1-Phosphate-Lyase-Deficient Mice Development in Sphingosine

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Discontinued Postnatal Thymocyte Development in Sphingosine 1-Phosphate-Lyase-Deficient Mice This information is current as Claudia Weber, Andreas Krueger, Anika Münk, Constantin of October 1, 2021. Bode, Paul P. Van Veldhoven and Markus H. Gräler J Immunol 2009; 183:4292-4301; Prepublished online 11 September 2009; doi: 10.4049/jimmunol.0901724 http://www.jimmunol.org/content/183/7/4292 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2009/09/10/jimmunol.090172 Material 4.DC1 http://www.jimmunol.org/ References This article cites 48 articles, 20 of which you can access for free at: http://www.jimmunol.org/content/183/7/4292.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Discontinued Postnatal Thymocyte Development in Sphingosine 1-Phosphate-Lyase-Deficient Mice1,2 Claudia Weber,3* Andreas Krueger,3* Anika Mu¨nk,* Constantin Bode,* Paul P. Van Veldhoven,† and Markus H. Gra¨ler4* Circulation of lymphocytes through peripheral lymphoid tissues as well as progenitor entry into the thymus and its output of mature T cells are critical for normal immune function. Egress of lymphocytes from both peripheral lymphoid organs and thymus is dependent on sphingosine 1-phosphate (S1P) gradients. S1P-lyase 1 (SGPL1) deficiency leads to accumulation of S1P in lym- phoid tissues, which blocks lymphocyte egress and induces thymus atrophy. In this study, we investigated thymocyte development in SGPL1-deficient mice (SGPL1؊/؊), which exhibited postnatal discontinuation of early thymocytopoiesis starting at 2 wk after birth. SGPL؊/؊ thymi showed a loss of developing thymocytes in the thymic cortex between 2 and 4 wk of age, whereas mature thymocytes accumulated in the medulla. Detailed analysis demonstrated a deficit in thymic early T cell progenitors (ETP) as the Downloaded from principal reason for discontinued thymocyte development. This developmental block was accompanied by accumulation of cer- amides, resulting in enhanced apoptosis of developing T cells. Lack of immigration or settlement of ETP completely halted -thymocyte development. We conclude that increased ceramide levels in the thymus of SGPL1؊/؊ mice abrogate thymic develop ment postnatally by enhanced thymocyte apoptosis and depletion of thymic ETP. Our findings indicate that potentially therapeutic immunosuppression by SGPL1 inhibition should benefit from monitoring ceramides to prevent their increase to apoptosis- in- ducing levels. The Journal of Immunology, 2009, 183: 4292–4301. http://www.jimmunol.org/ elf-renewing hematopoietic stem cells are the source of well as CD127ϩCD117low common lymphoid progenitors (4) all blood cell lineages including T cells. Intrathymic T and CD117lowCD90high circulating T cell progenitors (5). cell development depends on continuous recruitment of The most potent T cell precursors inside the thymus are found S 5 ϩ Ϫ bone marrow (BM) -derived progenitors via the bloodstream. in the heterogeneous CD44 , CD25 , and CD4 and CD8 dou- The nature of thymus-seeding precursors remains yet elusive, ble-negative (DN) 1 thymocyte population and were originally but several candidate populations have been proposed such as characterized as CD4lowCD117ϩ (6, 7). These cells are able to Fms-like tyrosine kinase receptor 3 (Flt3)-positive multipotent differentiate in T, B, NK, and lymphoid dendritic cells. Further ϩ ϩ Ϫ/low progenitors, L-selectin progenitors (1), RAG-1 early lym- investigations identified LSK and IL-7R␣ early T cell pro- by guest on October 1, 2021 phoid progenitors (2), all of which share a lineage-negative genitors (ETP) in the DN1 subset with high T and limited B as Ϫ ϩ high (Lin ), Sca-1 , and CD117 (c-kit) (LSK) phenotype (3), as well as myeloid potential (8). The molecular requirements for homing of extrathymic progen- itors to the thymus are mostly unknown. Although a competitive *Institute for Immunology, Hannover Medical School, Hanover, Germany; and †Lab- oratory for Lipid Biochemistry and Protein Interactions, Department of Molecular disadvantage of ETP in seeding the thymus was reported for Ϫ Ϫ Cell Biology, Katholieke Universiteit Leuven, Leuven, Belgium CCR9 / mice as well as for mice deficient in PSGL-1, the ligand Received for publication May 29, 2009. Accepted for publication August 5, 2009. for P-selectin (9, 10), complete loss of ETP in a noncompetitive The costs of publication of this article were defrayed in part by the payment of page situation has not been observed so far, indicating that compensa- charges. This article must therefore be hereby marked advertisement in accordance tory mechanisms exist that allow thymus seeding both in the ab- with 18 U.S.C. Section 1734 solely to indicate this fact. sence of CCR9 or PSGL-1. 