DOCSLIB.ORG

Alternative Splicing of EZH2 Pre-Mrna by SF3B3 Contributes To

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Alternative Splicing of EZH2 Pre-Mrna by SF3B3 Contributes To Published OnlineFirst November 22, 2016; DOI: 10.1158/1078-0432.CCR-16-2020 Biology of Human Tumors Clinical Cancer Research Alternative Splicing of EZH2 pre-mRNA by SF3B3 Contributes to the Tumorigenic Potential of Renal Cancer Ke Chen1,2, Haibing Xiao1,2,3, Jin Zeng1,2, Gan Yu1,2, Hui Zhou1,2, Chunhua Huang4, Weimin Yao1,2, Wei Xiao1,2, Junhui Hu1,2, Wei Guan1,2, Lily Wu5, Jiaoti Huang6, Qihong Huang7,HuaXu1,2, and Zhangqun Ye1,2 Abstract Purpose: Deregulation or mutation of the EZH2 gene causes ited, and EZH2 promoted, cell growth, migration, proliferation, various tumors, including clear cell renal cell carcinoma (ccRCC). and tumorigenicity in a xenograft model. Mechanistic studies Although several splice variants of EZH2 have been identified, demonstrated that EZH2D14 isoform functions as a dominant- little is known about how EZH2 splicing is regulated or the negative inhibitor of full-length EZH2. Coexpression of EZH2D14 contribution of alternative splicing to its protumorigenic variant with full-length EZH2 not only abrogated DAB2IP and functions. HOXA9 suppression but also inhibited EZH2-driven tumorigen- Experimental Design: We conducted RT-PCR, Western blot esis. Strikingly, the splicing factor SF3B3 stimulates inclusion of analysis, and IHC techniques to examine EZH2 and its alternative exon14 and has pro-proliferative activity. Importantly, the upre- splicing transcript expression in renal cancer tissue and renal gulation of SF3B3 expression observed in clinical ccRCC samples cancer cell lines. Proliferation, migration, clonogenicity, and parallels the increased inclusion of EZH2 exon14, and the SF3B3 tumorigenicity of renal cancer cells either exhibiting knockdown level is associated with higher tumor stage and poor overall of EZH2 or its splicing factor SF3B3 were assessed by CCK8, survival. Transwell assay, and murine xenograft experiments. Conclusions: These results suggest SF3B3 as a key regulator of Results: We found that the inclusion of alternative EZH2 exon EZH2 pre-mRNA splicing and SF3B3 may represent a novel 14 was significantly increased in ccRCC samples and renal cancer prognostic factor and potential therapeutic target in ccRCC. Clin cell lines. In ccRCC lines, enforced expression of EZH2D14 inhib- Cancer Res; 1–14. Ó2016 AACR. Introduction carcinoma (2–6). Mechanistically, EZH2, and by inference H3K27 methylation, targets many tumor suppressor genes such PRC2 catalyzes the mono-, di-, and trimethylation of lysine 27 as DAB2IP and HOXA9 (7). Besides, EZH2 also has other HMT- of histone H3, which plays an important role in the regulation of independent functions, including DNA methylation, STAT3 tumor transformation and progression (1). EZH2, the catalytic methylation, GATA4 methylation, RORalpha methylation, subunit of PRC2, is recurrently mutated in several forms of cancer NOTCH1 activation, and androgen receptor activation (8–13). and is highly expressed in numerous others, including renal cell Numerous studies showed that PRC2 can also have a tumor- suppressive function (reviewed in refs.14, 15). In numerous experimental settings, it has been established that EZH2 expres- 1Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong 2 sion and activity are highly regulated at the transcriptional (16– University of Science and Technology, Wuhan, P.R. China. Hubei Institute of – Urology, Wuhan, P.R. China. 3Department of Urology, Union Hospital, Tongji 19), posttranscriptional (20 23), and posttranslational levels Medical College, Huazhong University of Science and Technology, Wuhan, P.R. (24–28). Targeting EZH2 is believed to be a promising strategy China. 