Supplementary Material:
Supplemental Figure 1. (A) Analysis of the ncRNAs of Arabidopsis inflorescences and pollen bioreplicates (two bioreplicates for each tissue).
Biological replicates 1 and 2 of inflorescence are paired samples for both pollen biological replicates 1 and 2. (B) Individual tRF accumulation profiles for the different sRNA libraries used in Figure 1C. (C-D) Distribution of 5’ end nucleotide of 19 nt sRNAs along mature tRNA transcript sequences post- transcriptionally modified with the CCA sequence, in inflorescence (C) and pollen (D).
Supplemental Figure 2. (A-C) Distribution of 5’ end nucleotide of 19 nt tRFs along mature tRNA transcript sequences post-transcriptionally modified with the
CCA sequence in rice (A) and maize (B) pollen, and Physcomitrella patens gametophote-sporophyte (C) samples.
Supplemental Figure 3. (A) Individual tRF accumulation profiles for the different sRNA libraries used in Figure 3A. (B) tRF accumulation profile in seedling sRNA libraries from ddm1 (red) and wt (blue), normalized in RPM. (C)
Distribution of 19 nt tRFs along mature tRNA transcript sequences post- transcriptionally modified with the CCA sequence in the ddm1 background. (D) tRF accumulation profile in inflorescence sRNA libraries from met1 single and ddc triple mutants.
1 Supplemental Figure 4. (A) Individual tRF accumulation profiles for the different sRNA libraries used in Figure 4B. (B) AGO1-immunoprecipitated tRF accumulation size profile in wt and ddm1. (C) NcRNA categorization of the
AGO1-immunoprecipitated sRNAs in wt and ddm1 libraries. (D) RT-PCR analysis of the accumulation of tRNA transcripts in gene-specific reverse (1) or oligo-dT (2) primers synthesized cDNA for selected tRNAs in the ddm1, ddm1/dcl1-11 and ddm1/ago1-24 backgrounds. The gene Tyrosine amminotransferase (TyrAT, At2g20610) and the miR161 precursor (pre- miR161) were used as controls.
Supplemental Figure 5. wt and ddm1 inflorescence PARE reads aligned along a 100 nt window 5’ and 3’ to the PAREsnip-predicted target sites for protein coding genes.
Supplemental Figure 6. Model of tRF processing. Data suggests that the
Dicer-dependent tRF processing from the pre-tRNA occurs after RNase P and
RNase Z activity, and generates a tRF-5s 19nt sRNA capable of targeting and cleaving TE mRNA transcripts.
Supplemental Table 1. Mutant alleles used in this study.
Supplemental Table 2. PCR Primers used in this study.
Supplemental Table 3. sRNA and PARE libraries used in this study.
Supplemental Table 4. 5’-derived 19 nt tRF-predicted targets in Arabidopsis thaliana.
2 Supplemental Figure 1
A 450000 small RNA derived from non-coding RNAs C 100 Inflorescence tRF alignment 400000 90 25 nts 350000 24 nts 80 300000 23 nts 70 250000 22 nts 60 RPM 200000 21 nts 50 150000 20 nts 40 100000 19 nts Percentage 50000 18 nts 30 0 20
10
Pollen-Biorep1
Pollen-Biorep1
Pollen-Biorep1
Pollen-Biorep2
Pollen-Biorep2
Pollen-Biorep2 Pollen-Biorep1 Pollen-Biorep2 Pollen-Biorep2 Pollen-Biorep1
5’- tRNA mature transcript -CCA-3’
In orescence-Biorep1
In orescence-Biorep1
In orescence-Biorep2
In orescence-Biorep2 In orescence-Biorep2
In orescence-Biorep2 In orescence-Biorep1
In orescence-Biorep1 In orescence-Biorep1 In orescence-Biorep2 rRNAs tRNAs miRNAs snoRNAs snRNAs
B RPM D 100 tRF accumulation profile 90 Pollen tRF alignment 0 40000 80 25 70 60 50
size (nt) 40
Percentage 30 19 20 18 10
5’- tRNA mature transcript -CCA-3’ infl Rep1 infl Rep2 leaf Rep1 leaf Rep2 leaf Rep3 Pollen Rep2 Pollen Rep3 Pollen Rep5 Pollen Rep1 Pollen Rep4 Supplemental Figure 2
A B C 100 100 100 Rice pollen Maize pollen 90 P.patens gametophore 90 90 80 80 80 and sporophyte 70 70 70 60 60 60 50 50 50 40 40 40 30 30 30 20 20 20 10 10 10 -CCA-3’ 5’- tRNA mature transcript -CCA-3’ 5’- tRNA mature transcript -CCA-3’ 5’- tRNA mature transcript Supplemental Figure 3
RPM A ddm1 tRF accumulation profile B tRF accumulation profile in wt Col and ddm1 seedlings 0 50000 14000 25nt 12000 wt Col seedling ddm1 seedling 10000
8000 size (nt) RPM 6000 20 nt 4000
18 nt 2000
0 Rep1 Rep2 Rep3 18 19 20 21 22 23 24 25 wt Rep1 wt Rep2 wt Rep3 size (nt) ddm1 ddm1 ddm1 D C tRF accumulation profile in ddc and met1 4000 100 wt Col ddm1 tRF distribution profile 3500 90 ddc 80 3000 met1 70 2500 60 2000
50 RPM
Percentage 40 1500 30 1000 20 500 10 0 5’- tRNA mature transcript -CCA-3’ 18 19 20 21 22 23 24 25 size (nt) Supplemental Figure 4.
RPM D RT-detection of poly-A transcripts A tRF accumulation profile 0 50000
25 nt 1 2 ) t gene-specific primer Oligo-dT primer n Oligo-dT primer ( +RT +RT No RT z e i s 20 nt
18 nt
Ladder ddm1 ddm1/dcl1 ddm1/ago1 Ladder ddm1 ddm1/dcl1 ddm1/ago1 Ladder ddm1 ddm1/dcl1 ddm1/ago1 ddm1 ddm1 ddm1/dcl1 ddm1/dcl1 Rep2 Rep3 Rep1 Rep2 200 nt 100 nt Ala AGC B 16000 AGO1 immunoprecipitated-tRF profile 50 nt 14000 wt Col 12000 200 nt ddm1 10000 100 nt Arg TCT 8000 50 nt 6000 RPM 200 nt 4000 Leu AAG 2000 100 nt 0 50 nt 18 19 20 21 22 23 24 25 size (nt) 200 nt 100 nt Met CAT C AGO1 IP ncRNA categorization 50 nt wt Col ddm1 300 nt tRFs 200 nt At2g20610 miRNAs 100 nt control gene snoRNAs 300 nt snRNAs 200 nt pre-miR161 rRNAs 100 nt Supplemental Figure 5 500 Protein coding genes
400 wt Col ddm1
300 RPM
200
100
0 -100-90 -80 -70 -60 -50 -40 -30 -20 -10 0 10 20 30 40 50 60 70 80 90 100
Distance to predicted target site Pol III complex RNase P RNase Z
Transcription
active tRNA gene pre-tRNA
tRF biogenesis Protein biogenesis
CCA CCA DCL1
mature-tRNA
5’ tRF
CCA AGO1
5’ tRF
TE mRNA cleavage Translation CCA
CCA CCA AGO1 CCA (A)n
5’ tRF
mRNA (A)n Supplemental Table 1. Mutant alleles used in this study Mutant Allele Background ddm1 ddm1-2 Col-0 dcl1 dcl1-11 Col-0 dcl2 dcl2-1 Col-0 ago1 ago1-27 Col-0 Supplemental Table 2. Primers used in this study Primer name Use in this study Sequence (5'-3') Athila 4C_1 5'RLM RACE GCAAGATAAGGAGGGTGGCTA Athila 4C_2 5'RLM RACE TCGACACTCTGGTCGTTTTG Athila 6A_1 5'RLM RACE GCAACTAGTCCTGAAGGGATTC Athila 6A_2 5'RLM RACE CCAATCCCTTGGGATAGAGAC AlaAGC_5'_tRF_probe Northern blot CCATCTGAGCTACATCCCC ArgTCT_probe Northern blot TCCATTAGGCCACGGGCGC LysTTT_probe Northern blot ACCACTGAGCTAAGACGGC miR161_probe Northern blot TAGTCACTTTCAATGCATTGA miR166_probe Northern blot GGGGAATGAAGCCTGGTCCGA U6_snRNA_probe Northern blot TCATCCTTGCGCAGGGGCCA pre-miR161_Forward RT-PCR TGCTTGATCTCGGTTTTTGACC pre-miR161_Forward RT-PCR TGCTTTTCCCTCTTTTTACAAATGC AlaAGC_RT_Forward RT-PCR GGGGATGTAGCTCAGATGG AlaAGC_RT_Reverse RT-PCR TGGTGGAGTGCGGGGTATCG LeuAAG_RT_Forward RT-PCR GTTGATATGGCCGAGTTGGTC LeuAAG_RT_Reverse RT-PCR TGGTGTTGACAGTGGGATTTG ArgTCT_RT_Forward RT-PCR GCGCCCGTGGCCTAATGGATA ArgTCT_RT_Reverse RT-PCR TGGCACGCCCGGTGGGACTCG MetCAT_RT_Forward RT-PCR GGGGTGGTGGCGCAGGTTGGCT MetCAT_RT_Reverse RT-PCR TGGTGGGGTGAGAGAGGTCG KRP6_promoter_Forward Cloning CACCTCGTTGTTGCATCAGTCACTTAATTATTAC KRP6_promoter_21nt_mock_H2B_Reverse Cloning ATCTGCCTTCGCCATTAACTGTCTAACGTAGGCACCtctctcttggatttttgtgtgc KRP6_promoter_21nt_Athila_H2B_Reverse Cloning ATCTGCCTTCGCCATGAACCATGCCTAGATTGCTCTtctctcttggatttttgtgtgc H2B_Forward Cloning ATGGCGAAGGCAGATAAGAAACCAG H2B_Reverse Cloning AGAACTCGTAAACTTCGTAACCG Athila 4C_qPCR_Forward qPCR TCCTTCTCTTCTGCATGTCG Athila 4C_qPCR_Reverse qPCR GGCAGCTGATATGGAAGAGC Athila 6A_qPCR_Forward qPCR CGACATTGAGTTTTTGCTTCA Athila 6A_qPCR_Reverse qPCR TGCGGAATCTGAATAACTTGG Supplemental Table 3. sRNA and PARE libraries used in this study
Library type Organism Tissue Genotype Use in this work Reference Public database refence number Database webpage Figure sRNA A.thaliana Leaf wt Col Leaf bioreplicate 1 [65] GSM773795 http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Leaf wt Col Leaf bioreplicate 2 [65] GSM773794 http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Leaf wt Col Leaf bioreplicate 3 [65] GSM773793 http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Inflorescence wt Col Inflorescence bioreplicate 1/ddm1 control inflorescence 1 [3] GSM1495677 http://www.ncbi.nlm.nih.gov/geo/ Figure 1/Figure 3 sRNA A.thaliana Inflorescence wt Col Inflorescence bioreplicate 2 this study - http://www.ncbi.nlm.nih.gov/geo/ Figure 1/Figure 3 sRNA A.thaliana Pollen wt Col Pollen bioreplicate 1 [3] RMKS01 https://mpss.udel.edu Figure 1 sRNA A.thaliana Pollen wt Col Pollen bioreplicate 2 this study - http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Pollen wt Col Pollen bioreplicate 3 this study - http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Pollen wt Col Pollen bioreplicate 4 this study - http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Pollen wt Col Pollen bioreplicate 5 this study - http://www.ncbi.nlm.nih.gov/geo/ Figure 1 sRNA A.thaliana Inflorescence ddm1 ddm1 bioreplicate 1 [3] GSM1495678 http://www.ncbi.nlm.nih.gov/geo/ Figure 3/Figure 4 sRNA A.thaliana Inflorescence ddm1 ddm1 bioreplicate 2 [17] GSM1278498 http://www.ncbi.nlm.nih.gov/geo/ Figure 3/Figure 4 sRNA A.thaliana Inflorescence ddm1 ddm1 bioreplicate 3 [17] GSM1278503 http://www.ncbi.nlm.nih.gov/geo/ Figure 3/Figure 4 sRNA A.thaliana seedling wt Col wt Col seedling [66] GSM338557 http://www.ncbi.nlm.nih.gov/geo/ Supp Figure 3 sRNA A.thaliana seedling ddm1 ddm1 seedling [66] GSM338558 http://www.ncbi.nlm.nih.gov/geo/ Supp Figure 3 sRNA A.thaliana Inflorescence wt Col wt Col control of met1 and ddc mutants [68] GSM277608 http://www.ncbi.nlm.nih.gov/geo/ Supp Figure 3 sRNA A.thaliana Inflorescence met1 met1 [68] GSM277609 http://www.ncbi.nlm.nih.gov/geo/ Supp Figure 3 sRNA A.thaliana Inflorescence ddc ddc [68] GSM277610 http://www.ncbi.nlm.nih.gov/geo/ Supp Figure 3 sRNA A.thaliana AGO1 IP wt Col AGO1 IP wt Col bioreplicate 1 this study - http://www.ncbi.nlm.nih.gov/geo/ Figure 4 sRNA A.thaliana AGO1 IP wt Col AGO1 IP wt Col bioreplicate 2 this study - http://www.ncbi.nlm.nih.gov/geo/ Figure 4 sRNA A.thaliana AGO1 IP ddm1 AGO1 IP ddm1 bioreplicate 1 this study - http://www.ncbi.nlm.nih.gov/geo/ Supp Figure 4 sRNA A.thaliana AGO1 IP ddm1 AGO1 IP ddm1 bioreplicate 2 this study - http://www.ncbi.nlm.nih.gov/geo/ Supp Figure 4 sRNA A.thaliana Inflorescence wt Col wt Col control inflorescence 2 for ddm1 bioreplicate 2 [17] GSM1278497 http://www.ncbi.nlm.nih.gov/geo/ Figure 3 sRNA A.thaliana Inflorescence wt Col wt Col control inflorescence 3 for ddm1 bioreplicate 3 [17] GSM1278502 http://www.ncbi.nlm.nih.gov/geo/ Figure 3 sRNA A.thaliana Inflorescence ddm1/dcl1 ddm1/dcl1 bioreplicate 1 [17] GSM1278501 http://www.ncbi.nlm.nih.gov/geo/ Figure 4 sRNA A.thaliana Inflorescence ddm1/dcl1 ddm1/dcl1 bioreplicate 2 [17] GSM1278504 http://www.ncbi.nlm.nih.gov/geo/ Figure 4 sRNA Oryza sativa Inflorescence wt Rice Inflorescence [70] GSM647192 http://www.ncbi.nlm.nih.gov/geo/ Figure 2 sRNA Oryza sativa Pollen wt Rice pollen [69] GSM722128 http://www.ncbi.nlm.nih.gov/geo/ Figure 2 sRNA Z.mays Ear B73 Mayze Ear [71] GSM448853 http://www.ncbi.nlm.nih.gov/geo/ Figure 2 sRNA Z.mays Pollen B73 Mayze pollen [71] GSM448854 http://www.ncbi.nlm.nih.gov/geo/ Figure 2 sRNA P.patens Protonemata wt Protonemata [67] GSM115095 http://www.ncbi.nlm.nih.gov/geo/ Figure 2 sRNA P.patens Protonemata-Young gametophores wt Protonemata-Young gametophores [67] GSM115096 http://www.ncbi.nlm.nih.gov/geo/ Figure 2 sRNA P.patens Gametophores-Sporophytes wt Gametophores-Sporophytes [67] GSM115097 http://www.ncbi.nlm.nih.gov/geo/ Figure 2 PARE A.thaliana Inflorescence wt Col Degradome wt Col [17] GSM1263708 http://www.ncbi.nlm.nih.gov/geo/ Figure 5 PARE A.thaliana Inflorescence ddm1 Degradome ddm1 [17] GSM1263709 http://www.ncbi.nlm.nih.gov/geo/ Figure 5 Supplemental Table 4.
5' tRF Target_Accession Target gene description AlaAGC AT1G06240 Protein of unknown function DUF455 AlaAGC AT1G36810 transposable element gene AlaAGC AT1G73490 RNA-binding (RRM/RBD/RNP motifs) family protein AlaAGC AT3G20075 CYP705A14P a pseudogene with cytochrome P450 domain AlaAGC AT3G57560 NAGK N-acetyl-l-glutamate kinase AlaAGC AT3G61060 AtPP2-A13, PP2-A13 phloem protein 2-A13 AlaAGC AT4G21440 ATMYB102, ATM4, MYB102 MYB-like 102 AlaAGC AT4G37190 LOCATED IN: cytosol, plasma membrane AlaAGC AT5G46210 CUL4, ATCUL4 cullin4 AlaAGC AT5G47400 unknown protein AlaTGC AT1G08630 THA1 threonine aldolase 1 AlaTGC AT1G15520 PDR12, ATPDR12, ABCG40, ATABCG40 pleiotropic drug resistance 12 AlaTGC AT1G16800 P-loop containing nucleoside triphosphate hydrolases superfamily protein AlaTGC AT1G22650 Plant neutral invertase family protein AlaTGC AT1G51020 unknown protein AlaTGC AT1G62530 Plant protein of unknown function (DUF863) AlaTGC AT2G01320 ABC-2 type transporter family protein AlaTGC AT2G01600 ENTH/ANTH/VHS superfamily protein AlaTGC AT2G05935 transposable element gene AlaTGC AT2G07702 unknown protein AlaTGC AT2G15540 transposable element gene AlaTGC AT2G43990 unknown protein AlaTGC AT3G13060 ECT5 evolutionarily conserved C-terminal region 5 AlaTGC AT3G21980 Domain of unknown function (DUF26) AlaTGC AT3G22040 Domain of unknown function (DUF26) AlaTGC AT3G24740 Protein of unknown function (DUF1644) AlaTGC AT3G48020 unknown protein AlaTGC AT3G49162 pseudogene of glycoside hydrolase family 28 protein AlaTGC AT3G57920 SPL15 squamosa promoter binding protein-like 15 AlaTGC AT3G60190 ADL4, ADLP2, EDR3, DRP1E, ADL1E, DL1E DYNAMIN-like 1E AlaTGC AT4G07500 transposable element gene AlaTGC AT4G26542 Potential natural antisense gene, locus overlaps with AT4G26540 AlaTGC AT5G05990 Mitochondrial glycoprotein family protein AlaTGC AT5G13360 Auxin-responsive GH3 family protein AlaTGC AT5G13380 Auxin-responsive GH3 family protein AlaTGC AT5G13430 Ubiquinol-cytochrome C reductase iron-sulfur subunit AlaTGC AT5G13440 Ubiquinol-cytochrome C reductase iron-sulfur subunit AlaTGC AT5G18245 other RNA AlaTGC AT5G23550 Got1/Sft2-like vescicle transport protein family AlaTGC AT5G52800 DNA primases AlaTGC ATCG00670 CLPP1, PCLPP plastid-encoded CLP P AlaTGC ATMG00440 ORF152A hypothetical protein AlaTGC ATMG01140 ORF152B hypothetical protein ArgACG AT1G04150 C2 calcium/lipid-binding plant phosphoribosyltransferase family protein ArgACG AT1G17070 GC-rich sequence DNA-binding factor-like protein with Tuftelin interacting domain ArgACG AT1G25430 transposable element gene ArgACG AT1G27140 ATGSTU14, GST13, GSTU14 glutathione S-transferase tau 14 ArgACG AT1G50430 DWF5, PA, LE, ST7R, 7RED Ergosterol biosynthesis ERG4/ERG24 family ArgACG AT1G69570 Dof-type zinc finger DNA-binding family protein ArgACG AT2G11290 transposable element gene ArgACG AT2G14730 transposable element gene ArgACG AT2G17330 CYP51G2, CYP51A1 putative obtusifoliol 14-alpha demethylase. Expressed pseudogene. ArgACG AT2G45030 Translation elongation factor EFG/EF2 protein ArgACG AT3G03770 Leucine-rich repeat protein kinase family protein ArgACG AT3G06710 FUNCTIONS IN: molecular function unknown ArgACG AT3G12915 Ribosomal protein S5/Elongation factor G/III/V family protein ArgACG AT3G28705 transposable element gene ArgACG AT3G47950 AHA4, HA4 H(+)-ATPase 4 ArgACG AT5G47010 UPF1, LBA1, ATUPF1 RNA helicase, putative ArgACG AT5G54080 HGO homogentisate 1,2-dioxygenase ArgCCG AT1G03380 ATATG18G, ATG18G homolog of yeast autophagy 18 (ATG18) G ArgCCG AT1G10770 Plant invertase/pectin methylesterase inhibitor superfamily protein ArgCCG AT1G11610 CYP71A18 cytochrome P450, family 71, subfamily A, polypeptide 18 ArgCCG AT1G11620 F-box and associated interaction domains-containing protein ArgCCG AT1G15230 unknown protein ArgCCG AT1G18100 E12A11, MFT PEBP (phosphatidylethanolamine-binding protein) family protein ArgCCG AT1G29980 Protein of unknown function, DUF642 ArgCCG AT1G33220 Glycosyl hydrolase superfamily protein ArgCCG AT1G55350 DEK1 calpain-type cysteine protease family ArgCCG AT1G66570 ATSUC7, SUC7 sucrose-proton symporter 7 ArgCCG AT1G67950 RNA-binding (RRM/RBD/RNP motifs) family protein ArgCCG AT1G72480 Lung seven transmembrane receptor family protein ArgCCG AT2G01420 PIN4 Auxin efflux carrier family protein ArgCCG AT2G01590 CRR3 chlororespiratory reduction 3 ArgCCG AT2G24250 Protein of unknown function (DUF295) ArgCCG AT2G30750 CYP71A12 cytochrome P450, family 71, subfamily A, polypeptide 12 ArgCCG AT2G30770 CYP71A13 cytochrome P450, family 71, subfamily A, polypeptide 13 ArgCCG AT2G36810 ARM repeat superfamily protein ArgCCG AT2G43500 Plant regulator RWP-RK family protein ArgCCG AT3G27670 RST1 ARM repeat superfamily protein ArgCCG AT3G27770 unknown protein ArgCCG AT3G30745 transposable element gene ArgCCG AT3G43320 transposable element gene ArgCCG AT3G56400 WRKY70, ATWRKY70 WRKY DNA-binding protein 70 ArgCCG AT3G61250 AtMYB17, MYB17 myb domain protein 17 ArgCCG AT4G03380 BEST Arabidopsis thaliana protein match is: nuclear assembly factor 1 (TAIR:AT1G03530.1) ArgCCG AT4G03500 Ankyrin repeat family protein ArgCCG AT4G08091 transposable element gene ArgCCG AT4G33810 Glycosyl hydrolase superfamily protein ArgCCG AT5G11160 APT5 adenine phosphoribosyltransferase 5 ArgCCG AT5G18255 other RNA ArgCCG AT5G19600 SULTR3 ArgCCG AT5G24775 transposable element gene ArgCCG AT5G25310 Exostosin family protein ArgCCG AT5G34266 transposable element gene ArgCCG AT5G34412 transposable element gene ArgCCG AT5G34820 transposable element gene ArgCCG AT5G38230 transposable element gene ArgCCG AT5G40820 ATRAD3, ATR, ATATR Ataxia telangiectasia-mutated and RAD3-related ArgCCG AT5G45820 CIPK20, SnRK3.6, PKS18 CBL-interacting protein kinase 20 ArgCCG AT5G48800 Phototropic-responsive NPH3 family protein ArgCCG AT5G57150 basic helix-loop-helix (bHLH) DNA-binding superfamily protein ArgCCG AT5G57920 ENODL10, AtENODL10 early nodulin-like protein 10 ArgCCG AT5G60590 DHBP synthase RibB-like alpha/beta domain ArgCCT AT1G54520 unknown protein ArgCCT AT1G70150 zinc ion binding ArgCCT AT2G34660 MRP2, ABCC2, AtABCC2 multidrug resistance-associated protein 2 ArgCCT AT3G05050 Protein kinase superfamily protein ArgCCT AT4G23820 Pectin lyase-like superfamily protein ArgCCT AT4G24370 unknown protein ArgCCT AT4G34660 SH3 domain-containing protein ArgCCT AT5G26642 transposable element gene ArgCCT AT5G34831 pseudogene, hypothetical protein, similar to contains similarity to Drosophila suppressor of sable protein (GB:M57889) ArgTCG AT1G46696 Protein of unknown function, DUF601 ArgTCG AT1G49820 ATMTK, MTK S-methyl-5-thioribose kinase ArgTCG AT1G62710 BETA-VPE, BETAVPE beta vacuolar processing enzyme ArgTCG AT1G76460 RNA-binding (RRM/RBD/RNP