1 This work was supported by the Emmy Noether Program of the German Research Foundation (Deutsche Forschungsgemeinschaft), Grants GR 1943/1-4 (to M.H.G.) and Inside the thymus thymocytes pass a series of defined develop- KR 2320/2-1 (to A.K.); the Deutsche Forschungsgemeinschaft Priority Program 1267 mental stages and ultimately differentiate into mature CD4 or CD8 “Sphingolipids-Signals and Disease,” Grant GR 1943/2-1 (to M.H.G.); and the Fonds single-positive (SP) cells, which exit the thymus via a sphingosine Wetenschappelijk Onderzoek-Vlaanderen (Grants G.0405.02 and G.0581.09; to P.P.V.V., ϩ/Ϫ covering the fee for the generation of the chimeric SGPL1 mice by Lexicon Genetics). 1-phosphate (S1P) and S1P receptor type 1 (S1P1)-dependent 2 The funders had no role in study design, data collection and analysis, decision to mechanism (11, 12). S1P in blood stimulates the S1P1 receptor on publish, or preparation of this manuscript. mature thymocytes and induces their egress from thymus, where 3 C.W. and A.K. contributed equally to this work. S1P levels are typically low (13–15). Depletion of S1P from blood 4 Address correspondence and reprint requests to Dr. Markus H. Gra¨ler, Institute results in accumulation of mature thymocytes in thymus because for Immunology, Hannover Medical School, OE 9422, Building K11, Carl-Neu- of the missing egress signal (15). S1P belongs to the sphingolipid berg-Strasse 1, 30625 Hannover, Germany. E-mail address: graeler.markus@ mh-hannover.de family and is produced by N-deacylation of ceramide (Cer) and 5 Abbreviations used in this paper: BM, bone marrow; Cer, ceramide; DOP, 4-deoxy- subsequent phosphorylation of sphingosine (Sph) (16). The ratio of pyridoxine; DN, double negative; DP, double positive; ETP, early T cell progenitor; S1P, S1P and Cer was reported to be a determinant of cell fate, with S1P sphingosine 1-phosphate; SP, single positive; Sph, sphingosine; SGPL1, S1P-lyase 1; promoting survival and Cer inducing apoptosis (17). Both caspase- Flt3, Fms-like tyrosine kinase receptor 3; ETP, early T cell progenitor; S1P1, SP1 receptor type 1; SA, streptavidin; LC/MS/MS, liquid chromatography/mass spectrometry/mass dependent and -independent signaling cascades were reported for spectrometry; ESI, electrospray ionization; 2-MEE, 2-(2-methoxyethoxy)ethanol; wt, Cer-mediated apoptosis (18, 19). wild type; DL4, Delta-like 4; AxV, annexin V; LSK, LinϪSca-1ϩc-kithigh. Inhibition of the S1P-degrading enzyme SGPL1 by the vitamin Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 B6 antagonist 4-deoxypyridoxine (DOP) causes increased S1P www.jimmunol.org/cgi/doi/10.4049/jimmunol.0901724 The Journal of Immunology 4293 levels in lymphoid organs which block lymphocyte egress and in- overnight. Debris was removed by centrifugation, DNA was precipitated duce lymphopenia (14). Accumulated S1P in thymus and lymph with isopropanol, washed once with 75% ethanol, and resuspended in wa- nodes annihilates a proposed gradient between lymphoid tissues on ter after drying. The genotype was determined by a duplex PCR performed with reagents from Fermentas in the MasterCycler Epgradient (Eppendorf) one side and blood and lymph on the other side (13–15). It induces using the following primers (Operon) and optimized conditions (P. P. down-regulation of S1P1 receptor surface expression on lympho- Van Veldhoven, unpublished data): Gal-2s: 5Ј-CGAATACCTGTTCCGT cytes, which, in turn, renders them unresponsive to S1P (13, 14), CATAGC, Gal-2r: 5Ј-ACCACTACCATCATCAATCCGGTAG, MmSPL- and it entails the closure of suggested portals in the sinus-lining Trap-s: 5Ј-TGATAGGG CTGAAAACCACTG, and MmSPL-Trap-r: 5Ј- TCAGAAGCAAAACTGCCTTG; conditions were: 94°C for 2 min for 1 endothelium of lymph nodes (20–22). As a consequence, SP thy- cycle, 94°C for 30 s, 60°C for 30 s, 72°C for 1 min for 35 cycles, and 72°C mocytes and lymph node lymphocytes do not exit into blood and for 7 min for 1 cycle. PCR with these primers yielded a single 667-bp band lymph, but remain in lymph nodes and accumulate in the thymus for SGPL1Ϫ/Ϫ (derived from the ␤-geo sequence in the gene trap), a single ϩ ϩ (11, 12, 14). SGPL1 inhibitors were therefore proposed as poten- 499-bp band for SGPL1 / (amplicon covering the trap insertion site), and ϩ/Ϫ tial immunosuppressive drugs (14) and the SGPL1 inhibitor both bands for SGPL1 mice, when PCR products were separated on an ethidium bromide-agarose gel.
Recommended publications
  • Horse Gamma Globulin Stabilized in 0.3 Molar Glycine to a Ph of Approximately 6.8

