Biology and Host-Pathogen Interaction of Stagonosporopsis Tanaceti, the Cause of Ray Blight Disease in Pyrethrum

Home , Stagonosporopsis

Biology and host-pathogen interaction of

Stagonosporopsis tanaceti, the cause of ray

blight in pyrethrum

Md Abdullahil Baki Bhuiyan

Submitted in total fulfilment of the requirements of the degree of

Doctor of Philosophy

Faculty of Veterinary and Agricultural Sciences

The University of Melbourne

April 2017

Declaration

I declare that this thesis includes only my original work in the direction of the degree of

Doctor of Philosophy. I also acknowledge all other materials use in the text. The words of this do not exceed 100,000 words. This thesis fulfils the stipulations set out for the degree of Doctor of Philosophy by the University of Melbourne.

Md Abdullahil Baki Bhuiyan April 2017

Acknowledgements

My grateful thanks to my major supervisor Professor Paul Taylor and co-supervisor Dr

Marc Nicolas for their scholastic academic guidance and continuous help to accomplish this thesis. My special thanks to Paul for his friendly support, guidance and encouragement.

My special thanks to Tim Groom, Manager- Agricultural Businesses, Botanical

Resources Australia (BRA) Pty. Ltd. for his judicious suggestions, inspirations and invitation at BRA to discuss my findings with the industry people which made this research worthwhile.

Many thanks to our lab managers Carolyn Selway, Michelle Rhee and Martin Ji;

Stephen and Priya Chand (Faculty staff), Steven (Glasshouse) for their assistance and continuous support throughout the research period. I would like offer special gratitude to my lab colleagues especially Niloofar, Dina, Eden, Mee-Yung, Sophia, Azin, Jiang,

Dilani, Ruvini and Aruni for their friendship and continuous support.

I would like to acknowledge with special gratitude the Melbourne International

Research Scholarship (MIRS) and Melbourne International Fee Remission Scholarship

(MIFRS) awarded by the University of Melbourne and financial support from BRA.

I am especially grateful to my wife Farhana Jenny and my son Ahnaf Rayan Bhuiyan for their sacrifice, mental support and continuous inspiration during my whole study period in overseas. Special thanks to my parents in law Nizam Uddin Patwary and

Jahanara Begum, sister in law Fariha and brother in law Arnab for their continuous support to my family. I would like to acknowledge the support and inspiration from my brother Md. Ashiqur Rahman Bayzid and also thanks to his wife Shamsun Nahar Suchi for her wish.

iii

Finally, I would like to acknowledge my parents Md Abdul Awal Bhuiyan and Ayesha

Begum for their wish, inspiration, sacrifice and pray during my study period in abroad.

Abstract

Ray blight (Stagonosporopsis tanaceti) is a major biotic constraint for pyrethrum production in Australia. The biology and host-pathogen interaction of S. tanaceti in seed, seedlings and mature pyrethrum plants were studied in glasshouse experiments.

Molecular detection and quantification of infection within pyrethrum tissues were determined using TaqMan PCR.

Direct penetration into the epidermal cells of leaves resulted in the development of brown to black necrotic lesions. Hyphae of S. tanaceti then colonised the cortical tissues intra- and intercellularly resulting in degradation of tissues and deposition of extracellular material in necrotic cells. Pycnidia formed within 12 days after infection in the epidermis and hypodermis of pyrethrum leaves. Quadruple staining technique was more suitable than single or dual staining for visualising fungal hyphae within the tissue because the combination of four stains enabled the hyphae to stain blue-green in contrast to the cell tissues.

Stagonosporopsis tanaceti infected only the seed coat and not the embryo with infected seed being symptomless and not deformed or discoloured. After germination, S. tanaceti infected the embryonic tissues in the seed coat and depending on the level of infection of these tissues, resulted in pre-emergence and post-emergence damping off.

Degradation of whole embryonic tissues by S. tanaceti resulted in pre-emergence death while disintegration of hypocotyl/crown tissues resulted in post-emergence death. Some of the infected embryos developed into seedlings with S. tanaceti being present in the hypocotyl/ crown tissues without these tissues showing visible symptoms thus indicating a latent stage in the life cycle of the pathogen.

Stagonosporopsis tanaceti infected the cauline and petiolate leaves, crown tissues, flower stems, flower buds and rays of the flower but not the roots of pyrethrum plants.

The necrotic region of flower stems extended from the peduncle to 8-11 cm down the flower stems where the epidermis, hypodermis and cortical tissues were degraded.

Pycnidia that developed in the necrotic tissue of flower stems released pycnidiospores, which dispersed through wind and water-splash and then presumably settled onto the flower buds and infected the flower rays before infecting the developing seed. Pycnidia that also formed on the infected foliage released pycnidiospores that were then deposited, by water splash dispersal to the region of the crown tissue where the petioles emerged. At this point the spores germinated and infected the parenchyma cells of the hypodermis and cortical tissues of the crown. Throughout the infection cycle, vascular tissues of all plant organs were not colonised with the endodermis acting as a barrier to hyphal infection. The results of the infection and colonisation of various plant tissues has enabled a complete disease cycle of ray blight in pyrethrum to be described.

The effect of S. tanaceti on growth and development of pyrethrum was studied in two glasshouse trials where the first trial optimised the inoculation concentration to establish ray blight and the second trial determined the effect of S. tanaceti on five cultivars

5 3 6 inoculated at10 spores/ mL. At inoculation concentrations of 10 and 10 spores/ mL there was a significant reduction in biomass (above and below ground dry weights) of cultivar BR1, 6 months after inoculation (mai). At 106 spores/ mL there was a significant reduction in the above ground biomass at 1 and 2 mai but only a significant reduction in below ground biomass at 2 mai. At 103 spores/ mL there was no significant difference in biomass (above and below ground) to the non-inoculated control plants at

1 and 2 mai although dry weights were lower in the infected plants. Infected pyrethrum

vi cultivars BR1, BR2, Pyper, Pyrate and RS5 had significantly reduced plant height, above ground biomass, shoot and flower numbers over two growing cycles. Although cultivar BR1 was affected by S. tanaceti, this cultivar had significantly higher biomass and flower production in two consecutive growing seasons than the other cultivars indicating that BR1 may have moderate resistance/tolerance to S. tanaceti. The performance of BR1 needs to be further assessed under field conditions with natural levels of inoculum.

A TaqMan probe-based polymerase chain reaction (PCR) assay was developed to quantify the level of S. tanaceti inoculum in pyrethrum seed and seedlings. Primer pair

St_qF3 and St_qR2 was designed based on the intergenic spacer (IGS) region of S. tanaceti, which produced a 125 bp amplicon specific to S. tanaceti. TaqMan PCR assay using these primers and probe St_qP was highly specific against the genomic DNA of S. tanaceti and did not amplify the genomes of 14 related Stagonosporopsis species. The sensitivity limit of this assay was measured using the cycle threshold (Ct) value, which ranged from 17.59 for 10 ng to 36.34 for 100 fg of genomic DNA of S. tanaceti. There was a significant negative correlation (r= -0.999, P≤ 0) between the Ct value and the percent of S. tanaceti infected seed. This TaqMan PCR assay detected S. tanaceti in hypocotyl/ crown tissue of symptomless seedlings demonstrating the efficacy of this assay to detect latent infection of seedlings.

In summary, this study has provided better understanding of the biology and infection process of S. tanaceti in pyrethrum seed, seedlings and mature plants and identified moderate level of resistance/tolerance in cultivar BR1. In addition, the amount of infection within pyrethrum seed and seedlings was able to be quantified using TaqMan

PCR which will enable the pyrethrum industry to develop a seed testing service. The

vii outcomes from this project will enable the development and application of more efficient targeted control measures and provide a basis to develop varietal resistance breeding programs to S. tanaceti.

viii

Table of contents

Declaration ...... ii

Acknowledgements ...... iii

Abstract ...... v

Table of contents ...... ix

List of tables...... xiv

List of figures ...... xv

List of abbreviations ...... xviii

Preface ...... xxi

Chapter 1 ...... 1

Introduction ...... 1

Chapter 2 ...... 4

Review of the literature ...... 4

2.1. Pyrethrum ------4

2.1.1. Origin and distribution ...... 4 2.1.2. Insecticidal properties of pyrethrum ...... 4 2.1.3. Production of pyrethrum in Australia ...... 5 2.1.4. Morphological and anatomical features of the pyrethrum plant ...... 6 2.1.5. Fungal diseases of pyrethrum ...... 8

2.2. Ray blight ------8

2.2.1. Taxonomy of ray blight pathogens ...... 8 2.2.2. Molecular classification of Phoma sp...... 9 2.2.3. Infection process of S. tanaceti in pyrethrum ...... 10 2.2.4. Source of S. tanaceti inoculum ...... 10

2.2.5. Epidemics of ray blight in pyrethrum ...... 11 2.2.6. Management of ray blight in pyrethrum ...... 12 2.2.6.1. Use of heat treatment of seed ...... 12 2.2.6.2. Management of cultural practices ...... 12 2.2.6.3. Management of ray blight using fungicides ...... 13 2.2.7. Diagnostics of S. tanaceti in pyrethrum plants ...... 14 2.2.7.1. Assay by visual observation ...... 15 2.2.7.2. Agar plate incubation assay ...... 16 2.2.7.3. Molecular TaqMan PCR assay ...... 17

2.3. Histopathology ------19

2.3.1. Histopathology of ray blight (S. tanaceti) in pyrethrum ...... 19 2.3.2. Role of multiple stains in histopathology ...... 19

2.4. Aims of the thesis ------20

Chapter 3 ...... 21

Histopathology of S. tanaceti infection in pyrethrum leaf lamina ...... 21

3.1. Introduction, research gaps and aims ------21

3.2. Published manuscript ------22

Chapter 4 ...... 30

Infection process of Stagonosporopsis tanaceti in pyrethrum seed and seedlings ... 30

4.1. Introduction, research gaps and aims ------30

4.2. Published manuscript ------31

Chapter 5 ...... 40

Disease cycle of Stagonosporopsis tanaceti in pyrethrum plants ...... 40

5.1. Introduction, research gaps and aims ------40

5.2. Published manuscript ------41

Chapter 6 ...... 49

Effect of Stagonosporopsis tanaceti on growth and development of pyrethrum ..... 49

6.1. Introduction ------49

6.2. Materials and methods ------51

6.2.1. Experiment 1: Effect of inoculum concentration of S. tanaceti on growth and development of pyrethrum cultivar BR1 ...... 51 6.2.1.1. Plant source ...... 51 6.2.1.2. Inoculation treatments ...... 51 6.2.1.3. Assessment of plant growth and incidence of S. tanaceti infection ...... 52 6.2.2. Experiment 2: Effect of S. tanaceti on growth and development of five pyrethrum cultivars ...... 52 6.2.2.1. 1st growing cycle ...... 53 6.2.2.1.1. Plant source ...... 53 6.2.2.1.2. Inoculation treatment ...... 53 6.2.2.1.3. Defining the life stages of pyrethrum and management of control plants ...... 53 6.2.2.1.4. Assessment of plant height, number of shoots, yield of flowers, above ground biomass and incidence of S. tanaceti infection in the 1st growing cycle ...... 54 6.2.2.2. 2nd growing cycle: ...... 55 6.2.2.2.1. Assessment of the number of regenerated shoots, yield of flowers, above ground biomass and incidence of S. tanaceti in the 2nd growing cycle after 1st harvest ...... 55 6.2.3. Data analysis ...... 55

6.3. Results ------56

6.3.1. Experiment 1: Effect of inoculum concentration of S. tanaceti on growth and development of pyrethrum cultivar BR1 ...... 56 6.3.1.1. Biomass of above and below ground parts of pyrethrum plants ...... 56 6.3.1.2. Incidence of S. tanaceti in BR1 ...... 58 6.3.2. Experiment 2: Effect of S. tanaceti on growth and development of five pyrethrum cultivars for two growing cycles ...... 58 6.3.2.1. 1st growing cycle ...... 58 6.3.2.1.1. Incidence of S. tanaceti on pyrethrum cultivars at different growth stages ...... 58 6.3.2.1.2. Effect of S. tanaceti on height of pyrethrum cultivars ...... 58 6.3.2.1.3. Effect of S. tanaceti on number of green shoots of pyrethrum cultivars and symptoms of infection at crown region ...... 60 6.3.2.1.4. Effect of S. tanaceti on above ground dry biomass ...... 62

6.3.2.1.5. Effect of S. tanaceti on yield of flowers ...... 63 6.3.2.2. 2nd growing cycle ...... 64 6.3.2.2.1. Effect of S. tanaceti on regeneration of green shoots ...... 64 6.3.2.2.2. Effect of S. tanaceti on yield of flowers ...... 65 6.3.2.2.3. Incidence of S. tanaceti on pyrethrum cultivars ...... 66 6.3.2.2.4. Effect of S. tanaceti on dry biomass of above ground part of plant ...... 66

6.4. Discussion ------67

Chapter 7 ...... 72

TaqMan PCR assay for detection and quantification of Stagonosporopsis tanaceti in pyrethrum seed and seedlings ...... 72

7.1. Introduction ------72

7.2. Materials and Methods ------73

7.2.1. Extraction of Stagonosporopsis tanaceti genomic DNA and collection of genomic DNA of Stagonosporopsis species ...... 73 7.2.2. Agar plate assay of S. tanaceti infection level (%) in seed lots of farmers field ...... 74 7.2.3. DNA extraction from seed samples ...... 75 7.2.4. Raising seedling from an infected seed lot and extraction of DNA ...... 75 7.2.5. TaqMan PCR primer design and validation ...... 75 7.2.6. TaqMan PCR assay ...... 77 7.2.7. Specificity testing ...... 78 7.2.8. Sensitivity testing ...... 78 7.2.9. Detection and quantification of S. tanaceti infection in seed lots of farmer’s field and seedlings raised from infected seed ...... 78

7.3. Results ------79

7.3.1. Selection of PCR primers ...... 79 7.3.2. Specificity testing of primer pair St_qF3/ St_qR2 against Stagonosporopsis species ...... 79 7.3.3. Sensitivity testing of TaqMan PCR assay ...... 80 7.3.4. Detection and quantification of S. tanaceti in pyrethrum seed lots ...... 81 7.3.5. Detection and quantification of S. tanaceti in pyrethrum seedlings ...... 82

xii

7.4. Discussion ------83

Chapter 8 ...... 85

General discussion ...... 85

Conclusion ...... 90

Chapter 9 ...... 91

References ...... 91

xiii

List of tables Chapter 3

Table 3.1. Fixation, clearing and staining of pyrethrum leaf lamina

Table 3.2. Processing of tissues for differential stains

Table 3.3. Composition of differential stains

Appendix i. Compositions of reagents

Chapter 4

Table 4.1. Classification of seed development based on occurrence of infection at

14 days after incubation on water wager

Chapter 6

Table 6.1. Effect of S. tanaceti inoculum concentration on dry biomass (g) of

above ground part of pyrethrum plants

Table 6.2. Effect of S. tanaceti inoculum concentration on dry biomass (g) of

below ground part of pyrethrum plants

Chapter 7

Table 7.1: Isolates used for the validation of diagnostic assay specificity

Table 7.2. Designations, sequences and expected product sizes of oligonucleotide

primers (forward and reverse) and an oligonucleotide TaqMan probe for the

purpose of specificity and ability to amplify the IGS region of S. tanaceti

Table 7.3. Estimation of level of infection with S. tanaceti (%) in pyrethrum seed

using traditional culture and TaqMan PCR assays

Table 7.4. Ct values of TaqMan PCR determined in duplicate on seedlings

xiv

List of figures

Chapter 2

Figure 2.1. a. A mature pyrethrum plant; b. A mature pyrethrum seed, c. Dissected seed

with different tissues.

Figure 2.2. Flower stems infected by Stagonosporopsis tanaceti showing

“shepherd crook” symptom (white arrow).

Chapter 3

Figure 3.1. Percent germination of S. tanaceti conidia over time on adaxial leaf

surface of pyrethrum.

Figure 3.2. Infection hypha (hy) or germ tube (gt) from the conidia had no

affinity towards stoamta at 12 HAI.

Figure 3.3. Penetration of infection hyphae in pyrethrum leaves by S. tanaceti

using quadruple stain.

Figure 3.4. a. pin point necrosis lesion on adaxial leaf surface at 1 dai; b typical

necrotic lesion on adaxial leaf surface at 3 DAI; c. extended lesion at the tip of the

leaf lamina at 5 DAI; d. pycnidia with ostiole on the adaxial leaf surface at 12

DAI.

Figure 3.5. Hyphae penetrated directly through the middle lamella in between

two palisade parenchyma (pp) cells with brown discolouration.

Chapter 4

Figure 4.1. A mature pyrethrum seed (cultivar BR1/RS5) showing distint ribs/

ridges ® and a pappus.

Figure 4.2. Pyrethrum seedlings infected with Stagonosporopsis tanaceti.

Figure 4.3. Infection of pyrethrum seeds (cultivar BR1) by Stagonosporopsis

tanaceti.

Figure 4.4. Complete digestion of embryonic (emb) cells of pyrethrum seed

(cultivar BR1), infected with Stagonosporopsis tanaceti; that failed to germinate

(pre-emergence death) at 7 days after incubation (dai).

Figure 4.5. Pyrethrum seedling (cultivar BR1) infected by Stagonosporopsis

tanaceti but with no symptoms, showing three distinct growing regions

(epicot/shoot, crown/hypocotyl and radicle) at 6 weeks after germination.

Chapter 5

Figure 5.1. Infection hypha in the epidermal tissue with swollen hyphal tip.

Figure 5.2. Pycnidium burst through the epidermis and released spores.

Figure 5.3. Infected flower stem showing typical shepherd crook symptom and a

constriction at the junction between the necrotic and symptomless infected tissue.

Figure 5.4. Infection process of S. tanaceti in crown tissues.

