DOCSLIB.ORG

A) Analysis of the Ncrnas of Arabidopsis Inflorescences and Pollen Bioreplicates (Two Bioreplicates for Each Tissue

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A) Analysis of the Ncrnas of Arabidopsis Inflorescences and Pollen Bioreplicates (Two Bioreplicates for Each Tissue Supplementary Material: Supplemental Figure 1. (A) Analysis of the ncRNAs of Arabidopsis inflorescences and pollen bioreplicates (two bioreplicates for each tissue). Biological replicates 1 and 2 of inflorescence are paired samples for both pollen biological replicates 1 and 2. (B) Individual tRF accumulation profiles for the different sRNA libraries used in Figure 1C. (C-D) Distribution of 5’ end nucleotide of 19 nt sRNAs along mature tRNA transcript sequences post- transcriptionally modified with the CCA sequence, in inflorescence (C) and pollen (D). Supplemental Figure 2. (A-C) Distribution of 5’ end nucleotide of 19 nt tRFs along mature tRNA transcript sequences post-transcriptionally modified with the CCA sequence in rice (A) and maize (B) pollen, and Physcomitrella patens gametophote-sporophyte (C) samples. Supplemental Figure 3. (A) Individual tRF accumulation profiles for the different sRNA libraries used in Figure 3A. (B) tRF accumulation profile in seedling sRNA libraries from ddm1 (red) and wt (blue), normalized in RPM. (C) Distribution of 19 nt tRFs along mature tRNA transcript sequences post- transcriptionally modified with the CCA sequence in the ddm1 background. (D) tRF accumulation profile in inflorescence sRNA libraries from met1 single and ddc triple mutants. 1 Supplemental Figure 4. (A) Individual tRF accumulation profiles for the different sRNA libraries used in Figure 4B. (B) AGO1-immunoprecipitated tRF accumulation size profile in wt and ddm1. (C) NcRNA categorization of the AGO1-immunoprecipitated sRNAs in wt and ddm1 libraries. (D) RT-PCR analysis of the accumulation of tRNA transcripts in gene-specific reverse (1) or oligo-dT (2) primers synthesized cDNA for selected tRNAs in the ddm1, ddm1/dcl1-11 and ddm1/ago1-24 backgrounds. The gene Tyrosine amminotransferase (TyrAT, At2g20610) and the miR161 precursor (pre- miR161) were used as controls. Supplemental Figure 5. wt and ddm1 inflorescence PARE reads aligned along a 100 nt window 5’ and 3’ to the PAREsnip-predicted target sites for protein coding genes. Supplemental Figure 6. Model of tRF processing. Data suggests that the Dicer-dependent tRF processing from the pre-tRNA occurs after RNase P and RNase Z activity, and generates a tRF-5s 19nt sRNA capable of targeting and cleaving TE mRNA transcripts. Supplemental Table 1. Mutant alleles used in this study. Supplemental Table 2. PCR Primers used in this study. Supplemental Table 3. sRNA and PARE libraries used in this study. Supplemental Table 4. 5’-derived 19 nt tRF-predicted targets in Arabidopsis thaliana. 2 Supplemental Figure 1 A 450000 small RNA derived from non-coding RNAs C 100 Inflorescence tRF alignment 400000 90 25 nts 350000 24 nts 80 300000 23 nts 70 250000 22 nts 60 RPM 200000 21 nts 50 150000 20 nts 40 100000 19 nts Percentage 50000 18 nts 30 0 20 10 Pollen-Biorep1 Pollen-Biorep1 Pollen-Biorep1 Pollen-Biorep2 Pollen-Biorep2 Pollen-Biorep2 Pollen-Biorep1 Pollen-Biorep2 Pollen-Biorep2 Pollen-Biorep1 5’- tRNA mature transcript -CCA-3’ Inorescence-Biorep1 Inorescence-Biorep1 Inorescence-Biorep2 Inorescence-Biorep2 Inorescence-Biorep2 Inorescence-Biorep2 Inorescence-Biorep1 Inorescence-Biorep1 