    Horse Gamma Globulin Stabilized in 0.3 Molar Glycine to a Ph of Approximately 6.8

    LPD Reference: ATG-SIN-0414/1 Date of Last Revision: 08 September 2014 Country: Singapore Reference document: CDS Version 3.0, effective date: 17-Mar-2014 Reason for change: LPD update in accordance with CDS 3.0 ; 2014-09-08 IR: 1. Remove entire proposed subsection <Renal Transplant Prophylaxis> under ‘Pharmacodynamic Properties - Clinical Studies’ & 2. Relocate paragraph “Clinical trials […] standard supportive care alone” from <Therapeutic Indications> to < Pharmacodynamic Properties - Clinical Studies>, subsection <Aplastic Anemia>. Atgam® lymphocyte immune globulin, anti-thymocyte globulin [equine] sterile solution For Intravenous Use only DESCRIPTION ATGAM Sterile Solution contains lymphocyte immune globulin, anti-thymocyte globulin [equine]. It is the purified, concentrated, and sterile gamma globulin, primarily monomeric IgG, from hyperimmune serum of horses immunized with human thymus lymphocytes. Anti-thymocyte globulin (equine) is a transparent to slightly opalescent aqueous protein solution. It may appear colorless to faintly pink or brown and is nearly odorless. It may develop a slight granular or flaky deposit during storage. (For information about in-line filters, see Infusion Instructions in the POSOLOGY AND METHOD OF ADMINISTRATION.) Before release for clinical use, each lot of anti-thymocyte globulin (equine) is tested to assure its ability to inhibit rosette formation between human peripheral lymphocytes and sheep red blood cells in vitro. In each lot, antibody activity against human red blood cells and platelets is also measured and determined to be within acceptable limits. Only lots that test negative for antihuman serum protein antibody, antiglomerular basement membrane antibody and pyrogens are released. Each milliliter of anti-thymocyte globulin (equine) contains 50 mg of horse gamma globulin stabilized in 0.3 molar glycine to a pH of approximately 6.8.
  • 3156.Full.Pdf

    3156.Full.Pdf

    A New IFN-Like Cytokine, Limitin Modulates the Immune Response Without Influencing Thymocyte Development This information is current as Isao Takahashi, Hiroshi Kosaka, Kenji Oritani, William R. of October 1, 2021. Heath, Jun Ishikawa, Yu Okajima, Megumu Ogawa, Sin-ichiro Kawamoto, Masahide Yamada, Hiroaki Azukizawa, Satoshi Itami, Kunihiko Yoshikawa, Yoshiaki Tomiyama and Yuji Matsuzawa J Immunol 2001; 167:3156-3163; ; doi: 10.4049/jimmunol.167.6.3156 Downloaded from http://www.jimmunol.org/content/167/6/3156 References This article cites 68 articles, 28 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/167/6/3156.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2001 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. A New IFN-Like Cytokine, Limitin Modulates the Immune Response Without Influencing Thymocyte Development1 Isao Takahashi,* Hiroshi Kosaka,† Kenji Oritani,2* William R.
  • Immunology: Improving on Nature Review in the Twenty-First Century