Chapter 6

Figure 6.1. Effect of S. tanaceti on plant height (cm) of cultivars BR1, BR2,

Pyper, Pyrate and RS5 at three different growth stages.

xvi

Figure 6.2. Effect of S. tanaceti on number of green shoots of cultivars BR1, BR2,

Pyper, Pyrate and RS5 at three different growth stages.

Figure 6.3. Effect of S. tanaceti on growth of shoots and necrosis at the crown

region.

Figure 6.4. Effect of S. tanaceti on above ground biomass (g) of pyrethrum

cultivars BR1, BR2, Pyper, Pyrate and RS5 at early vegetative, late vegetative and

flowering stages.

Figure 6.5. Effect of S. tanaceti on yield of flowers per plant in BR1, BR2, Pyper,

Pyrate and RS5.

Figure 6.6. a) Effect of S. tanaceti on regeneration of shoots per plant in BR1,

BR2, Pyper, Pyrate and RS5. b) Comparative regenerated shoots between S.

tanaceti infected and control cultivar (BR1) three months after 1st year’s harvest.

Figure 6.7. Effect of S. tanaceti on yield of flowers developed from regenerated

shoots per plant in five pyrethrum cultivars (BR1, BR2, Pyper, Pyrate and RS5).

Figure 6.8. Effect of S. tanaceti on above ground dry biomass (g) of regenerated

shoots per plant in BR1, BR2, Pyper, Pyrate and RS5.

Chapter 7

Figure 7.1. Specificity testing of S. tanaceti using conventional PCR assay.

Figure 7.2. Standard regression line of the 10-fold serial dilution of S. tanaceti

genomic DNA in a TaqMan assay.

Figure 7.3. Correlation between infection level of S. tanaceti (%) and Ct value in

TaqMan PCR assay.

xvii

List of abbreviations

ACT Actin ai active ingredient

ANOVA Analysis of variance

BLAST Basic Local Alignment Search Tool

BRA Botanical Resources Australia Pty. Ltd.

CBS Centraalbureau voor Schimmelcultures fungal collection co Conidium

Cort Cortex cu Cuticle

Dai Days after inoculation

DMI demethylation inhibitors

EAM Extracellular anthocyanin-like materials

Epi Epidermis

FAA Formalin, acetic acid, ethanol

FMI Flower maturity index ecm Extracellular materials emb Embryo es Empty space

FRAC Fungicide Resistance Action Committee

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

xviii hai Hours after inoculation hypo Hypodermis gt Germ tube hy Hyphae

IGS Intergenic spacer of nrDNA il Inner layer

ITS Internal Transcribed Spacer of nrDNA

IGS Intergeneric sequence of nrDNA

LS Longitudinal section

LSD Least significant difference

LSU Large subunit (28S nrDNA) mai Months after inoculation

MAT Mating-type gene/locus ml Middle lamella nrDNA nuclear ribosomal DNA ol Outer layer

PCR Polymerase chain reaction

PDA Potato dextrose agar

Ph Phloem r Ridge st Stomata

SDHI succinate dehydrogenase inhibitors

xix

SDW Sterile distilled water

SSU Small subunit (18S nrDNA)

TAS Tasmanian Institute of Agriculture Fungal Collection

TIA Tasmanian Institute of Agriculture

TS Transverse section

TUB2 Beta tubulin 2

UMTAS Tasmanian Institute of Agriculture Fungal Collection at University of Melbourne

WA Water agar wai weeks after inoculation

X Xylem

Preface Publications from this thesis

Bhuiyan MAHB, Groom T, Nicolas ME, Taylor PWJ, 2015. Histopathology of S. tanaceti infection in pyrethrum leaf lamina. Australasian Plant Pathology, 44 (6), 629-

636.

Bhuiyan MAHB, Groom T, Nicolas ME, Taylor PWJ, 2016. Infection process of S. tanaceti in pyrethrum seeds and seedlings. Plant Pathology, doi:10.1111/ppa.12622.

Bhuiyan MAHB, Groom T, Nicolas ME, Taylor PWJ, 2017. Disease cycle of

Stagonosporopsis tanaceti in pyrethrum plants. Australasian Plant Pathology, 46 (1),

83–90.

Bhuiyan MAHB, Groom T, Nicolas ME, Taylor PWJ, 2017. TaqMan PCR assay for detection and quantification of Stagonosporopsis tanaceti in pyrethrum seed and seedlings. European Journal of Plant Pathology (accepted). DOI 10.1007/s10658-

017-1343-1.

Bhuiyan MAHB, Groom T, Nicolas ME, Taylor PWJ, Effect of Stagonosporopsis tanaceti on growth and development of pyrethrum (manuscript in preparation).

Bhuiyan MAHB, Groom T, Nicolas ME, Taylor PWJ, Biology and host pathogen interaction and management of ray blight of pyrethrum in Australia. A review article is preparing to submit in Plant Pathology.

xxi

Conference proceedings:

Bhuiyan, M. A. H. B. Biology and host-pathogen interaction of Stagonosporopsis tanaceti; the causal agent of ray blight disease in pyrethrum. BRA Pty Ltd, Ulverstone,

Tasmania. 16 September, 2016.

Bhuiyan, M. A. H. B. Nicolas M. E. and Taylor, P. W. J. Ray blight disease development (Stagonosporopsis tanaceti) in pyrethrum. APS Meeting, Tampa, Florida,

USA, 5-9 August, 2016.

Bhuiyan, M. A. H. B. Nicolas M. E. and Taylor, P. W. J. Histopathology of

Stagonosporopsis tanaceti infected pyrethrum seed. APPS conference in Perth,

Australia. 14-16 September, 2015.

Bhuiyan, M. A. H. B. Nicolas M. E. and Taylor, P. W. J. Biology and host-pathogen interaction of Stagonosporopsis tanaceti, the cause of ray blight disease in pyrethrum.

APPS-Victoria general meeting. 16th February, 2015.

Bhuiyan, M. A. H. B. and Taylor, P. W. J. Effect of crown infection by

Stagonosporopsis tanaceti on growth and development of pyrethrum. The Australasian soil-borne diseases symposium. Hobart, Tasmania. 10-13 November, 2014.

Bhuiyan, M. A. H. B. Groom, T. and Taylor, P. W. J. Infection and colonization of pyrethrum leaves by Stagonosoporopsis tanaceti. August 9-13. 2014 APS-CPS Joint

Meeting, Minneapolis, Minnesota, USA.

xxii

Chapter 1: Introduction

Chapter 1 Introduction

Pyrethrum (Tanacetum cinerariifolium (Trevir.) Sch. Bip.) is a perennial herbaceous plant belonging to the Asteraceae family and is commercially grown in Australia for the production of insecticidal pyrethrins (Zito, 1994; Katsuda, 1999). Pyrethroid insecticides are highly effective against insects (Andreev et al., 2008; Sladonja et al.,

2014), used in food preservation and organic farming throughout the world (Li et al.,

2011; Sladonja et al., 2014), have low toxicity to mammals and the compounds are broken down after exposure to light and air (Elliott, 1995). Pyrethrum plants originated from the Dalmatian coast of Croatia but now are commercially grown in Kenya,

Rwanda, Tanzania, Papua New Guinea, Australia (Tasmania and Victoria) and China

(Pethybridge et al., 2008b). In Australia, approximately 3000 ha of pyrethrum are grown which accounts for two thirds of production worldwide (Hay et al., 2015).

Ray blight caused by Stagonosporopsis tanaceti is a serious disease that affects pyrethrum production in Australia (Vaghefi et al. 2016a). Ray blight causes substantial yield reduction and complete yield loss is possible in serious outbreaks (Pethybridge et al., 2008b; 2013). Over the last 10 to 15 years there has been research into the epidemiology, population structure, development of disease diagnostic techniques and management of ray blight of pyrethrum however, the mechanism of infection and colonisation of pyrethrum plants and the effect of S. tanaceti infection on growth and development of pyrethrum cultivars has not been assessed.

Chapter two in this thesis is a review of the literature of ray blight in pyrethrum with an introduction to the Australian pyrethrum industry, insecticidal properties of pyrethrins, ray blight disease cycle, epidemiology, management practices and diagnostics of S.

Chapter 1: Introduction

tanaceti. This chapter also outlines the gaps in understanding of the biology and infection process of S. tanaceti and hence the disease cycle of ray blight.

Chapter three details the infection by S. tanaceti of leaves of pyrethrum and formation of pycnidia in the leaf tissues. The development of a differential staining technique in histopathology is also discussed. Seed is the primary source of inoculum for transmission of S. tanaceti from seed-to-seedlings. Chapter four describes S. tanaceti infection within the seed coat and developing embryo and details the mechanism of seed-to-seedling infection.

Severe necrosis and chlorosis of crown tissues has been associated with yield decline in pyrethrum fields in northern Tasmania. Several fungal pathogens including Paraphoma vinacea and Fusarium oxysporum have been reported to cause crown rot of pyrethrum

(Moslemi et al., 2016; 2017b). Although, S. tanaceti is a major foliar pathogen of pyrethrum its role in crown infection has not been determined. Chapter five therefore, describes the process of crown infection by S. tanaceti. In addition, the infection process of S. tanaceti in plant tissues of mature plants such as petiolate leaf, flower stems, buds and roots are also described. Secondary dispersal of S. tanaceti conidia is discussed in relationship to elucidating the disease cycle of S. tanaceti in pyrethrum.

The effect of S. tanaceti infection on growth and development of five cultivars of pyrethrum is described in chapter six.

Molecular diagnosis to detect S. tanaceti in pyrethrum seed has been limited to using conventional PCR (Pethybridge et al., 2006). A multiplex PCR using single reactions was recently developed to identify three closely related Stagonosporopsis species that caused ray blight in pyrethrum and chrysanthemum (Vaghefi et al., 2016b). Chapter seven presents results on the detection and quantification of S. tanaceti inoculum in

Chapter 1: Introduction

naturally infected farmer’s pyrethrum seed lots using quantitative real time TaqMan

PCR. In addition, this assay was used to detect S. tanaceti latent infection within the seedlings.

Chapter 2: Literature Review

Chapter 2 Review of the literature

2.1. Pyrethrum

2.1.1. Origin and distribution

Pyrethrum (Tanacetum cinerariifolium (Trevir.) Sch. Bip., syn. Chrysanthemum cinerariifolium (Trevir.) Vis. ≡ Pyrethrum cinerariifolium Trevir.) is a perennial herbaceous plant which belongs to the family Asteraceae (Grdiša et al., 2009) and is cultivated for extraction of pyrethrins which have insecticidal properties. Tanacetum cinerariifolium was identified as a species in Dalmatia in 1847 (Glynne-Jones, 2001) and then plants were transferred to the East coast of the Adriatic Sea, Italy, northern

Albania, Croatia, Bosnia and Herzegovina and Montenegro. The period between 1910 to 1930 was considered as the golden years of pyrethrum production in Dalmatia when the pyrethrum was used to control insects in crops. But, with the inception of DDT and

World War II, production of pyrethrum in these regions was reduced (Grdiša et al.,

2009). Pyrethrum production was introduced to Kenya by Captain Gilbert Walker in

1928 (Chandler, 1948). Other major pyrethrum producing countries are China, Kenya,

Tanzania, Rwanda, Papua New Guinea and Australia (Pethybridge et al., 2008b).

2.1.2. Insecticidal properties of pyrethrum

The insecticidal properties of pyrethrum were discovered by a Croatian pharmacist

Antun Drobac (1810-1882) (Grdiša et al., 2009). Dried pyrethrum flowers were known as ‘Persian dust’ (Davies et al., 2007) and ‘Dalmatian insect powder’ in Europe for controlling mosquitoes and body lice on humans and animals (Glynne-Jones, 2001).

Chapter 2: Literature Review

The majority of pyrethrins (about 94%) are contained within the secretory ducts and oil glands of achenes of the pyrethrum flower. Dried pyrethrum flowers contain about 1-

2% pyrethrins by weight. Natural form of pyrethrins include six polyacetylenes namely pyrethrin I, pyrethrin II, jasmolin I, jasmolin II, cinerin I and cinerin II (Pan et al.,

1995). Among these, pyrethrin I and II have the natural constituent used for controlling insects (Elliot, 1976). Pyrethrins have low mammalian toxicity and insects are not likely to develop resistance to these insecticides (Crombie and Elliot, 1961). Usually, pyrethrins act on the voltage-gated sodium channel leads to paralysis and death of insects (Davies et al., 2007). However, in recent times some of insects such as pollen beetle (Meligethes aeneus) developed resistance against pyrethrins (Cook et al., 2006) because they modified the sodium channel protein that prevented binding of insecticides

(Davies et al., 2007).

2.1.3. Production of pyrethrum in Australia

Tasmania is the major pyrethrum producing area in Australia. Pyrethrum is predominantly produced in the northwest coast of Tasmania between Deloraine (41° 31´

S; 146° 39´ E) and Table Cape (40° 56´ S; 145° 43´ E) (Pethybridge et al., 2008b) which covers more than 3000 ha. Pyrethrum production has also expanded to the

Ballarat region of Victoria (Suraweera et al., 2014). Cultivation of pyrethrum in

Australia is intense with the use of herbicides, fungicides, fertilizers and overhead irrigation. Seeds are used as the primary planting material and fields are prepared in late winter and early spring (July-September). Harvesting of flower heads is performed mechanically in the subsequent summer (December-January), 15-18 months after planting. After first harvest, new shoots emerge from the crown which remain semidormant in winter, and then flower stems develop in the subsequent spring

Chapter 2: Literature Review

followed by harvesting in summer (Pethybridge et al., 2008b). This production cycle is continued for 4-5 years (Pethybridge et al., 2009).

2.1.4. Morphological and anatomical features of the pyrethrum plant

The height that pyrethrum plants can achieve is between 75 and 100 cm. The lower part of the plant (from just below the soil level to 3-5 cm above soil level is called the crown region from where shoots originate (Fig. 2.1a). A single daisy-like inflorescence originates from a single shoot. In addition, secondary shoots are also produced from the crown from where inflorescences are produced. The pinnatipartite leaves are composed of the cauline leaves which are short petiolate (leaves that are borne on the stem as opposed to the basal leaves) and the basal leaves which are 10 to 20 cm long and petiolate (Bhat, 1995; Greenhill, 2007).

Trichomes are present in large numbers on both the adaxial and abaxial leaf epidermis, and petiole of Tanacetum spp (Esau, 1977). These trichomes are also present in vallecular grooves of seeds of other Asteraceae plants (Simmons et al., 2002). The flowers are composed of yellow disc florets on the centre of the flower head and white ray florets on the outer edge of flower head that originate from the pyrethrum inflorescence. The ray florets have a strap shaped corolla which is tubular at the base and envelopes the style, which is placed on top of the ovary. The pentagonal ovary is attached with a green calyx. Disc florets are bisexual and ray florets contain only the female organ. Stamens are situated at the base of the inner surface of the corolla (Grdisa et al., 2009). Due to sporophytic incompatibility only cross pollination results in fertilization and embryo development (Bhat, 1995).

Chapter 2: Literature Review

Fig 2.1. a. A mature pyrethrum plant; b. A mature pyrethrum seed, c. Dissected seed with different tissues (ol: outer layer, il: inner layer, emb: embryo). Scale bar in b= 1 mm; c= 250 µm.

Seed (Fig. 2.1b & c) of pyrethrum is termed as the achene (Spjut, 1994). According to

Harris and Harris (1994) achenes are small, indehiscent dry fruit which have a single locule and single ovule and the ovule is attached to the ovary wall at a single point. The modified calyx of the pyrethrum seed is attached persistently to the seed and is called the pappus which is bristly and plumose (Frangiote-Pallone and De Souza, 2014). The length of seed is 2.5-3.5 mm long, curved inward with five ribs, glandular and has an irregularly lobed corona in the pappus 0.7-1.0 mm high (Dillon, 1981). There is a basal abscission zone called the carpopodium which is formed by one or more rows of cells usually distinct from the achene wall. This wall is regarded as the anchor point of the inferior ovary of the floret to the inflorescence (Roque et al., 2009, Marzinek and

Oliveira, 2010). Both glandular and non-glandular trichomes are the common features of many species of Asteraceae (Metcalfe and Chalk, 1950). The trichomes are one of the major characteristics of the pericarp of many Asteraceae (Roth, 1977).

Chapter 2: Literature Review

2.1.5. Fungal diseases of pyrethrum

Commonly occurring fungal diseases of pyrethrum in Australia are ray blight

(S. tanaceti), tan spot (Didymella tanaceti/ D. rosea), sclerotinia crown rot (Sclerotinia minor), sclerotinia flower blight (Sc. sclerotiorum), botrytis flower blight (Botrytis cinerea), winter blight (Alternaria tenuissima), pink spot (Stemphylium botryosum), anthracnose (Colletotrichum tanaceti) and two foliar pathogens A. infectoria and S. herbarum (Vaghefi et al., 2016b; Moslemi et al., 2017a). Recently Paraphoma vinacea, causal agent of paraphoma crown rot and F. oxysporum isolated from yield decline affected areas in northern Tasmania were reported to be significant pathogens of pyrethrum plants (Moslemi et al., 2016; 2017b). Among these diseases, ray blight is considered as the major foliar disease of pyrethrum (Vaghefi et al., 2016b).

2.2. Ray blight

Ray blight is named because of the characteristic blighting symptom of the corolla of the ray florets which results in discoloured heads that become straw coloured and withered (Stevens, 1907). Ray blight of pyrethrum was identified in Kenya in 1954, in

Tanzania in 1964, in Papua New Guinea in 1984 and in Australia in 1995 (Pethybridge and Wilson, 1998). The disease caused minor losses from 1995-1999 (Pethybridge et al., 2008b) however, recent severe outbreaks have become common in many pyrethrum fields in Australia causing complete crop loss if not managed (Vaghefi et al., 2016b).