4College of Basic Medicine, Hubei University of Traditional Chinese for cancer therapy (29, 30). However, an incomplete understand- Medicine, No.1 HUANGJIAHU Road, Hongshan District, Wuhan, China. 5Depart- ing of the molecular mechanisms that regulate EZH2 remains a ment of Molecular and Medical Pharmacology, David Geffen School of Medicine, barrier to designing effective therapeutics against EZH2. University of California Los Angeles, Los Angeles, California. 6Department of Almost all human genes are subject to alternative splicing, a Urology, David Geffen School of Medicine at UCLA, Los Angeles, California. 7The Wistar Institute, Philadelphia, Pennsylvania. pivotal mechanism for generating protein diversity; indeed dif- ferent splice isoforms from the same gene may have differing and Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/). even opposing functions. Increasing evidence suggests that tumorigenesis often involves large-scale alterations in alternative K. Chen and H. Xiao contributed equally to this article. splicing (reviewed in ref.31). For example, SF3B1 is a crucial Corresponding Author: Hua Xu, Tongji Hospital, Tongji Medical College, Huaz- component of the splicing machinery, which is frequently mutat- hong University of Science and Technology, Wuhan 430030, Hubei, China. ed in refractory anemia with ring sideroblasts (RARS; ref.32), Phone/Fax: 8627-8366-3454; E-mail: [email protected] RARS associated with thrombocytosis (RARS-T; ref.33), and doi: 10.1158/1078-0432.CCR-16-2020 chronic lymphocytic leukemia (34, 35). Thus, the deregulation Ó2016 American Association for Cancer Research. of alternative RNA splicing plays a critical role in tumor www.aacrjournals.org OF1 Downloaded from clincancerres.aacrjournals.org on September 28, 2021. © 2016 American Association for Cancer Research. Published OnlineFirst November 22, 2016; DOI: 10.1158/1078-0432.CCR-16-2020 Chen et al. horseradish peroxidase (HRP)-linked whole antibody (31430) and Translational Relevance goat anti-rabbit IgG HRP-linked whole antibody (31460) pur- Dysregulated expression or mutation of EZH2 is being chased from Thermo Scientific. recognized as a critical event in several genetic disorders and cancer, but the regulation of EZH2 splicing, and the functional Plasmids and clinical significance of the variants in clear cell renal cell Human EZH2 cDNA was PCR amplified using primers EZH2-50 carcinoma (ccRCC) remains unexplored. Herein, we found and -30, digested by BamHI and XhoI, and ligated into psi-HA, psi- that inclusion of alternative EZH2 exon 14 was significantly Myc, psi-Flag, and EGFP-myc-C1, respectively. The SUZ12 cDNA increased in ccRCC samples. Functional assays identified that was PCR amplified using primers SUZ12-50 and SUZ12-30, SF3B3 promotes inclusion of EZH2 exon 14 and has pro- digested by XhoI and EcoRI, and ligated into psi-Flag cut with proliferative activity. Importantly, the upregulation of SF3B3 XhoI and EcoRI to create the Flag-SUZ12. The EED cDNA was PCR expression observed in clinical ccRCC samples parallels the amplified using primers EED-50 and EED-30, digested by BamHI increased inclusion of EZH2 exon 14, and the SF3B3 level is and XhoI, and ligated into psi-Flag cut with BamHI and XhoIto associated with higher tumor stage and poor overall survival. create the Flag-EED. The RNAi-resistant EZH2 (Flag–EZH2–RM) Collectively, our findings clarified how upregulation of SF3B3 constructs, which the RNAi-targeted nucleotide sequence was exerts an oncogenic function in ccRCC that may offer a novel partially substituted without affecting the aa residues (50- prognostic factor and potential therapeutic target in this GGACGGCTCCTCTAACCATGT-30), was