    Immunology: Improving on Nature Review in the Twenty-First Century

    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Cell, Vol. 100, 129±138, January 7, 2000, Copyright 2000 by Cell Press Immunology: Improving on Nature Review in the Twenty-First Century Abul K. Abbas* and Charles A. Janeway Jr.² notion at the time, one that challenged existing concepts *Department of Pathology of how proteins conformed to the shapes of other inter- University of California San Francisco School acting proteins. Nevertheless, the clonal selection the- of Medicine ory became the foundation for our understanding of the San Francisco, California 94123 specificity and development of immune responses. The ² Section of Immunobiology molecular understanding of how the diverse repertoire Yale University School of Medicine of antigen receptors is generated came with the studies New Haven, Connecticut 06520 of Susumu Tonegawa in the 1970s (Tonegawa et al., 1977). Based on this work, and its many subsequent refinements, it is now known that the antigen receptors Introduction of B and T lymphocytes are encoded by genes that are Immunology is the study of the body's defenses against produced by somatic recombination of gene segments infection. The birth of immunology as an experimental during maturation of the cells. The recombination pro- science dates to Edward Jenner's successful vaccina- cess is initiated by the RAG proteins, and presence of tion against smallpox in 1796 (Jenner, 1798). The world- RAG genes during phylogeny identifies the evolutionary wide acceptance of vaccination led to mankind's great- time of appearance of the adaptive immune system, est achievements in preventing disease, and smallpox which is just past the appearance of vertebrates (Agra- is the first and only human disease that has been eradi- wal et al., 1998; Hiom et al., 1998).
  • Rac-King up New Roles in Haematopoiesis

    Rac-King up New Roles in Haematopoiesis

    HIGHLIGHTS numbers of pro-B, pre-B and imma- SIGNALLING IN BRIEF ture B cells in the bone marrow, but reduced numbers of B cells at later Rac-king up developmental stages in the spleen NATURAL KILLER CELLS and lymph nodes. In the absence of new roles in both Rac1 and Rac2, B-cell develop- The mature activating natural killer cell immunologic ment seems to be blocked at the synapse is formed in distinct stages. haematopoiesis transitional type 1 B-cell stage in the Orange, J. S. et al. Proc. Natl Acad. Sci. USA 100, 14151–14156 (2003) spleen. Rac1 and Rac2 guanosine triphos- Recent studies have shown activa- The interface between a natural killer (NK) cell and its target cell phatases (GTPases) are crucial sig- tion of Rac1 after B-cell receptor — the activating NK-cell immunological synapse — is highly nalling regulators in eukaryotic (BCR) stimulation, and signals from organized. In this study, Orange et al. show that CD2 and CD11b, cells, acting downstream of various the BCR are known to be crucial for similar to CD11a, co-localize with filamentous actin in the cellular receptors. Two studies pub- B-cell development, so are BCR sig- peripheral supramolecular activation cluster (pSMAC), whereas lished in Science have used condi- nalling defects responsible for the perforin accumulates in the central SMAC (cSMAC). Polarization tional gene targeting to clarify the observed phenotype of Rac1BRac2–/– of CD2, CD11a and CD11b to the pSMAC was dependent on roles of Rac1 and Rac2 in particular mice? Rac2–/– and Rac1–/+Rac2–/– actin polymerization and Wiskott-Aldrich syndrome protein aspects of haematopoietic-cell mature B cells stimulated with an (WASP), but independent of microtubule function.
  • Molecular Regulation of Peripheral B Cells and Their Progeny in Immunity