Inorescence-Biorep1 Inorescence-Biorep2 rRNAs tRNAs miRNAs snoRNAs snRNAs B RPM D 100 tRF accumulation profile 90 Pollen tRF alignment 0 40000 80 25 70 60 50 size (nt) 40 Percentage 30 19 20 18 10 5’- tRNA mature transcript -CCA-3’ infl Rep1 infl Rep2 leaf Rep1 leaf Rep2 leaf Rep3 Pollen Rep2 Pollen Rep3 Pollen Rep5 Pollen Rep1 Pollen Rep4 Supplemental Figure 2 A B C 100 100 100 Rice pollen Maize pollen 90 P.patens gametophore 90 90 80 80 80 and sporophyte 70 70 70 60 60 60 50 50 50 40 40 40 30 30 30 20 20 20 10 10 10 -CCA-3’ 5’- tRNA mature transcript -CCA-3’ 5’- tRNA mature transcript -CCA-3’ 5’- tRNA mature transcript Supplemental Figure 3 RPM A ddm1 tRF accumulation profile B tRF accumulation profile in wt Col and ddm1 seedlings 0 50000 14000 25nt 12000 wt Col seedling ddm1 seedling 10000 8000 size (nt) RPM 6000 20 nt 4000 18 nt 2000 0 Rep1 Rep2 Rep3 18 19 20 21 22 23 24 25 wt Rep1 wt Rep2 wt Rep3 size (nt) ddm1 ddm1 ddm1 D C tRF accumulation profile in ddc and met1 4000 100 wt Col ddm1 tRF distribution profile 3500 90 ddc 80 3000 met1 70 2500 60 2000 50 RPM Percentage 40 1500 30 1000 20 500 10 0 5’- tRNA mature transcript -CCA-3’ 18 19 20 21 22 23 24 25 size (nt) Supplemental Figure 4. RPM D RT-detection of poly-A transcripts A tRF accumulation profile 0 50000 25 nt 1 2 ) t gene-specific primer Oligo-dT primer n Oligo-dT primer ( e +RT +RT No RT z i s 20 nt 18 nt Ladder ddm1 ddm1/dcl1 ddm1/ago1 Ladder ddm1 ddm1/dcl1 ddm1/ago1 Ladder ddm1 ddm1/dcl1 ddm1/ago1 ddm1 ddm1 ddm1/dcl1 ddm1/dcl1 Rep2 Rep3 Rep1 Rep2 200 nt 100 nt Ala AGC B 16000 AGO1 immunoprecipitated-tRF profile 50 nt 14000 wt Col 12000 200 nt ddm1 10000 100 nt Arg TCT 8000 50 nt 6000 RPM 200 nt 4000 Leu AAG 2000 100 nt 0 50 nt 18 19 20 21 22 23 24 25 size (nt) 200 nt 100 nt Met CAT C AGO1 IP ncRNA categorization 50 nt wt Col ddm1 300 nt tRFs 200 nt At2g20610 miRNAs 100 nt control gene snoRNAs 300 nt snRNAs 200 nt pre-miR161 rRNAs 100 nt Supplemental Figure 5 500 Protein coding genes 400 wt Col ddm1 300 RPM 200 100 0 -100-90 -80 -70 -60 -50 -40 -30 -20 -10 0 10 20 30 40 50 60 70 80 90 100 Distance to predicted target site Pol III complex RNase P RNase Z Transcription active tRNA gene pre-tRNA tRF biogenesis Protein biogenesis CCA CCA DCL1 mature-tRNA 5’ tRF CCA AGO1 5’ tRF TE mRNA cleavage Translation CCA CCA CCA AGO1 CCA (A)n 5’ tRF mRNA (A)n Supplemental Table 1. Mutant alleles used in this study Mutant Allele Background ddm1 ddm1-2 Col-0 dcl1 dcl1-11 Col-0 dcl2 dcl2-1 Col-0 ago1 ago1-27 Col-0 Supplemental Table 2. Primers used in this study Primer name Use in this study Sequence (5'-3') Athila 4C_1 5'RLM RACE GCAAGATAAGGAGGGTGGCTA Athila 4C_2 5'RLM RACE TCGACACTCTGGTCGTTTTG Athila 6A_1 5'RLM RACE GCAACTAGTCCTGAAGGGATTC Athila 6A_2 5'RLM RACE CCAATCCCTTGGGATAGAGAC AlaAGC_5'_tRF_probe Northern blot CCATCTGAGCTACATCCCC ArgTCT_probe Northern blot TCCATTAGGCCACGGGCGC LysTTT_probe Northern blot ACCACTGAGCTAAGACGGC miR161_probe Northern blot TAGTCACTTTCAATGCATTGA miR166_probe Northern blot GGGGAATGAAGCCTGGTCCGA U6_snRNA_probe Northern blot TCATCCTTGCGCAGGGGCCA pre-miR161_Forward RT-PCR TGCTTGATCTCGGTTTTTGACC pre-miR161_Forward RT-PCR TGCTTTTCCCTCTTTTTACAAATGC AlaAGC_RT_Forward RT-PCR GGGGATGTAGCTCAGATGG AlaAGC_RT_Reverse RT-PCR TGGTGGAGTGCGGGGTATCG LeuAAG_RT_Forward RT-PCR GTTGATATGGCCGAGTTGGTC LeuAAG_RT_Reverse RT-PCR TGGTGTTGACAGTGGGATTTG ArgTCT_RT_Forward RT-PCR GCGCCCGTGGCCTAATGGATA ArgTCT_RT_Reverse RT-PCR TGGCACGCCCGGTGGGACTCG MetCAT_RT_Forward