. Mol. Plant-

Microbe interact. 24:408-420.

270. Gamarnik AV, Andino R. 1998. Switch from translation to RNA replication in a

positive-stranded RNA virus. Genes Dev. 12:2293-2304.

271. Zhang J, Yamada O, Yoshida H, Iwai T, Araki H. 2002. Autogenous translational

inhibition of core protein: implication for switch from translation to RNA replication

in hepatitis C virus. Virology 293:141-150.

272. Bonderoff JM, Larey JL, Lloyd RE. 2008. Cleavage of poly(A)-binding protein by

poliovirus 3C proteinase inhibits viral internal ribosome entry site-mediated

translation. J. Virol. 82:9389-9399.

161

273. Li Y, Zhang Q, Zhang J, Wu L, Qi Y, Zhou JM. 2010. Identification of

microRNAs involved in pathogen-associated molecular pattern-triggered plant innate

immunity. Plant Physiol. 152:2222-2231.

274. Yi H, Richards EJ. 2007. A Cluster of Disease Resistance Genes in Arabidopsis Is

Coordinately Regulated by Transcriptional Activation and RNA Silencing. Plant Cell

19:2929-2939.

275. Cheng C, Gao X, Feng B, Sheen J, Shan L, He P. 2013. Plant immune response to

pathogens differs with changing temperatures. Nature communications 4:2530.

276. Hua J. 2013. Modulation of plant immunity by light, circadian rhythm, and

temperature. Curr. Opin. Plant Biol. 16:406-413.

277. Mangrauthia SK, Singh Shakya VP, Jain RK, Praveen S. 2009. Ambient

temperature perception in papaya for papaya ringspot virus interaction. Virus Genes

38:429-434.

278. Rott ME, Tremaine JH, Rochon DM. 1991. Comparison of the 5' and 3' termini of

tomato ringspot virus RNA1 and RNA2: evidence for RNA recombination. Virology

185:468-472.

279. Tu JC. 1989. The role of temperature and inoculum concentration in the development

of tip necrosis and seedling death of beans infected with Bean yellow mosaic virus

necrosis. Plant Disease 73:405-407.

280. Ziebell H, Carr JP. 2010. Cross-protection a century of mystery. Adv. Virus Res.

76:211-264.

162

281. Goto K, Kobori T, Kosaka Y, Natsuaki T, Masuta C. 2007. Characterization of

silencing suppressor 2b of Cucumber mosaic virus based on examination of its small

RNA-binding abilities. Plant Cell Physiol. 48:1050-1060.

282. Martinez de Alba AE, Jauvion V, Mallory AC, Bouteiller N, Vaucheret H. 2011.

The miRNA pathway limits AGO1 availability during siRNA-mediated PTGS

defense against exogenous RNA. Nucleic Acids Res. 39:9339-9344.

283. Foster TM, Lough TJ, Emerson SJ, Lee RH, Bowman JL, Forster RL, Lucas

WJ. 2002. A surveillance system regulates selective entry of RNA into the shoot

apex. Plant Cell 14:1497-1508.

284. Azevedo C, Betsuyaku S, Peart J, Takahashi A, Noel L, Sadanandom A, Casais

C, Parker J, Shirasu K. 2006. Role of SGT1 in resistance protein accumulation in

plant immunity. EMBO J. 25:2007-2016.

285. Nagy PD, Pogany J. 2008. Multiple roles of viral replication proteins in plant RNA

virus replication. Methods Mol. Biol. 451:55-68.

286. Sanfacon H. 2013. Investigating the role of viral integral membrane proteins in

promoting the assembly of nepovirus and comovirus replication factories. Front Plant

Sci 3:313.

287. Nagy PD, Pogany J. 2012. The dependence of viral RNA replication on co-opted

host factors. Nat. Rev. Microbiol. 10:137-149.

288. Moffett P. 2009. Mechanisms of recognition in dominant R gene mediated resistance.

Adv. Virus Res. 75:1-33.

163

289. Alvarado V, Scholthof HB. 2009. Plant responses against invasive nucleic acids:

RNA silencing and its suppression by plant viral pathogens. Semin Cell Dev Biol

20:1032-1040.

290. Dangl JL, Jones JD. 2001. Plant pathogens and integrated defence responses to

infection. Nature 411:826-833.

291. Chisholm ST, Coaker G, Day B, Staskawicz BJ. 2006. Host-microbe interactions:

shaping the evolution of the plant immune response. Cell 124:803-814.

292. Senthil-Kumar M, Mysore KS. 2011. Virus-induced gene silencing can persist for

more than 2 years and also be transmitted to progeny seedlings in Nicotiana

benthamiana and tomato. Plant Biotechnol. J. 9:797-806.

293. Roossinck MJ. 2011. The good viruses: viral mutualistic symbioses. Nat. Rev.

Microbiol. 9:99-108.

164