    Molecular Regulation of Peripheral B Cells and Their Progeny in Immunity

    Downloaded from genesdev.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Molecular regulation of peripheral B cells and their progeny in immunity Mark R. Boothby,1,2 Emily Hodges,3 and James W. Thomas1,2 1Department of Pathology–Microbiology–Immunology, Vanderbilt University School of Medicine, Nashville, Tennessee 37232, USA; 2Department of Medicine, Rheumatology Division, Vanderbilt University Medical Center, Nashville, Tennessee 37232, USA; 3Department of Biochemistry, Vanderbilt Genetics Institute, Nashville, Tennessee 37232, USA Mature B lymphocytes are crucial components of adap- potentials. A vast trove of findings illuminates the tran- tive immunity, a system essential for the evolutionary fit- scriptional regulation and chromatin modifications (for ness of mammals. Adaptive lymphocyte function requires convenience, referred to here as epigenetic) that program an initially naïve cell to proliferate extensively and its developmental progression from common lymphoid pro- progeny to have the capacity to assume a variety of fates. genitors (CLPs) to the establishment of the naïve popu- These include either terminal differentiation (the long- lations of mature T and B cells (e.g., for review, see lived plasma cell) or metastable transcriptional repro- Busslinger 2004; Champhekar et al. 2015). Similarly, the gramming (germinal center and memory B cells). In this process of diversifying subsets of T cells after their activa- review, we focus principally on the regulation of differen- tion has been studied and reviewed intensively (Glimcher tiation and functional diversification of the “B2” subset. and Murphy 2000; Fang and Zhu 2017; Henning et al. An overview is combined with an account of more recent 2018). Mature B lymphocytes also have the potential to advances, including initial work on mechanisms that distribute their progeny among several distinct fates or eliminate DNA methylation and potential links between intermediate states after they have encountered a ligand intracellular metabolites and chromatin editing.
  • Cell-Independent Plasma Cell Production Involvement of Twisted

    Cell-Independent Plasma Cell Production Involvement of Twisted

    Involvement of Twisted Gastrulation in T Cell-Independent Plasma Cell Production Sotiris Tsalavos, Katerina Segklia, Ourania Passa, Anna Petryk, Michael B. O'Connor and Daniel Graf This information is current as of September 26, 2021. J Immunol 2011; 186:6860-6870; Prepublished online 13 May 2011; doi: 10.4049/jimmunol.1001833 http://www.jimmunol.org/content/186/12/6860 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2011/05/13/jimmunol.100183 Material 3.DC1 References This article cites 53 articles, 20 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/186/12/6860.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 26, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Involvement of Twisted Gastrulation in T Cell-Independent Plasma Cell Production Sotiris Tsalavos,* Katerina Segklia,* Ourania Passa,* Anna Petryk,†,‡ Michael B.
  • Equine Anti-Thymocyte Globulin (ATGAM) Administration in Patient

    Equine Anti-Thymocyte Globulin (ATGAM) Administration in Patient

    Open Access Journal of Clinical Nephrology Case Report Equine Anti-Thymocyte Globulin (ATGAM) administration in patient ISSN 2576-9529 with previous rabbit Anti-Thymocyte Globulin (Thymoglobulin) induced serum sickness: A case report 1 2 3 *Address for Correspondence: Joseph B Pryor, Joseph B Pryor *, Ali J Olyaei , Joseph B Lockridge and Douglas J MD Candidate, Oregon Health and Science 4 Norman University, School of Medicine, Portland, Email: 1 [email protected] MD Candidate, Oregon Health and Science University, School of Medicine, Portland 2Professor of Medicine & Pharmacotherapy, Pharmacy Practice/ Nephrology & Hypertension, Submitted: 08 March 2018 Oregon State University/Oregon Health & Science University, Portland Approved: 22 March 2018 3 Published: 23 March 2018 Assistant Professor of Medicine & Medical Director, Division of Nephrology, Department of Medicine, Oregon Health and Science University and Portland VA Medical Center, Portland Copyright: 2018 Pryor JB. et al. This is 4Professor of Medicine & Director, Immunogenetics Laboratory, Division of Nephrology, Department an open access article distributed under the Creative Commons Attribution License, which of Medicine, Oregon Health and Science University and Portland VA Medical Center, Portland permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Keywords: Thymoglobulin; ATGAM; Serum sickness; Kidney transplantation Thymoglobulin is a rabbit-derived anti-thymocyte antibody directed at T-cells and commonly used for induction immunosuppression therapy in solid organ transplantation, especially in immunologically high risk kidney transplant recipients. Despite its frequent use and effi cacy, the heterologous makeup of thymoglobulin can induce the immune system resulting in serum sickness which typically presents with rash, fever, fatigue, and poly-arthralgia in the weeks following drug exposure.
  • Package Insert