RT-PCR GGGGTGGTGGCGCAGGTTGGCT MetCAT_RT_Reverse RT-PCR TGGTGGGGTGAGAGAGGTCG KRP6_promoter_Forward Cloning CACCTCGTTGTTGCATCAGTCACTTAATTATTAC KRP6_promoter_21nt_mock_H2B_Reverse Cloning ATCTGCCTTCGCCATTAACTGTCTAACGTAGGCACCtctctcttggatttttgtgtgc KRP6_promoter_21nt_Athila_H2B_Reverse Cloning ATCTGCCTTCGCCATGAACCATGCCTAGATTGCTCTtctctcttggatttttgtgtgc H2B_Forward Cloning ATGGCGAAGGCAGATAAGAAACCAG H2B_Reverse Cloning AGAACTCGTAAACTTCGTAACCG Athila 4C_qPCR_Forward qPCR TCCTTCTCTTCTGCATGTCG Athila 4C_qPCR_Reverse qPCR GGCAGCTGATATGGAAGAGC Athila 6A_qPCR_Forward qPCR CGACATTGAGTTTTTGCTTCA Athila 6A_qPCR_Reverse qPCR TGCGGAATCTGAATAACTTGG Supplemental Table 3. sRNA and PARE libraries used in this study Library type Organism Tissue Genotype Use in this work Reference Public database refence number Database webpage Figure sRNA A.thaliana Leaf wt Col Leaf bioreplicate 1 [65] GSM773795 http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Leaf wt Col Leaf bioreplicate 2 [65] GSM773794 http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Leaf wt Col Leaf bioreplicate 3 [65] GSM773793 http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Inflorescence wt Col Inflorescence bioreplicate 1/ddm1 control inflorescence 1 [3] GSM1495677 http://www.ncbi.nlm.nih.gov/geo/ Figure 1/Figure 3 sRNA A.thaliana Inflorescence wt Col Inflorescence bioreplicate 2 this study - http://www.ncbi.nlm.nih.gov/geo/ Figure 1/Figure 3 sRNA A.thaliana Pollen wt Col Pollen bioreplicate 1 [3] RMKS01 https://mpss.udel.edu Figure 1 sRNA A.thaliana Pollen wt Col Pollen bioreplicate 2 this study - http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Pollen wt Col Pollen bioreplicate 3 this study - http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Pollen wt Col Pollen bioreplicate 4 this study - http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Pollen wt Col Pollen bioreplicate 5 this study - http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Inflorescence ddm1 ddm1 bioreplicate 1 [3] GSM1495678 http://www.ncbi.nlm.nih.gov/geo/ Figure 3/Figure 4 sRNA A.thaliana Inflorescence ddm1 ddm1 bioreplicate 2 [17] GSM1278498 http://www.ncbi.nlm.nih.gov/geo/ Figure 3/Figure 4 sRNA A.thaliana Inflorescence ddm1 ddm1 bioreplicate 3 [17] GSM1278503 http://www.ncbi.nlm.nih.gov/geo/ Figure 3/Figure 4 sRNA A.thaliana seedling wt Col wt Col seedling [66] GSM338557 http://www.ncbi.nlm.nih.gov/geo/ Supp Figure 3 sRNA A.thaliana seedling ddm1 ddm1 seedling [66] GSM338558 http://www.ncbi.nlm.nih.gov/geo/ Supp Figure 3 sRNA A.thaliana Inflorescence wt Col wt Col control of met1 and ddc mutants [68] GSM277608 http://www.ncbi.nlm.nih.gov/geo/ Supp Figure 3 sRNA A.thaliana Inflorescence met1 met1 [68] GSM277609 http://www.ncbi.nlm.nih.gov/geo/ Supp Figure 3 sRNA A.thaliana Inflorescence ddc ddc [68] GSM277610 http://www.ncbi.nlm.nih.gov/geo/ Supp Figure 3 sRNA A.thaliana AGO1 IP wt Col AGO1 IP wt Col bioreplicate 1 this study
Load more

Recommended publications
  • Promiscuity and Specificity of Eukaryotic Glycosyltransferases