motifs) family protein ArgTCG AT1G79390 unknown protein ArgTCG AT2G43610 Chitinase family protein ArgTCG AT3G43180 RING/U-box superfamily protein ArgTCG AT3G43300 ATMIN7 HOPM interactor 7 ArgTCG AT3G43750 RING/U-box protein with C6HC-type zinc finger domain ArgTCG AT3G45510 RING/U-box protein ArgTCG AT3G45580 RING/U-box protein with C6HC-type zinc finger ArgTCG AT3G55480 PAT2 protein affected traffi ArgTCG AT3G60830 ATARP7, ARP7 actin-related protein 7 ArgTCG AT4G39660 AGT2 alanine:glyoxylate aminotransferase 2 ArgTCG AT5G04070 NAD(P)-binding Rossmann-fold superfamily protein ArgTCG AT5G26270 unknown protein ArgTCG AT5G50780 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase family protein ArgTCT AT1G05136 unknown protein ArgTCT AT1G21970 LEC1, EMB 212, EMB212, NF-YB9 Histone superfamily protein ArgTCT AT1G78850 D-mannose binding lectin protein with Apple-like carbohydrate-binding domain ArgTCT AT2G16750 Protein kinase protein with adenine nucleotide alpha hydrolases-like domain ArgTCT AT2G18800 ATXTH21, XTH21 xyloglucan endotransglucosylase/hydrolase 21 ArgTCT AT2G33100 ATCSLD1, CSLD1 cellulose synthase-like D1 ArgTCT AT3G14025 pseudogene of scarecrow transcription factor family protein ArgTCT AT3G31530 transposable element gene ArgTCT AT4G17140 pleckstrin homology (PH) domain-containing protein ArgTCT AT4G18780 CESA8, IRX1, ATCESA8, LEW2 cellulose synthase family protein ArgTCT AT4G35030 Protein kinase superfamily protein ArgTCT AT5G17330 GAD, GAD1 glutamate decarboxylase AsnGTT AT1G02080 transcription regulators AsnGTT AT1G05190 emb2394 Ribosomal protein L6 family AsnGTT AT1G06670 NIH nuclear DEIH-boxhelicase AsnGTT AT1G10220 unknown protein AsnGTT AT1G10870 AGD4 ARF-GAP domain 4 AsnGTT AT1G17610 Disease resistance protein (TIR-NBS class) AsnGTT AT1G25380 ATNDT2, NDT2 NAD+ transporter 2 AsnGTT AT1G38260 transposable element gene AsnGTT AT1G38330 transposable element gene AsnGTT AT1G38430 transposable element gene AsnGTT AT1G47570 RING/U-box superfamily protein AsnGTT AT1G50280 Phototropic-responsive NPH3 family protein AsnGTT AT1G59830 PP2A-1 protein phosphatase 2A-2 AsnGTT AT1G62550 transposable element gene AsnGTT AT1G75010 ARC3 GTP binding AsnGTT AT1G78140 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein AsnGTT AT1G78560 Sodium Bile acid symporter family AsnGTT AT1G79540 Pentatricopeptide repeat (PPR) superfamily protein AsnGTT AT2G07395 transposable element gene AsnGTT AT2G09990 Ribosomal protein S5 domain 2-like superfamily protein AsnGTT AT2G12330 transposable element gene AsnGTT AT2G19780 Leucine-rich repeat (LRR) family protein AsnGTT AT2G19920 RNA-dependent RNA polymerase family protein AsnGTT AT2G20210 RNI-like superfamily protein AsnGTT AT2G22840 AtGRF1, GRF1 growth-regulating factor 1 AsnGTT AT2G33860 ETT, ARF3 Transcriptional factor B3 family protein / auxin-responsive factor AUX/IAA-related AsnGTT AT2G34520 RPS14 mitochondrial ribosomal protein S14 AsnGTT AT2G44690 ARAC9, ATROP8, ROP8 Arabidopsis RAC-like 9 AsnGTT AT3G02570 MEE31, PMI1 Mannose-6-phosphate isomerase, type I AsnGTT AT3G13225 WW domain-containing protein AsnGTT AT3G16560 Protein phosphatase 2C family protein AsnGTT AT3G18777 pseudogene, similar to RING-H2 zinc finger protein, similar to putative RING zinc finger protein GB:AAF16660 from (Arabidopsis thaliana) AsnGTT AT3G20490 unknown protein AsnGTT AT3G26040 HXXXD-type acyl-transferase family protein AsnGTT AT3G27180 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein AsnGTT AT3G42054 transposable element gene AsnGTT AT3G44480 RPP1, cog1 Disease resistance protein (TIR-NBS-LRR class) family AsnGTT AT3G51290 Protein of unknown function (DUF630) AsnGTT AT3G51300 ARAC11, ROP1, ROP1AT, ATRAC11, ATROP1 RHO-related protein from plants 1 AsnGTT AT3G51740 IMK2 inflorescence meristem receptor-like kinase 2 AsnGTT AT3G53100 GDSL-like Lipase/Acylhydrolase superfamily protein AsnGTT AT3G55260 HEXO1, ATHEX2 beta-hexosaminidase 1 AsnGTT AT3G56320 PAP/OAS1 substrate-binding domain superfamily AsnGTT AT3G59780 Rhodanese/Cell cycle control phosphatase superfamily protein AsnGTT AT3G62170 VGDH2 VANGUARD 1 homolog 2 AsnGTT AT4G05610 transposable element gene AsnGTT AT4G06500 transposable element gene AsnGTT AT4G06518 transposable element gene AsnGTT AT4G06544 transposable element gene AsnGTT AT4G06560 transposable element gene AsnGTT AT4G07490 transposable element gene AsnGTT AT4G07494 transposable element gene AsnGTT AT4G11970 YTH family protein AsnGTT AT4G14900 FRIGIDA-like protein AsnGTT AT4G17615 CBL1, ATCBL1, SCABP5 calcineurin B-like protein 1 AsnGTT AT4G24790 AAA-type ATPase family protein AsnGTT AT4G27270 Quinone reductase family protein AsnGTT AT4G28950 ARAC7, ATROP9, ATRAC7, RAC7, ROP9 RHO-related protein from plants 9 AsnGTT AT4G29820 CFIM-25, ATCFIM-25 homolog of CFIM-25 AsnGTT AT4G32430 Pentatricopeptide repeat (PPR) superfamily protein AsnGTT AT4G32840 PFK6 phosphofructokinase 6 AsnGTT AT4G32940 GAMMA-VPE, GAMMAVPE gamma vacuolar processing enzyme AsnGTT AT5G02860 Pentatricopeptide repeat (PPR) superfamily protein AsnGTT AT5G11010 Pre-mRNA cleavage complex II protein family AsnGTT AT5G17020 XPO1A exportin 1A AsnGTT AT5G18380 Ribosomal protein S5 domain 2-like superfamily protein AsnGTT AT5G20320 DCL4 dicer-like 4 AsnGTT AT5G22500 FAR1 fatty acid reductase 1 AsnGTT AT5G32616 transposable element gene AsnGTT AT5G33441 pseudogene, similar to cytochrome P450-like protein, blastp match of 46% identity and 6.5e-67 P-value to GP AsnGTT AT5G36223 transposable element gene AsnGTT AT5G47320 RPS19 ribosomal protein S19 AsnGTT AT5G50860 Protein kinase superfamily protein AsnGTT AT5G59290 UXS3, ATUXS3 UDP-glucuronic acid decarboxylase 3 AsnGTT AT5G65920 ARM repeat superfamily protein AspGTC AT1G24460 unknown protein AspGTC AT1G37110 transposable element gene AspGTC AT2G14030 transposable element gene AspGTC AT2G41705 camphor resistance CrcB family protein AspGTC AT2G48010 RKF3 receptor-like kinase in in flowers 3 AspGTC AT3G02370 unknown protein AspGTC AT3G05180 GDSL-like Lipase/Acylhydrolase superfamily protein AspGTC AT3G06145 unknown protein AspGTC AT3G13730 CYP90D1 cytochrome P450, family 90, subfamily D, polypeptide 1 AspGTC AT3G22630 PBD1, PRCGB 20S proteasome beta subunit D1 AspGTC AT3G26265 transposable element gene AspGTC AT3G54840 ARA6, RABF1 Ras-related small GTP-binding family protein AspGTC AT3G61190 BAP1 BON association protein 1 AspGTC AT4G11540 Cysteine/Histidine-rich C1 domain family protein AspGTC AT4G33170 Tetratricopeptide repeat (TPR)-like superfamily protein AspGTC AT4G39300 unknown protein AspGTC AT5G29574 transposable element gene AspGTC AT5G57970 DNA glycosylase superfamily protein GlnCTG AT1G01030 NGA3 AP2/B3-like transcriptional factor family protein GlnCTG AT1G06310 ACX6 acyl-CoA oxidase 6 GlnCTG AT1G65950 Protein kinase superfamily protein GlnCTG AT1G71010 FAB1C FORMS APLOID AND BINUCLEATE CELLS 1C GlnCTG AT1G77960 unknown protein GlnCTG AT1G78330 pseudogene, putative serine acetyltransferase, blastp match of 78% identity and 4.2e-32 P-value to GP GlnCTG AT2G17640 ATSERAT3 GlnCTG AT2G25460 CONTAINS InterPro DOMAIN/s: C2 calcium-dependent membrane targeting (InterPro:IPR000008) GlnCTG AT2G38220 RING/U-box superfamily protein GlnCTG AT3G22345 unknown protein GlnCTG AT3G31358 transposable element gene GlnCTG AT4G02330 ATPMEPCRB Plant invertase/pectin methylesterase inhibitor superfamily GlnCTG AT4G09584 unknown pseudogene GlnCTG AT4G12810 F-box family protein GlnCTG AT4G12820 F-box family protein with a domain of unknown function (DUF295) GlnCTG AT4G35640 ATSERAT3 GlnCTG AT5G47340 alpha/beta-Hydrolases superfamily protein GlnCTG AT5G47350 alpha/beta-Hydrolases superfamily protein GlnCTG AT5G65820 Pentatricopeptide repeat (PPR) superfamily protein GlnCTG AT5G66558 other RNA GlnTTG AT1G01040 DCL1 dicer-like 1 GlnTTG AT1G08640 CJD1 Chloroplast J-like domain 1 GlnTTG AT1G11890 SEC22, ATSEC22 Synaptobrevin family protein GlnTTG AT1G47950 transposable element gene GlnTTG AT1G48400 F-box/RNI-like/FBD-like domains-containing protein GlnTTG AT1G74920 ALDH10A8 aldehyde dehydrogenase 10A8 GlnTTG AT2G01070 Lung seven transmembrane receptor family protein GlnTTG AT2G23150 NRAMP3, ATNRAMP3 natural resistance-associated macrophage protein 3 GlnTTG AT2G30942 Protein of unknown function (DUF3317) GlnTTG AT2G35520 DAD2 Defender against death (DAD family) protein GlnTTG AT3G05430 Tudor/PWWP/MBT superfamily protein GlnTTG AT3G09300 ORP3B OSBP(oxysterol binding protein)-related protein 3B GlnTTG AT3G28860 ATMDR1, ATMDR11, PGP19, MDR11, MDR1, ATPGP19, ABCB19, ATABCB19 ATP binding cassette subfamily B19 GlnTTG AT3G45140 LOX2, ATLOX2 lipoxygenase 2 GlnTTG AT3G50625 transposable element gene GlnTTG AT4G07943 transposable element gene GlnTTG AT4G15990 unknown protein GlnTTG AT4G33100 CONTAINS InterPro DOMAIN/s: Mitochondrial distribution/morphology family 35/apoptosis (InterPro:IPR007918) GlnTTG AT5G56650 ILL1 IAA-leucine resistant (ILR)-like 1 GlnTTG AT5G59710 VIP2, AtVIP2 VIRE2 interacting protein 2 GlnTTG AT5G64150 RNA methyltransferase family protein GluCTC AT1G09195 FUNCTIONS IN: molecular function unknown GluCTC AT1G18415 