    Package Insert

    HIGHLIGHTS OF PRESCRIBING INFORMATION ---------------------DOSAGE FORMS AND STRENGTHS---------------------- These highlights do not include all the information needed to use • Single-use 10 mL vial containing 25 mg of anti-thymocyte globulin (rabbit) THYMOGLOBULIN® safely and effectively. See full prescribing lyophilized, sterile powder. (3) information for THYMOGLOBULIN. ------------------------------CONTRAINDICATIONS------------------------------- THYMOGLOBULIN (anti-thymocyte globulin [rabbit]) for intravenous Allergy or anaphylactic reaction to rabbit proteins or to any product use excipients, or active acute or chronic infections which contraindicate any Initial U.S. Approval: 1998 additional immunosuppression (4) WARNING: IMMUNOSUPPRESSION ----------------------WARNINGS AND PRECAUTIONS------------------------- ® • THYMOGLOBULIN should only be used by physicians experienced in THYMOGLOBULIN should only be used by physicians experienced in immunosuppressant therapy in transplantation. (5.1) immunosuppressive therapy in transplantation. (5.1) • Immune-mediated reactions: THYMOGLOBULIN infusion could result in ---------------------------RECENT MAJOR CHANGES--------------------------- an anaphylactic reaction. (5.2) Indications and Usage (1) 04/2017 • Infusion-associated reactions: Close compliance with the recommended Dosage and Administration (2.1, 2.2, 2.3, 2.4) 04/2017 infusion time may reduce the incidence and severity of infusion-associated Contraindications (4) 04/2017 reactions. (5.3) Warnings and Precautions (5.1, 5.2, 5.3, 5.5,
  • Cytokine Expression on Thymocyte Apoptosis and Th1/Th2 Synergistic

    Cytokine Expression on Thymocyte Apoptosis and Th1/Th2 Synergistic

    Synergistic Effect of IL-2, IL-12, and IL-18 on Thymocyte Apoptosis and Th1/Th2 Cytokine Expression This information is current as Maria Cecilia Rodriguez-Galán, Jay H. Bream, Andrew Farr of September 23, 2021. and Howard A. Young J Immunol 2005; 174:2796-2804; ; doi: 10.4049/jimmunol.174.5.2796 http://www.jimmunol.org/content/174/5/2796 Downloaded from References This article cites 48 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/174/5/2796.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 23, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Synergistic Effect of IL-2, IL-12, and IL-18 on Thymocyte Apoptosis and Th1/Th2 Cytokine Expression1,2 Maria Cecilia Rodriguez-Gala´n,* Jay H. Bream,† Andrew Farr,‡ and Howard A.
  • The Thymus Is Relevant in the Migration of Mature Lymphocytes

    The Thymus Is Relevant in the Migration of Mature Lymphocytes

    Cell and Tissue Research (2019) 376:19–24 https://doi.org/10.1007/s00441-019-02994-z MINI REVIEW The thymus is relevant in the migration of mature lymphocytes Reinhard Pabst1 Received: 11 September 2018 /Accepted: 15 January 2019 /Published online: 14 February 2019 # Springer-Verlag GmbH Germany, part of Springer Nature 2019 Abstract The thymus is a primary lymphoid organ where T lymphocyte proliferation and selection takes place. The different subsets of lymphocytes leave the thymus as recent thymic emigrants. Peripheral dendritic cells migrate to the thymus. In addition to the homing of hematopoietic progenitor cells to the thymus, there is evidence for lymphocyte entry from peripheral lymphoid tissues mainly into the medulla. The entry sites are the venules in the medullary part near to the cortex with a higher endothelium. Furthermore, there are also B lymphocytes in the thymus. The thymus is not only a primary lymphoid organ but is well integrated in lymphocyte traffic as shown in several different species. Keywords Thymus . Medulla . Lymphocyte entry . Peripheral lymphoid organs . Blymphocytes Introduction Zúñiga-Pflücker 2007). Rodewald (2007) included a cer- vical thymus in the mouse, which produces T cells only The thymus is normally taken as a typical primary lymphoid after birth. organ thus independent of the influx of mature lymphocytes Stem cells from the bone marrow enter this epithelial from the periphery (see textbooks of immunology, e.g., structure and differentiate into different subsets and Cowan et al. 2016,orofanatomy,seeStandring2016). form the structural backbone. There is a multistep cas- However, there are many data documenting the entry of lym- cade of adhesion molecules essential for bone marrow– phocytes from the blood and secondary lymphoid organs into derived progenitor cells to home to the thymus the thymus, which have mostly been neglected so far.
  • Thymocyte Development: Cytokines Have the Casting Vote