generated by a two-step disease. PCR-based mutagenesis procedure using Flag-EZH2 as the tem- plate. psi-Rluc-MCS-Fluc recombinant was constructed by cloning the coding region of Renilla luciferase and firefly luciferase into psi-EGFP-N1. Splicing reporter Rluc-miniEZH2-Fluc construct, which contains a point change sequence that introduced the stop development and progression. However, the roles of spliced codon in the EZH2 exon 14, was generated by a two-step PCR- variants and splicing factors that control splicing dysregulation based mutagenesis procedure. The primers for making these in tumorigenesis need more investigation. constructs are showed in Supplementary Table S1. All plasmids In this study, we observe that inclusion of EZH2 exon 14 is were verified by sequencing. significantly increased in renal cancer cell lines and renal cancer Gene-specific shRNA target sequence was synthesized and samples. EZH2D14 inhibits, and EZH2 promotes, renal tumor cloned into the HpaI and XhoI sites of the pSicoR plasmid tumorigenesis. Mechanistically, EZH2D14 competes with EZH2 (Addgene, #11597). The primers for making these constructs were for other PRC2 components and long noncoding RNA (lncRNA) provided in Supplementary Table S1. The paired primers were binding, but had little or no histone methyltransferase (HMT) annealed and ligated into pSicoR cut with HpaI and XhoI to create activity, and EZH2D14 isoform functions as a dominant-negative shRNA plasmids. For application of Cas9 for site-specific genome inhibitor of full-length EZH2. We also demonstrated that the editing in human cells, EZH2-specific sgRNA was synthesized and splicing factor SF3B3 promotes the inclusion of exon 14. Knock- cloned into lentiCRISPRv2 containing two expression cassettes, down of SF3B3 inhibits cell proliferation, colony formation, and hSpCas9 and the chimeric guide RNA (Addgene, #52961). The cell migration in vitro and suppresses carcinogenesis in vivo. paired primers were annealed and ligated into lentiCRISPRv2 and Importantly, SF3B3 is upregulated in ccRCC and highly correlates cut with BsmBI to create sgEZH2 plasmids. For the activation of with EZH2
Load more

Recommended publications
  • Mutated SF3B1 Is Associated with Transcript Isoform Changes of The
    bioRxiv preprint doi: https://doi.org/10.1101/000992; this version posted July 13, 2014. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Reyes et al. RESEARCH Mutated SF3B1 is associated with transcript isoform changes of the genes UQCC and RPL31 both in CLLs and uveal melanomas Alejandro Reyes1, Carolin Blume2, Vincent Pelechano1, Petra Jakob1, Lars M Steinmetz1,3, Thorsten Zenz2,4 and Wolfgang Huber1* *Correspondence: [email protected] 1European Molecular Biology Abstract Laboratory, Genome Biology Unit, 69117, Heidelberg Germany Background: Genome sequencing studies of chronic lympoid leukemia (CLL) Full list of author information is have provided a comprehensive overview of recurrent somatic mutations in coding available at the end of the article genes. One of the most intriguing discoveries has been the prevalence of mutations in the HEAT-repeat domain of the splicing factor SF3B1. A frequently observed variant is predicted to cause the substitution of a lysine with a glutamic acid at position 700 of the protein (K700E). However, the molecular consequences of the mutations are largely unknown. Results: To start exploring this question, we sequenced the transcriptomes of six samples: four samples of CLL tumour cells, of which two contained the K700E mutation in SF3B1, and CD19 positive cells from two healthy donors. We identified 41 genes that showed differential usage of exons statistically associated with the mutated status of SF3B1 (false discovery rate of 10%).