    Biochemical Society Transactions (2020) 48 891–900 https://doi.org/10.1042/BST20190651 Review Article Promiscuity and specificity of eukaryotic glycosyltransferases Ansuman Biswas and Mukund Thattai Simons Centre for the Study of Living Machines, National Centre for Biological Sciences, TIFR, Bangalore, India Correspondence: Mukund Thattai ([email protected]) Glycosyltransferases are a large family of enzymes responsible for covalently linking sugar monosaccharides to a variety of organic substrates. These enzymes drive the synthesis of complex oligosaccharides known as glycans, which play key roles in inter-cellular interac- tions across all the kingdoms of life; they also catalyze sugar attachment during the syn- thesis of small-molecule metabolites such as plant flavonoids. A given glycosyltransferase enzyme is typically responsible for attaching a specific donor monosaccharide, via a spe- cific glycosidic linkage, to a specific moiety on the acceptor substrate. However these enzymes are often promiscuous, able catalyze linkages between a variety of donors and acceptors. In this review we discuss distinct classes of glycosyltransferase promiscuity, each illustrated by enzymatic examples from small-molecule or glycan synthesis. We high- light the physical causes of promiscuity, and its biochemical consequences. Structural studies of glycosyltransferases involved in glycan synthesis show that they make specific contacts with ‘recognition motifs’ that are much smaller than the full oligosaccharide sub- strate. There is a wide range in the sizes of glycosyltransferase recognition motifs: highly promiscuous enzymes recognize monosaccharide or disaccharide motifs across multiple oligosaccharides, while highly specific enzymes recognize large, complex motifs found on few oligosaccharides. In eukaryotes, the localization of glycosyltransferases within compartments of the Golgi apparatus may play a role in mitigating the glycan variability caused by enzyme promiscuity.
    [Show full text]
  • Fucosyltransferase Genes on Porcine Chromosome 6Q11 Are Closely Linked to the Blood Group Inhibitor (S) and Escherichia Coli F18 Receptor (ECF18R) Loci
    Mammalian Genome 8, 736–741 (1997). © Springer-Verlag New York Inc. 1997 Two a(1,2) fucosyltransferase genes on porcine Chromosome 6q11 are closely linked to the blood group inhibitor (S) and Escherichia coli F18 receptor (ECF18R) loci E. Meijerink,1 R. Fries,1,*P.Vo¨geli,1 J. Masabanda,1 G. Wigger,1 C. Stricker,1 S. Neuenschwander,1 H.U. Bertschinger,2 G. Stranzinger1 1Institute of Animal Science, Swiss Federal Institute of Technology, ETH-Zentrum, CH-8092 Zurich, Switzerland 2Institute of Veterinary Bacteriology, University of Zurich, CH 8057 Zurich, Switzerland Received: 17 February 1997 / Accepted: 30 May 1997 Abstract. The Escherichia coli F18 receptor locus (ECF18R) has fimbriae F107, has been shown to be genetically controlled by the been genetically mapped to the halothane linkage group on porcine host and is inherited as a dominant trait (Bertschinger et al. 1993) Chromosome (Chr) 6. In an attempt to obtain candidate genes for with B being the susceptibility allele and b the resistance allele. this locus, we isolated 5 cosmids containing the a(1,2)fucosyl- The genetic locus for this E. coli F18 receptor (ECF18R) has been transferase genes FUT1, FUT2, and the pseudogene FUT2P from mapped to porcine Chr 6 (SSC6), based on its close linkage to the a porcine genomic library. Mapping by fluorescence in situ hy- S locus and other loci of the halothane (HAL) linkage group (Vo¨- bridization placed all these clones in band q11 of porcine Chr 6 geli et al. 1996). The epistatic S locus suppresses the phenotypic (SSC6q11). Sequence analysis of the cosmids resulted in the char- expression of the A-0 blood group system when being SsSs (Vo¨geli acterization of an open reading frame (ORF), 1098 bp in length, et al.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown Et Al