    Thymocyte Development: Cytokines Have the Casting Vote

    RESEARCH HIGHLIGHTS Nature Reviews Immunology | AOP, published online 19 February 2010; doi:10.1038/nri2732 THYMOCYTE DEVELOPMENT Cytokines have the casting vote Signals through the T cell receptor other STAT molecules. The authors the TCR-associated tyrosine kinase (TCR) are crucial for the positive conclude that STAT-mediated ZAP70 were crossed with Socs1- selection of double-positive (DP) cytokine signalling is required for the knockout mice transgenic for the IL-7 thymocytes and for the differen- generation of most, if not all, CD8+ receptor α-chain to produce mice in tiation of CD4+ T cells. Far less thymocytes, which was supported by which thymocytes were arrested at a is known about how CD8+ T cell the total lack of CD8+ thymocytes in pre-selection DP stage, owing to a lack lineage specification occurs; this mice transgenic for the STAT signal- of TCR signalling, but were responsive study indicates that although TCR ling inhibitor suppressor of cytokine to IL-7. In vitro culture of purified DP signalling sets the stage for the differ- signalling 1 (SOCS1). thymocytes from these mice with IL-7 entiation of CD8+ T cells, signalling In an in vitro model of positive or transgenic intrathymic expression by cytokines such as interleukin-7 selection, the Runt-family transcrip- of IL-7 in vivo resulted in RUNX3 (IL-7) is the deciding factor. tion factor RUNX3 — which speci- expression by thymocytes and the dif- TCR-mediated positive selection fies the CD8+ T cell lineage — was ferentiation of CD8+ T cells expressing converts cytokine-unresponsive DP expressed only after stimulation markers of functional competence.
  • Davina Dadley-Moore

    Davina Dadley-Moore

    RESEARCH HIGHLIGHTS of monoclonal antibodies specific early phase response when trans- for type II collagen together with ferred to mice that are deficient in lipopolysaccharide and is character- both T-bet and RAG2. Consistent IN BRIEF ized by an early innate phase followed with this role for DCs in the early by a later adaptive phase. Compared inflammatory phase, the authors with wild-type mice, the onset of showed that T-bet-deficient DCs pro- T-CELL DEVELOPMENT CAIA in T-bet-deficient mice was duced less of the pro-inflammatory Premature expression of chemokine receptor CCR9 delayed and was less severe in both mediators interleukin-1α and impairs T cell development. the initial and the late phases. CC-chemokine ligand 3 (CCL3) Uehara, S. et al. J. Immunol. 176, 75–84 (2006) Mice that are deficient in RAG2 and more CCL17, a ligand for the Only late CD4–CD8– double-negative (DN) thymocytes and + + (recombination-activating gene 2), TH2-cell-specific chemokine CD4 CD8 double-positive thymocytes express CC-chemokine which completely lack B and T cells, receptor CCR4, than wild-type DCs. receptor 9 (CCR9). To investigate whether expression of CCR9 developed early joint inflammation, Moreover, the ability of DCs to prime controls the migration of thymocytes and their retention in the but the later phase was attenuated. naive T cells in vivo was impaired thymus, Uehara et al. generated transgenic mice in which CCR9 + + And mice that are deficient in both in the absence of T-bet. was expressed throughout T-cell development. CD4 and CD8 single-positive (SP) thymocytes could exit the thymus, indicating T-bet and RAG2 were resistant to the In light of these results, that CCR9 downregulation is not essential for SP thymocyte induction of arthritis.