other RNA GluCTC AT1G54430 transposable element gene GluCTC AT1G62975 basic helix-loop-helix (bHLH) DNA-binding superfamily protein GluCTC AT2G01190 Octicosapeptide/Phox/Bem1p family protein GluCTC AT2G17370 HMG2, HMGR2 3-hydroxy-3-methylglutaryl-CoA reductase 2 GluCTC AT2G28320 Pleckstrin homology (PH) and lipid-binding START domains-containing protein GluCTC AT2G35630 MOR1, GEM1 ARM repeat superfamily protein GluCTC AT2G38823 unknown protein GluCTC AT3G05040 HST, HST1 ARM repeat superfamily protein GluCTC AT3G11560 LETM1-like protein GluCTC AT3G14172 FUNCTIONS IN: molecular function unknown GluCTC AT3G16050 A37, ATPDX1.2, PDX1.2 pyridoxine biosynthesis 1.2 GluCTC AT3G25590 unknown protein GluCTC AT3G30747 transposable element gene GluCTC AT3G42460 transposable element gene GluCTC AT3G51140 Protein of unknown function (DUF3353) GluCTC AT4G04950 thioredoxin family protein GluCTC AT4G16150 calmodulin binding GluCTC AT4G25990 CIL CCT motif family protein GluCTC AT5G04910 unknown protein GluCTC AT5G09420 ATTOC64-V, MTOM64, TOC64-V, OM64, AtmtOM64 translocon at the outer membrane of chloroplasts 64-V GluCTC AT5G15850 COL1, ATCOL1 CONSTANS-like 1 GluCTC AT5G24318 O-Glycosyl hydrolases family 17 protein GluCTC AT5G43840 AT-HSFA6A, HSFA6A heat shock transcription factor A6A GluCTC AT5G52260 AtMYB19, MYB19 myb domain protein 19 GluCTC AT5G59260 Concanavalin A-like lectin protein kinase family protein GluTTC AT1G04540 Calcium-dependent lipid-binding (CaLB domain) family protein GluTTC AT1G17160 pfkB-like carbohydrate kinase family protein GluTTC AT1G61760 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family GluTTC AT1G73650 Protein of unknown function (DUF1295) GluTTC AT2G07791 transposable element gene GluTTC AT2G09865 transposable element gene GluTTC AT2G20900 DGK5, ATDGK5 diacylglycerol kinase 5 GluTTC AT2G20980 MCM10 minichromosome maintenance 10 GluTTC AT2G24050 eIFiso4G2 MIF4G domain-containing protein / MA3 domain-containing protein GluTTC AT2G26990 FUS12, ATCSN2, COP12, CSN2 proteasome family protein GluTTC AT2G28560 ATRAD51B, RAD51B DNA repair (Rad51) family protein GluTTC AT2G34680 AIR9 Outer arm dynein light chain 1 protein GluTTC AT3G01870 Plant protein of unknown function (DUF946) GluTTC AT3G05520 Subunits of heterodimeric actin filament capping protein Capz superfamily GluTTC AT3G05590 RPL18 ribosomal protein L18 GluTTC AT3G08960 ARM repeat superfamily protein GluTTC AT3G26840 Esterase/lipase/thioesterase family protein GluTTC AT3G32200 BEST Arabidopsis thaliana protein match is: myosin heavy chain-related (TAIR:AT5G32590.1) GluTTC AT3G48190 ATM, ATATM ataxia-telangiectasia mutated GluTTC AT3G54350 emb1967 Forkhead-associated (FHA) domain-containing protein GluTTC AT4G11440 Mitochondrial substrate carrier family protein GluTTC AT4G12780 Chaperone DnaJ-domain superfamily protein GluTTC AT4G18050 PGP9 P-glycoprotein 9 GluTTC AT4G19240 unknown protein GluTTC AT4G22770 AT hook motif DNA-binding family protein GluTTC AT4G24100 Protein kinase superfamily protein GluTTC AT4G26980 RNI-like superfamily protein GluTTC AT4G29110 unknown protein GluTTC AT4G29620 Cytidine/deoxycytidylate deaminase family protein GluTTC AT4G29630 Cytidine/deoxycytidylate deaminase family protein GluTTC AT4G36520 Chaperone DnaJ-domain superfamily protein GluTTC AT5G09690 ATMGT7, MGT7, MRS2-7 magnesium transporter 7 GluTTC AT5G12980 Cell differentiation, Rcd1-like protein GluTTC AT5G14890 NHL domain-containing protein GluTTC AT5G34780 Thiamin diphosphate-binding fold (THDP-binding) superfamily protein GluTTC AT5G44180 Homeodomain-like transcriptional regulator GluTTC AT5G46850 FUNCTIONS IN: molecular function unknown GluTTC AT5G57870 eIFiso4G1 MIF4G domain-containing protein / MA3 domain-containing protein GluTTC AT5G63950 CHR24 chromatin remodeling 24 GluTTC AT5G64560 MGT9, MRS2-2, ATMGT9 magnesium transporter 9 GluTTC AT5G65540 unknown protein GluTTC AT5G66410 PLP3b phosducin-like protein 3 homolog GlyCCC AT1G08730 XIC, ATXIC Myosin family protein with Dil domain GlyCCC AT1G11055 Encodes a defensin-like (DEFL) family protein. GlyCCC AT1G54560 XIE, ATXIE Myosin family protein with Dil domain GlyCCC AT1G72330 ALAAT2 alanine aminotransferase 2 GlyCCC AT2G31900 XIF, ATXIF, ATMYO5 myosin-like protein XIF GlyCCC AT2G41340 RPB5D RNA polymerase II fifth largest subunit, D GlyCCC AT3G23060 RING/U-box superfamily protein GlyCCC AT3G46100 ATHRS1, HRS1 Histidyl-tRNA synthetase 1 GlyCCC AT3G58160 XIJ, ATXIJ, ATMYOS3, MYA3, XI-16 P-loop containing nucleoside triphosphate hydrolases superfamily protein GlyCCC AT3G59120 Cysteine/Histidine-rich C1 domain family protein GlyCCC AT3G59130 Cysteine/Histidine-rich C1 domain family protein GlyCCC AT4G19530 disease resistance protein (TIR-NBS-LRR class) family GlyCCC AT5G02880 UPL4 ubiquitin-protein ligase 4 GlyCCC AT5G03406 Class II aaRS and biotin synthetases superfamily protein GlyCCC AT5G20490 XIK, ATXIK, XI-17 Myosin family protein with Dil domain GlyCCC AT5G50870 UBC27 ubiquitin-conjugating enzyme 27 GlyCCC AT5G53905 unknown protein GlyCCC AT5G65620 Zincin-like metalloproteases family protein GlyGCC AT1G08720 EDR1, ATEDR1 Protein kinase superfamily protein GlyGCC AT1G09850 XBCP3 xylem bark cysteine peptidase 3 GlyGCC AT1G17840 WBC11, ABCG11, DSO, COF1, ATWBC11 white-brown complex homolog protein 11 GlyGCC AT1G29160 Dof-type zinc finger DNA-binding family protein GlyGCC AT1G50560 CYP705A25 cytochrome P450, family 705, subfamily A, polypeptide 25 GlyGCC AT1G52290 Protein kinase superfamily protein GlyGCC AT1G54355 other RNA GlyGCC AT1G56600 AtGolS2, GolS2 galactinol synthase 2 GlyGCC AT1G60600 ABC4 UbiA prenyltransferase family protein GlyGCC AT1G70620 cyclin-related GlyGCC AT1G76030 ATPase, V1 complex, subunit B protein GlyGCC AT2G15050 LTP, LTP7 lipid transfer protein GlyGCC AT2G16810 F-box and associated interaction domains-containing protein GlyGCC AT2G17020 F-box/RNI-like superfamily protein GlyGCC AT2G31260 APG9, ATAPG9 autophagy 9 (APG9) GlyGCC AT3G12950 Trypsin family protein GlyGCC AT3G20950 CYP705A32 cytochrome P450, family 705, subfamily A, polypeptide 32 GlyGCC AT3G54930 Protein phosphatase 2A regulatory B subunit family protein GlyGCC AT4G27020 unknown protein GlyGCC AT4G34940 ARO1 armadillo repeat only 1 GlyGCC AT5G37830 OXP1 oxoprolinase 1 GlyGCC AT5G39280 ATEXPA23, ATEXP23, ATHEXP ALPHA 1.17, EXPA23 expansin A23 GlyGCC AT5G39300 ATEXPA25, EXP25, ATEXP25, ATHEXP ALPHA 1.18, EXPA25 expansin A25 GlyGCC AT5G45610 SUV2 protein dimerizations GlyGCC AT5G66210 CPK28 calcium-dependent protein kinase 28 GlyTCC AT1G02400 ATGA2OX4, ATGA2OX6, DTA1, GA2OX6 gibberellin 2-oxidase 6 GlyTCC AT1G07000 ATEXO70B2, EXO70B2 exocyst subunit exo70 family protein B2 GlyTCC AT1G07725 ATEXO70H6, EXO70H6 exocyst subunit exo70 family protein H6 GlyTCC AT1G30400 ATMRP1, EST1, ABCC1, ATABCC1, MRP1 multidrug resistance-associated protein 1 GlyTCC AT1G58390 Disease resistance protein (CC-NBS-LRR class) family GlyTCC AT1G72630 ELF4-L2 ELF4-like 2 GlyTCC AT2G32860 BGLU33 beta glucosidase 33 GlyTCC AT2G39675 TAS1C TAS1C GlyTCC AT2G46020 CHR2, ATBRM, BRM, CHA2 transcription regulatory protein SNF2, putative GlyTCC AT3G21370 BGLU19 beta glucosidase 19 GlyTCC AT3G27720 ARI4, ATARI4 IBR domain containing protein GlyTCC AT3G42434 transposable element gene GlyTCC AT3G42850 Mevalonate/galactokinase family protein GlyTCC AT4G38540 FAD/NAD(P)-binding oxidoreductase family protein GlyTCC AT5G07505 transposable element gene GlyTCC AT5G12260 BEST Arabidopsis thaliana protein match is: glycosyltransferase family protein 2 (TAIR:AT5G60700.1) GlyTCC AT5G20710 BGAL7 beta-galactosidase 7 GlyTCC AT5G28320 unknown protein GlyTCC AT5G28400 unknown protein GlyTCC AT5G49665 Zinc finger (C3HC4-type RING finger) family protein GlyTCC AT5G50360 unknown protein IleAAT AT1G08700 PS1 Presenilin-1 IleAAT AT1G72300 Leucine-rich receptor-like protein kinase family protein IleAAT AT1G73280 scpl3 serine carboxypeptidase-like 3 IleAAT AT2G02910 Protein of unknown function (DUF616) IleAAT AT2G33205 Serinc-domain containing serine and sphingolipid biosynthesis protein IleAAT AT2G33845 Nucleic acid-binding, OB-fold-like protein IleAAT AT2G41790 Insulinase (Peptidase family M16) family protein IleAAT AT2G45460 SMAD/FHA domain-containing protein IleAAT AT2G46270 GBF3 G-box binding factor 3 IleAAT AT3G05160 Major facilitator superfamily protein IleAAT AT3G13030 hAT transposon superfamily protein IleAAT AT3G25510 disease resistance protein (TIR-NBS-LRR class), putative IleAAT AT3G30570 transposable element gene IleAAT AT3G42791 transposable element gene IleAAT AT3G44340 CEF clone eighty-four IleAAT AT3G44770 Protein of unknown function (DUF626) IleAAT AT3G56660 BZIP49 basic region/leucine zipper motif protein 49 IleAAT AT3G57470 Insulinase (Peptidase family M16) family protein IleAAT AT3G63445 other RNA IleAAT AT4G11900 S-locus lectin protein kinase family protein IleAAT AT4G15620 Uncharacterised protein family (UPF0497) IleAAT AT4G37210 Tetratricopeptide repeat (TPR)-like superfamily protein IleAAT AT4G37950 Rhamnogalacturonate lyase family protein IleAAT AT5G12250 TUB6 beta-6 tubulin IleAAT AT5G14020 Endosomal