    US 20030082511A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown et al. (43) Pub. Date: May 1, 2003 (54) IDENTIFICATION OF MODULATORY Publication Classification MOLECULES USING INDUCIBLE PROMOTERS (51) Int. Cl." ............................... C12O 1/00; C12O 1/68 (52) U.S. Cl. ..................................................... 435/4; 435/6 (76) Inventors: Steven J. Brown, San Diego, CA (US); Damien J. Dunnington, San Diego, CA (US); Imran Clark, San Diego, CA (57) ABSTRACT (US) Correspondence Address: Methods for identifying an ion channel modulator, a target David B. Waller & Associates membrane receptor modulator molecule, and other modula 5677 Oberlin Drive tory molecules are disclosed, as well as cells and vectors for Suit 214 use in those methods. A polynucleotide encoding target is San Diego, CA 92121 (US) provided in a cell under control of an inducible promoter, and candidate modulatory molecules are contacted with the (21) Appl. No.: 09/965,201 cell after induction of the promoter to ascertain whether a change in a measurable physiological parameter occurs as a (22) Filed: Sep. 25, 2001 result of the candidate modulatory molecule. Patent Application Publication May 1, 2003 Sheet 1 of 8 US 2003/0082511 A1 KCNC1 cDNA F.G. 1 Patent Application Publication May 1, 2003 Sheet 2 of 8 US 2003/0082511 A1 49 - -9 G C EH H EH N t R M h so as se W M M MP N FIG.2 Patent Application Publication May 1, 2003 Sheet 3 of 8 US 2003/0082511 A1 FG. 3 Patent Application Publication May 1, 2003 Sheet 4 of 8 US 2003/0082511 A1 KCNC1 ITREXCHO KC 150 mM KC 2000000 so 100 mM induced Uninduced Steady state O 100 200 300 400 500 600 700 Time (seconds) FIG.
    [Show full text]
  • Expression and Localization of Grass Carp Pkc-Θ (Protein Kinase C Theta) Gene After Its Activation T
    Fish and Shellfish Immunology 87 (2019) 788–795 Contents lists available at ScienceDirect Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi Full length article Expression and localization of grass carp pkc-θ (protein kinase C theta) gene after its activation T ∗∗ Rumana Mehjabina,b,1, Liangming Chena,b,1, Rong Huanga, , Denghui Zhua,b, Cheng Yanga,b, ∗ Yongming Lia, Lanjie Liaoa, Libo Hea, Zuoyan Zhua, Yaping Wanga, a State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, 430072, China b University of Chinese Academy of Sciences, Beijing, 100049, China ARTICLE INFO ABSTRACT Keywords: Haemorrhagic disease caused by grass carp reovirus (GCRV) can result in large-scale death of young grass carp, Grass carp leading to irreparable economic losses that seriously affect large-scale breeding. Protein kinase C (PKC, also Grass carp reovirus (GCRV) known as PRKC) represents a family of serine/threonine protein kinases that includes multiple isozymes in many Protein kinase C (PKC) species. Among these, PKC-θ (PKC theta, also written as PRKCQ) is a novel isoform, mainly expressed in T cells, Host immune defences that is known to be involved in immune system function in mammals. To date, no research on immunological functions of fish Pkc-θ has been reported. To address this issue, we cloned the grass carp pkc-θ gene. Phylogenetic and syntenic analysis showed that this gene is the most evolutionarily conserved relative to zeb- rafish. Real-time quantitative PCR (RT-qPCR) indicated that pkc-θ was expressed at high levels in the gills and spleen of healthy grass carp.
