Discontinued Postnatal Thymocyte Development in Sphingosine 1-Phosphate-Lyase-Deficient Mice This information is current as Claudia Weber, Andreas Krueger, Anika Münk, Constantin of October 1, 2021. Bode, Paul P. Van Veldhoven and Markus H. Gräler J Immunol 2009; 183:4292-4301; Prepublished online 11 September 2009; doi: 10.4049/jimmunol.0901724 http://www.jimmunol.org/content/183/7/4292 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2009/09/10/jimmunol.090172 Material 4.DC1 http://www.jimmunol.org/ References This article cites 48 articles, 20 of which you can access for free at: http://www.jimmunol.org/content/183/7/4292.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Discontinued Postnatal Thymocyte Development in Sphingosine 1-Phosphate-Lyase-Deficient Mice1,2 Claudia Weber,3* Andreas Krueger,3* Anika Mu¨nk,* Constantin Bode,* Paul P. Van Veldhoven,† and Markus H. Gra¨ler4* Circulation of lymphocytes through peripheral lymphoid tissues as well as progenitor entry into the thymus and its output of mature T cells are critical for normal immune function. Egress of lymphocytes from both peripheral lymphoid organs and thymus is dependent on sphingosine 1-phosphate (S1P) gradients. S1P-lyase 1 (SGPL1) deficiency leads to accumulation of S1P in lym- phoid tissues, which blocks lymphocyte egress and induces thymus atrophy. In this study, we investigated thymocyte development in SGPL1-deficient mice (SGPL1؊/؊), which exhibited postnatal discontinuation of early thymocytopoiesis starting at 2 wk after birth. SGPL؊/؊ thymi showed a loss of developing thymocytes in the thymic cortex between 2 and 4 wk of age, whereas mature thymocytes accumulated in the medulla. Detailed analysis demonstrated a deficit in thymic early T cell progenitors (ETP) as the Downloaded from principal reason for discontinued thymocyte development. This developmental block was accompanied by accumulation of cer- amides, resulting in enhanced apoptosis of developing T cells. Lack of immigration or settlement of ETP completely halted -thymocyte development. We conclude that increased ceramide levels in the thymus of SGPL1؊/؊ mice abrogate thymic develop ment postnatally by enhanced thymocyte apoptosis and depletion of thymic ETP. Our findings indicate that potentially therapeutic immunosuppression by SGPL1 inhibition should benefit from monitoring ceramides to prevent their increase to apoptosis- in- ducing levels. The Journal of Immunology, 2009, 183: 4292–4301. http://www.jimmunol.org/ elf-renewing hematopoietic stem cells are the source of well as CD127ϩCD117low common lymphoid progenitors (4) all blood cell lineages including T cells. Intrathymic T and CD117lowCD90high circulating T cell progenitors (5). cell development depends on continuous recruitment of The most potent T cell precursors inside the thymus are found S 5 ϩ Ϫ bone marrow (BM) -derived progenitors via the bloodstream. in the heterogeneous CD44 , CD25 , and CD4 and CD8 dou- The nature of thymus-seeding precursors remains yet elusive, ble-negative (DN) 1 thymocyte population and were originally but several candidate populations have been proposed such as characterized as CD4lowCD117ϩ (6, 7). These cells are able to Fms-like tyrosine kinase receptor 3 (Flt3)-positive multipotent differentiate in T, B, NK, and lymphoid dendritic cells. Further ϩ ϩ Ϫ/low progenitors, L-selectin progenitors (1), RAG-1 early lym- investigations identified LSK and IL-7R␣ early T cell pro- by guest on October 1, 2021 phoid progenitors (2), all of which share a lineage-negative genitors (ETP) in the DN1 subset with high T and limited B as Ϫ ϩ high (Lin ), Sca-1 , and CD117 (c-kit) (LSK) phenotype (3), as well as myeloid potential (8). The molecular requirements for homing of extrathymic progen- itors to the thymus are mostly unknown. Although a competitive *Institute for Immunology, Hannover Medical School, Hanover, Germany; and †Lab- oratory for Lipid Biochemistry and Protein Interactions, Department of Molecular disadvantage of ETP in seeding the thymus was reported for Ϫ Ϫ Cell Biology, Katholieke Universiteit Leuven, Leuven, Belgium CCR9 / mice as well as for mice deficient in PSGL-1, the ligand Received for publication May 29, 2009. Accepted for publication August 5, 2009. for P-selectin (9, 10), complete loss of ETP in a noncompetitive The costs of publication of this article were defrayed in part by the payment of page situation has not been observed so far, indicating that compensa- charges. This article must therefore be hereby marked advertisement in accordance tory mechanisms exist that allow thymus seeding both in the ab- with 18 U.S.C. Section 1734 solely to indicate this fact. sence of CCR9 or PSGL-1. 