targeting BRO1-like domain-containing protein IleAAT AT5G15948 CPuORF10 conserved peptide upstream open reading frame 10 IleAAT AT5G15950 Adenosylmethionine decarboxylase family protein IleAAT AT5G25040 Major facilitator superfamily protein IleAAT AT5G27660 Trypsin family protein with PDZ domain IleAAT AT5G37130 Protein prenylyltransferase superfamily protein IleAAT AT5G43020 Leucine-rich repeat protein kinase family protein LeuAAG AT1G19830 SAUR-like auxin-responsive protein family LeuAAG AT1G38176 transposable element gene LeuAAG AT1G38380 transposable element gene LeuAAG AT1G73360 HDG11, EDT1, ATHDG11 homeodomain GLABROUS 11 LeuAAG AT2G27170 TTN7, SMC3 Structural maintenance of chromosomes (SMC) family protein LeuAAG AT2G35360 ubiquitin family protein LeuAAG AT3G13433 unknown protein LeuAAG AT3G29540 transposable element gene LeuAAG AT3G33595 transposable element gene LeuAAG AT4G02770 PSAD-1 photosystem I subunit D-1 LeuAAG AT4G08180 ORP1C OSBP(oxysterol binding protein)-related protein 1C LeuAAG AT4G17570 GATA26 GATA transcription factor 26 LeuAAG AT4G32730 PC-MYB1, MYB3R-1, ATMYB3R-1, ATMYB3R1 Homeodomain-like protein LeuAAG AT5G26850 Uncharacterized protein LeuAAG AT5G48390 ATZIP4 Tetratricopeptide repeat (TPR)-like superfamily protein LeuCAA AT1G16970 KU70, ATKU70 KU70 homolog LeuCAA AT1G22930 T-complex protein 11 LeuCAA AT1G28530 unknown protein LeuCAA AT1G37669 transposable element gene LeuCAA AT1G38158 transposable element gene LeuCAA AT1G38350 transposable element gene LeuCAA AT1G38440 transposable element gene LeuCAA AT1G42540 ATGLR3.3, GLR3.3 glutamate receptor 3.3 LeuCAA AT1G64550 ATGCN3, GCN3 general control non-repressible 3 LeuCAA AT2G01029 transposable element gene LeuCAA AT2G09920 transposable element gene LeuCAA AT2G13080 transposable element gene LeuCAA AT2G17510 EMB2763 ribonuclease II family protein LeuCAA AT2G22900 Galactosyl transferase GMA12/MNN10 family protein LeuCAA AT2G25660 emb2410 embryo defective 2410 LeuCAA AT2G40570 initiator tRNA phosphoribosyl transferase family protein LeuCAA AT3G09770 RING/U-box superfamily protein LeuCAA AT3G11090 LBD21 LOB domain-containing protein 21 LeuCAA AT3G17970 atToc64-III, TOC64-III translocon at the outer membrane of chloroplasts 64-III LeuCAA AT3G18040 MPK9 MAP kinase 9 LeuCAA AT3G18970 MEF20 mitochondrial editing factor 20 LeuCAA AT3G32000 transposable element gene LeuCAA AT3G62780 Calcium-dependent lipid-binding (CaLB domain) family protein LeuCAA AT4G03860 transposable element gene LeuCAA AT4G06492 transposable element gene LeuCAA AT4G06524 transposable element gene LeuCAA AT4G06532 transposable element gene LeuCAA AT4G06545 transposable element gene LeuCAA AT4G06708 transposable element gene LeuCAA AT4G07360 transposable element gene LeuCAA AT4G07937 transposable element gene LeuCAA AT4G07941 transposable element gene LeuCAA AT4G11420 EIF3A, ATEIF3A-1, EIF3A-1, ATTIF3A1, TIF3A1 eukaryotic translation initiation factor 3A LeuCAA AT4G18130 PHYE phytochrome E LeuCAA AT4G20490 transposable element gene LeuCAA AT4G30790 INVOLVED IN: autophagy LeuCAA AT5G07430 Pectin lyase-like superfamily protein LeuCAA AT5G27895 transposable element gene LeuCAA AT5G30673 transposable element gene LeuCAA AT5G32505 transposable element gene LeuCAA AT5G34895 transposable element gene LeuCAA AT5G58300 Leucine-rich repeat protein kinase family protein LeuCAA AT5G59920 ULI3 Cysteine/Histidine-rich C1 domain family protein LeuCAG AT1G04480 Ribosomal protein L14p/L23e family protein LeuCAG AT1G15740 Leucine-rich repeat family protein LeuCAG AT1G62130 AAA-type ATPase family protein LeuCAG AT2G01820 Leucine-rich repeat protein kinase family protein LeuCAG AT2G20050 protein serine/threonine phosphatases LeuCAG AT2G22740 SUVH6 SU(VAR)3-9 homolog 6 LeuCAG AT3G20710 F-box family protein LeuCAG AT3G42050 vacuolar ATP synthase subunit H family protein LeuCAG AT3G51050 FG-GAP repeat-containing protein LeuCAG AT3G55370 OBP3 OBF-binding protein 3 LeuCAG AT4G16880 Leucine-rich repeat (LRR) family protein LeuCAG AT4G25540 MSH3, ATMSH3 homolog of DNA mismatch repair protein MSH3 LeuCAG AT5G13390 NEF1 no exine formation 1 LeuCAG AT5G19130 GPI transamidase component family protein / Gaa1-like family protein LeuCAG AT5G28527 pseudogene, hypothetical protein LeuCAG AT5G56325 FBD-like domain family protein LeuTAA AT1G45100 RNA-binding (RRM/RBD/RNP motifs) family protein LeuTAA AT1G49090 transposable element gene LeuTAA AT1G56030 RING/U-box superfamily protein LeuTAA AT1G62970 Chaperone DnaJ-domain superfamily protein LeuTAA AT2G04530 CPZ, TRZ2 Metallo-hydrolase/oxidoreductase superfamily protein LeuTAA AT2G18000 TAF14 TBP-associated factor 14 LeuTAA AT2G24240 BTB/POZ domain with WD40/YVTN repeat-like protein LeuTAA AT2G29320 NAD(P)-binding Rossmann-fold superfamily protein LeuTAA AT2G40250 SGNH hydrolase-type esterase superfamily protein LeuTAA AT2G43440 F-box and associated interaction domains-containing protein LeuTAA AT2G47980 SCC3, ATSCC3 sister-chromatid cohesion protein 3 LeuTAA AT3G04830 Protein prenylyltransferase superfamily protein LeuTAA AT3G06810 IBR3 acyl-CoA dehydrogenase-related LeuTAA AT3G23120 AtRLP38, RLP38 receptor like protein 38 LeuTAA AT3G29620 transposable element gene LeuTAA AT3G30420 transposable element gene LeuTAA AT3G31906 pseudogene, ATP-dependent CLPB protein, blastp match of 74% identity and 9.9e-102 P-value to GP LeuTAA AT3G32195 transposable element gene LeuTAA AT3G46487 transposable element gene LeuTAA AT4G06527 transposable element gene LeuTAA AT4G08333 transposable element gene LeuTAA AT4G13940 HOG1, SAHH1 S-adenosyl-L-homocysteine hydrolase LeuTAA AT4G15390 HXXXD-type acyl-transferase family protein LeuTAA AT4G17900 PLATZ transcription factor family protein LeuTAA AT4G18480 CHLI1, CH42, CH-42, CHL11, CHLI-1 P-loop containing nucleoside triphosphate hydrolases superfamily protein LeuTAA AT4G20810 transcription initiation factor IIE (TFIIE) alpha subunit family protein / general transcription factor TFIIE family protein LeuTAA AT4G37380 Tetratricopeptide repeat (TPR)-like superfamily protein LeuTAA AT4G37930 SHM1, STM, SHMT1 serine transhydroxymethyltransferase 1 LeuTAA AT5G06050 Putative methyltransferase family protein LeuTAA AT5G24110 WRKY30, ATWRKY30 WRKY DNA-binding protein 30 LeuTAA AT5G26230 unknown protein LeuTAA AT5G58030 Transport protein particle (TRAPP) component LeuTAA AT5G59040 COPT3 copper transporter 3 LeuTAA AT5G61840 GUT1 Exostosin family protein LeuTAG AT1G17470 ATDRG1, ATDRG, DRG1 developmentally regulated G-protein 1 LeuTAG AT1G19730 ATTRX4, ATH4 Thioredoxin superfamily protein LeuTAG AT1G21130 O-methyltransferase family protein LeuTAG AT1G27510 Protein of unknown function (DUF3506) LeuTAG AT1G31050 basic helix-loop-helix (bHLH) DNA-binding superfamily protein LeuTAG AT1G36650 transposable element gene LeuTAG AT1G43850 SEU SEUSS transcriptional co-regulator LeuTAG AT1G62200 Major facilitator superfamily protein LeuTAG AT1G70770 Protein of unknown function DUF2359, transmembrane LeuTAG AT1G71880 SUC1, ATSUC1 sucrose-proton symporter 1 LeuTAG AT1G75290 NAD(P)-binding Rossmann-fold superfamily protein LeuTAG AT1G76520 Auxin efflux carrier family protein LeuTAG AT1G76530 Auxin efflux carrier family protein LeuTAG AT1G77730 Pleckstrin homology (PH) domain superfamily protein LeuTAG AT2G07280 unknown protein LeuTAG AT2G12530 transposable element gene LeuTAG AT2G12540 transposable element gene LeuTAG AT2G17680 Arabidopsis protein of unknown function (DUF241) LeuTAG AT2G24720 ATGLR2.2, GLR2.2 glutamate receptor 2.2 LeuTAG AT2G32660 AtRLP22, RLP22 receptor like protein 22 LeuTAG AT2G42440 Lateral organ boundaries (LOB) domain family protein LeuTAG AT3G03960 TCP-1/cpn60 chaperonin family protein LeuTAG AT3G06590 basic helix-loop-helix (bHLH) DNA-binding superfamily protein LeuTAG AT3G11390 Cysteine/Histidine-rich C1 domain family protein LeuTAG AT3G16800 Protein phosphatase 2C family protein LeuTAG AT3G17100 sequence-specific DNA binding transcription factors LeuTAG AT3G18730 TSK, MGO3, BRU1 tetratricopeptide repeat (TPR)-containing protein LeuTAG AT3G28865 transposable element gene LeuTAG AT3G31475 transposable element gene LeuTAG AT3G42431 transposable element gene LeuTAG AT3G43148 FUNCTIONS IN: molecular function unknown LeuTAG AT3G46620 zinc finger (C3HC4-type RING finger) family protein LeuTAG AT3G48520 CYP94B3 cytochrome P450, family 94, subfamily B, polypeptide 3 LeuTAG AT3G48850 PHT3 LeuTAG AT3G58800 unknown protein LeuTAG AT3G59290 ENTH/VHS family protein LeuTAG AT3G62725 transposable element gene LeuTAG AT4G16230 GDSL-like Lipase/Acylhydrolase superfamily protein LeuTAG AT4G16440 ferredoxin hydrogenases LeuTAG AT4G18360 Aldolase-type TIM barrel family protein LeuTAG AT4G18900 Transducin/WD40 repeat-like superfamily protein LeuTAG AT4G26190 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein LeuTAG AT4G26490 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family LeuTAG AT4G26690 SHV3, MRH5, GPDL2 PLC-like phosphodiesterase family protein LeuTAG AT5G01960 RING/U-box superfamily protein LeuTAG AT5G07690 MYB29, ATMYB29, PMG2 myb domain protein 29 LeuTAG AT5G15845 other RNA