2.2.1. Taxonomy of ray blight pathogens

Ray blight was first reported in chrysanthemum with the causal organism being described as Ascochyta chrysanthemi (Stevens, 1907). The teleomorph of the ray blight pathogen was initially described as Mycosphaerella ligulicola by Baker et al. (1949) but

Chapter 2: Literature Review

was later renamed Didymella ligulicola (Müller and Von Arx, 1962). Again, with extensive studies on type-species of Ascochyta and Phoma, D. ligulicola was renamed as Phoma ligulicola (Van der Aa et al., 1990). Based on the macro-chemical reaction to

NaOH, P. ligulicola was again divided into two varieties; P. ligulicola var. ligulicola which produced colourless antibiotic metabolite ‘E’ upon application of NaOH that lead to oxidation, therefore red pigmentation was generated on malt extract agar. In contrast no oxidation occurred when other varieties of Phoma were reacted with NaOH, hence the name Phoma ligulicola var. inoxydabilis (Van der Aa et al., 1990).

2.2.2. Molecular classification of Phoma sp.

Classification of Phoma sp. based on morphological characteristics of conidial size and shape, cultural characteristics, colony growth rate and variation of colony colour is very complicated (Aveskamp et al., 2010). Therefore, the majority of Phoma species were reclassified based on evolutionary phylogenetic analysis of DNA sequences (De Gruyter et al., 2009). In order to delineate generic boundaries of nine Phoma species in the

Didymellaceae family, Aveskamp et al. (2010) used multi-locus sequence typing based on sequences obtained from 28S nrDNA (LSU), 18S nrDNA (SSU), internal transcribed spacer (ITS) regions 1&2 and 5.8S nrDNA (ITS), and part of the beta-tubulin (TUB) gene region for phylogenetic studies. Based on the sequence data, Phoma ligulicola was found to belong to the Didymellaceae family. Reference strains of Phoma ligulicola were reclassified to Stagonosporopsis based on both molecular data and morphological observations (Vaghefi et al., 2012). The causal organism of ray blight previously identified as Phoma ligulicola var. inoxydabilis (Pethybridge and Wilson, 1998) was then redescribed as Stagonosporopsis tanaceti based on multi-gene phylogeny (actin, elongation factor 1-alpha, internal transcribed spacer region and beta-tubulin 2 gene

Chapter 2: Literature Review

sequences) (Vaghefi et al., 2012). Stagonosporopsis chrysanthemi and S. inoxydabilis were also elevated to species level from the two varieties of S. ligulicola. These two species although causing ray blight in pyrethrum in Europe have never been reported in

Australia (Vaghefi et al., 2012).

2.2.3. Infection process of S. tanaceti in pyrethrum

Pethybridge et al. (2006) suggested that S. tanaceti infected both within and outside of the pyrethrum seed. However, exact location of infection within the seed tissue was not established. Although S. tanaceti caused necrotic lesions on leaf margins which lead to defoliation (Pethybridge et al., 2008b) little is known about the initial infection process by S. tanaceti, establishment of infection and time required to develop fruiting structures in pyrethrum plants tissues.

2.2.4. Source of S. tanaceti inoculum

Pyrethrum seed is the major source of S. tanaceti inoculum with alternative hosts playing a minor role as a source of inoculum (Pethybridge et al., 2006).

Stagonosporopsis tanaceti has the ability to infect alternate hosts such as annual chrysanthemum (Chrysanthemum carinatum), Tagetes patula and Chenopodium carinatum (Vaghefi et al., 2016b; Pethybridge et al., 2008a) which could be possible sources of inoculum. Pethybridge et al., (2008a) showed that Australian S. tanaceti isolates were unable to cause disease in zinnia (Zinnia elegans), sunflower (Helianthus annuus), dahlia (Dahlia variabilis) and some cultivars of lettuce (Lactuca sativa).

Dispersal of the pycnidiospores by rain splash from the infected plants to adjacent healthy plants commonly occurs in pyrethrum fields (Pethybridge et al., 2003).

Ascospores have been shown to be absent in the ray blight-pyrethrum pathosystem in

Chapter 2: Literature Review

Australia (Vaghefi et al., 2015a). Stagonosporopsis tanaceti overwinters in plant debris and the severity of necrotic leaf lesions on pyrethrum plants increased with the increase of overwintering frequency of S. tanaceti on plant debris (Pethybridge et al., 2011;

2013).

2.2.5. Epidemics of ray blight in pyrethrum

An epidemic is an increase in disease with time and space (Van Maanen and Xu, 2003).

Plant disease epidemics occur in a cyclical manner which is repeated cycles of pathogen development in relation to host and environment. An epidemic resulting from the pathogen producing only one reproductive cycle per crop season is called a monocyclic epidemic, whereas an epidemic resulting from more than one reproductive cycle per crop season, is referred to as polycyclic epidemic (Van Maanen and Xu, 2003). Both monocyclic and polycyclic epidemics have been reported in ray blight of pyrethrum in

Australia (Pethybridge et al., 2011).

In Australia, incidence and severity of ray blight is higher in September and decreases gradually in October when the number of consecutive days with rainfall is reduced

(Pethybridge et al., 2005; 2009). A survey conducted by Pethybridge et al. (2003) reported that the isolation frequency of S. tanaceti from pyrethrum leaves was ~19.4% in early to midwinter, 37.8% in late winter and 56.9 to 82.7% over the spring.

According to McCoy (1973) wet and warm conditions favour the development of ray blight epidemics in chrysanthemum. Pethybridge et al. (2003) showed that the isolation frequency of S. tanaceti from the necrotic lesions of pyrethrum plant parts increased during September and October in 2000-2001 due to changes in host physiology. In chrysanthemum, development of epidemics of S. chrysanthemi was favoured by the wetter and warmer conditions of spring (McCoy and Dimock, 1973).

Chapter 2: Literature Review

Rainfall and temperature coupled with edaphic or site specific factors such as aspect and elevation of the fields are also considered as risk factors for ray blight outbreak in pyrethrum (Pethybridge and Hay, 2001; Pethybridge et al., 2009). For many fungal pathogens, rain splash plays a vital role in dispersal of spores (Fitt et al., 1989).

Pyrethrum plants grown in south-facing slopes and in valleys are at higher risk of infection by S. tanaceti as compared to north-facing slopes and on the crests of hills in

Tasmania (Pethybridge et al., 2009). Moreover, densely populated pyrethrum fields are subjected to infection by S. tanaceti due to favourable microclimatic conditions

(Pethybridge et al., 2011).

2.2.6. Management of ray blight in pyrethrum

2.2.6.1. Use of heat treatment of seed

Thermotherapies such as hot water, hot air, solar heat, aerated steam and radiation were suggested to eliminate seed-borne fungal pathogens in pyrethrum seed (Pethybridge et al., 2006) however, the efficacy of these treatments to control S. tanaceti in pyrethrum seed have not been assessed. Effectiveness of hot water combined with aerated steam and thyme oil (0.1%) was reported to reduce seed borne Phoma on carrot, cabbage and lamb’s lettuce seed without affecting seed germination (Schmitt et al., 2009).

2.2.6.2. Management of cultural practices

Pyrethrum plants are perennial growing for 3-4 years in the field but decline of plant regrowth after harvest has increased over the last 10 years leading to reports of yield decline (Moslemi et al., 2016). The microclimate of densely populated pyrethrum fields is favourable for ray blight epidemics therefore, reduction of plant density was suggested as a means for reduction of inoculum in the subsequent years (Pethybridge et

Chapter 2: Literature Review

al., 2011). Minimizing the use of liquid fertilizers and overhead irrigation (Fox, 1998), rouging and burning of diseased plants, cultivation of disease free planting materials and rotation with non-susceptible hosts for at least 3 years (Baker et al., 1949, 1961;

Fox, 1998) have been suggested as useful management practices for controlling ray blight in chrysanthemum (Pethybridge et al., 2008b).

The flowers of perennial pyrethrum plants are harvested 2-3 times in a year by mechanical harvesting that separates the flower heads from the stems and then cuts the flower stems at the crown region, leaving the crop residues in the field (Moslemi et al.,

2017b). Surveys conducted in 2015-16 at yield-decline affected sites of pyrethrum in northern Tasmania reported necrotic leaf and crown tissues with fungal fruiting structures of different fungi including ray blight pathogen in the crop residues (Moslemi et al., 2017a). The practice of crop rotation could be beneficial for controlling pathogens that remain in the crop residues (Keinath, 1996). Two year crop rotation with non- cucurbit plants was used to reduce inoculum level of gummy stem blight (S. cucurbitaceae) in plant debris in the soil (Li et al., 2016).

Although cultivation of disease resistant cultivars has been shown to be effective to manage ray blight in chrysanthemum (Strider, 1994) a breeding program for resistance to S. tanaceti in pyrethrum has yet to be developed.

2.2.6.3. Management of ray blight using fungicides

Management of ray blight currently relies mostly on application of fungicides such as succinate dehydrogenase inhibitors (SDHI’s), demethylation inhibitors (DMI’s), strobilurins (methoxyacrylates), aniline-pyrimidines and phenylpyrroles applied in spring as recommended by Fungicide Resistance Action Committee (FRAC) to avoid resistance risk. Application of any of FRAC group fungicides such as azoxystrobin or

Chapter 2: Literature Review

difenoconazole (Score) in early spring has been shown to control ray blight in pyrethrum (Pethybridge et al., 2007). Meanwhile, additional application of any of these fungicides in autumn did not provide additional protection (Pethybridge et al., 2005;

Jones et al., 2007). In a severe outbreak, complete crop loss was recorded in pyrethrum fields left untreated in spring Pethybridge et al. (2007, 2011).

Pyrethrum seeds infected with S. tanaceti have been shown to be a primary source of ray blight infection (Pethybridge et al., 2006). Defoliation severity in spring correlated with the incidence of S. tanaceti in pyrethrum seed during harvest. Therefore, application of fungicides in the standing crops in spring (November) prior to harvest in

February reduced seed-borne infection (Pethybridge et al., 2006). Fungicide seed treatments have been shown to reduce the growth of the inoculum within the chick pea seed coat or protecting the seed from P. rabei after planting (Agarwal and Sinclair,

1997). The most effective seed treating chemicals such as thiabendazole/thiram and fludioxonil were used to reduce the incidence of S. tanaceti in pyrethrum seed

(Pethybridge et al., 2006). Thiram as a seed treating fungicide has also effectively controlled P. betae on sugar-beet seed (Durrant et al., 1988) and P. lingam on brassica seed (Maude et al., 1984).

2.2.7. Diagnostics of S. tanaceti in pyrethrum plants

Disease diagnosis includes traditional/ conventional approaches, which involves interpretation of visual symptoms followed by laboratory identification of the causal pathogen using selective media and microscopy (Ward et al., 2004). Drawbacks such as requirement of highly specialised expertise, length of time for diagnosis and inconclusive results are related to traditional approaches. Meanwhile, nucleic acid based molecular diagnostics have been used increasingly in recent years (Martin et al., 2000)

Chapter 2: Literature Review

due to the specificity, sensitivity and rapidness of detection (Ward et al., 2004). Over the last decade traditional and molecular detection assays have been developed to assess the incidence of infection of S. tanaceti in planting materials of pyrethrum.

2.2.7.1. Assay by visual observation

Assay by visual observation is very simple and inexpensive but requires experience to identify symptoms associated with a specific pathogen (Walcott, 2003; Mancini et al.,

2016). A problem of this technique is that similar kinds of symptoms are produced by different pathogens therefore, the results are not accurate especially to the fungal species level (Murakishi, 1951; Ward et al., 2004; Mancini et al., 2016). Due to similar symptoms produced by different pathogens, it is not always recommended to identify a particular pathogen based on symptoms (Andersen and Leach, 1961; Ward et al., 2004).

Visual observation of symptoms has been used for identifying infected seed such as for lettuce, lamb’s lettuce, basil, chicory, endive and spinach (Gullino et al., 2014).

Limited studies have been conducted on symptomology of S. tanaceti infected pyrethrum seed. The typical ‘shepherd’s crook’ symptom in diseased buds and flowers with a clear constriction and outlining between the necrotic and healthy part of the peduncle is the most characteristic symptom of ray blight in pyrethrum (Fig. 2.2).

Besides necrotic lesions on flower buds and flower stems, lesions have also appeared on leaf margins and newly developing shoots (Pethybridge et al., 2008b). However, little is known about whether the petioles (particularly at the base) and crown tissues become infected and infection on above ground foliage is transmitted to the roots or flowers through vascular tissues.

Chapter 2: Literature Review

Fig 2.2. Flower stems infected by Stagonosporopsis tanaceti showing “shepherd crook” symptom (white arrow).

2.2.7.2. Agar plate incubation assay

Agar plate incubation is considered as a direct method of testing seeds for fungal infection (Mancini et al., 2016) and has been widely used to identify the incidence of

S. tanaceti infection of pyrethrum seed. The method is based on identifying S. tanaceti cultural characteristics on potato dextrose agar (PDA) or V8 agar media (Pethybridge et al., 2008b; Vaghefi et al., 2012). This technique is very simple and inexpensive to isolate and detect seedborne fungi, but accurate identification based on morphology of cultures can be difficult if many different pathogens are isolated. In addition, this technique is time consuming and laborious (Mancini et al., 2016).

Chapter 2: Literature Review

2.2.7.3. Molecular TaqMan PCR assay

In contrast to the difficulties to identify closely related plant pathogens using traditional assays, molecular detection assays have been shown to precisely identify specific pathogens (Mancini et al., 2016). Among the molecular assay techniques, conventional

PCR-based detection assays have been used to detect the genotype of an organism, which were highly precise, sensitive, rapid and unaffected by the environmental changes. PCR-based markers have been used to identify the targeted pathogen from the infected plant parts (Luo and Mitchell, 2002). The main disadvantage of conventional

PCR is that it only generates qualitative data and does not provide information on the percentage of infected seeds which is vital information needed for the seed growers

(Mancini et al., 2016). Multiplex assays are used to differentiate multiple pathogens in a single reaction (Luo and Mitchell, 2002; Lievens and Thomma, 2005).

Real-time qPCR assay quantifies specific DNA targets (Ward et al., 2004). This assay has less possibility of false positive reaction in a cross contamination of reaction mixtures (Tomlinson et al., 2005), is less time-consuming than other detection assays, highly sensitive and rapid (Mancini et al., 2016). Real time qPCR enabled sensitive and reliable detection of fungal pathogens with quantification of F. graminearum DNA in infected wheat seed using SYBR green or TaqMan probe detection techniques (Demeke et al., 2010; Horevaj et al., 2011).

A PCR-based method for detection of S. tanaceti in pyrethrum seed was developed based on amplification of the ITS region of the ribosomal DNA genes of S. tanaceti

(Pethybridge et al., 2004). However, the ITS sequences were very similar for the three closely related ray blight pathogens S. tanaceti, S. chrysanthemi and S. inoxydabilis and hence could not discriminate these species. Although S. tanaceti occurs in Australia, S.

Chapter 2: Literature Review

inoxydabilis has been reported to cause ray blight of pyrethrum in Europe while S. chrysanthemi is the causal agent of ray blight of Chrysathemum sp (Vaghefi et al.,

2016a). In order to prevent the entry of S. inoxydabilis and S. chrysanthemi into

Australia, taxon-specific DNA-based markers are needed to differentiate these three ray blight pathogens (Vaghefi et al., 2012).

In contrast to the ITS, intergenic spacer (IGS) region is more diverse with high copy number within the nrDNA gene complex (Chilvers et al., 2014; Liew et al., 1998).

Multiple copies of the IGS region have not evolved separately in many organisms, as this region is homogenised through the process of concerted evolution (Hillis and

Dixon, 1991). The IGS region is homogenised in asexually reproducing species through mitotic recombination (Mekha et al., 2010). Due to presence of more sequence polymorphism in the IGS region compared to ITS region (Pantou et al., 2003), the IGS region was found to be suitable for discriminating multiple closely related species

(Sanzani et al., 2012). Therefore, Vaghefi et al., (2016b) sequenced the 28S ribosomal

RNA gene and 28S-18S ribosomal RNA IGS region from S. tanaceti strain CBS

131484 which was 3006 bp long (GenBank accession number is KP161044; NCBI website). Vaghefi et al. (2016a) used the IGS region to develop a species-specific primer pair for S. tanaceti which produced ~400 bp amplicon. Separate species-specific primers were developed to identify S. inoxydabilis and S. chrysanthemi. Using multiplex PCR assay, three amplicons (~400 bp in S. tanaceti, ~630 bp in S. inoxydabilis and ~560 bp in S. chrysanthemi) were generated all together in a single reaction (Vaghefi et al., 2016b).

Besides ITS and IGS, actin sequences were used to distinguish S. andigena and S. crystalliniformis in potato or tomato leaves (de Gruyter et al., 2012). But, actin

Chapter 2: Literature Review

sequence was unable to differentiate the three ray blight pathogens due to limited number of consecutive nucleotide differences which resulted in cross-amplification at low temperature (Vaghefi et al., 2016a). Currently, available detection assays are not sensitive and quick enough to measure the level of S. tanaceti infection within commercial pyrethrum seed lots. Therefore, a TaqMan assay based on the S. tanaceti specific primers developed by Vaghefi et al (2016a) may be a more accurate technique to measure the infection level in pyrethrum seed lots prior to selecting planting material.

2.3. Histopathology

2.3.1. Histopathology of ray blight (S. tanaceti) in pyrethrum

Knowledge of the interaction between the host plant and pathogen is critical for developing new ways to control plant pathogens (Lumsden, 1979). Histopathology provides a means to visualise the fungal hyphae inside the infected plant tissue using differential stains and microscopy. Although, histopathology has been used to study many fungal diseases of plants little is known about the histology of ray blight in pyrethrum.

2.3.2. Role of multiple stains in histopathology

A procedure was developed by Johansen (1939) where quadruple stains were used in paraffin sections of plant tissues colonised by fungal hyphae. These stains were safranin

O, methyl violet 2B, fast green FCF and orange G. A striking colour contrast was created using these stains which helped to identify every type of cell structure with cytoplasmic materials. Invading fungal mycelia in plant cells stained bright green whereas lignified cell walls stained bright red, cutinised cell walls reddish purple, suberized walls red, cellulose cell walls greenish orange, middle lamellae green and

Chapter 2: Literature Review

cytoplasm bright orange (Johansen 1939). Double stain with safranin O-fast green FCF was used in visualising pathological changes in tissues (Bryan, 1955). Orange G in alcoholic solution was used as an excellent agent for differentiating host and parasite.