    [Show full text]
  • Mitochondrial ABC Transporters Vxpx Cargo-Targeting to Cilium Alpha
    PA2GF PA2G5PA2GD PA21BPA2GEPA2GXPA2G3 Acyl chainAcyl chainremodelling remodelling of PI of PG Acyl chain remodelling of PS PA24C AcylAcyl chain chain remodelling remodelling of PCof PE GABA A receptor activation Neurotransmitter receptors and postsynaptic signal transmission GBRA2 GBRB3GBRA6GBRA5 PA2GA GBRA1GBRG2GBRB2GBRB1 GBRT GBRG3GBRA4GBRA3 PA24B Ligand-gated ion channel transport Acyl-CoA:dihydroxyacetonephosphateacyltransferase PPBI Hydrolysis of LPC Hydrolysis ofSynthesis LPE of PA LA Post-translational modification: synthesis of GPI-anchored proteins Catecholamine biosynthesis Plasmalogen biosynthesis GABAGBRR3 AGBRR2 (rho) receptor activation RNA Polymerase III Transcription Termination GBRR1 Creatine metabolism RNA Polymerase III AbortivePNMT AndDDC Retractive Initiation ReuptakeS6A11 of GABA PPBT DigestionPPBN S6A12SC6A7 Interaction between L1 and Ankyrins GLRA1 SC6A1 S6A13 SerotoninSodium/myo-inositol andInositol melatonin transporters cotransporter biosynthesis 2 GLRA2 KCRM FOLR2 KCNQ2 5HT3E5HT3D SC6A3 Astrocytic Glutamate-Glutamine Uptake And Metabolism 5HT3B EAA1 5HT3A5HT3C Na+/Cl- dependent neurotransmitter transportersDopamine clearance from the synaptic cleft SCN8AEAA2 Methylation of TransportINMTMeSeH forof inorganicexcretionSCNAASCN3ASCN2A cations/anions and amino acids/oligopeptidesGlycosyltransferase-likeO-linked glycosylation protein LARGE1 SC6A5SC6A9S6A15 SCN9ASCN4ASCN1ASCNBA SC6A6 SCN7ASCN5A Insulin effects increased synthesis of Xylulose-5-Phosphate SC6A2 TPH1 Potassium transport channels MOT2 Glutamine synthetaseCAC1I
    [Show full text]
  • A-Transferase, 338 ABO Blood Group System, 330 and Cloning, 338
    Index A-transferase, 338 ALG9,165 ABO blood group system, 330 ALGlO,168 and cloning, 338 genetic basis of, 22 B-transferase, 338 activated oligosaccharides bacterial S-Iayers in glycopeptide synthesis, 466, 470 glycosylation in, 439 2-aminoethylphosphonate bacterial toxins in invertebrate glycoproteins, 420 and glycosylation, 413 anomer, 5 biological macromolecules formal defmition of, 6 the four groups of, 2 Hudson definition of, 6 bird's nest soup, 16 anomeric carbon blood group antigens, 22 in synthesis, 459 and cancer, 23 anomeric effect, 8 prognostic value of, 23 anomeric oxygen exchange reactions, blood typing, 22 460,461 ABO system of, 22 anomeric oxygen-retaining reactions, 460, Lewis system of, 22 464 Bombay blood group, 331, 336, 348 antennae Bombay phenotype, 22 definition of, 10 branch specificity, 93 J3-arabinofuranose in plants, 418 caeruloplasmin, 23 asialoglycoprotein receptor, 494 calnexin, 54, 182 asparagine-linked glycosylation genes calreticulin, 54, 182, 188 ALGI, 158 capillary electrophoresis, 457 ALG2,161 carbohydrate metabolism, 1, 17 ALG3,165 Carbohydrate-Deficient Glycoprotein ALG5,167 Syndrome (COGS) Type 1, 152 ALG6,168 Carbohydrate-Deficient Glycoprotein ALG7,155 Syndrome (COGS) Type II, 226 ALGB,168 500 Index Carbohydrates; See a/so oligosaccharides deoxymannoj irimycin, 191 as molecules with key biological deoxynojirimycin, 184 functions, 3 dietary sugars, 1 biology of, 2 disaccharides covalent attachment to protein, 17 structural determination of, 17 definition of, 4 DNA,1 in bacterial and viral infection,
    [Show full text]
  • Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease
    Supplementary Online Content Ganz P, Heidecker B, Hveem K, et al. Development and validation of a protein-based risk score for cardiovascular outcomes among patients with stable coronary heart disease. JAMA. doi: 10.1001/jama.2016.5951 eTable 1. List of 1130 Proteins Measured by Somalogic’s Modified Aptamer-Based Proteomic Assay eTable 2. Coefficients for Weibull Recalibration Model Applied to 9-Protein Model eFigure 1. Median Protein Levels in Derivation and Validation Cohort eTable 3. Coefficients for the Recalibration Model Applied to Refit Framingham eFigure 2. Calibration Plots for the Refit Framingham Model eTable 4. List of 200 Proteins Associated With the Risk of MI, Stroke, Heart Failure, and Death eFigure 3. Hazard Ratios of Lasso Selected Proteins for Primary End Point of MI, Stroke, Heart Failure, and Death eFigure 4. 9-Protein Prognostic Model Hazard Ratios Adjusted for Framingham Variables eFigure 5. 9-Protein Risk Scores by Event Type This supplementary material has been provided by the authors to give readers additional information about their work. Downloaded From: https://jamanetwork.com/ on 10/02/2021 Supplemental Material Table of Contents 1 Study Design and Data Processing ......................................................................................................... 3 2 Table of 1130 Proteins Measured .......................................................................................................... 4 3 Variable Selection and Statistical Modeling ........................................................................................