LeuTAG AT5G24490 30S ribosomal protein, putative LeuTAG AT5G34790 transposable element gene LeuTAG AT5G59090 ATSBT4.12, SBT4.12 subtilase 4.12 LeuTAG AT5G59220 HAI1 highly ABA-induced PP2C gene 1 LeuTAG AT5G63050 EMB2759 embryo defective 2759 LysCTT AT1G03110 TRM82, AtTRM82 Transducin/WD40 repeat-like superfamily protein LysCTT AT1G06220 MEE5 Ribosomal protein S5/Elongation factor G/III/V family protein LysCTT AT1G15910 XH/XS domain-containing protein LysCTT AT1G48900 Signal recognition particle, SRP54 subunit protein LysCTT AT2G25140 HSP98.7, CLPB-M, CLPB4 casein lytic proteinase B4 LysCTT AT2G46230 PIN domain-like family protein LysCTT AT3G07770 Hsp89.1, AtHsp90.6, AtHsp90-6 HEAT SHOCK PROTEIN 89.1 LysCTT AT3G44530 HIRA homolog of histone chaperone HIRA LysCTT AT4G00230 XSP1 xylem serine peptidase 1 LysCTT AT4G08810 SUB1 calcium ion binding LysCTT AT4G37895 other RNA LysCTT AT5G07420 Pectin lyase-like superfamily protein LysCTT AT5G25230 Ribosomal protein S5/Elongation factor G/III/V family protein LysCTT AT5G62190 PRH75 DEAD box RNA helicase (PRH75) LysTTT AT1G03090 MCCA methylcrotonyl-CoA carboxylase alpha chain, mitochondrial / 3-methylcrotonyl-CoA carboxylase 1 (MCCA) LysTTT AT1G08010 GATA11 GATA transcription factor 11 LysTTT AT1G22460 O-fucosyltransferase family protein LysTTT AT1G36160 ACC1 acetyl-CoA carboxylase 1 LysTTT AT1G36180 ACC2 acetyl-CoA carboxylase 2 LysTTT AT1G48650 DEA(D/H)-box RNA helicase family protein LysTTT AT1G60545 other RNA LysTTT AT1G61520 LHCA3 photosystem I light harvesting complex gene 3 LysTTT AT1G64590 NAD(P)-binding Rossmann-fold superfamily protein LysTTT AT1G65365 pseudogene, putative protein kinase, blastp match of 45% identity and 1.7e-40 P-value to GP LysTTT AT1G72125 Major facilitator superfamily protein LysTTT AT2G07170 ARM repeat superfamily protein LysTTT AT2G24940 AtMAPR2, MAPR2 membrane-associated progesterone binding protein 2 LysTTT AT2G24945 unknown protein LysTTT AT2G30590 WRKY21 WRKY DNA-binding protein 21 LysTTT AT2G39190 ATATH8 Protein kinase superfamily protein LysTTT AT2G44710 RNA-binding (RRM/RBD/RNP motifs) family protein LysTTT AT2G47120 NAD(P)-binding Rossmann-fold superfamily protein LysTTT AT2G47130 NAD(P)-binding Rossmann-fold superfamily protein LysTTT AT3G08810 Galactose oxidase/kelch repeat superfamily protein LysTTT AT3G13510 Protein of Unknown Function (DUF239) LysTTT AT3G19740 P-loop containing nucleoside triphosphate hydrolases superfamily protein LysTTT AT3G26800 unknown protein LysTTT AT3G33072 transposable element gene LysTTT AT3G50740 UGT72E1 UDP-glucosyl transferase 72E1 LysTTT AT3G58480 calmodulin-binding family protein LysTTT AT4G21380 ARK3, RK3 receptor kinase 3 LysTTT AT4G33240 FAB1A 1-phosphatidylinositol-4-phosphate 5-kinases LysTTT AT4G36925 unknown protein LysTTT AT5G01740 Nuclear transport factor 2 (NTF2) family protein LysTTT AT5G15070 Phosphoglycerate mutase-like family protein LysTTT AT5G18720 Domain of unknown function (DUF3444) LysTTT AT5G20310 Adenine nucleotide alpha hydrolases-like superfamily protein LysTTT AT5G38680 Galactose oxidase/kelch repeat superfamily protein LysTTT AT5G41610 ATCHX18, CHX18 cation/H+ exchanger 18 LysTTT AT5G46890 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein LysTTT AT5G46900 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein MetCAT AT1G05380 Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger protein MetCAT AT1G15320 unknown protein MetCAT AT1G30925 phospholipase Cs MetCAT AT1G30940 pseudogene, F-box protein -related, contains TIGRfam:TIGR01640 F-box protein interaction domain MetCAT AT1G49010 Duplicated homeodomain-like superfamily protein MetCAT AT1G61680 TPS14 terpene synthase 14 MetCAT AT1G62640 KAS III 3-ketoacyl-acyl carrier protein synthase III MetCAT AT1G63540 hydroxyproline-rich glycoprotein family protein MetCAT AT1G64720 CP5 Polyketide cyclase/dehydrase and lipid transport superfamily protein MetCAT AT1G66660 Protein with RING/U-box and TRAF-like domains MetCAT AT1G66940 protein kinase-related MetCAT AT2G16500 ADC1, ARGDC1, ARGDC, SPE1 arginine decarboxylase 1 MetCAT AT2G21150 XCT XAP5 family protein MetCAT AT2G21170 TIM, PDTPI triosephosphate isomerase MetCAT AT2G29670 Tetratricopeptide repeat (TPR)-like superfamily protein MetCAT AT2G36720 Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger domain MetCAT AT2G39940 COI1 RNI-like superfamily protein MetCAT AT2G43710 SSI2, FAB2 Plant stearoyl-acyl-carrier-protein desaturase family protein MetCAT AT2G45880 BMY4, BAM7 beta-amylase 7 MetCAT AT2G47500 P-loop nucleoside triphosphate hydrolases superfamily protein with CH (Calponin Homology) domain MetCAT AT2G48075 unknown protein MetCAT AT3G01740 Mitochondrial ribosomal protein L37 MetCAT AT3G10490 ANAC052, NAC052 NAC domain containing protein 52 MetCAT AT3G14510 Polyprenyl synthetase family protein MetCAT AT3G14530 Terpenoid synthases superfamily protein MetCAT AT3G27480 Cysteine/Histidine-rich C1 domain family protein MetCAT AT3G27500 Cysteine/Histidine-rich C1 domain family protein MetCAT AT3G27510 Cysteine/Histidine-rich C1 domain family protein MetCAT AT3G28650 Cysteine/Histidine-rich C1 domain family protein MetCAT AT3G29618 transposable element gene MetCAT AT3G32040 Terpenoid synthases superfamily protein MetCAT AT3G45530 Cysteine/Histidine-rich C1 domain family protein MetCAT AT3G46800 Cysteine/Histidine-rich C1 domain family protein MetCAT AT3G47080 Tetratricopeptide repeat (TPR)-like superfamily protein MetCAT AT3G47740 ATATH2, ATH2, ABCA3 ABC2 homolog 2 MetCAT AT3G57610 ADSS adenylosuccinate synthase MetCAT AT4G06609 transposable element gene MetCAT AT4G09790 pseudogene of the F-box family protein MetCAT AT4G14790 ATSUV3, EDA15 ATP-dependent RNA helicase, mitochondrial (SUV3) MetCAT AT4G19000 IWS2, ATIWS2 Transcription elongation factor (TFIIS) family protein MetCAT AT4G20760 NAD(P)-binding Rossmann-fold superfamily protein MetCAT AT4G26095 other RNA MetCAT AT4G30100 P-loop containing nucleoside triphosphate hydrolases superfamily protein MetCAT AT5G02340 Cysteine/Histidine-rich C1 domain family protein MetCAT AT5G03790 ATHB51, LMI1, HB51 homeobox 51 MetCAT AT5G06810 Mitochondrial transcription termination factor family protein MetCAT AT5G08690 ATP synthase alpha/beta family protein MetCAT AT5G12150 Rho GTPase activation protein (RhoGAP) with PH domain MetCAT AT5G13860 ELC-Like ELCH-like MetCAT AT5G18510 Aminotransferase-like, plant mobile domain family protein MetCAT AT5G21130 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family MetCAT AT5G23450 ATLCBK1, LCBK1 long-chain base (LCB) kinase 1 MetCAT AT5G33207 transposable element gene MetCAT AT5G42840 Cysteine/Histidine-rich C1 domain family protein MetCAT AT5G44925 transposable element gene MetCAT AT5G47620 RNA-binding (RRM/RBD/RNP motifs) family protein MetCAT AT5G49690 UDP-Glycosyltransferase superfamily protein MetCAT AT5G50130 NAD(P)-binding Rossmann-fold superfamily protein MetCAT AT5G51420 long-chain-alcohol O-fatty-acyltransferase family protein / wax synthase family protein MetCAT AT5G51710 KEA5, ATKEA5 K+ efflux antiporter 5 MetCAT AT5G51930 Glucose-methanol-choline (GMC) oxidoreductase family protein MetCAT AT5G55580 Mitochondrial transcription termination factor family protein MetCAT AT5G63910 FCLY farnesylcysteine lyase MetCAT AT5G66100 winged-helix DNA-binding transcription factor family protein MetCAT AT5G66200 ARO2 armadillo repeat only 2 MetCAT AT5G67460 O-Glycosyl hydrolases family 17 protein PheGAA AT1G01730 unknown protein PheGAA AT1G07150 MAPKKK13 mitogen-activated protein kinase kinase kinase 13 PheGAA AT1G36975 transposable element gene PheGAA AT1G53050 Protein kinase superfamily protein PheGAA AT2G15350 FUT10, ATFUT10 fucosyltransferase 10 PheGAA AT2G15370 FUT5, ATFUT5 fucosyltransferase 5 PheGAA AT2G15790 SQN, CYP40 peptidyl-prolyl cis-trans isomerase / cyclophilin-40 (CYP40) / rotamase PheGAA AT2G20810 GAUT10, LGT4 galacturonosyltransferase 10 PheGAA AT2G35620 FEI2 Leucine-rich repeat protein kinase family protein PheGAA AT3G01460 MBD9, ATMBD9 methyl-CPG-binding domain 9 PheGAA AT3G07220 SMAD/FHA domain-containing protein PheGAA AT3G07260 SMAD/FHA domain-containing protein PheGAA AT3G19040 TAF1, TAF1B, HAF2 histone acetyltransferase of the TAFII250 family 2 PheGAA AT3G26670 Protein of unknown function (DUF803) PheGAA AT3G33081 transposable element gene PheGAA AT4G05591 transposable element gene PheGAA AT4G32220 transposable element gene PheGAA AT4G35170 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family PheGAA AT5G18460 Protein of Unknown Function (DUF239) PheGAA AT5G55893 unknown protein ProCGG AT1G56612 other RNA ProCGG AT1G70130 Concanavalin A-like lectin protein kinase family protein ProCGG AT2G10200 transposable element gene ProCGG AT3G43650 transposable element gene ProCGG AT4G04273 transposable element gene ProCGG AT4G06564 transposable element gene ProCGG AT4G06615 transposable element gene ProCGG AT4G07706 transposable element gene ProCGG AT5G03270 lysine decarboxylase family protein ProCGG AT5G29028 transposable element gene ProCGG AT5G30870 transposable element gene ProCGG AT5G32122 transposable element