Moreover, it is also used as a counter-stain for the cellulose walls (Stoughton, 1930).

2.4. Aims of the thesis

This thesis objective is to address the knowledge gaps in the biology and host-pathogen interaction of S. tanaceti in pyrethrum; and develop a TaqMan assay for detection of infected seed and seedlings. Specific aims are to:

1 – Identify the infection, colonisation and reproduction process by S. tanaceti in pyrethrum leaves;

2 – Identify the infection process of S. tanaceti in pyrethrum seed and the mechanism of transmission from seed to seedlings;

3 – Determine the role of crown infection by S. tanaceti and infected petiolate leaves and flower stems in the disease cycle of ray blight of pyrethrum;

4 – Assess the effect of S. tanaceti on growth and development of five cultivars of pyrethrum;

5 – Develop a TaqMan PCR system to detect and quantify S. tanaceti infection in seed and seedlings of pyrethrum;

The outcomes from this study will expand knowledge on the biology, infection process and disease of the ray blight pathogen in Australia. In addition, cultivar screening for resistance and development of a TaqMan assay for quantification of S. tanaceti in infected pyrethrum tissues will help the pyrethrum industry to revise and optimise existing management strategies.

Chapter 3: Histopathology of S. tanaceti infection in pyrethrum leaf

Chapter 3

Histopathology of S. tanaceti infection in pyrethrum leaf lamina

3.1.Introduction, research gaps and aims

Stagonosporopsis tanaceti causes necrotic lesions in pyrethrum leaves and petioles. In addition, upper flower stems can become infected with lesions produced on one side of the flower stems that results in drooping of the flower buds hence producing the typical

‘shepherd crook’ symptom (Vaghefi et al., 2016b). In Australia, S. tanaceti reproduces through asexual pycnidia while the sexual mode of reproduction is unknown (Vaghefi et al., 2015a). Disease management approaches are dependent on thorough knowledge of pathogen biology (Bergstrom and Nicholson, 1999). In order to implement a better management system for controlling ray blight in pyrethrum, there is a need to understand the mechanism of infection, colonisation of host tissue and development of reproductive structures. Histopathology of infected plant tissue enables visualisation of disease development within the plant tissues (Alturkistani et al., 2016).

The primary aim of this chapter was therefore, to identify initial infection, colonisation and reproduction by S. tanaceti in pyrethrum leaves using histopathology and differential staining.

Section 3.2 presents the outcomes of this research in a published manuscript that identified the mechanism of initial infection by S. tanaceti in the epidermis of pyrethrum leaves, identified colonisation of infected leaves through intra- and intercellular infection hyphae within cortical tissues, and development of pycnidia.

Chapter 3: Histopathology of S. tanaceti infection in pyrethrum leaf

3.2.Published manuscript

Chapter 3: Histopathology of S. tanaceti infection in pyrethrum leaf

Chapter 4: Infection process of S. tanaceti in pyrethrum seed and seedlings

Chapter 4

Infection process of Stagonosporopsis tanaceti in pyrethrum seed and seedlings

4.1. Introduction, research gaps and aims

The major planting of pyrethrum in Australia is through direct sowing of seed.

However, infected seed is considered as the primary source of inoculum of S. tanaceti

(Vaghefi et al., 2016b). Seed infection and the process of transmission of S. tanaceti from seed-to-seedlings is poorly understood.

The primary aim of this chapter was to identify the infection process in seed and the mechanism of transmission of S. tanaceti from seed-to-seedlings using histopathology and differential staining.

Section 4.2 presents the results of this research in a published manuscript that identified the process of infection by S. tanaceti within the seed tissues, mechanism of pre- and post-emergence death of seedlings and latent infection in the seedlings.

Chapter 4: Infection process of S. tanaceti in pyrethrum seed and seedlings

4.2. Published manuscript

Chapter 4: Infection process of S. tanaceti in pyrethrum seed and seedlings

Chapter 5: Disease cycle of S. tanaceti in pyrethrum

Chapter 5

Disease cycle of Stagonosporopsis tanaceti in pyrethrum plants

5.1. Introduction, research gaps and aims

Although, ray blight infects leaves, petioles, flower stems, flower buds and seed

(Bhuiyan et al., 2015, 2016; Vaghefi et al., 2016b) the role of infected crown and root tissues in the disease cycle is unknown. Moslemi et al. (2016, 2017b) showed that pyrethrum crown tissue infected by Paraphoma vinacea and F. oxysporum affected plant growth and contributed to yield decline in Australia. Secondary dispersal of the pathogen has been shown to occur through water splash and wind-blown pyncidiospores

(Vaghefi et al., 2016b). Elucidation of the disease cycle is important for undertaking efficient disease management (Bergstrom and Nicholson, 1999; De Wolf and Isard,

2007). However, the disease cycle for ray blight in pyrethrum is poorly understood

The primary aims of this chapter were therefore to determine the role of crown and root infection by S. tanaceti, and infected petiolate leaves and flower stems in the disease cycle of ray blight of pyrethrum.

Section 5.2 presents the outcomes of this research in a published manuscript that identified the importance of infection by S. tanaceti in the crown, petiolate leaves and flower stems in the disease cycle of ray blight of pyrethrum.

Chapter 5: Disease cycle of S. tanaceti in pyrethrum

5.2. Published manuscript

Chapter 5: Disease cycle of S. tanaceti in pyrethrum

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

Chapter 6

Effect of Stagonosporopsis tanaceti on growth and development of pyrethrum

6.1. Introduction

Pyrethrum is a perennial herbaceous plant which is established in late winter and early spring (July to September) in Australia using seed as the major planting material (Bhuiyan et al., 2016). First harvest is conducted 15-18 months after planting (December to January) then new shoots are generated from the crown and flower stems again develop in the spring of the following year (Pethybridge et al.,

2008b). The harvesting cycle is meant to continue for at least four years however, the industry has recently been affected by a yield decline that reduces the regrowth of the plants after harvest (Moslemi et al., 2016). Several fungal pathogens such as

Paraphoma sp (Moslemi et al., 2016), F. oxysporum (Moslemi et al., 2017b) and S. tanaceti that causes ray blight (Bhuiyan et al., 2017; Vaghefi et al., 2012) have been associated with yield decline.

Ray blight is considered a major biotic constraint for pyrethrum production in

Australia as the pathogen causes leaf lesions, flower blight and crown infection

(Bhuiyan et al., 2017; Vaghefi et al., 2016b). In the absence of spring fungicides, ray blight has been shown to cause 100% crop loss (Pethybridge et al., 2007). Disease progression by ray blight occurs through both monocyclic and polycyclic disease development (Pethybridge et al., 2011). Monocyclic disease occurs at the early seedling stage where infection hyphae are transmitted from the seed to the crown region of developing seedlings (Bhuiyan et al., 2016). Polycyclic disease occurs in

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

spring when the plants have reached the mature growth stage and infection results from transmission of pycnidiospores from plant to plant (Pethybridge et al., 2005;

Bhuiyan et al., 2016). Mating type gene analysis revealed that S. tanaceti in Australia reproduces asexually and its sexual reproduction is either unknown or present at a very low frequency (Vaghefi et al., 2015a).

Initial infection of leaves of pyrethrum by S. tanaceti occurs through direct penetration of the epidermal cells. Extensive colonisation then occurs through intra- and intercellular hyphae that results in degradation of host tissues. Pycnidia develop in leaves, petioles and flower stems (Bhuiyan et al., 2015, 2017). Conidia released from the pycnidia are dispersed through rain splash with spores transferred through water droplets to the crown region of the plant (Bhuiyan et al., 2017).

Little is known about the role of S. tanaceti in the yield decline syndrome affecting pyrethrum plants and the effect of inoculum concentration on infection, colonisation and subsequent growth and yield of pyrethrum. Management of S. tanaceti is largely dependent on the use of fungicides with genetic resistance to S. tanaceti yet to be identified (Vaghefi et al., 2016b). Therefore, the aim of this study was to develop a glasshouse bioassay to determine the effect of S. tanaceti on growth and yield of five pyrethrum cultivars.

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

6.2. Materials and methods

6.2.1. Experiment 1: Effect of inoculum concentration of S. tanaceti on growth and development of pyrethrum cultivar BR1

Two concentrations of S. tanaceti (UMTAS-1) spore inoculum were used to inoculate plants of cultivar BR1 grown from seedlings to six-month-old (pre- flowering) stage. Sterile distilled water (SDW) was used as a control treatment.

6.2.1.1. Plant source

Plantlets were clonally separated from 10-week-old healthy plant stock (cultivar

BR1) by cutting each plantlet with a sterilized knife through the crown region, transplanting to sterilized potting mix in 10 cm diameter plastic pots and grown in the glasshouse at 25 °C/20 °C day/night in 12 h photoperiod for two weeks. The plants were irrigated using sprinkler irrigation and fertilised twice with 10 g of

Osmocote® (Scotts Australia Pty Ltd, Bella Vista, NSW), once during planting and another six months after planting.

6.2.1.2. Inoculation treatments

Isolate UMTAS-1 of S. tanaceti was cultured on V8 medium at 25°C in a 12 h photoperiod for two weeks then spore suspensions were prepared following the protocol of Bhuiyan et al. (2015).

3 Pyrethrum plants, three months after transplanting, were inoculated with either 10 or

6 10 spores/ mL at ~150 mL/plant, and control plants were sprayed with SDW. All the plants were individually covered with transparent polybags for 48 h. Both inoculated and control plants were arranged randomly and grown in the glasshouse for another

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

four months before being transferred into 20 cm diam plastic pots. These plants were then grown outside the glasshouse under natural conditions and watered by sprinkler irrigation.

6.2.1.3. Assessment of plant growth and incidence of S. tanaceti infection

Four plants were destructively sampled from each of the control and inoculated treatments at 1, 2 and 6 months after inoculation (mai). At each sampling, the plants were cut at the junction between the crown (above ground) and roots (below ground) then five tissue pieces (1-2 cm/piece) were randomly cut using a sterilized razor blade from cauline and petiolate leaves, crown, root and flower stems. Koch’s postulates were completed by culturing these tissues on PDA to reisolate S. tanaceti as described in Bhuiyan et al. (2017). Then the incidence of S. tanaceti infection was determined as described by Bhuiyan et al. (2017). Both above and below ground plant parts of each plant were then separately oven-dried at 70 °C for 48 h and dry weights recorded.

6.2.2. Experiment 2: Effect of S. tanaceti on growth and development of five pyrethrum cultivars

5 For these experiments a spore suspension of 10 spores/ mL of S. tanaceti was used as the inoculation treatment and SDW was used as control treatment for cultivars

BR1, BR2, Pyper, Pyrate and RS5. The plants were grown to flowering, harvested, and then regrown until a second flowering (two growing cycles). Duration for each cycle was about 15 months.

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

6.2.2.1. 1st growing cycle

6.2.2.1.1. Plant source

Two-month-old seedlings of the five cultivars, raised from steam sterilised seed, were separated into single shoots, planted separately in sterilized potting mix in 10 cm diam plastic pots and grown in the glasshouse as described above.

6.2.2.1.2. Inoculation treatment

Three-month-old seedlings of each cultivar were sprayed with a spore suspension of

S. tanaceti at 105 spores/mL as described in experiment 1. The control seedlings were sprayed with SDW. After spray inoculation, each seedling in a pot was separately covered with transparent polybags for 48 h. Both control and inoculated seedlings were separated by a one meter gap in the glasshouse. After 10 weeks, the established plants were transferred into 20 cm diam pots which were then grown outside the glasshouse under natural environmental conditions with three meter gap between the control and inoculated plants to minimise cross infection by S. tanaceti from the inoculated plants to the controls. Each plant was watered twice per day using a drip irrigation system and fertilised twice with 10 g of slow releasing fertilizer

Osmocote®, first at planting in small pots and second at planting in larger pots.

6.2.2.1.3. Defining the life stages of pyrethrum and management of control plants

The growth of pyrethrum per growing cycle was divided into three major stages. The early vegetative stage where new shoots developed from crown tissues, 3 to 4 months after germination. Late vegetative stage, when the development of shoots was completed and the new flower stems had initiated with a few immature flower buds at flower maturity index (FMI; Suraweera et al., 2016) between 100 to 200, 4-6

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

months after germination Flowering or maturity stage where all the flower stems had developed and all flower buds were fully opened, 6 to 12 months after germination.

Control plants were sprayed three times with fungicide Chorus® (Syngenta) @ 4 g/10

L water at 2, 16 and 28 weeks after planting in the 1st growing cycle and 12 weeks after the 1st harvest in the 2nd growing cycle to avoid cross-infection of control plants from spores of infected plants in the inoculated treatment.

6.2.2.1.4. Assessment of plant height, number of shoots, yield of flowers, above ground biomass and incidence of S. tanaceti infection in the 1st growing cycle

Eight plants were destructively sampled from each of the inoculated plants from each of five cultivars at early vegetative (1 mai), late vegetative (3 mai) and flowering (12 mai) stages. Eight of the control plants at each stage were also sampled. At each sampling, plants were cut at the junction between the crown (above ground) and roots (below ground). The length of above ground leaves or flower stems was measured to determine plant height. Total number of green leaves at all three stages, and flowers at the flowering stage, from each plant were counted. At each sampling, five pieces of tissues (1-2 cm/piece) from cauline leaf, petiolate leaf, petiole base, crown, flower stems and roots of each plant were randomly collected and cultured to determine the incidence of S. tanaceti in a particular plant as described above. Above ground tissues from each plant were oven-dried at 70°C for 48 h followed by measuring dry weight as described above.

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

6.2.2.2. 2nd growing cycle:

6.2.2.2.1. Assessment of the number of regenerated shoots, yield of flowers, above ground biomass and incidence of S. tanaceti in the 2nd growing cycle after 1st harvest

Eight plants from each of five inoculated and control cultivars were cut at the crown region (5-cm above the ground level) at flowering stage when the plants were 15- months-old to allow the regrowth of new shoots from the crown tissue in the 2nd growing cycle after 1st harvest.

Total number of shoots per plant was assessed at 3 months after the 1st harvest. All the eight plants from each of control and inoculated cultivars were destructively sampled then each plant was cut at the junction between above and below ground level at 15 months after 1st harvest. At this stage, total number of flowers per plant at

FMI=500-800 was recorded. In addition, from each plant five pieces of tissues (1-2 cm/ piece) were randomly collected from cauline leaf, petiolate leaf, petiole base, crown, flower stem and root for culturing on PDA to determine the incidence of

S. tanaceti. The remainder of the green tissues of each plant was separately oven dried to measure the dry biomass following the steps described above.

6.2.3. Data analysis

The first experiment consisted of inoculating glasshouse plants with one isolate of S. tanaceti at two spore concentrations (103 and 106 spores/ mL) and one control

(SDW) with three different sampling times (1, 2 and 6 months after inoculation) with four replicates at each time giving a total of 36 pots (3x3x4). The pots were arranged in a randomized block design in a glasshouse with 25 °C/20 °C day/night in 12 h photoperiod. Dry biomass of above and below ground parts of the plants were measured at each time. The effect of S. tanaceti inoculum concentration on dry

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

biomass was analyzed using univariate analysis of variance (ANOVA). Non-normal data were log transformed before analysis. Comparison of means was performed by using Tukey HSD test at the 5% level. F-values and significance levels for univariate

ANOVA of the data were analyzed using General Linear Model (GLM) using IBM

SPSS Statistics 22 software.

The second experiment was arranged in a randomized complete block factorial design where Block 1 contained control treatments for five cultivars arranged in a completely randomised design and Block 2 the five cultivars with treatment arranged in a completely randomised design; each block had an unbalanced number of replicates, where each treatment had four or eight replicates. To examine the effect of treatments, cultivars and their interactions for each parameter were measured, data analysed using a general linear model with F-test (P ≤ 0.05) using IBM SPSS

Statistics 22 software. Where interactions were significant, Fisher’s protected least significant difference (lsd at ɑ = 0.05) was calculated.

6.3. Results

6.3.1. Experiment 1: Effect of inoculum concentration of S. tanaceti on growth and development of pyrethrum cultivar BR1

6.3.1.1. Biomass of above and below ground parts of pyrethrum plants

At inoculation concentration of 106 spores/mL there was a significant reduction in biomass of above ground biomass (dry weights) of cultivar BR1 at 1, 2 and 6 months after inoculation (mai; Table 6.1). At 103 spores/mL there was a significant reduction in the above ground biomass only at 6 mai, with no significant difference to the controls at 1 and 2 mai.

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

For below ground biomass for BR1 at inoculation concentration of 106 spores/mL there was a significant reduction at 2 and 6 months mai (Table 6.2). However, at 103 spores/mL there was only a significant difference at 6 mai although dry weights were lower in the infected plants.

Table 6.1. Effect of S. tanaceti inoculum concentration on dry biomass (g) of above ground part of pyrethrum plants

Spore concentration *Biomass (g) at 1 mai Biomass (g) at 2 mai Biomass (g) at 6 mai Control 6.41 (0.787) A 11.62 A 32.75 A

3 10 spores/ mL 4.74 (0.672) AB 7.88 AB 27.75 B

6 10 spores/mL 3.90 (0.587) B 5.22 B 25.75 B

F-ratio (P-value) 4.21 (<0.051) 10.37 (<0.005) 19.77 (<0.001)

Means with different letters in the same column are significantly different by Tukey HSD test (ɑ = 0.05); n=4. F ratio for testing the treatment effect at 2 and 9 df in all cases. * Values in the parenthesis of second column are the means of log transformed values.