    [Show full text]
  • CDG and Immune Response: from Bedside to Bench and Back Authors
    CDG and immune response: From bedside to bench and back 1,2,3 1,2,3,* 2,3 1,2 Authors: Carlota Pascoal , Rita Francisco , Tiago Ferro , Vanessa dos Reis Ferreira , Jaak Jaeken2,4, Paula A. Videira1,2,3 *The authors equally contributed to this work. 1 Portuguese Association for CDG, Lisboa, Portugal 2 CDG & Allies – Professionals and Patient Associations International Network (CDG & Allies – PPAIN), Caparica, Portugal 3 UCIBIO, Departamento Ciências da Vida, Faculdade de Ciências e Tecnologia, Universidade NOVA de Lisboa, 2829-516 Caparica, Portugal 4 Center for Metabolic Diseases, UZ and KU Leuven, Leuven, Belgium Word count: 7478 Number of figures: 2 Number of tables: 3 This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1002/jimd.12126 This article is protected by copyright. All rights reserved. Abstract Glycosylation is an essential biological process that adds structural and functional diversity to cells and molecules, participating in physiological processes such as immunity. The immune response is driven and modulated by protein-attached glycans that mediate cell-cell interactions, pathogen recognition and cell activation. Therefore, abnormal glycosylation can be associated with deranged immune responses. Within human diseases presenting immunological defects are Congenital Disorders of Glycosylation (CDG), a family of around 130 rare and complex genetic diseases. In this review, we have identified 23 CDG with immunological involvement, characterised by an increased propensity to – often life-threatening – infection.
    [Show full text]
  • PKC-Theta-Mediated Signal Delivery from Thetcr/CD28 Surface Receptors
    REVIEW ARTICLE published: 22 August 2012 doi: 10.3389/fimmu.2012.00273 PKC-theta-mediated signal delivery from theTCR/CD28 surface receptors Noah Isakov1* and Amnon Altman2 1 The Shraga Segal Department of Microbiology and Immunology, Faculty of Health Sciences and the Cancer Research Center, Ben-Gurion University of the Negev, Beer Sheva, Israel 2 Division of Cell Biology, La Jolla Institute for Allergy and Immunology, La Jolla, CA, USA Edited by: Protein kinase C-theta (PKCθ) is a key enzyme inT lymphocytes, where it plays an important Nick Gascoigne, Scripps Research role in signal transduction downstream of the activated T cell antigen receptor (TCR) and Institute, USA the CD28 costimulatory receptor. Interest in PKCθ as a potential drug target has increased Reviewed by: following recent findings that PKCθ is essential for harmful inflammatory responses medi- Balbino Alarcon, Consejo Superior de Investigaciones Cientificas, Spain ated byTh2 (allergies) andTh17 (autoimmunity) cells as well as for graft-versus-host disease Salvatore Valitutti, INSERM, France (GvHD) and allograft rejection, but is dispensable for beneficial responses such as antiviral *Correspondence: immunity and graft-versus-leukemia (GvL) response. TCR/CD28 engagement triggers the Noah Isakov, The Shraga Segal translocation of the cytosolic PKCθ to the plasma membrane (PM), where it localizes at Department of Microbiology and the center of the immunological synapse (IS), which forms at the contact site between an Immunology, Faculty of Health Sciences and the Cancer Research antigen-specificT cell and antigen-presenting cells (APC). However, the molecular basis for Center, Ben-Gurion University this unique localization, and whether it is required for its proper function have remained of the Negev, P.O.