gene ProCGG AT5G32179 transposable element gene ProCGG AT5G32215 transposable element gene ProCGG AT5G32595 transposable element gene ProCGG AT5G50530 CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein ProCGG AT5G50640 CBS / octicosapeptide/Phox/Bemp1 (PB1) domains-containing protein ProTGG AT1G03840 MGP C2H2 and C2HC zinc fingers superfamily protein ProTGG AT1G12670 Encodes a Plant thionin family protein [pseudogene] ProTGG AT1G23750 Nucleic acid-binding, OB-fold-like protein ProTGG AT1G24240 Ribosomal protein L19 family protein ProTGG AT1G28710 Nucleotide-diphospho-sugar transferase family protein ProTGG AT1G38870 transposable element gene ProTGG AT1G41855 transposable element gene ProTGG AT1G59750 ARF1 auxin response factor 1 ProTGG AT1G65210 Galactose-binding protein ProTGG AT1G72890 Disease resistance protein (TIR-NBS class) ProTGG AT1G76660 FUNCTIONS IN: molecular function unknown ProTGG AT1G77390 TAM, CYCA1 ProTGG AT1G79570 Protein kinase superfamily protein with octicosapeptide/Phox/Bem1p domain ProTGG AT2G09900 transposable element gene ProTGG AT2G23330 transposable element gene ProTGG AT2G31830 endonuclease/exonuclease/phosphatase family protein ProTGG AT2G45520 unknown protein ProTGG AT3G24630 unknown protein ProTGG AT3G25960 Pyruvate kinase family protein ProTGG AT3G30690 transposable element gene ProTGG AT3G33097 transposable element gene ProTGG AT3G42256 transposable element gene ProTGG AT3G55650 Pyruvate kinase family protein ProTGG AT3G55810 Pyruvate kinase family protein ProTGG AT4G06589 transposable element gene ProTGG AT4G08765 transposable element gene ProTGG AT4G11630 Ribosomal protein L19 family protein ProTGG AT4G24020 NLP7 NIN like protein 7 ProTGG AT4G25620 hydroxyproline-rich glycoprotein family protein ProTGG AT5G11470 bromo-adjacent homology (BAH) domain-containing protein ProTGG AT5G11750 Ribosomal protein L19 family protein ProTGG AT5G19620 EMB213, OEP80, ATOEP80, TOC75 outer envelope protein of 80 kDa ProTGG AT5G28253 transposable element gene ProTGG AT5G32483 transposable element gene ProTGG AT5G32490 transposable element gene ProTGG AT5G32513 transposable element gene ProTGG AT5G33237 transposable element gene ProTGG AT5G34856 transposable element gene ProTGG AT5G47690 binding ProTGG AT5G49770 Leucine-rich repeat protein kinase family protein ProTGG AT5G60070 ankyrin repeat family protein ProTGG AT5G66400 RAB18, ATDI8 Dehydrin family protein SerAGA AT1G09380 nodulin MtN21 /EamA-like transporter family protein SerAGA AT1G21340 Dof-type zinc finger DNA-binding family protein SerAGA AT1G35186 transposable element gene SerAGA AT1G35230 AGP5 arabinogalactan protein 5 SerAGA AT1G67328 other RNA SerAGA AT1G68890 magnesium ion binding SerAGA AT1G73250 ATFX, GER1 GDP-4-keto-6-deoxymannose-3,5-epimerase-4-reductase 1 SerAGA AT1G80450 VQ motif-containing protein SerAGA AT2G16660 Major facilitator superfamily protein SerAGA AT2G18850 SET domain-containing protein SerAGA AT2G20710 Tetratricopeptide repeat (TPR)-like superfamily protein SerAGA AT2G34510 Protein of unknown function, DUF642 SerAGA AT2G38060 PHT4 SerAGA AT2G38660 Amino acid dehydrogenase family protein SerAGA AT2G42390 protein kinase C substrate, heavy chain-related SerAGA AT3G01910 SOX, AT-SO, AtSO sulfite oxidase SerAGA AT3G12350 F-box family protein SerAGA AT3G13400 sks13 SKU5 similar 13 SerAGA AT3G17090 Protein phosphatase 2C family protein SerAGA AT3G20080 CYP705A15 cytochrome P450, family 705, subfamily A, polypeptide 15 SerAGA AT3G32240 transposable element gene SerAGA AT3G33115 transposable element gene SerAGA AT4G19390 Uncharacterised protein family (UPF0114) SerAGA AT4G23500 Pectin lyase-like superfamily protein SerAGA AT4G39610 Protein of unknown function, DUF617 SerAGA AT5G01190 LAC10 laccase 10 SerAGA AT5G06690 WCRKC1 WCRKC thioredoxin 1 SerAGA AT5G12330 LRP1 Lateral root primordium (LRP) protein-related SerAGA AT5G56960 basic helix-loop-helix (bHLH) DNA-binding family protein SerAGA AT5G66020 IBS2, ATSAC1B, ATSAC6, SACIB Phosphoinositide phosphatase family protein SerGCT AT1G01470 LEA14, LSR3 Late embryogenesis abundant protein SerGCT AT1G03060 SPI Beige/BEACH domain SerGCT AT1G17940 Endosomal targeting BRO1-like domain-containing protein SerGCT AT1G19100 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase family protein SerGCT AT1G19880 Regulator of chromosome condensation (RCC1) family protein SerGCT AT1G30360 ERD4 Early-responsive to dehydration stress protein (ERD4) SerGCT AT1G40127 transposable element gene SerGCT AT1G42170 transposable element gene SerGCT AT1G52320 unknown protein SerGCT AT1G64340 unknown protein SerGCT AT1G66880 Protein kinase superfamily protein SerGCT AT1G70510 KNAT2, ATK1 KNOTTED-like from Arabidopsis thaliana 2 SerGCT AT1G70810 Calcium-dependent lipid-binding (CaLB domain) family protein SerGCT AT1G71695 Peroxidase superfamily protein SerGCT AT1G78370 ATGSTU20, GSTU20 glutathione S-transferase TAU 20 SerGCT AT2G07640 NAD(P)-binding Rossmann-fold superfamily protein SerGCT AT2G10600 transposable element gene SerGCT AT2G15520 transposable element gene SerGCT AT2G20610 SUR1, HLS3, RTY, ALF1, RTY1 Tyrosine transaminase family protein SerGCT AT2G21120 Protein of unknown function (DUF803) SerGCT AT2G42920 Pentatricopeptide repeat (PPR-like) superfamily protein SerGCT AT2G47710 Adenine nucleotide alpha hydrolases-like superfamily protein SerGCT AT3G03440 ARM repeat superfamily protein SerGCT AT3G05510 Phospholipid/glycerol acyltransferase family protein SerGCT AT3G13610 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein SerGCT AT3G18190 TCP-1/cpn60 chaperonin family protein SerGCT AT3G22860 TIF3C2, ATEIF3C-2, EIF3C-2, ATTIF3C2 eukaryotic translation initiation factor 3 subunit C2 SerGCT AT3G28390 PGP18 P-glycoprotein 18 SerGCT AT3G30695 transposable element gene SerGCT AT3G32893 transposable element gene SerGCT AT3G43863 transposable element gene SerGCT AT3G45630 RNA binding (RRM/RBD/RNP motifs) family protein SerGCT AT3G56280 pseudogene, protein kinase family, contains protein kinase domain, Pfam:PF00069 SerGCT AT3G66652 fip1 motif-containing protein SerGCT AT4G06485 transposable element gene SerGCT AT4G07942 transposable element gene SerGCT AT4G11000 Ankyrin repeat family protein SerGCT AT4G16950 RPP5 Disease resistance protein (TIR-NBS-LRR class) family SerGCT AT4G19185 nodulin MtN21 /EamA-like transporter family protein SerGCT AT4G22360 SWIB complex BAF60b domain-containing protein SerGCT AT4G24560 UBP16 ubiquitin-specific protease 16 SerGCT AT4G27800 TAP38, PPH1 thylakoid-associated phosphatase 38 SerGCT AT4G28000 P-loop containing nucleoside triphosphate hydrolases superfamily protein SerGCT AT4G37310 CYP81H1 cytochrome P450, family 81, subfamily H, polypeptide 1 SerGCT AT4G40045 unknown protein SerGCT AT5G03770 KDTA KDO transferase A SerGCT AT5G06680 SPC98, ATGCP3, ATSPC98, GCP3 spindle pole body component 98 SerGCT AT5G32590 myosin heavy chain-related SerGCT AT5G33306 transposable element gene SerGCT AT5G33383 transposable element gene SerGCT AT5G33385 transposable element gene SerGCT AT5G37017 Pseudogene of AT5G16486 SerGCT AT5G45050 TTR1, ATWRKY16, WRKY16 Disease resistance protein (TIR-NBS-LRR class) SerGCT AT5G54870 unknown protein SerGCT AT5G60350 unknown protein SerGGA AT1G17340 Phosphoinositide phosphatase family protein SerGGA AT1G22490 basic helix-loop-helix (bHLH) DNA-binding superfamily protein SerGGA AT1G36520 transposable element gene SerGGA AT1G47930 pseudogene, glutamyl-tRNA synthetase, similar to GI:3435196 from (Arabidopsis thaliana) SerGGA AT2G13470 transposable element gene SerGGA AT2G33050 AtRLP26, RLP26 receptor like protein 26 SerGGA AT2G37890 Mitochondrial substrate carrier family protein SerGGA AT3G01750 Ankyrin repeat family protein SerGGA AT3G06410 Zinc finger C-x8-C-x5-C-x3-H type family protein SerGGA AT3G22340 transposable element gene SerGGA AT3G27965 transposable element gene SerGGA AT3G29800 P-loop containing nucleoside triphosphate hydrolases superfamily protein SerGGA AT3G54430 SRS6 SHI-related sequence 6 SerGGA AT3G59680 unknown protein SerGGA AT4G13100 RING/U-box superfamily protein SerGGA AT5G18550 Zinc finger C-x8-C-x5-C-x3-H type family protein SerGGA AT5G18900 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein SerGGA AT5G19473 RPM1-interacting protein 4 (RIN4) family protein SerGGA AT5G26090 Plant self-incompatibility protein S1 family SerGGA AT5G62250 MAP65-9 microtubule-associated protein 65-9 SerGGA ATCG00090 TRNS.1 tRNA-Ser SerGGA ATCG00290 TRNS.2 tRNA-Ser SerTGA AT1G09795 ATATP-PRT2, HISN1B, ATP-PRT2 ATP phosphoribosyl transferase 2 SerTGA AT1G11920 Pectin lyase-like superfamily protein SerTGA AT1G20750 RAD3-like DNA-binding helicase protein SerTGA AT1G22610 C2 calcium/lipid-binding plant phosphoribosyltransferase family protein SerTGA AT1G28100 unknown protein SerTGA AT1G30350 Pectin lyase-like superfamily protein SerTGA AT1G33700 Beta-glucosidase, GBA2 type family protein SerTGA AT1G36250 transposable element gene SerTGA AT1G41896 transposable element gene SerTGA AT1G42380 transposable element gene SerTGA AT1G48860 RNA 3'-terminal phosphate cyclase/enolpyruvate