Table 6.2. Effect of S. tanaceti inoculum concentration on dry biomass (g) of below ground part of pyrethrum plants

Spore concentration Biomass (g) at 1 mai Biomass (g) at 2 mai Biomass (g) at 6 mai

Control 6.86 A 10.48 A 27.25 A

3 10 spores/ mL 6.47 A 8.33 AB 21.81 B

6 10 spores/mL 5.83 A 6.36 B 19.88 B

F-ratio (P-value) 0.46 (<0.643) 4.84 (<0.037) 19.29 (<0.001)

Means with different letters in the same column are significantly different by Tukey HSD test (ɑ = 0.05); n=4. F ratio for testing the treatment effect at 2 and 9 df in all cases.

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

6.3.1.2. Incidence of S. tanaceti in BR1

Stagonosporopsis tanaceti was recovered in culture from all the inoculated

3 6 pyrethrum plants at 10 and 10 spores/ mL fulfilling Koch’s postulate. In addition, control plants progressively became infected in the foliage with no crown infection and with the incidences of S. tanaceti of 25, 50 and 50% at 1, 2 and 6 months respectively.

6.3.2. Experiment 2: Effect of S. tanaceti on growth and development of five pyrethrum cultivars for two growing cycles

6.3.2.1. 1st growing cycle

6.3.2.1.1. Incidence of S. tanaceti on pyrethrum cultivars at different growth stages

At each sampling at early vegetative, late vegetative and flowering stages, BR1,

BR2, Pyper, Pyrate and RS5 inoculated with S. tanaceti showed 100% incidence of infection as confirmed by Koch’s postulate. None of the control plants of each cultivar was infected by S. tanaceti at the early vegetative and flowering stages.

However, at the late vegetative stage, the incidence of leaf infection by S. tanaceti in control plants of Pyper and RS5 was 12.5 and 25.0% respectively with no infection in BR1, BR2 and Pyrate.

6.3.2.1.2. Effect of S. tanaceti on height of pyrethrum cultivars

The height of S. tanaceti infected cultivars BR1, BR2, Pyrate and RS5 at early vegetative stage was not significantly different to the control however, for Pyper there was a significant reduction in height (Fig. 6.1). At late vegetative stage, the height of infected cultivars BR2, Pyper and Pyrate was significantly less compared to the controls, but the height of infected BR1 and RS5 was not significantly different

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

to the control cultivars. At the flowering stage, the height of all the five infected cultivars was significantly less than the control cultivars. However, the highest (85%) and lowest (59%) reduction occurred in BR2 and Pyrate respectively compared to the controls (Fig. 6.1).

At the flowering stage, the plant height was significantly more increased than at the late vegetative stage in both control and infected cultivars however, the height of infected cultivars was significantly reduced relative to control.

Figure 6.1. Effect of S. tanaceti on plant height (cm) of cultivars BR1, BR2, Pyper, Pyrate and RS5 at three different growth stages. The F value = 3.69 (P ≤ 0.000) and Fisher’s protected l.s.d (P= 0.05) = 2.15 for cultivar × treatment × harvesting time. Capped lines are ± standard errors of the mean values (n=4 in early vegetative and n=8 in late vegetative and flowering stages). Early and late vegetative and flowering correspond to fist, second and third sampling, respectively.

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

6.3.2.1.3. Effect of S. tanaceti on number of green shoots of pyrethrum cultivars and symptoms of infection at crown region

At the early vegetative stage, the number of green shoots of infected BR1, BR2,

Pyrate and RS5 were not significantly different relative to the control. However, infected Pyper had significantly less green shoots than the control. At the late vegetative stage, the number of green shoots of infected BR1, BR2, Pyper and Pyrate were significantly less than the control. However, green shoots of infected RS5 did not differ to the control. At the flowering stage, number of green shoots of all control cultivars was significantly higher than infected cultivars. At this stage, the highest

(44%) and lowest (16%) reduction of green shoots occurred in infected BR2 and

Pyper compared to the control (Fig. 6.2).

At the flowering stage, there was an increased number of green shoots produced from control cultivars (Fig. 6.3a) relative to infected cultivars with dark brown to black necrotic lesions at the crown region (Fig. 6.3b).

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

Figure 6.2: Effect of S. tanaceti on number of green shoots of cultivars BR1, BR2, Pyper, Pyrate and RS5 at three different growth stages. The F value = 3.28 (P ≤ 0.000) and Fisher’s protected l.s.d (P= 0.05) = 0.78 for cultivar × treatment × harvesting time. Early and late vegetative and flowering correspond to fist, second and third sampling, respectively. (n=4 in early vegetative and n=8 in late vegetative and flowering stages).

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

a b

Figure 6.3. Effect of S. tanaceti on growth of shoots and necrosis at the crown region (a) Large number of green shoots and no necrotic lesion (black arrow) at the crown region of non-infected control plants of BR1, (b) Less number of shoots produced with black necrosis (white arrow) at the crown region from infected plants of BR1.

6.3.2.1.4. Effect of S. tanaceti on above ground dry biomass

At early vegetative stage, there was no significant difference in above ground biomass of infected BR2, Pyrate and RS5 compared to the uninfected controls however, the biomass was significantly less in infected BR1 and Pyper compared to the control. At late vegetative stage, above ground biomass of infected BR2, Pyper and Pyrate was significantly less while the biomass of BR1 and RS5 was not significantly different to the control. At flowering stage, above ground biomass of all infected cultivars was significantly reduced relative to non-infected controls. The highest (161%) and lowest (53%) reduction occurred in infected BR2 and Pyrate respectively compared to the control (Fig. 6.4).

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

60 Control Inoculated

20 Above ground biomass (g) biomass ground Above

0 BR1 BR2 Pyper Pyrate RS5 BR1 BR2 Pyper Pyrate RS5 BR1 BR2 Pyper Pyrate RS5 Early vegetative stage Late vegetative stage Flowering stage

Figure 6.4. Effect of S. tanaceti on above ground dry biomass (g) of pyrethrum cultivars BR1, BR2, Pyper, Pyrate and RS5 at early vegetative, late vegetative and flowering stages. The F- value = 13.59 (P ≤ 0.000) and Fisher’s protected l.s.d (P = 0.05) = 1.36 for cultivar × treatment × harvesting time. Capped lines are ± standard errors of the mean values (n=4 in early vegetative and n=8 in late vegetative and flowering stages). Early and late vegetative and flowering correspond to fist, second and third sampling, respectively.

6.3.2.1.5. Effect of S. tanaceti on yield of flowers

The yield of flowers was greatly affected by infection caused by S. tanaceti in the 1st growing cycle. Total flower production per plant was significantly reduced in all five infected cultivars compared to the non-infected controls. The highest (59%) and lowest (34%) reduction of flowers occurred in the infected Pyper and BR1 respectively compared to the non-infected controls (Fig. 6.5).

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

35 Control Inoculated 30

Number of flower of Number 10

0 BR1 BR2 Pyper Pyrate RS5

Figure 6.5. Effect of S. tanaceti on yield of flowers per plant in BR1, BR2, Pyper, Pyrate and RS5. The F-value = 2.56 (P ≤ 0.046) and Fisher’s protected l.s.d (P= 0.05) = 1.98 for cultivar × treatment. Capped lines are ± standard errors of the mean values; n=8 plants.

6.3.2.2. 2nd growing cycle

6.3.2.2.1. Effect of S. tanaceti on regeneration of green shoots

In the 2nd growing cycle, 3 months after the 1st harvest, the inoculation treatment had a highly significant effect on green shoot regeneration (Fig. 6.6a). The uninfected control plants had significantly larger number of green shoots regenerated from the crown tissues for each of the five cultivars compared to the infected cultivars (Fig.

6.6b). The highest (71.72%) and lowest (59%) reduction of new green shoots from the crown occurred in infected Pyper and BR2 respectively relative to the non- infected controls.

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

Figure 6.6. (a) Effect of S. tanaceti on regeneration of shoots per plant in BR1, BR2, Pyper, Pyrate and RS5; The F-Probability ≤ 0.000 for treatment (control vs inoculated), but cultivars and treatment × cultivar were non-significant. Fisher’s protected l.s.d at P= 0.05 for treatment = 2.45; Capped lines are ± standard errors of the mean values (N=8 plants). (b) Comparative regenerated shoots between S. tanaceti infected and control cultivar (BR1) three months after 1st year’s harvest.

6.3.2.2.2. Effect of S. tanaceti on yield of flowers

In the 2nd growing cycle, 15 months after first harvest, the inoculation treatment had significant effect on yield of flowers (Fig. 6.7). There were a significantly higher number of flowers produced in all five control cultivars compared to infected cultivars. Among the infected cultivars, the highest (58%) and lowest (36%) reduction of flowers occurred in Pyper and BR1 respectively relative to the control

(Fig. 6.7).

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

35 Control Inoculated 30

Number of flower of Number 10

0 BR1 BR2 Pyper Pyrate RS5

Figure 6.7. Effect of S. tanaceti on yield of flowers developed from regenerated shoots per plant in five pyrethrum cultivars (BR1, BR2, Pyper, Pyrate and RS5); The F-Probability ≤ 0.000 for treatment (control vs inoculated), but cultivars and treatment × cultivar were non-significant. Fisher’s protected l.s.d at P= 0.05 for treatment = 1.11; Capped lines are ± standard errors of the mean values (n=8 plants).

6.3.2.2.3. Incidence of S. tanaceti on pyrethrum cultivars

In the 2nd growing cycle 15 months after the 1st harvest, all the five infected cultivars showed 100% incidence of S. tanaceti. None of the uninoculated plants of BR1,

Pyrate and RS5 were infected however, there was S. tanaceti infection of leaves in

12.5% of both BR2 and Pyper.

6.3.2.2.4. Effect of S. tanaceti on dry biomass of above ground part of plant

In the 2nd growing cycle after the first harvest, the inoculation treatment had significantly affected the above ground dry biomass (Fig. 6.8). The above ground dry biomass was significantly reduced in all five infected cultivars compared to the controls. The highest (64%) and lowest (42%) reduction of dry biomass occurred in infected Pyper and BR1 respectively compared to the controls (Fig. 6.8).

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

35 Control Inoculated 30

Dry biomass (g) biomass Dry 10

0 BR1 BR2 Pyper Pyrate RS5

Figure 6.8. Effect of S. tanaceti on above ground dry biomass (g) of regenerated shoots per plant in BR1, BR2, Pyper, Pyrate and RS5; The F-Probability ≤ 0.000 for treatment (control vs inoculated), but cultivars and treatment × cultivar were non- significant. Fisher’s protected l.s.d at P= 0.05 for treatment = 1.16; Capped lines are ± standard errors of the mean values (n=8 plants).

6.4. Discussion

Stagonosporopsis tanaceti, the cause of ray blight of pyrethrum, significantly reduced plant height, above ground biomass, shoot and flower numbers of pyrethrum cultivars BR1, BR2, Pyper, Pyrate and RS5 in glasshouse trials over two growing cycles.

The inoculum optimisation experiment showed that there was a significant reduction in biomass of cultivar BR1, 6 months after inoculation (mai) at both 103 and

106spores/ mL. However, at 103 spores/ mL there was no significant difference between the non-inoculated control plants at 1 and 2 mai although dry weights were

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

lower in the infected plants. Both the above and below ground dry weights were significantly reduced at both spore concentrations at 6 mai hence, it would be expected that both these inoculum concentrations may effect subsequent growth and flowering. Similar results were reported by Vloutoglou and Kalogerakis (2000) where there was no difference in leaf symptoms at 24 h for tomatoes inoculated with

A. solani at 5 × 102 or 105 conidia/mL however, the defoliation rate increased linearly with the increase of spore concentration.

In both treatments, all the inoculated plants were infected however, control plants slowly became infected over time so that at 6 mai 50% of the controls had S. tanaceti isolated from the leaf tissue. Bhuiyan et al. (2017) reported that splash dispersal of spores from pycnidia on leaves was an important means of secondary infection for ray blight in pyrethrum. Hence, having both inoculated and control plants grown in close proximity and being watered through a sprinkler irrigation system must have been conducive to the transmission of the S. tanaceti spores from the infected plants to the control plants. Cross leaf infection started within 1 mai and incidence increased over time, thus preventing this experiment from going beyond 6 mai.

Bhuiyan et al. (2016) reported that S. tanaceti produced pycnidia 12 days after the initial infection of pyrethrum leaves so with sprinkler irrigation being conducive to spore dispersal it was not surprising that cross host infection occurred after only 1 month. Schoeny et al. (2008) showed that one asexual pycnidium of M. pinodes could produce 1685 conidia and rain splash played a major role in dispersal of fungal pathogens (Fitt et al., 1989; Schoeny et al., 2008). Hence, the watering system in the second pot trial was changed to drip irrigation to minimise splashing and hence reduce spore dispersal between plants.

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

In the multi-cultivar experiment, with the plants inoculated with a spore concentration of 105 spores/ml, there were necrotic dark brown lesions at the base of petioles and around the crown tissues; and significant reductions in plant growth, shoot numbers, dry biomass and flowers in all five pyrethrum cultivars at the first and second harvests (1st and 2nd growth cycles). The disease symptoms in plants with shoots regrown 3 months after the first harvest resembled the yield decline symptoms seen in field grown plants in yield decline fields in northern Tasmania (Moslemi et al., 2016, 2017a & b). These plants were characterised by necrotic leaf lesions, necrotic crown tissues and stunting.

Although inoculated plants were separated by a distance of 3 m from the uninoculated controls and fungicides were sprayed on the control plants three times in the 1st cycle (2, 16 and 28 weeks after inoculation) and once in the 2nd cycle (12 weeks after 1st harvest), some of the control plants were found to be infected at late vegetative stage in the 1st cycle and at 15 months after 1st harvest in the 2nd cycle.

This cross infection was most likely due to splash dispersal of spores from the inoculated infected plants even though the controls were 3 m in distance from the infected plants. Nevertheless, the infection in the controls was restricted to the lower older leaves and hence would not have been expected to have a major impact on growth and flower development. Thus reductions in growth and yield of the inoculated plants were more likely to be due to the effect of the pathogen especially from crown infection.

In severe outbreaks of ray blight in northern Tasmania in early spring, considerable loss of pyrethrum production was reported to be due to damage to developing flower stems and severe defoliation which ultimately resulted in reduction in plant growth

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

and yield of pyrethrins (Pethybridge et al., 2007; 2008b; 2009). Besides fungal pathogens, the combined effect of drought and prolonged frost has also been shown to affect pyrethrum production (Hay et al., 2015). Javid et al. (2013) showed that a combination of waterlogging and ray blight (S. tanaceti) significantly reduced biomass of pyrethrum. Likewise, growth of field peas (Pisum sativum L.) was reduced due to a combined effect of M. pinodes and abiotic stresses caused by waterlogging (McDonald and Dean, 1996).

In the 2nd cycle after 1st harvest, there were significantly less regrowth of shoots which was likely to have been due to the severely infected crown tissues. The reduced numbers of shoots resulted in lower above ground biomass and less number of flowers in all five infected cultivars compared to the control. None of the cultivars were resistant to S. tanaceti. There was a highly significant decrease of growth parameters (height, green shoots, dry weight) and less yield of flowers in all the infected cultivars relative to controls in both cycles of plant development. However, among the infected cultivars BR1 had the highest flower yield in both cycles and the least reduced biomass in the 2nd cycle as compared to the other four cultivars. In contrast both BR2 and Pyper were the most susceptible to S. tanaceti in terms of growth and yield potential. The lack of resistance to ray blight in pyrethrum is not surprising since these cultivars were mainly selected for high levels of pyrethrins and not for resistance to S. tanaceti (T Groom personal communication). Nevertheless, the tolerance/resistance of BR1 needs to be assessed further, especially in field trials under natural levels of S. tanaceti inoculum.

If BR1 proves to have some degree of resistance to S. tanaceti then the mechanism of resistance needs to be determined and this cultivar could be cultivated in ray blight

Chapter 6: Effect of Stagonosporopsis tanaceti on growth of pyrethrum

prone areas in Australia for better yield or used in a resistance breeding program.

Further trials are needed to determine the importance of the interaction between S. tanaceti and pyrethrum cultivars in combination with abiotic stresses in the field at different pyrethrum growing areas in Australia.

Chapter 7: TaqMan PCR assay

Chapter 7 TaqMan PCR assay for detection and quantification of Stagonosporopsis tanaceti in pyrethrum seed and seedlings

7.1. Introduction

Pyrethrum seed is considered a major carrier of S. tanaceti (Bhuiyan et al., 2016) although infected seed did not show obvious necrotic symptoms or morphological abnormalities. Seedlings with low levels of infection of S. tanaceti that developed from infected seed often did not have symptoms and were difficult to differentiate from healthy seedlings (Bhuiyan et al., 2016).

Culturing pyrethrum seed on biological media has been used to determine the infection level of S. tanaceti in commercial seed lots (Bhuiyan et al., 2016).

However, culturing methods are time consuming and not effective to discriminate closely related fungal species. Molecular detection assays are species specific and have been used to identify closely related species (Mancini et al., 2016).

Polymerase chain reaction (PCR) based molecular detection assays are based on the genotype of an organism therefore, the detection is precise, rapid, sensitive and not affected by the environment (Luo and Mitchell, 2002). A PCR-based molecular detection assay based on primers developed to the ITS gene sequence of S. tanaceti was developed by Pethybridge et al. (2004, 2006) to detect the ray blight pathogen of pyrethrum in Australia. However, the ITS sequence was found to be too conserved to discriminate the closely related ray blight pathogens S. tanaceti and S. chrysanthemi

(Vaghefi et al., 2016b). Vaghefi et al. (2016a) used variable sequences of the IGS region of the ray blight pathogens to design PCR primers to enable differentiation of

Chapter 7: TaqMan PCR assay

these species. These species-specific primers were incorporated into a multiplex PCR

(Vaghefi et al., 2016b). Besides ITS and IGS genes, the actin region has been used to delineate S. andigena and S. crystalliniformis (De Gruyter et al., 2012). However, there are limited numbers of consecutive nucleotides differences among the actin gene of the ray blight pathogens, therefore this gene was unsuitable for discriminating these closely related species (Vaghefi et al., 2016a).