    [Show full text]
  • SF3B3) and Sin3a Associated Protein 130 (SAP130
    cells Communication Ambiguity about Splicing Factor 3b Subunit 3 (SF3B3) and Sin3A Associated Protein 130 (SAP130) Paula I. Metselaar 1,* , Celine Hos 1, Olaf Welting 1, Jos A. Bosch 2,3, Aletta D. Kraneveld 4 , Wouter J. de Jonge 1 and Anje A. Te Velde 1 1 Tytgat Institute for Liver and Intestinal Research, AGEM, Amsterdam UMC, University of Amsterdam, 1105BK Amsterdam, The Netherlands; [email protected] (C.H.); [email protected] (O.W.); [email protected] (W.J.d.J.); [email protected] (A.A.T.V.) 2 Department of Psychology, University of Amsterdam, 1018WS Amsterdam, The Netherlands; [email protected] 3 Department of Medical Psychology, Amsterdam UMC, University of Amsterdam, 1001NK Amsterdam, The Netherlands 4 Division of Pharmacology, Utrecht Institute for Pharmaceutical Sciences, Faculty of Science, Utrecht University, 3584CG Utrecht, The Netherlands; [email protected] * Correspondence: [email protected] Abstract: In 2020, three articles were published on a protein that can activate the immune system by binding to macrophage-inducible C-type lectin receptor (Mincle). In the articles, the protein was referred to as ‘SAP130, a subunit of the histone deacetylase complex.’ However, the Mincle ligand the authors aimed to investigate is splicing factor 3b subunit 3 (SF3B3). This splicing factor is unrelated to SAP130 (Sin3A associated protein 130, a subunit of the histone deacetylase-dependent Sin3A corepressor complex). The conclusions in the three articles were formulated for SF3B3, Citation: Metselaar, P.I.; Hos, C.; while the researchers used qPCR primers and antibodies against SAP130.
    [Show full text]
  • Anti-Phospho-SF3B1 (Sap155) (Ser129) Pab
    PD043 Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-Phospho-SF3B1 (Sap155) (Ser129) pAb CODE No. PD043 CLONALITY Polyclonal ISOTYPE Rabbit Ig, affinity purified QUANTITY 100 L SOURCE Purified IgG from rabbit serum IMMUNOGEN KLH conjugated synthetic peptide, RTMII(pS)PERL (corresponding to amino acid residues 124-133 of human SF3B1) FORMURATION PBS containing 50% Glycerol (pH 7.2). No preservative is contained. STORAGE This antibody solution is stable for one year from the date of purchase when stored at -20°C. APPLICATION-CONFIRMED Western blotting 1:1000 for chemiluminescence detection system SPECIES CROSS REACTIVITY on WB Species Human Mouse Rat Hamster Cell HeLa, Raji NIH/3T3, WR19L Not tested Not tested Reactivity Entrez Gene ID 23451 (Human), 81898 (Mouse) REFERENCES 1) Wang, C., et al., Genes Dev. 12, 1409-1414 (1998) 2) Shi, Y., et al., Mol Cell 23, 819-829 (2006) 3) Tanuma, N., et al., J. Biol. Chem., 283, 35805-35814 (2008) 4) Yoshida, K., et al., Nature 478, 64-69 (2011) 5) Rossi, D., et al., Blood 118, 6904-6908 (2011) 6) Quesada, V., et al., Nat Genet 44, 47-52 (2011) 7) Wang, L., et al., N Engl J Med. 365, 2497-2506 (2011) 8) Biankin, A. V., et al., Nature 491, 399-405 (2012) For more information, please visit our web site http://ruo.mbl.co.jp/ MEDICAL & BIOLOGICAL LABORATORIES CO., LTD. URL http://ruo.mbl.co.jp/ e-mail [email protected], TEL 052-238-1904 PD043 Page 2 P a g RELATED PRODUCTS e PD043 Anti-Phospho-SF3B1 (Sap155) (Ser129) pAb D138-3 Anti-Sap155 (SF3B12) mAb D221-3 Anti-Sap155 (SF3B1)
    [Show full text]
  • Monoclonal B-Cell Lymphocytosis Is Characterized by Mutations in CLL Putative Driver Genes and Clonal Heterogeneity Many Years Before Disease Progression
    Leukemia (2014) 28, 2395–2424 © 2014 Macmillan Publishers Limited All rights reserved 0887-6924/14 www.nature.com/leu LETTERS TO THE EDITOR Monoclonal B-cell lymphocytosis is characterized by mutations in CLL putative driver genes and clonal heterogeneity many years before disease progression Leukemia (2014) 28, 2395–2398; doi:10.1038/leu.2014.226 (Beckton Dickinson) and data analyzed using Cell Quest software. On the basis of FACS (fluorescence-activated cell sorting) analysis, we observed after enrichment an average of 91% of CD19+ cells Monoclonal B-cell lymphocytosis (MBL) is defined as an asympto- (range 76–99%) and 91% of the CD19+ fraction were CD19+/CD5+ matic expansion of clonal B cells with less than 5 × 109/L cells in the cells (range 66–99%). We used the values of the CD19+/CD5+ peripheral blood and without other manifestations of chronic fraction to calculate the leukemic B-cell fraction and reduce any lymphocytic leukemia (CLL; for example, lymphadenopathy, cyto- significant contamination of non-clonal B cells in each biopsy. DNA penias, constitutional symptoms).1 Approximately 1% of the MBL was extracted from the clonal B cells and non-clonal (that is, T cells) cohort develops CLL per year. Evidence suggests that nearly all CLL cells using the Gentra Puregene Cell Kit (Qiagen, Hilden, Germany). 2 fi fi cases are preceded by an MBL state. Our understanding of the Extracted DNAs were ngerprinted to con rm the relationship genetic basis, clonal architecture and evolution in CLL pathogenesis between samples of the same MBL individual and to rule out sample has undergone significant improvements in the last few years.3–8 In cross-contamination between individuals.