1 This work was supported by the Emmy Noether Program of the German Research Foundation (Deutsche Forschungsgemeinschaft), Grants GR 1943/1-4 (to M.H.G.) and Inside the thymus thymocytes pass a series of defined develop- KR 2320/2-1 (to A.K.); the Deutsche Forschungsgemeinschaft Priority Program 1267 mental stages and ultimately differentiate into mature CD4 or CD8 “Sphingolipids-Signals and Disease,” Grant GR 1943/2-1 (to M.H.G.); and the Fonds single-positive (SP) cells, which exit the thymus via a sphingosine Wetenschappelijk Onderzoek-Vlaanderen (Grants G.0405.02 and G.0581.09; to P.P.V.V., ϩ/Ϫ covering the fee for the generation of the chimeric SGPL1 mice by Lexicon Genetics). 1-phosphate (S1P) and S1P receptor type 1 (S1P1)-dependent 2 The funders had no role in study design, data collection and analysis, decision to mechanism (11, 12). S1P in blood stimulates the S1P1 receptor on publish, or preparation of this manuscript. mature thymocytes and induces their egress from thymus, where 3 C.W. and A.K. contributed equally to this work. S1P levels are typically low (13–15). Depletion of S1P from blood 4 Address correspondence and reprint requests to Dr. Markus H. Gra¨ler, Institute results in accumulation of mature thymocytes in thymus because for Immunology, Hannover Medical School, OE 9422, Building K11, Carl-Neu- of the missing egress signal (15). S1P belongs to the sphingolipid berg-Strasse 1, 30625 Hannover, Germany. E-mail address: graeler.markus@ mh-hannover.de family and is produced by N-deacylation of ceramide (Cer) and 5 Abbreviations used in this paper: BM, bone marrow; Cer, ceramide; DOP, 4-deoxy- subsequent phosphorylation of sphingosine (Sph) (16). The ratio of pyridoxine; DN, double negative; DP, double positive; ETP, early T cell progenitor; S1P, S1P and Cer was reported to be a determinant of cell fate, with S1P sphingosine 1-phosphate; SP, single positive; Sph, sphingosine; SGPL1, S1P-lyase 1; promoting survival and Cer inducing apoptosis (17). Both caspase- Flt3, Fms-like tyrosine kinase receptor 3; ETP, early T cell progenitor; S1P1, SP1 receptor type 1; SA, streptavidin; LC/MS/MS, liquid chromatography/mass spectrometry/mass dependent and -independent signaling cascades were reported for spectrometry; ESI, electrospray ionization; 2-MEE, 2-(2-methoxyethoxy)ethanol; wt, Cer-mediated apoptosis (18, 19). wild type; DL4, Delta-like 4; AxV, annexin V; LSK, LinϪSca-1ϩc-kithigh. Inhibition of the S1P-degrading enzyme SGPL1 by the vitamin Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 B6 antagonist 4-deoxypyridoxine (DOP) causes increased S1P www.jimmunol.org/cgi/doi/10.4049/jimmunol.0901724 The Journal of Immunology 4293 levels in lymphoid organs which block lymphocyte egress and in- overnight. Debris was removed by centrifugation, DNA was precipitated duce lymphopenia (14). Accumulated S1P in thymus and lymph with isopropanol, washed once with 75% ethanol, and resuspended in wa- nodes annihilates a proposed gradient between lymphoid tissues on ter after drying. The genotype was determined by a duplex PCR performed with reagents from Fermentas in the MasterCycler Epgradient (Eppendorf) one side and blood and lymph on the other side (13–15). It induces using the following primers (Operon) and optimized conditions (P. P. down-regulation of S1P1 receptor surface expression on lympho- Van Veldhoven, unpublished data): Gal-2s: 5Ј-CGAATACCTGTTCCGT cytes, which, in turn, renders them unresponsive to S1P (13, 14), CATAGC, Gal-2r: 5Ј-ACCACTACCATCATCAATCCGGTAG, MmSPL- and it entails the closure of suggested portals in the sinus-lining Trap-s: 5Ј-TGATAGGG CTGAAAACCACTG, and MmSPL-Trap-r: 5Ј- TCAGAAGCAAAACTGCCTTG; conditions were: 94°C for 2 min for 1 endothelium of lymph nodes (20–22). As a consequence, SP thy- cycle, 94°C for 30 s, 60°C for 30 s, 72°C for 1 min for 35 cycles, and 72°C mocytes and lymph node lymphocytes do not exit into blood and for 7 min for 1 cycle. PCR with these primers yielded a single 667-bp band lymph, but remain in lymph nodes and accumulate in the thymus for SGPL1Ϫ/Ϫ (derived from the ␤-geo sequence in the gene trap), a single ϩ ϩ (11, 12, 14). SGPL1 inhibitors were therefore proposed as poten- 499-bp band for SGPL1 / (amplicon covering the trap insertion site), and ϩ/Ϫ tial immunosuppressive drugs (14) and the SGPL1 inhibitor both bands for SGPL1 mice, when PCR products were separated on an ethidium bromide-agarose gel.