Compared to conventional PCR, TaqMan PCR assay is less time-consuming and highly sensitive (Mancini et al., 2016) and has been used to quantify specific DNA targets (Ward et al. 2004). Moreover, TaqMan PCR has a much lower possibility of a false positive reaction in a cross reaction mixture than conventional PCR (Tomlinson et al., 2005).

Assay techniques to detect and quantify S. tanaceti infection levels within pyrethrum plant tissue are limited. Therefore, the objective of this study was to develop a

TaqMan probe based PCR assay using primers specific to the IGS region to detect and quantify S. tanaceti infection in pyrethrum seed and seedlings.

7.2. Materials and Methods

7.2.1. Extraction of Stagonosporopsis tanaceti genomic DNA and collection of genomic DNA of Stagonosporopsis species

Genomic DNA was extracted from two isolates (TAS1, TAS55503) of S. tanaceti recovered from infected pyrethrum plants in Tasmania as described by Vaghefi et al.

(2016a). Genomic DNA of 14 Stagonosporopsis species, derived from reference cultures were obtained from the culture collection of Centraalbureau voor

Schimmelcultures (CBS), The Netherlands (Table 7.1).

Chapter 7: TaqMan PCR assay

Table 7.1: Isolates used for the validation of diagnostic assay specificity

Species Strain number Substrate Country S. tanaceti TAS1, Tanacetum Australia TAS55503 cinerariifolium S. chrysanthemi CBS 500.63 Chrysanthemum Netherlands morifolium S. inoxydabilis CBS 425.90 C. parthenii Netherlands S. ajacis CBS 177.93 Delphinium sp. Kenya S. chrytalliniformis CBS 713.85 Lycopersicon esculentum Columbia S. andigena CBS 101.80 Solanum sp. Peru S. oculo-hominis CBS 634.92 Human USA S. valerianellae CBS 329.67 Valerianella locusta var. Netherlands oleracea S. caricae CBS 248.90 Carica papaya Chile S. dorenboschii CBS 426.90 Physostegia virginiana Netherlands S. hortensis CBS 104.42 Unknown Netherlands S. heliopsidis CBS 109182 Heliopsis patula Netherlands S. loticola CBS 562.81 Lotus pedunculatus New Zealand S. astragali CBS 178.25 Astragalus sp. Unknown S. trachelii CBS 379.9 Campanula isophylla Netherlands

7.2.2. Agar plate assay of S. tanaceti infection level (%) in seed lots of farmers field

A total of 32 seed samples were collected from seed lots made up from four pyrethrum cultivars (BR1, BR2, RS5 and Pyper) from four farms (site code: 30730,

30734, 30702 and 30724) of Botanical Resources Australia – Agricultural Services

Pty Ltd. (BRA) located at Forth and Kindred in North West Tasmania in the year

2014 and 2015. Four hundred seeds from each sample were plated separately onto

WA in 90-mm petri plates at 10 seed/ plate and incubated at 25°C with 12 h alternating dark and light for 7 d. Stagonosporopsis tanaceti infected seed were identified following the mycelial characteristics developed on WA by Bhuiyan et al.

Chapter 7: TaqMan PCR assay

(2016). The level of S. tanaceti infected seed was calculated using the formula given by Bhuiyan et al. (2016).

7.2.3. DNA extraction from seed samples

One hundred seeds (~129 mg) from each sample (32) were ground into fine powder by using mortar and pestle and liquid nitrogen. Extraction of DNA was performed using the DNeasy Plant Mini Kit (QIAGEN) following manufacturer’s guidelines.

Dilutions of 10 ng/µL were prepared for each seed sample for the use in TaqMan

PCR assays. This process was repeated three times from each sample.

7.2.4. Raising seedling from an infected seed lot and extraction of DNA

A total of 200 seeds from BR1-30730-15 at Forth, North West Tasmania were sown in potting mix (Debco) on a tray (30 × 35 cm) which grew in the glasshouse at 12 h alternating light/ dark at 25°/20°C in day/ night. The tray was watered once per day with 150 mL of water using a sprinkler system. After 3 weeks, 10 seedlings (~150 mg) free from any visible symptoms were randomly collected, washed with sterile distilled water to remove soil then dried in a laminar flow cabinet. DNA was extracted from these seedlings using the CTAB method of Clarke (2009). DNA extraction was repeated for three replicates of 10 seedlings. DNA concentration was adjusted using a NanoDrop 2000 machine (Thermo Scientific®) to a dilution of 10 ng/µL for use in TaqMan PCR assay.

7.2.5. TaqMan PCR primer design and validation

The sequence of the IGS region (~3 kb) of nrDNA of S. tanaceti was obtained from the NCBI database (GenBank accession number KP161044). A variable region

Chapter 7: TaqMan PCR assay

within the IGS, downstream of the 28S rDNA was targeted to design three forward and three reverse primers and a probe sequence (Table 7.2) using Primer3 software

(Rozen and Skaletsky 1999) for the purpose of TaqMan PCR assay. The primer pairs and probe were checked for their specificity using BLAST against NCBI GenBank to avoid the possibility of non-specific priming. Then the primers were synthesised by

Sigma-Aldrich, New South Wales and the probe by Life Technologies Australia Pty

Ltd, Mulgrave, Victoria, Australia.

The amplification conditions were 15 µL of reaction mix containing 0.3 µL of DNA template (2 ng), 0.10 mM each deoxynucleotide triphosphate, 3 µL of buffer (Taq

DNA Polymerase, Bioline®), 0.3 mM of each of forward and reverse primer and 1U

Taq DNA Polymerase (Bioline®). The PCR conditions were initial denaturation at

95°C for 5 min; 35 cycles of 30 s denaturation at 95°C, 30 s annealing at 59°C, extension was for 2 min at 72°C. Products (7 µL) were visualised on ethidium bromide-stained 1.5% (w/v) agarose gels. The specificity of the primers was tested against DNA templates of S. tanaceti (TAS1, TAS55503) and other

Stagonosporopsis species in Table 7.1.

Table 7.2. Designations, sequences and expected product sizes of oligonucleotide primers (forward and reverse) and an oligonucleotide TaqMan probe

Set Primer/ Probe Sequence (5´ to 3´ ) Expected numb product (bp) er i. St_q F1 (forward primer) ATTCCCCCTAAAGGTGAGG 112 St_q R1 (reverse primer) AGTACCTGCCGAAGCTGA ii. St_q F2 (forward primer) CCCTAAAGGTGAGGGTAGG 119 St_q R2 (reverse primer) GAGCTTTTGGGCAGTACCT iii. St_q F3 (forward primer) CATTCCCCCTAAAGGTGAG 85 St_q R3 (reverse primer) CCCCTAACTCTAGGCGGTAT iv. St_q F1 (forward primer) ATTCCCCCTAAAGGTGAGG 124

Chapter 7: TaqMan PCR assay

St_q R2 (reverse primer) CCCTAAAGGTGAGGGTAGG v. St_q F1 (forward primer) ATTCCCCCTAAAGGTGAGG 84 St_q R3 (reverse primer) CCCCTAACTCTAGGCGGTAT vi. St_q F2 (forward primer) CCCTAAAGGTGAGGGTAGG 107 St_q R1 (reverse primer) AGTACCTGCCGAAGCTGA vii. St_q F2 (forward primer) CCCTAAAGGTGAGGGTAGG 79 St_q R3 (reverse primer) CCCCTAACTCTAGGCGGTAT viii. St_q F3 (forward primer) CATTCCCCCTAAAGGTGAG 113 St_q R1 (reverse primer) AGTACCTGCCGAAGCTGA ix. St_q F3 (forward primer) CATTCCCCCTAAAGGTGAG 125 St_q R2 (reverse primer) GAGCTTTTGGGCAGTACCT St_q P (TaqMan probe) CCTAGCTTAGGGGCTCGACT

7.2.6. TaqMan PCR assay

All TaqMan PCR analyses were carried out on the Bio-Rad ICycler real time PCR system (Bio-Rad; Australia). Each DNA sample was loaded in triplicate in a total volume of 20 µL per sample which included 10 µL master mix (TF, 2X-TaqMan

Fast Universal PCR Master, Life technologies Australia Pty Ltd., Mulgrave,

Victoria), 0.3 µL of each primer (0.1 µM), 0.4 µL of TaqMan probe (5 µM)

(TaqMan MGB probe- 6000 PMoles, Life technologies Australia Pty Ltd., Mulgrave,

Victoria), 3 µL genomic DNA and 6 µL nuclease free water. Each series of amplification reactions included a negative control by using only sterile deionized

MQ water to test for contamination. Thermal cycling conditions included a holding stage for 2 min at 50°C and 20 s at 95°C, followed by 40 cycles of amplification at

95°C for 1 s, and then at 60°C for 20 s. Data were collected and analysed using

Minitab (v. 16; State College PA, Minitab Inc.) software.

Chapter 7: TaqMan PCR assay

7.2.7. Specificity testing

A suitable primer pair specific only to S. tanaceti was preliminarily selected from the conventional PCR assay. Then the selected primers and probe were tested for their specificity against the IGS region (KP161044) using 1 ng/µL of genomic DNA from

14 fungal isolates collected from CBS (Table 7.1) and two isolates of S. tanaceti

(TAS1, TAS55503) followed by the TaqMan PCR assay. The Ct value > 2 cycles below the smallest standard or no amplification of any product were counted as no detection.

7.2.8. Sensitivity testing

The sensitivity and amplification efficiency for the IGS region of S. tanaceti was assessed by the slope of a regression standard curve constructed from the amplification of 10-fold dilution series of template DNA of S. tanaceti (10 ng, 1 ng,

100 pg, 10 pg, 1 pg, 100 fg, 10 fg and 1 fg). The reproducibility of the standard curve was assessed by calculating the standard deviation of triplicate reactions in 96-well plates.

7.2.9. Detection and quantification of S. tanaceti infection in seed lots of farmer’s field and seedlings raised from infected seed

Three µL of the extracted DNA from each of the above seed and seedlings was tested with TaqMan PCR assays which were conducted in duplicate or in triplicate under the same conditions. A positive control using genomic DNA of S. tanaceti and sterile deionized MQ water as a negative control were included. The quantity of genomic

DNA of S. tanaceti in seed and seedlings was determined based on the Ct value corresponding to the standard value generated from the sensitivity testing. Linear

Chapter 7: TaqMan PCR assay

regression analysis was used to analyse the relationship between the seed infection level and cyclic threshold of S. tanaceti DNA in pyrethrum seed.

7.3. Results

7.3.1. Selection of PCR primers

All nine primer pairs successfully amplified DNA obtained from pure culture of S. tanaceti without any primer dimer in conventional PCR assay. The PCR products on

1.5% agarose gel for primer pair St_qF3/ St_qR2 was more intense than for the other primer pairs. Therefore, these oligonucleotides primer pairs were selected for the assessment of TaqMan PCR assays.

7.3.2. Specificity testing of primer pair St_qF3/ St_qR2 against Stagonosporopsis species

Using conventional PCR, the primer pair St_qF3, St_qR2 repeatedly and reliably amplified a 125 bp DNA fragment from the IGS region of nrDNA of S. tanaceti, isolates TAS 1 and TAS 55503 but was unable to amplify sequences from the closely related ray blight pathogens of chrysanthemum S. chrysanthemi and S. inoxydabilis, and twelve related Stagonosporopsis species (Fig. 7.1).

Using TaqMan PCR assay, the combination of primers (St_qF3, St_qR2) and probe

(St_q P) consistently amplified a 125 bp product from IGS region of S. tanaceti

(TAS1, TAS55503), but not amplification from from any of 14 species tested including the closely related S. chrysanthemi and S. inoxydabilis.

Chapter 7: TaqMan PCR assay

Figure 7.1. Specificity testing of S. tanaceti using conventional PCR assay. Primer pair (St_qF3/St_qR2) only amplified S. tanaceti (approximately 125 bp amplicon), compared to 14 related Stagonosporopsis species; L=100-pb DNA ladder marker

(New England BioLabs Inc., Ipswich, MA, USA). Uppermost band= 500 bp and lowermost band= 100 bp.

7.3.3. Sensitivity testing of TaqMan PCR assay

In the sensitivity assay using primer-probe (St_qF3/St_qR2 and St_q P) in dilution series of S. tanaceti DNA, the upper and lower limits for quantification of target

DNA was between 10 ng and 100 fg with Ct values between 17.59 and 36.34 (Fig.

7.2). Samples yielding a Ct value ≤ 36.34 were counted as positive. The standard curve between the DNA concentrations expressed as Log (q) and Ct value produced a linear fit with a slope of -3.668, linear regression coefficient (R²) of 0.996 and the

PCR efficiency (%) was 87.3. The linearity was lost and the R² value was decreased if the samples were included with the quantity of genomic DNA above and below the range 10 ng to 100 fg.

Chapter 7: TaqMan PCR assay

value 20 t C

0 -5 -4 -3 -2 -1 0 1 2 Log (q)

Figure 7.2. Standard regression line of the 10-fold serial dilution of S. tanaceti genomic DNA in a TaqMan assay. Threshold cycles (Ct) were plotted in Y-axis against the log of genomic DNA standards of known concentrations (q) plotted in X- axis. Data represented mean of triplicate of a known DNA concentration; bars represent the standard deviation of a mean.

7.3.4. Detection and quantification of S. tanaceti in pyrethrum seed lots

Only five seed samples (21%) were infected with S. tanaceti with 1 to 30.5% infection level (Table 7.3). The others were free from S. tanaceti infection in both culture and TaqMan PCR assays.

There was a significantly negative correlation between infection level of S. tanaceti and Ct values (r= -0.999, P≤ 0) (Fig. 7.3). The highest Ct value (33.60) was obtained from 1% S. tanaceti infected seed sample and the lowest Ct value (24.72) was obtained from 30.5% S. tanaceti infected seed lot.

Chapter 7: TaqMan PCR assay

Table 7.3. Estimation of level of infection with S. tanaceti (%) in pyrethrum seed using traditional culture and TaqMan PCR assays.

* † Pyrethrum seed Estimated infection level of Ct value (SE) ; P ≤ 0 (Cultivar-site-year) S. tanaceti (%) using culture assay BR1-30730-15 30.5 24.72 (0.14) RS5-30734-15 19.5 28.40 (0.18) BR2-30702-14 14.7 29.47 (0.10) BR2-30730-14 4.5 32.38 (0.09) Pyper-30724-14 1.0 33.60 (0.18) *Values represent arithmetic mean, †Standard error (SE), n=9.

15 infected seeds infectedseeds (%)

5 S.taanceti

0 20 22 24 26 28 30 32 34 36

Ct value

Figure 7.3. Correlation between infection level of S. tanaceti (%) and Ct value in

TaqMan PCR assay (r= -0.999; P ≤ 0).

7.3.5. Detection and quantification of S. tanaceti in pyrethrum seedlings

Infected seedlings were detected in two out of three samples where the quantity of genomic DNA of S. tanaceti was between ~540 fg to 1 pg (Table 7.4).

Chapter 7: TaqMan PCR assay

Table 7.4. Ct values of TaqMan PCR determined in duplicate on seedlings

Replication Ct values against genomic DNA of S. tanaceti

1 33.62 32.45

2 33.56 32.65

3 nd nd nd= not detected

7.4. Discussion

The primer pair St_qF3/ St_qR2 developed from the IGS region of genomic DNA of

S. tanaceti was highly specific in detecting the DNA of S. tanaceti and was unable to amplify DNA of 14 closely related Stagonosporopsis species using conventional

PCR assay. In addition, the same primer pair and probe St_qP in TaqMan PCR assay only amplified DNA of S. tanaceti but not the other 14 related Stagonosporopsis species.

The sensitivity limit of detection of S. tanaceti DNA in this TaqMan assay was higher than previous conventional PCR detection range as reported by Pethybridge et al. (2006). In addition, this was the first attempt to quantify genomic DNA using IGS sequence where the detection and quantification ranged between 10 ng to 100 fg against the Ct threshold values 17.59 and 36.34. Infected pyrethrum seed did not produce any visual symptoms of infection thus making diagnosis of the pathogen difficult (Bhuiyan et al., 2016). This TaqMan PCR enabled assessment of latent infection and quantified the infection level in commercial seed lots. Correct estimation of infection level within the seed lot is important because seed is a major source of spread of S. tanaceti in the field which may contribute to ray blight epidemics (Pethybridge et al., 2005). According to Pethybridge et al. (2006) a level

Chapter 7: TaqMan PCR assay

of S. tanaceti infection in commercial seed lots above 28% may lead to the development of ray blight epidemics in the field.

For the first time, S. tanaceti infection was detected and quantified within symptomless seedlings using TaqMan PCR assay. These results support the finding of Bhuiyan et al. (2016) where about 7% seedlings from seed lots containing 30 to

35% infection with S. tanaceti, were infected within the epidermis and cortical tissues without showing any visible symptoms. Transmission of S. tanaceti infection from pyrethrum seed-to-seedling where seedlings remained asymptomatic was also reported by Pethybridge et al. (2008b).

This TaqMan PCR assay will help to assess the infection level within the seed and seedlings which is very essential to undertake effective seed treatments. This assay may also be used to detect the latent infection in planta as the disease develops during different growth stages of the pyrethrum plants.

Chapter 8: General Discussion

Chapter 8 General discussion

Primary objectives of this thesis were to firstly elucidate the biology and host- pathogen interaction of S. tanaceti in seed, seedlings and mature pyrethrum plant tissues; and secondly, to develop a TaqMan PCR assay to detect and quantify the infection within pyrethrum seed and seedlings. Major findings of this thesis and suggestions for future research are discussed in this chapter.