    [Show full text]
  • Thesematthieuvillegente2013annexes
    Supplemental table 1: list of the proteins identifed from the total protein fraction of Amborella trichopoda isolated embryo by shot gun Proteins have been analyzed by mono-dimensional electrophoresis and identified by mass spectrometry LC/MS-MS. The protein spots were analysed by LC-MS/MS on the PAPPSO plateform (Benoit Valot, Thierry Balliau, Michel Zivy, INRA Moulon, France; http://pappso.inra.fr). Based on the spectrum generated, proteins were identified using the X-Tandem software. "NCBI accession number" is the accession number in NCBI database. "Protein name" . "Organism" relates to the organism from which the identied protein comes from for functional analysis - efforts were focus on Arabidopsis thaliana as a plant model. " "AGI" . "Function category" and "Function description" relate to the functional categories defined according to the ontological classification of Bevan et al . [Bevan et al . (1998) Nature 391:485-488]. "log(Evalue) identification" reflects the statistical power of the identification by BLAST (performed on TAIR or BLAST). "Identity" indicates in % the recovery of the Amborella protein sequence against the identified protein. "Compartement" indicates if the identification is found in the embryo (emb.), the endosperm (end.) or both (emb./end.). "Description" was taken from the Amborella EVM 27 Predicted Proteins (http://www.amborella.org). The "log (E value)" is a statistical parameter that represents the number of peptides present at random in the database. It was calculated by the product of the Evalue of unique peptides identified in the protein spot (Valot et al., 2011). "Coverage" refers to the recovery rate of the protein by the identified peptides, expressed in %.
    [Show full text]
  • Novel Roles of SH2 and SH3 Domains in Lipid Binding
    cells Review Novel Roles of SH2 and SH3 Domains in Lipid Binding Szabolcs Sipeki 1,†, Kitti Koprivanacz 2,†, Tamás Takács 2, Anita Kurilla 2, Loretta László 2, Virag Vas 2 and László Buday 1,2,* 1 Department of Molecular Biology, Institute of Biochemistry and Molecular Biology, Semmelweis University Medical School, 1094 Budapest, Hungary; [email protected] 2 Institute of Enzymology, Research Centre for Natural Sciences, 1117 Budapest, Hungary; [email protected] (K.K.); [email protected] (T.T.); [email protected] (A.K.); [email protected] (L.L.); [email protected] (V.V.) * Correspondence: [email protected] † Both authors contributed equally to this work. Abstract: Signal transduction, the ability of cells to perceive information from the surroundings and alter behavior in response, is an essential property of life. Studies on tyrosine kinase action fundamentally changed our concept of cellular regulation. The induced assembly of subcellular hubs via the recognition of local protein or lipid modifications by modular protein interactions is now a central paradigm in signaling. Such molecular interactions are mediated by specific protein interaction domains. The first such domain identified was the SH2 domain, which was postulated to be a reader capable of finding and binding protein partners displaying phosphorylated tyrosine side chains. The SH3 domain was found to be involved in the formation of stable protein sub-complexes by constitutively attaching to proline-rich surfaces on its binding partners. The SH2 and SH3 domains have thus served as the prototypes for a diverse collection of interaction domains that recognize not only proteins but also lipids, nucleic acids, and small molecules.
    [Show full text]
  • Role of the Ras-Association Domain Family 1 Tumor Suppressor Gene in Human Cancers
    Review Role of the Ras-Association Domain Family 1 Tumor Suppressor Gene in Human Cancers Angelo Agathanggelou, Wendy N. Cooper, and Farida Latif Section of Medical and Molecular Genetics, Division of Reproductive and Child Health, The Institute of Biomedical Research, University of Birmingham, Edgbaston, Birmingham, United Kingdom Abstract renal cell carcinomas was identified from region 3p25 confirming In recent years, the list of tumor suppressor genes (or this hypothesis (3). This prompted the search for TSGs within the candidate TSG) that are inactivated frequently by epigenetic other regions of 3p. An important TSG was suspected to reside in events rather than classic mutation/deletion events has been 3p21.3 because instability of this region is the earliest and most growing. Unlike mutational inactivation, methylation is frequently detected deficiency in lung cancer. Overlapping homo- reversible and demethylating agents and inhibitors of histone zygous deletions in lung and breast tumor cell lines reduced the deacetylases are being used in clinical trails. Highly sensitive critical region in 3p21.3 to 120 kb and this region was found to be and quantitative assays have been developed to assess exceptionally gene rich. From this critical region, eight genes were methylation in tumor samples, early lesions, and bodily fluids. identified, including CACNA2D2, PL6/placental protein 6, CYB561D2/101F6, TUSC4/NPRL2/G21, ZMYND10/BLU, RASSF1/ Hence, gene silencing by promoter hypermethylation has potential clinical benefits in early cancer diagnosis, prognosis, 123F2, TUSC2/FUS1, and HYAL2/LUCA2. However, despite extensive treatment, and prevention. The hunt for a TSG located at genetic analysis in lung and breast tumors, none of these candidate 3p21.3 resulted in the identification of the RAS-association genes were frequently mutated.
    [Show full text]