    [Show full text]
  • SF3B2-Mediated RNA Splicing Drives Human Prostate Cancer Progression
    Published OnlineFirst August 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3965 Cancer Molecular Cell Biology Research SF3B2-Mediated RNA Splicing Drives Human Prostate Cancer Progression Norihiko Kawamura1,2, Keisuke Nimura1, Kotaro Saga1, Airi Ishibashi1, Koji Kitamura1,3, Hiromichi Nagano1, Yusuke Yoshikawa4, Kyoso Ishida1,5, Norio Nonomura2, Mitsuhiro Arisawa4, Jun Luo6, and Yasufumi Kaneda1 Abstract Androgen receptor splice variant-7 (AR-V7) is a General RNA splicing SF3B2 complex-mediated alternative RNA splicing constitutively active AR variant implicated in U2 castration-resistant prostate cancers. Here, we show U2 snRNA that the RNA splicing factor SF3B2, identified by 3’ 3’ in silico and CRISPR/Cas9 analyses, is a critical 5’ 3’ splice site 5’ SF3B7 AR-V7 5’ A U2AF2 AGA Exon ? determinant of expression and is correlated SF3B6(p14) SF3B4 SF3B1 SF3B4 SF3B1 with aggressive cancer phenotypes. Transcriptome SF3B5 SF3B2 SF3B3 SF3B2 SF3B3 and PAR-CLIP analyses revealed that SF3B2 con- SF3A3 SF3B2 complex SF3A3 SF3A1 SF3A1 SF3b complex trols the splicing of target genes, including AR, to AR pre-mRNA drive aggressive phenotypes. SF3B2-mediated CE3 aggressive phenotypes in vivo were reversed by AR-V7 mRNA AR mRNA AR-V7 knockout. Pladienolide B, an inhibitor of CE3 a splicing modulator of the SF3b complex, sup- Drive malignancy pressed the growth of tumors addicted to high While the SF3b complex is critical for general RNA splicing, SF3B2 promotes inclusion of the target exon through recognizing a specific RNA motif. SF3B2 expression. These findings support the idea © 2019 American Association for Cancer Research that alteration of the splicing pattern by high SF3B2 expression is one mechanism underlying prostate cancer progression and therapeutic resistance.
    [Show full text]
  • Flexible, Unbiased Analysis of Biological Characteristics Associated with Genomic Regions
    bioRxiv preprint doi: https://doi.org/10.1101/279612; this version posted March 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. BioFeatureFinder: Flexible, unbiased analysis of biological characteristics associated with genomic regions Felipe E. Ciamponi 1,2,3; Michael T. Lovci 2; Pedro R. S. Cruz 1,2; Katlin B. Massirer *,1,2 1. Structural Genomics Consortium - SGC, University of Campinas, SP, Brazil. 2. Center for Molecular Biology and Genetic Engineering - CBMEG, University of Campinas, Campinas, SP, Brazil. 3. Graduate program in Genetics and Molecular Biology, PGGBM, University of Campinas, Campinas, SP, Brazil. *Corresponding author: [email protected] Mailing address: Center for Molecular Biology and Genetic Engineering - CBMEG, University of Campinas, Campinas, SP, Brazil. Av Candido Rondo, 400 Cidade Universitária CEP 13083-875, Campinas, SP Phone: 55-19-98121-937 bioRxiv preprint doi: https://doi.org/10.1101/279612; this version posted March 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Abstract BioFeatureFinder is a novel algorithm which allows analyses of many biological genomic landmarks (including alternatively spliced exons, DNA/RNA- binding protein binding sites, and gene/transcript functional elements, nucleotide content, conservation, k-mers, secondary structure) to identify distinguishing features.