Histopathology revealed that the germ tubes from the conidia of S. tanaceti penetrated directly into the leaf epidermis within 12 hours after inoculation. Infection hyphae then colonised the cortical tissues intra- and inter-cellularly resulting in disintegration of cell wall and cell organelles such as cytoplasm, nucleus and chloroplasts followed by the development of pycnidia in the epidermis of pyrethrum leaves within 12 days after inoculation. van Kan (2006) reported that necrotrophic fungi such as B. cinerea produced enzymes at the penetration site to enable direct penetration into the cuticle and epidermis of host cells followed by colonization within the host tissues. Development of pycnidia from related fungi such as Phoma macdonaldii in sunflower leaves occurred 10-15 days after infection (Roustaee et al.,

2000). Pycnidia formation in infected wheat leaves occurred 21 days after infection for Septoria nodorum or Sep. tritici (Holmes and Colhoun, 1975). Knowledge on pycnidia development may enable more effective application of foliar fungicides at the very initial stage of ray blight symptom development to curb secondary dissemination of inoculum in the field.

Histopathology also revealed that the infection process by S. tanaceti in the pyrethrum seed was confined to the seed coat without infection of the embryo.

Chapter 8: General Discussion

However, as the seed germinated the developing embryo then became infected from the infection hyphae in the seed coat. Severely infected seed tissues quickly degraded causing pre-emergence death of the germinated seed. Germinating embryos and hypocotyls from seed with a lower level of seed coat infection took longer to become infected resulting in post emergence death of seedlings. In several instances infected seedlings grew from infected seed and survived without showing symptoms with the pathogen entering into a latent infection life style. A short latent infection life style has been reported to occur in necrotrophic fungal pathogens. De Silva et al. (2017) reported that latent infection by Colletotrichum spp not only occurred after initial infection of immature fruit but also after initial infection of leaves. Colletotrichum gloeosporioides has been shown to remain latent in the green fruits of peach for 2-3 weeks after inoculation (Zaitlin et al., 2000). According to Calleja et al. (2013) latent infected planting material was an important source of C. acutatum in strawberry plants, and the level of latent infection on strawberry leaves correlated to the fruit rot at harvest and post-harvest (Debode et al., 2015). Latent fungal infections are difficult to control with fungicides. Monilinia fructicola infection in peach was not able to be controlled using protective fungicides because the pathogen entered a latent infection phase in its lifecycle after initial infection of immature fruit (Kable,

1971). However, long term latent infection in wheat by My. graminicola was controlled by using the systemic fungicide azoxystrobin (Palmer and Skinner, 2002).

The latent infection of seedlings has epidemiological significance for disease development and control of ray blight. In Australia, previous epidemics of ray blight in 1999 were thought to be caused by seed infection and latent seedling infection

(Pethybridge et al., 2011). This enabled secondary infection of pyrethrum plants

Chapter 8: General Discussion

once environmental conditions became conducive to the S. tanaceti disease cycle.

Although there was evidence for S. tanaceti latent infection within the pyrethrum seedlings, the duration of the latent stage was not determined. In this situation, frequent application of systemic fungicides was recommended throughout the growing season in the field.

As S. tanaceti only infected the seed coat, conventional fungicide seed treatments as well as heat treatment should be effective in controlling ray blight in pyrethrum seedlings. Chemical seed treatments have been shown to not only reduce infection in seed tissues but also eliminate seedling diseases (Sharma-Poudyal et al., 2005;

Bradley, 2008). Pea seed infected by My. pinodes and Ascochyta pisi was controlled by soaking the seeds with thiram and captan suspensions (Maude, 1966). Brassica seed infected by P. lingam, A. brassicicola and A. brassicae were effectively controlled by using iprodione and fenpropimorph without affecting seed germination

(Maude et al., 1984). Combination of captan + pentachloronitrobenzene + thiabendazole and fludioxonil completely removed Sc. sclerotiorum from soybean seed coat (Mueller et al., 1999). Transmission of B. cinerea from chickpea seed-to- seedling was reduced by 98% using heat treatment of seed at 50° C for 5 min

(Burgess et al., 1997).

Infection of the crown tissue by S. tanaceti was found to be an important part of the disease cycle of the ray blight pathogen. Stagonosporopsis tanaceti was able to infect the parenchyma tissues of the cortex of the crown without infecting the vascular tissues. The source of crown infection was most likely from pycnidiospores that were spread to the crown from the infected foliage. Severe crown infection of pyrethrum plants by Paraphoma vinacea and F. oxysporum was shown to significantly reduce

Chapter 8: General Discussion

growth of pyrethrum (Moslemi et al., 2016; 2017b). Since S. tanaceti is widely distributed throughout the pyrethrum growing areas of Australia, crown infection would most likely cause significant pyrethrum growth reduction, impact on yield decline and poor regrowth of the plants after harvest. Therefore, fungicides need to be recommended for application at different growth stages to prevent crown infection.

The multi-cultivar resistance trial found that none of the infected five cultivars (BR1,

BR2, Pyper, Pyrate and RS5) showed resistance against S. tanaceti. Infection by S. tanaceti significantly reduced the number of shoots, plant height, biomass and yield of flowers in two growing cycles of pyrethrum. Due to the absence of resistant cultivars, management of ray blight mostly relies on multiple applications of fungicides; where a field may receive up to 11 fungicide applications in 18 months of the growth cycle (Vaghefi et al., 2016b). Understanding of the susceptibility of these five cultivars highlights the need to identify resistant accessions and subsequently resistance genes (R-genes). Specific R-genes may confer long-term and sustainable resistance against S. tanaceti. Gene pyramiding using multiple R-genes has provided durable resistance against various pathogens including Magnaporthe oryzae in rice

(Fukuoka et al., 2015), Phytophthora infestans in potato (Tan et al., 2010; Kim et al.,

2012), Xanthomonas oryzae pv. oryzae and X. oryzae pv. oryzicola in rice (Zhou et al., 2009). Further screening of a wide range of pyrethrum germplasm under natural field conditions in different growing areas of pyrethrum production in Australia would be required to identify new sources of potential ray blight resistance. In order to develop durable resistant plant cultivars, it is essential to understand quantitative disease resistance (QDR). Molecular technique using quantitative trait locus (QTL)

Chapter 8: General Discussion

mapping is an effective way of developing plant disease resistant cultivar. Using this mapping, the specific disease resistant loci can be assessed. Positional cloning of partial resistance genes can also be made using this mapping system (Young, 1996).

TaqMan PCR quantified S. tanaceti infection within the seed and seedlings of pyrethrum in real time using cyclic threshold values which were directly proportionate to the amount of starting template of DNA (Ginzinger, 2002; Gachon et al., 2004). A similar assay was used for detection and quantification of

F. oxysporum f. sp. phaseoli, considered as a devastating pathogen in Phaseolus vulgaris (common bean) seeds (Sousa et al., 2015). This assay was much more sensitive, reliable and faster than conventional PCR (Filion et al., 2003). TaqMan assay technique has been used as an efficient seed health test to prevent long-distance dissemination of pathogens by contaminated seeds (Sousa et al., 2015) and to detect latent infection by C. acutatum within strawberry seedlings (Debode et al., 2015).

Latent infection of S. tanaceti within the pyrethrum seedlings was also confirmed with the TaqMan PCR assay. The Australian pyrethrum industry could utilise the

TaqMan assay technique to ascertain the level of latent infection within seedlings to mitigate the risk of spreading S. tanaceti into the fields. The assay may also be applied to identify the plant tissue colonised by the pathogen at different stages of the growth of the plant thus enabling more efficient targeted control measures to be undertaken.

Chapter 8: General Discussion

Conclusion

Detailed elucidation of the biology and infection process (disease cycle) of S. tanceti in seed, seedlings and mature pyrethrum plants will enable the pyrethrum industry to develop sustainable integrated disease control measures

Lack of resistance/tolerance in five commercial cultivars against S. tanaceti illustrates the importance of screening more accessions using the field and glasshouse bioassay to identify resistant lines.

TaqMan PCR was found to be more efficient and sensitive in the identification and quantification of the template DNA of S. tanaceti than conventional PCR thus the pyrethrum industry can use this as a routine assay to screen seed lots prior to release.

Chapter 9: References

Chapter 9 References

Agarwal K, Sinclair JB, 1997. Principles of Seed Pathology, 2nd ed. CRC Press, Inc.,

Lewis Publishers, Boca Raton, FL.

Alturkistani HA, Tashkandi FM, Mohammedsaleh ZM, 2016. Histological Stains: A

Literature Review and Case Study. Global Journal of Health Science 8 (3), 72.

Andersen AM, Leach CM, 1961. Testing seeds for seedborne organisms. Seeds: The

Yearbook of Agriculture. Washington, DC, USA: US Department of

Agriculture, 453-7.

Andreev R, Kutinkova H, Baltas K, 2008. Non-chemical control of some important

pests of sweet cherry. Journal of Plant Protection Research 48 (4), 503-508.

Aveskamp, MM, De Gruyter J, Woudenberg JHC, Verkley GJM, Crous PW, 2010.

Highlights of the Didymellaceae: a polyphasic approach to characterise Phoma

and related Pleosporalean genera. Studies in Mycology 65, 1-60.

Baker KF, Dimock A, Davis LH, 1949. Life history and control of the Ascochyta ray

blight of Chrysanthemum. Phytopathology 39 (10), 789-805.

Baker KF, Dimock A, Davis LH, 1961. Cause and prevention of the rapid spread of

the Ascochyta disease of Chrysanthemum. Phytopathology 51, 96-101.

Bergstrom GC, Nicholson RL, 1999. The biology of corn anthracnose: knowledge to

exploit for improved management. Plant Disease 83 (7), 596-608.

Chapter 9: References

Bhat B, 1995. Breeding methodologies applicable to pyrethrum. In: CASIDA, J. E.

& QUISTAD, G. B. (eds.) Pyrethrum flowers. production, chemistry,

toxicology, and uses. New York: Oxford University Press.

Bhuiyan MAHB, Groom T, Nicolas ME, Taylor PWJ, 2015. Histopathology of S.

tanaceti infection in pyrethrum leaf lamina. Australasian Plant Pathology, 44

(6), 629-636.

Bhuiyan MAHB, Groom T, Nicolas ME, Taylor PWJ, 2016. Infection process of S.

tanaceti in pyrethrum seeds and seedlings. Plant Pathology,

doi:10.1111/ppa.12622.

Bhuiyan MAHB, Groom T, Nicolas ME, Taylor PWJ, 2017. Disease cycle of

Stagonosporopsis tanaceti in pyrethrum plants. Australasian Plant Pathology,

46 (1), 83–90.

Bradley CA, 2008. Effect of fungicide seed treatments on stand establishment,

seedling disease, and yield of soybean in North Dakota. Plant Disease 92 (1),

120-125.

Bryan, J.H., 1955. Differential staining with a mixture of safranin and fast green

FCF. Stain technology, 30(4), pp.153-157.

Burgess DR, Bretag T, Keane PJ, 1997. Seed-to-seedling transmission of Botrytis

cinerea in chickpea and disinfestation of seed with moist heat. Animal

Production Science 37 (2), 223-229.

Chapter 9: References

Calleja EJ, Ilbery B, Spence NJ, Mills PR, 2013. The effectiveness of phytosanitary

controls in preventing the entry of Colletotrichum acutatum in the UK

strawberry sector. Plant Pathology 62, 266–78.

Cerkauskas RF, 1988. Latent colonization by Colletotrichum spp.: epidemiological

considerations and implications for mycoherbicides. Canadian Journal of

Plant Pathology 10 (4), 297-310.

Chandler SE, 1948. The Origin and Early History of the Production of Pyrethrum in

Kenya. Pyrethrum Post 1 (1), 10-13.

Chilvers MI, Jones S, Meleca J, Peever TL, Pethybridge SJ, Hay FS, 2014.

Characterization of mating type genes supports the hypothesis that

Stagonosporopsis chrysanthemi is homothallic and provides evidence that

Stagonosporopsis tanaceti is heterothallic. Current Genetics 60 (4), 295-302.

Clarke JD, 2009. Cetyltrimethyl ammonium bromide (CTAB) DNA miniprep for

plant DNA isolation. Cold Spring Harbor Protocols 2009 3, pdb-prot5177.

Cook SM, Watts NP, Castle LM and Williams IH, 2006. Determining the sex of

insect pests of oilseed rape for behavioral bioassays. Integrated control in

oilseed crops 29 (7), 205-211.

Crombie L, Elliott M, 1961. Chemistry of the natural pyrethrins. Springer Vienna.

In Fortschritte der Chemie Organischer Naturstoffe/Progress in the Chemistry

of Organic Natural Products/Progrès dans la Chimie des Substances

Organiques Naturelles, 120-164.

Davies TGE, Field LM, Usherwood PNR, Williamson MS, 2007. DDT, pyrethrins,

pyrethroids and insect sodium channels. IUBMB life 59 (3), 151-162.

Chapter 9: References

De Gruyter J, Aveskamp MM, Woudenberg JH, Verkley GJ, Groenewald JZ, Crous

PW, 2009. Molecular phylogeny of Phoma and allied anamorph genera:

towards a reclassification of the Phoma complex. Mycological research 113

(4), 508-519.

De Gruyter J, van Gent-Pelzer MP, Woudenberg JH, van Rijswick PC, Meekes ET,

Crous PW, Bonants PJ, 2012. The development of a validated real-time

(TaqMan) PCR for detection of Stagonosporopsis andigena and S.

crystalliniformis in infected leaves of potato and tomato. European Journal of

Plant Pathology 134 (2), 301-313.

De Silva DD, Crous PW, Ades PK, Hyde K, Taylor PWJ, 2017. Life styles of

Colletotrichum species and implications for plant biosecurity. Journal of

Fungal Biology Reviews (accepted).

De Wolf ED, Isard SA, 2007. Disease cycle approach to plant disease

prediction. Annual Review of Phytopathology 45, 203-220.

Debode J, Van Hemelrijck W, Xu XM, Maes M, Creemers P, Heungens K, 2015.

Latent entry and spread of Colletotrichum acutatum (species complex) in

strawberry fields. Plant Pathology 64 (2), 385-395.

Demeke T, Gräfenhan T, Clear RM, Phan A, Ratnayaka I, Chapados J, Patrick SK,

Gaba D, Lévesque CA, Seifert KA, 2010. Development of a specific TaqMan®

real-time PCR assay for quantification of Fusarium graminearum clade 7 and

comparison of fungal biomass determined by PCR with deoxynivalenol content

in wheat and barley. International Journal of Food Microbiology 141 (1), 45-

50.

Chapter 9: References

Dillon M, 1981. Flora of Peru: family Compositae: part 2. Tribe Anthemideae.

Fieldiana: Botany 7.

Durrant MJ, Payne PA, Prince JWF, Fletcher R, 1988. Thiram steep seed treatment

to control Phoma betae and improve the establishment of the sugar-beet plant

stand. Crop Protection 7 (5), 319-326.

Elliott M, 1976. Properties and applications of pyrethroids. Environmental Health

Perspectives 14, 1.

Elliott M, 1995. Chemicals in insect control. Pages 3-31 in: Pyrethrum Flowers:

Chemistry, Toxicology and Uses. J. E. Casida and G. B. Quistad, eds. Oxford

University Press, New York.

Esau K, 1977. Anatomy of seed plants, New York, John Wiley and Sons.

Filion M, St-Arnaud M, Jabaji-Hare SH, 2003. Direct quantification of fungal DNA

from soil substrate using real-time PCR. Journal of Microbiological

Methods 53 (1), 67-76.

Fitt BD, McCartney HA, Walklate PJ, 1989. The role of rain in dispersal of pathogen

inoculum. Annual Review of Phytopathology 27 (1), 241-270.

Fox RTV, 1998. Chrysanthemum ray blight. Mycologist 12 (3), 135-136.

Frangiote-Pallone, De Souza LA, 2014. Pappus and cypsela ontogeny in Asteraceae:

structural considerations of the tribal category. Revista Mexicana de

Biodiversidad 85, 62-77.

Chapter 9: References

Fukuoka S, Saka N, Mizukami Y, Koga H, Yamanouchi U, Yoshioka Y, Hayashi N,

Ebana K, Mizobuchi R, Yano M, 2015. Gene pyramiding enhances durable

blast disease resistance in rice. Scientific Reports 5, 7773.

Gachon C, Mingam A, Charrier B, 2004. Real-time PCR: what relevance to plant

studies? Journal of Experimental Botany 55 (402), 1445-1454.

Ginzinger DG, 2002. Gene quantification using real-time quantitative PCR: an

emerging technology hits the mainstream. Experimental Hematology 30 (6),

503-512.

Glynne-Jones A, 2001. Pyrethrum. Pesticide Outlook 12 (5), 195-198.

Grdiša M, Carović-Stanko K, Kolak I, Šatović Z, 2009. Morphological and

biochemical diversity of Dalmatian pyrethrum (Tanacetum cinerariifolium

(Trevir.) Sch. Bip.). Agriculturae Conspectus Scientificus (ACS) 74 (2), 73-80.

Greenhill M, 2007. Pyrethrum production: Tasmanian success story. Chronica

Horticulturae 47 (3), 5-8.

Gullino ML, Gilardi G, Ortu G, Garibaldi A, 2014. Development and

implementation of rapid and specific detection techniques for seed-borne

pathogens of leafy vegetable crops. In Detection and Diagnostics of Plant

Pathogens, Springer Netherlands. 157-165.

Harris JG, Harris MW, 1994. Plant identification terminology: an illustrated glossary

(No. QK9 H37 2001). Spring Lake, Utah: Spring Lake Publishing.

Hay FS, Gent DH, Pilkington SJ, Pearce TL, Scott JB, Pethybridge SJ, 2015.

Changes in distribution and frequency of fungi associated with a foliar disease

complex of pyrethrum in Australia. Plant Disease 99 (9), 1227-1235.

Chapter 9: References

Hillis DM, Dixon MT, 1991. Ribosomal DNA: molecular evolution and phylogenetic

inference. Quarterly Review of Biology 411-453.