transferase, alpha/beta SerTGA AT1G67990 ATTSM1, TSM1 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein SerTGA AT2G01260 Protein of unknown function (DUF789) SerTGA AT2G11310 transposable element gene SerTGA AT2G12370 transposable element gene SerTGA AT2G13110 transposable element gene SerTGA AT2G17960 unknown protein SerTGA AT2G33640 DHHC-type zinc finger family protein SerTGA AT2G38970 Zinc finger (C3HC4-type RING finger) family protein SerTGA AT3G10320 Glycosyltransferase family 61 protein SerTGA AT3G25260 Major facilitator superfamily protein SerTGA AT3G29510 transposable element gene SerTGA AT3G30582 transposable element gene SerTGA AT3G30716 transposable element gene SerTGA AT3G30749 transposable element gene SerTGA AT3G30811 transposable element gene SerTGA AT3G32475 transposable element gene SerTGA AT3G32899 transposable element gene SerTGA AT3G43358 transposable element gene SerTGA AT3G43955 transposable element gene SerTGA AT3G58460 RBL15 RHOMBOID-like protein 15 SerTGA AT4G04050 transposable element gene SerTGA AT4G06488 transposable element gene SerTGA AT4G08114 transposable element gene SerTGA AT4G15970 Nucleotide-diphospho-sugar transferase family protein SerTGA AT4G24730 Calcineurin-like metallo-phosphoesterase superfamily protein SerTGA AT4G27420 ABC-2 type transporter family protein SerTGA AT4G34220 Leucine-rich repeat protein kinase family protein SerTGA AT4G37370 CYP81D8 cytochrome P450, family 81, subfamily D, polypeptide 8 SerTGA AT5G01185 transposable element gene SerTGA AT5G03900 Iron-sulphur cluster biosynthesis family protein SerTGA AT5G15270 RNA-binding KH domain-containing protein SerTGA AT5G24370 Plant invertase/pectin methylesterase inhibitor superfamily protein SerTGA AT5G27000 ATK4, KATD kinesin 4 SerTGA AT5G43130 TAF4 TBP-associated factor 4 SerTGA AT5G50420 O-fucosyltransferase family protein SerTGA AT5G53280 PDV1 plastid division1 ThrCGT AT1G12660 Predicted to encode a PR (pathogenesis-related) protein. Belongs to the plant thionin (PR-13) family with the following members: At1g66100, At5g36910, At1g72260, At2g15010, At1g12663, At1g12660. ThrCGT AT1G19560 pseudogene, putative CHP-rich zinc finger protein ThrCGT AT1G43040 SAUR-like auxin-responsive protein family ThrCGT AT1G53023 Ubiquitin-conjugating enzyme family protein ThrCGT AT2G07500 transposable element gene ThrCGT AT3G23560 ALF5 MATE efflux family protein ThrCGT AT3G53910 malate dehydrogenase-related ThrCGT AT4G09610 GASA2 GAST1 protein homolog 2 ThrCGT AT4G11550 Cysteine/Histidine-rich C1 domain family protein ThrCGT AT5G25754 RNA polymerase I-associated factor PAF67 ThrCGT AT5G25757 RNA polymerase I-associated factor PAF67 ThrCGT AT5G47720 Thiolase family protein ThrCGT AT5G52320 CYP96A4 cytochrome P450, family 96, subfamily A, polypeptide 4 ThrCGT AT5G65290 LMBR1-like membrane protein ThrTGT AT1G08250 ADT6 arogenate dehydratase 6 ThrTGT AT1G19415 transposable element gene ThrTGT AT1G64060 ATRBOH F, ATRBOHF, RBOHAP108, RBOHF, RBOH F respiratory burst oxidase protein F ThrTGT AT1G74780 Nodulin-like / Major Facilitator Superfamily protein ThrTGT AT2G01210 Leucine-rich repeat protein kinase family protein ThrTGT AT2G34100 unknown protein ThrTGT AT3G03680 C2 calcium/lipid-binding plant phosphoribosyltransferase family protein ThrTGT AT3G04550 unknown protein ThrTGT AT3G43826 pseudogene, hypothetical protein ThrTGT AT4G20410 GSNAP, GAMMA-SNAP gamma-soluble NSF attachment protein ThrTGT AT4G30800 Nucleic acid-binding, OB-fold-like protein ThrTGT AT5G18390 Pentatricopeptide repeat (PPR) superfamily protein ThrTGT AT5G47700 60S acidic ribosomal protein family ThrTGT ATMG00320 ORF127 hypothetical protein TrpCCA AT1G08470 SSL3 strictosidine synthase-like 3 TrpCCA AT1G15690 AVP1, ATAVP3, AVP-3, AtVHP1 TrpCCA AT1G22880 ATGH9B4, ATCEL5, CEL5 cellulase 5 TrpCCA AT1G55090 carbon-nitrogen hydrolase family protein TrpCCA AT1G61940 AtTLP4, TLP4 tubby like protein 4 TrpCCA AT1G77460 Armadillo/beta-catenin-like repeat TrpCCA AT1G80530 Major facilitator superfamily protein TrpCCA AT2G37780 Cysteine/Histidine-rich C1 domain family protein TrpCCA AT2G37810 Cysteine/Histidine-rich C1 domain family protein TrpCCA AT2G42730 F-box family protein TrpCCA AT3G09780 CCR1, ATCRR1 CRINKLY4 related 1 TrpCCA AT3G21150 BBX32 B-box 32 TrpCCA AT3G25280 Major facilitator superfamily protein TrpCCA AT3G58590 Pentatricopeptide repeat (PPR) superfamily protein TrpCCA AT4G10414 Pseudogene of AT4G10430 TrpCCA AT4G20400 JMJ14, PKDM7B JUMONJI 14 TrpCCA AT4G30662 unknown protein TrpCCA AT5G17730 P-loop containing nucleoside triphosphate hydrolases superfamily protein TyrGTA AT1G77470 RFC3, RFC5 replication factor C subunit 3 TyrGTA AT2G03590 ATUPS1, UPS1 ureide permease 1 TyrGTA AT2G03600 UPS3 ureide permease 3 TyrGTA AT2G32160 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein TyrGTA AT2G32730 26S proteasome regulatory complex, non-ATPase subcomplex, Rpn2/Psmd1 subunit TyrGTA AT3G20530 Protein kinase superfamily protein TyrGTA AT3G49120 ATPERX34, PERX34, PRXCB, ATPCB, PRX34 peroxidase CB TyrGTA AT4G02580 NADH-ubiquinone oxidoreductase 24 kDa subunit, putative TyrGTA AT4G04420 transposable element gene TyrGTA AT4G06503 transposable element gene TyrGTA AT4G15420 Ubiquitin fusion degradation UFD1 family protein TyrGTA AT5G10100 TPPI Haloacid dehalogenase-like hydrolase (HAD) superfamily protein TyrGTA AT5G14570 ATNRT2.7, NRT2.7 high affinity nitrate transporter 2.7 TyrGTA AT5G46665 transposable element gene ValAAC AT1G21100 O-methyltransferase family protein ValAAC AT1G25886 transposable element gene ValAAC AT2G14770 transposable element gene ValAAC AT2G29120 ATGLR2.7, GLR2.7 glutamate receptor 2.7 ValAAC AT2G46495 RING/U-box superfamily protein ValAAC AT3G14750 unknown protein ValAAC AT3G24390 transposable element gene ValAAC AT3G42730 transposable element gene ValAAC AT3G43390 transposable element gene ValAAC AT3G49920 VDAC5 voltage dependent anion channel 5 ValAAC AT3G58490 Phosphatidic acid phosphatase (PAP2) family protein ValAAC AT4G05280 transposable element gene ValAAC AT5G02510 BEST Arabidopsis thaliana protein match is: Ubiquitin system component Cue protein (TAIR:AT5G32440.1) ValAAC AT5G15510 TPX2 (targeting protein for Xklp2) protein family ValAAC AT5G18210 NAD(P)-binding Rossmann-fold superfamily protein ValAAC AT5G34970 transposable element gene ValAAC AT5G36860 transposable element gene ValAAC AT5G59950 RNA-binding (RRM/RBD/RNP motifs) family protein ValCAC AT1G09310 Protein of unknown function, DUF538 ValCAC AT1G21270 WAK2 wall-associated kinase 2 ValCAC AT1G53930 Ubiquitin-like superfamily protein ValCAC AT2G18090 PHD finger family protein / SWIB complex BAF60b domain-containing protein / GYF domain-containing protein ValCAC AT2G36170 Ubiquitin supergroup ValCAC AT2G42835 other RNA ValCAC AT2G47110 UBQ6 ubiquitin 6 ValCAC AT3G02260 BIG, DOC1, TIR3, UMB1, ASA1, LPR1, CRM1 auxin transport protein (BIG) ValCAC AT3G22290 Endoplasmic reticulum vesicle transporter protein ValCAC AT3G42420 transposable element gene ValCAC AT3G47170 HXXXD-type acyl-transferase family protein ValCAC AT3G52590 UBQ1, EMB2167, ERD16, HAP4 ubiquitin extension protein 1 ValCAC AT3G55360 CER10, ECR, ATTSC13, TSC13 3-oxo-5-alpha-steroid 4-dehydrogenase family protein ValCAC AT3G62250 UBQ5 ubiquitin 5 ValCAC AT4G02890 UBQ14 Ubiquitin family protein ValCAC AT4G03443 unknown protein ValCAC AT4G05050 UBQ11 ubiquitin 11 ValCAC AT4G05320 UBQ10 polyubiquitin 10 ValCAC AT4G18270 ATTRANS11, TRANS11 translocase 11 ValCAC AT4G25020 D111/G-patch domain-containing protein ValCAC AT4G30640 RNI-like superfamily protein ValCAC AT5G03140 Concanavalin A-like lectin protein kinase family protein ValCAC AT5G07510 GRP14, ATGRP14, GRP-4, ATGRP-4 glycine-rich protein 14 ValCAC AT5G23660 MTN3, SWEET12, AtSWEET12 homolog of Medicago truncatula MTN3 ValCAC AT5G63100 S-adenosyl-L-methionine-dependent methyltransferases superfamily protein ValTAC AT1G36406 transposable element gene ValTAC AT1G72220 RING/U-box superfamily protein ValTAC AT1G73960 TAF2 TBP-associated factor 2 ValTAC AT2G04010 transposable element gene ValTAC AT2G04310 transposable element gene ValTAC AT2G12083 transposable element gene ValTAC AT2G23500 transposable element gene ValTAC AT2G25920 BEST Arabidopsis thaliana protein match is: 3'-5' exonuclease domain-containing protein / K homology domain-containing protein / KH domain-containing protein (TAIR:AT2G25910.2) ValTAC AT2G32480 ARASP ARABIDOPSIS SERIN PROTEASE ValTAC AT3G32060 transposable element gene ValTAC AT3G33160 transposable element gene ValTAC AT3G42110 transposable element gene ValTAC AT3G62600 ATERDJ3B, ERDJ3B DNAJ heat shock family protein ValTAC AT4G00730 ANL2, AHDP Homeobox-leucine zipper family protein / lipid-binding START domain-containing protein ValTAC AT4G06674 transposable element gene ValTAC AT4G33010 AtGLDP1, GLDP1 glycine decarboxylase P-protein 1 ValTAC AT5G02830 Tetratricopeptide repeat (TPR)-like superfamily protein ValTAC AT5G26660 ATMYB86, MYB86 myb domain protein 86 ValTAC AT5G35735 Auxin-responsive family protein ValTAC AT5G35791 transposable element gene ValTAC AT5G54570 BGLU41 beta glucosidase 41