    [Show full text]
  • Full-Length Transcript Characterization of SF3B1 Mutation in Chronic Lymphocytic Leukemia Reveals Downregulation of Retained Introns
    ARTICLE https://doi.org/10.1038/s41467-020-15171-6 OPEN Full-length transcript characterization of SF3B1 mutation in chronic lymphocytic leukemia reveals downregulation of retained introns Alison D. Tang 1, Cameron M. Soulette 2, Marijke J. van Baren1, Kevyn Hart1, Eva Hrabeta-Robinson1, ✉ Catherine J. Wu 3,4,5 & Angela N. Brooks 1 SF3B1 1234567890():,; While splicing changes caused by somatic mutations in are known, identifying full- length isoform changes may better elucidate the functional consequences of these mutations. We report nanopore sequencing of full-length cDNA from CLL samples with and without SF3B1 mutation, as well as normal B cell samples, giving a total of 149 million pass reads. We present FLAIR (Full-Length Alternative Isoform analysis of RNA), a computational workflow to identify high-confidence transcripts, perform differential splicing event analysis, and dif- ferential isoform analysis. Using nanopore reads, we demonstrate differential 3’ splice site changes associated with SF3B1 mutation, agreeing with previous studies. We also observe a strong downregulation of intron retention events associated with SF3B1 mutation. Full-length transcript analysis links multiple alternative splicing events together and allows for better estimates of the abundance of productive versus unproductive isoforms. Our work demon- strates the potential utility of nanopore sequencing for cancer and splicing research. 1 Department of Biomolecular Engineering, University of California, Santa Cruz, CA 95062, USA. 2 Department of Molecular Cell & Developmental Biology, University of California, Santa Cruz, CA 95062, USA. 3 Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 02215, USA. 4 Broad Institiute of Harvard and MIT, Cambridge, MA, USA.
    [Show full text]
  • Open Data for Differential Network Analysis in Glioma
    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
    [Show full text]
  • Mutations in Splicing Factor Genes in Myeloid Malignancies: Significance and Impact on Clinical Features
    cancers Review Mutations in Splicing Factor Genes in Myeloid Malignancies: Significance and Impact on Clinical Features Valeria Visconte 1, Megan O. Nakashima 2 and Heesun J. Rogers 2,* 1 Department of Translational Hematology and Oncology Research, Taussig Cancer Institute, Cleveland Clinic, Cleveland, OH 44195, USA; [email protected] 2 Department of Laboratory Medicine, Cleveland Clinic, Cleveland, OH 44195, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-216-445-2719 Received: 15 October 2019; Accepted: 19 November 2019; Published: 22 November 2019 Abstract: Components of the pre-messenger RNA splicing machinery are frequently mutated in myeloid malignancies. Mutations in LUC7L2, PRPF8, SF3B1, SRSF2, U2AF1, and ZRSR2 genes occur at various frequencies ranging between 40% and 85% in different subtypes of myelodysplastic syndrome (MDS) and 5% and 10% of acute myeloid leukemia (AML) and myeloproliferative neoplasms (MPNs). In some instances, splicing factor (SF) mutations have provided diagnostic utility and information on clinical outcomes as exemplified by SF3B1 mutations associated with increased ring sideroblasts (RS) in MDS-RS or MDS/MPN-RS with thrombocytosis. SF3B1 mutations are associated with better survival outcomes, while SRSF2 mutations are associated with a shorter survival time and increased AML progression, and U2AF1 mutations with a lower remission rate and shorter survival time. Beside the presence of mutations, transcriptomics technologies have shown that one third of genes in AML patients are differentially expressed, leading to altered transcript stability, interruption of protein function, and improper translation compared to those of healthy individuals. The detection of SF mutations demonstrates the importance of splicing abnormalities in the hematopoiesis of MDS and AML patients given the fact that abnormal splicing regulates the function of several transcriptional factors (PU.1, RUNX1, etc.) crucial in hematopoietic function.