Holmes SJI, Colhoun J, 1975. Straw-borne Inoculum of Septoria nodorum and S.

tritici in relation to Incidence of Disease on Wheat Plants. Plant Pathology 24

(2), 63-66.

Horevaj P, Milus EA, Bluhm BH, 2011. A real-time qPCR assay to quantify

Fusarium graminearum biomass in wheat kernels. Journal of Applied

Microbiology 111 (2), 396-406.

Javid M, Zhang P, Taylor PWJ, Pethybridge SJ, Groom T, Nicolas ME, 2013.

Interactions between waterlogging and ray blight in pyrethrum. Crop and

Pasture Science 64 (7), 726-735.

Jones S, Pethybridge S, Hay F, Groom T, Wilson C, 2007. Baseline sensitivity of

Australian Phoma ligulicola isolates from pyrethrum to azoxystrobin and

difenoconazole. Journal of Phytopathology 155 (6), 377-380.

Kable PF, 1971. Significance of short-term latent infections in the control of brown

rot in peach fruits. Journal of Phytopathology 70 (2), 173-176.

Katsuda Y, 1999. Development of and future prospects for pyrethroid chemistry.

Pesticide Science 55 (8), 775-782.

Keinath AP, 1996. Soil amendment with cabbage residue and crop rotation to reduce

gummy stem blight and increase growth and yield of watermelon. Plant

Disease 80 (5), 564-570.

Kim HJ, Lee HR, Jo KR, Mortazavian SM, Huigen DJ, Evenhuis B, Kessel G, Visser

RG, Jacobsen E, Vossen JH, 2012. Broad spectrum late blight resistance in

Chapter 9: References

potato differential set plants MaR8 and MaR9 is conferred by multiple stacked

R-genes. Theoretical and Applied Genetics 124 (5), 923-935.

Li Hao-Xi, Stevenson KL, Brewer M, 2016. Differences in sensitivity to a triazole

fungicide among Stagonosporopsis species causing gummy stem blight of

cucurbits. Plant Disease 100 (10), 2106-2112.

Li J, Yin LY, Jongsma MA, Wang CY, 2011. Effects of light, hydropriming and

abiotic stress on seed germination, and shoot and root growth of pyrethrum

(Tanacetum cinerariifolium). Industrial Crops and Products 34 (3), 1543-

1549.

Lievens B, Thomma BP, 2005. Recent developments in pathogen detection arrays:

implications for fungal plant pathogens and use in practice. Phytopathology 95

(12), 1374-1380.

Liew ECY, Maclean DJ, Irwin JAG, 1998. Specific PCR based detection of

Phytophthora medicaginis using the intergenic spacer region of the ribosomal

DNA. Mycological Research 102 (1), 73-80.

Lumsden RD, 1979. Histology and physiology of pathogenesis in plant diseases

caused by Sclerotinia species. Phytopathology 69 (8), 390-396.

Luo G, Mitchell TG, 2002. Rapid identification of pathogenic fungi directly from

cultures by using multiplex PCR. Journal of Clinical Microbiology 40 (8),

2860-2865.

Mancini V, Murolo S, Romanazzi G, 2016. Diagnostic methods for detecting fungal

pathogens on vegetable seeds. Plant Pathology 65 (5), 691–703.

Chapter 9: References

Martin RR, James D, Lévesque CA, 2000. Impacts of molecular diagnostic

technologies on plant disease management. Annual Review of

Phytopathology 38 (1), 207-239.

Marzinek J, Oliveira DMT, 2010. Structure and ontogeny of the pericarp of six

Eupatorieae (Asteraceae) with ecological and taxonomic considerations. Anais

Academ Brasil Ciências 82, 279-291.

Maude RB, 1966. Pea seed infection by Mycosphaerella pinodes and Ascochyta pisi

and its control by seed soaks in thiram and captan suspensions. Annals of

Applied Biology 57 (2), 193-200.

Maude RB, Humpherson-Jones FM, Shuring CG, 1984. Treatments to control

Phoma and Alternaria infections of brassica seeds. Plant Pathology 33 (4),

525-535.

McCoy RE, 1973. Ballistics of Mycosphaerella ligulicola ascospore discharge.

Phytopathology 63 (6), 793.

McCoy RE, Dimock AW, 1973, Environmental factors regulating ascospore

discharge by Mycosphaerella ligulicola. Phytopathology 63, 586-589.

McDonald GK, Dean G, 1996. Effect of waterlogging on the severity of disease

caused by Mycosphaerella pinodes in peas (Pisum sativum L.). Animal

Production Science 36 (2), 219-222.

Mekha N, Sugita T, Makimura K, Poonwan N, Sawanpanyalert P, Ikeda R,

Nishikawa A, 2010. The intergenic spacer region of the ribosomal RNA gene

of Penicillium marneffei shows almost no DNA sequence

diversity. Microbiology and Immunology 54 (11), 714-716.

Chapter 9: References

Metcalfe CR, Chalk L, 1950. Anatomy of the dicotyledons, (1). Systematic anatomy

of leaf and stem; with a brief history of the subject. v. 2: Wood structure and

conclusion of the general introduction.

Moslemi A, Ades PK, Groom T, Crous PW, Nicolas ME, Taylor PWJ, 2016.

Paraphoma crown rot of pyrethrum (Tanacetum cinerariifolium). Plant

Disease 100 (12), 2363-2369.

Moslemi A, Ades PK, Groom T, Nicolas ME, Taylor PWJ, 2017a. Alternaria

infectoria and Stemphylium herbarum, two new pathogens of pyrethrum

(Tanacetum cinerariifolium) in Australia. Australasian Plant Pathology 46 (1),

91-101.

Moslemi A, Ades PK, Groom T, Nicolas ME, Taylor PWJ, 2017b. Fusarium

oxysporum and Fusarium avenaceum associated with yield-decline of

pyrethrum in Australia. European Journal of Plant Pathology 149 (1), 43-56.

Mueller DS, Hartman GL, Pedersen WL, 1999. Development of sclerotia and

apothecia of Sclerotinia sclerotiorum from infected soybean seed and its

control by fungicide seed treatment. Plant disease 83 (12), 1113-1115.

Müller E, Von Arx J, 1962. Die Gattungen der didymosporen Pyrenomyceten.

Beitriige zur Kryptogamenflora der Schweiz 11.

Murakishi HH, 1951. Purple seed stain of Soybean. Phytopathology 41 (4), 305-318.

Palmer CL, Skinner W, 2002. Mycosphaerella graminicola: latent infection, crop

devastation and genomics. Molecular Plant Pathology 3 (2), 63-70.

100

Chapter 9: References

Pan WH, Chang CC, Su TT, Lee F, Fuh MRS, 1995. Preparative supercritical fluid

extraction of pyrethrin I and II from pyrethrum flower. Talanta 42 (11), 1745-

1749.

Pantou MP, Mavridou A, Typas MA, 2003. IGS sequence variation, group-I introns

and the complete nuclear ribosomal DNA of the entomopathogenic fungus

Metarhizium: excellent tools for isolate detection and phylogenetic

analysis. Fungal Genetics and Biology 38 (2), 159-174.

Pethybridge SJ, Esker P, Dixon P, Hay F, Groom T, Wilson C, Nutter Jr FW, 2007.

Quantifying loss caused by ray blight disease in Tasmanian pyrethrum

fields. Plant Disease 91 (9), 1116-1121.

Pethybridge SJ, Gent DH, Esker PD, Turechek WW, Hay FS, Nutter Jr, FW, 2009.

Site-specific risk factors for ray blight in Tasmanian pyrethrum fields. Plant

Disease 93 (3), 229-237.

Pethybridge SJ, Gent DH, Groom T, Hay FS, 2013. Minimizing crop damage

through understanding relationships between pyrethrum phenology and ray

blight disease severity. Plant Disease 97, 1431–1437.

Pethybridge SJ, Gent DH, Hay FS, 2011. Epidemics of ray blight on pyrethrum are

linked to seed contamination and overwintering inoculum of Phoma ligulicola

var. inoxydabilis. Phytopathology 101, 1112–21.

Pethybridge SJ, Hay F, Jones S, Wilson C, Groom T, 2006. Seedborne infection of

pyrethrum by Phoma ligulicola. Plant disease 90 (7), 891-897.

101

Chapter 9: References

Pethybridge SJ, Hay FS, 2001. Influence of Phoma ligulicola on yield, and site

factors on disease development, in Tasmanian pyrethrum crops. Australas

Plant Pathology 30 (1), 17.

Pethybridge SJ, Hay FS, Clarkson RA, Groom T, Wilson CR, 2008a. Host range of

Australian Phoma ligulicola var. inoxydablis isolates from pyrethrum. Journal

of Phytopathology 156 (7-8), 506-508.

Pethybridge SJ, Hay FS, Esker PD, Gent DH, Wilson CR, Groom T, Nutter Jr FW,

2008b. Diseases of pyrethrum in Tasmania: challenges and prospects for

management. Plant Disease 92 (9), 1260-1272.

Pethybridge SJ, Hay FS, Groom T, 2003. Seasonal fluctuations in fungi associated

with pyrethrum foliage in Tasmania. Australasian Plant Pathology 32 (2), 223-

230.

Pethybridge SJ, Hay FS, Wilson CR, Groom T, 2005. Development of a fungicide-

based management strategy for foliar disease caused by Phoma ligulicola in

Tasmanian pyrethrum fields. Plant Disease 89 (10), 1114-1120.

Pethybridge SJ, Scott JB, Hay FS, 2004. Genetic relationships among isolates of

Phoma ligulicola from pyrethrum and chrysanthemum based on ITS sequences

and its detection by PCR. Australasian Plant Pathology 33 (2), 173-181.

Pethybridge SJ, Wilson CR, 1998. Confirmation of ray blight disease of pyrethrum in

Australia. Australasian Plant Pathology 27 (1), 45-48.

Roque N, Kell DJ, Susanna A, Funk V, Susanna A, Stuessy T, Bayer R, 2009.

Illustrated glossary of Compositae. Systematics, evolution, and biogeography

102

Chapter 9: References

of Compositae. International Association for Plant Taxonomy, Vienna, 781-

806.

Roth I, 1977. Fruits of angiosperms. In Encyclopedia of plant anatomy, Borntraeger,

Berlin, Germany, 258-291.

Roustaee A, Costes S, Dechamp-Guillaume G, Barrault G, 2000. Phenotypic

variability of Leptosphaeria lindquistii (anamorph: Phoma macdonaldii), a

fungal pathogen of sunflower. Plant Pathology 49 (2), 227-234.

Rozen S, Skaletsky H, 1999. Primer3 on the WWW for general users and for

biologist programmers. In S. Misener & S. A. Krawetz (Eds.), Bioinformatics

methods and protocols 365–386. New Jersey: Humana press.

Sanzani SM, Schena L, De Cicco V, Ippolito A, 2012. Early detection of Botrytis

cinerea latent infections as a tool to improve postharvest quality of table

grapes. Postharvest Biology and Technology 68, 64-71.

Schena L, Nigro F, Ippolito A, Gallitelli D, 2004. Real-time quantitative PCR: a new

technology to detect and study phytopathogenic and antagonistic

fungi. European Journal of Plant Pathology 110 (9), 893-908.

Schmitt A, Koch E, Stephan D, Kromphardt C, Jahn M, Krauthausen HJ, Forsberg

G, Werner S, Amein T, Wright SA, Tinivella F, 2009. Evaluation of non-

chemical seed treatment methods for the control of Phoma valerianellae on

lamb's lettuce seeds. Journal of Plant Diseases and Protection 200-207.

Schoeny A, Menat J, Darsonval A, Rouault F, Jumel S, Tivoli B, 2008. Effect of pea

canopy architecture on splash dispersal of Mycosphaerella pinodes

conidia. Plant Pathology 57 (6), 1073-1085.

103

Chapter 9: References

Sharma-Poudyal D, Duveiller E, Sharma, RC, 2005. Effects of seed treatment and

foliar fungicides on Helminthosporium leaf blight and on performance of wheat

in warmer growing conditions. Journal of Phytopathology 153 (7-8), 401-408.

Simmons CB, Raj SK, Saxena PK, 2002. Morphocytological Characterization of

Feverfew (Tanacetum parthenium(L.) Schultz Bip). Journal of Herbs, Spices

and Medicinal Plants 9 (1), 29-45.

Sladonja B, Krapac M, Ban D, Užila Z, Dudaš S, Dorčić D, 2014. Effect of soil type

on pyrethrum seed germination. Journal of Plant Protection Research 54 (4),

421-425.

Sousa MV, Machado JDC, Simmons HE, Munkvold GP, 2015. Real-time

quantitative PCR assays for the rapid detection and quantification of Fusarium

oxysporum f. sp. phaseoli in Phaseolus vulgaris (common bean) seeds. Plant

Pathology 64 (2), 478-488.

Spjut RW, 1994. A systematic treatment of fruit types (Vol. 70). New York

Botanical Garden.

Stevens FL, 1907. The Chrysanthemum Ray Blight. Botanical Gazette 44 (4), 241-

258.

Stoughton RH, 1930. Thionin and orange G for the differential staining of bacteria

and fungi in plant tissues. Annals of applied biology 17 (1), 162-164.

Strider DL, 1994. Chrysanthemum diseases: a growers' guide. Revista Chapingo.

Serie Horticultura 1 (1), 131-136.

Suraweera DD, Nicolas, ME and Groom T, 2014. Effect of short periods of heat

stress during early flowering period on flower development and pyrethrin

104

Chapter 9: References

accumulation in pyrethrum. In XXIX International Horticultural Congress on

Horticulture: Sustaining Lives, Livelihoods and Landscapes (IHC2014): V

World 1125 (pp. 121-128).

Suraweera DD, Nicolas ME, Groom T, 2016. Effect of short periods of heat stress

during early flowering period on flower development and pyrethrin

accumulation in pyrethrum. Acta Horticulture 1125, 121–128.

Tan MA, Hutten RC, Visser RG, van Eck HJ, 2010. The effect of pyramiding

Phytophthora infestans resistance genes RPi-mcd1 and RPi-ber in

potato. Theoretical and Applied Genetics 121 (1), 117-125.

Tomlinson JA, Boonham N, Hughes KJD, Griffin RL, Barker I, 2005. On-site DNA

extraction and real-time PCR for detection of Phytophthora ramorum in the

field. Applied and Environmental Microbiology 71 (11), 6702-6710.

Vaghefi N, Ades PK, Hay FS, Pethybridge SJ, Ford R, Taylor PWJ, 2015a.

Identification of the MAT1 locus in Stagonosporopsis tanaceti, and exploring

its potential for sexual reproduction in Australian pyrethrum fields. Fungal

Biology 119 (5), 408-419.

Vaghefi N, Hay FS, Ades PK, Pethybridge SJ, Ford R, Taylor PWJ, 2015b. Rapid

changes in the genetic composition of Stagonosporopsis tanaceti population in

Australian pyrethrum fields. Phytopathology 105 (3), 358-369.

Vaghefi N, Hay FS, Pethybridge SJ, Ford R, Taylor PWJ, 2016a. Development of a

multiplex PCR diagnostic assay for the detection of Stagonosporopsis species

associated with ray blight of Asteraceae. European Journal of Plant Pathology

1-15.

105

Chapter 9: References

Vaghefi N, Pethybridge SJ, Ford R, Nicolas M, Crous P, Taylor PWJ, 2012.

Stagonosporopsis spp. associated with ray blight disease of Asteraceae.

Australasian Plant Pathology 41 (6), 675-686.

Vaghefi N, Pethybridge SJ, Hay FS, Ford R, Nicolas M, Taylor PWJ, 2016b.

Revisiting Stagonosporopsis species associated with chrysanthemum and

pyrethrum ray blight. Australasian Plant Pathology 1-10.

Van der Aa HA, Noordeloos ME, Gruyter JD, 1990. Species concepts in some larger

genera of the Coelomycetes. Studies in Mycology 32, 3-19. van Kan JA, 2006. Licensed to kill: the lifestyle of a necrotrophic plant

pathogen. Trends in Plant Science, 11 (5), 247-253.

Van Maanen A, Xu XM, 2003. Modelling plant disease epidemics. European

Journal of Plant Pathology 109 (7), 669-682.

Vloutoglou I, Kalogerakis SN, 2000. Effects of inoculum concentration, wetness

duration and plant age on development of early blight (Alternaria solani) and

on shedding of leaves in tomato plants. Plant Pathology 49 (3), 339-345.

Walcott RR, 2003. Detection of seedborne pathogens. Horttechnology 13, 40-7.

Ward E, Foster SJ, Fraaije BA, McCartney HA, 2004. Plant pathogen diagnostics:

immunological and nucleic acid-based approaches. Annals of Applied

Biology 145 (1), 1-16.

Young ND, 1996. QTL mapping and quantitative disease resistance in plants. Annual

review of phytopathology 34 (1), 479-501.

106

Chapter 9: References

Zaitlin B, Zehr EI, Dean RA, 2000. Latent infection of peach caused by

Colletotrichum gloeosporioides and Colletotrichum acutatum. Canadian

Journal of Plant Pathology 22 (3), 224-228.

Zhou YL, Xu JL, Zhou SC, Yu J, Xie XW, Xu M.R, Sun Y, Zhu LH, Fu BY, Gao

YM, Li ZK, 2009. Pyramiding Xa23 and Rxo1 for resistance to two bacterial

diseases into an elite indica rice variety using molecular approaches. Molecular

Breeding 23 (2), 279-287.

Zito SW, 1994. Chrysanthemum cinerariaefolium (Pyrethrum): In vitro culture and

the production of pyrethrins and other secondary metabolites. Medicinal and

Aromatic Plants VI (pp. 56-68). Springer Berlin Heidelberg.

107

Minerva Access is the Institutional Repository of The University of Melbourne

Author/s: Bhuiyan, Md Abdullahil Baki

Title: Biology and host-pathogen interaction of Stagonosporopsis tanaceti, the cause of ray blight in pyrethrum

Date: 2017

Persistent Link: http://hdl.handle.net/11343/192512

File Description: Complete thesis

Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.