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name splicing factor 3b, subunit 3, 130kDa Gene Symbol SF3B3 Organism Human Gene Summary This gene encodes subunit 3 of the splicing factor 3b protein complex. Splicing factor 3b together with splicing factor 3a and a 12S RNA unit forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 3 has also been identified as a component of the STAGA (SPT3-TAF(II)31-GCN5L acetylase) transcription coactivator-HAT (histone acetyltransferase) complex and the TFTC (TATA-binding-protein-free TAF(II)-containing complex). These complexes may function in chromatin modification transcription splicing and DNA repair. Gene Aliases KIAA0017, RSE1, SAP130, SF3b130, STAF130 RefSeq Accession No. NC_000016.9, NG_027529.1, NT_010498.15 UniGene ID Hs.514435 Ensembl Gene ID ENSG00000189091 Entrez Gene ID 23450 Assay Information Unique Assay ID qHsaCIP0030454 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000302516, ENST00000310750 Amplicon Context Sequence GAGCCACTGGCATCAGCTTTGCCATTCATGGAAACTTTTCTGGAACCAAACAACA AGAAATTGTTGTTTCCCGTGGGAAGATCTTGGAGCTGCTTCGCCCAGACCCCAA CACTGGCAAAGTACATACCCTACTCACTGTGGAAGTATTCGGTGTTATCCGGTCA CTCATGGCCTTT Amplicon Length (bp) 146 Chromosome Location 16:70560588-70562909 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9986 Page 1/5 PrimePCR™Assay Validation Report cDNA Cq 18.72 cDNA Tm (Celsius) 83 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report.
    [Show full text]
  • Report Summary 4 Clinically Significant Variants & Combinations 0 Relevant Therapies 0 Other Biomarkers
    Inov Klinisches Labor Schützengraben 42, 4051 Basel, Switzerland Tel: +41 61 123 4567 Case ID Patient sex Diagnosis Tumor purity Ordering physician XB-1064 Female Chronic lymphocytic leukemia not specified Dr. Niklaus Marti Patient MRN Patient DOB Sample type Sample collection date Ordering institution MRN1234567 04/08/1957 Blood 10/01/2020 Universitätsklinik Liestal Patient name Patient ethnicity Sample site Sample receipt date Ordering institution ID not specified not specified Blood 10/03/2020 OID123 Report summary 4 clinically significant variants & combinations 0 relevant therapies 0 other biomarkers variant variant variant variant SF3B1 p.K700E NOTCH1 p.P2514fs NPM1 p.W288fs CTNNB1 p.D32Y variant SF3B1 p.K700E VAF 36% RD 67 Tier I-A SF3B1 mutations are associated with worse or intermediate prognosis in CLL (WHO, NCCN, ESMO). These mutations may be present in CHIP (WHO). no approved therapies variant NOTCH1 p.P2514fs VAF 28% RD 25 Tier I-B In a phase III trial, the addition of rituximab to FC chemotherapy showed no benefit in patients with CLL harboring NOTCH1 P2514Rfs*4. NOTCH1 P2514Rfs*4 was associated with poor overall survival, progression-free survival, and treatment risk in clinical studies of CLL patients. no approved therapies variant NPM1 p.W288fs VAF 27% RD 1,590 Tier II-C NPM1 mutations are associated with with a favorable prognosis in cytogenetically normal acute myeloid leukemia (AML), (NCCN), (ESMO), (ELN), (WHO, 2016). Multiple clinical studies have reported that NPM1 mutation is associated with favorable prognosis in AML lacking FLT3 internal tandem duplication or other FLT3 mutation. NPM1 mutation is an important diagnostic marker in AML (NCCN), (WHO), and testing is strongly recommended for certain patients with suspected or confirmed AML (CAP-ASH) to confirm molecular subtype.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]