DOCSLIB.ORG

Expression Levels of SF3B3 Correlate with Prognosis and This Is the Author's Manuscript of Article Published in Final Edited Form As

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression Levels of SF3B3 Correlate with Prognosis and This Is the Author's Manuscript of Article Published in Final Edited Form As endocrine resistance in estrogen receptor-positive breast cancer. Modern Pathology, 28(5), 677–685. http://doi.org/10.1038/modpathol.2014.146 Gökmen-Polar, Y., Neelamraju, Goswami, C. P., Gu, X., Nallamothu, G., Janga, S. C., & Badve, (2015). Expression levels of SF3B3 correlate with prognosis and This is the author's manuscript of article published in final edited form as: 1 Expression levels of SF3B3 correlate with prognosis and endocrine resistance in estrogen 2 receptor positive breast cancer 3 4 Yesim Gökmen-Polar1*, Yaseswini Neelamraju3, Chirayu P. Goswami4, Xiaoping Gu1, 5 Gouthami Nallamothu1, Sarath Chandra Janga3,4,5, and Sunil Badve1,2,6* 6 Departments of 1Pathology and Laboratory Medicine, 2Medicine, Indiana University School of 7 Medicine, Indianapolis, IN, 3Department of Biohealth Informatics, School of Informatics and 8 Computing, IUPUI, Indianapolis, IN, 4Center for Computational Biology and Bioinformatics, 9 Indiana University School of Medicine; 5Department of Medical and Molecular Genetics, 10 Indiana University School of Medicine; 6Indiana University Melvin and Bren Simon Cancer 11 Center, Indianapolis, IN. 12 13 Grant Support 14 This work was supported by the Susan G Komen for the Cure® and 100 Voices of Hope to Sunil 15 Badve. 16 17 Disclosure of Potential Conflicts of Interest 18 The authors disclose no potential conflicts of interest. 19 20 *Address of corresponding: 21 Yesim Gökmen-Polar, PhD 22 Department of Pathology and Laboratory Medicine 23 Indiana University School of Medicine 24 635 Barnhill Dr., MS 0038 25 Indianapolis, IN 46202 26 [email protected] 27 28 Sunil Badve, MD, FRCPath 29 Department of Pathology and Laboratory Medicine 30 Indiana University School of Medicine 31 350 West 11th Street, IUHPL 4050 32 Indianapolis, IN 46202, USA 33 [email protected] 34 35 Running head: SF3B1 and SF3B3 expression in endocrine resistance 36 Keywords: Breast cancer, SF3B1, SF3B3, endocrine resistance, splicing factors 37 1 38 Abstract 39 De novo or acquired resistance to endocrine therapy limits its utility in a significant 40 number of estrogen receptor-positive (ER-positive) breast cancers. It is crucial to identify novel 41 targets for therapeutic intervention and improve the success of endocrine therapies. Splicing 42 factor 3b, subunit 1 (SF3B1) mutations are described in luminal breast cancer albeit in low 43 frequency. In this study, we evaluated the role of SF3B1 and SF3B3, critical parts of the SF3b 44 splicing complex, in ER-positive endocrine resistance. 45 To ascertain the role of SF3B1/SF3B3 in endocrine resistance, their expression levels 46 were evaluated in ER-positive/endocrine-resistant cell lines (MCF-7/LCC2 and MCF-7/LCC9) 47 using a real-time quantitative Reverse Transcription PCR (qRT-PCR). To further determine their 48 clinical relevance, expression analysis was performed in a cohort of 60 paraffin-embedded ER- 49 positive, node-negative breast carcinomas with low, intermediate, and high Oncotype DX 50 recurrence scores. Expression levels of SF3B1 and SF3B3 and their prognostic value were 51 validated in large cohorts using publicly available gene expression datasets including The Cancer 52 Genome Atlas. 53 SF3B1 and SF3B3 levels were significantly increased in ERα-positive cells with acquired 54 tamoxifen (MCF-7/LCC2; both P<0.0002) and fulvestrant/tamoxifen resistance (MCF-7/LCC9; 55 P=0.008 for SF3B1 and P=0.0006 for SF3B3). Expression levels of both MCF-7/LCC2 and 56 MCF-7/LCC9 were not affected by additional treatments with E2 and/or tamoxifen. 57 Furthermore, qRT-PCR analysis confirmed that SF3B3 expression is significantly upregulated in 58 Oncotype DX high risk groups when compared with low risk (P=0.019). Similarly, in publicly- 59 available breast cancer gene expression datasets, overexpression of SF3B3, but not SF3B1, was 2 60 significantly correlated with overall survival. Furthermore, the correlation was significant in ER- 61 positive, but not in ER-negative tumors. 62 This is the first study to document the role of splicing factor SF3B3 in endocrine 63 resistance and prognosis in ER-positive breast cancer. Potential strategies for therapeutic 64 targeting of the splicing mechanism(s) need to be evaluated. 65 66 3 67 INTRODUCTION 68 The process of alternative splicing results in synthesis of multiple mRNA variants from a 69 single gene. Earlier studies reported the importance of splice variants in a number of key genes 70 regulating signaling pathways such as apoptosis, metabolism, and angiogenesis. Alterations in 71 expression of some splicing factors, genes that regulate splicing process of mature messenger 72 RNA species from primary transcripts, have also been reported in various cancers including 73 breast cancer.1 The utilization of next-generation sequencing technologies have further revealed 74 that the presence of somatic mutations in splicing factors.2 Among them, the splicing factor 75 SF3B1 mutations occurred in several types of hematological malignancies as well as in solid 76 cancers such as breast, pancreatic cancers, and uveal melanomas.3-7 These mutations were shown 77 to be associated with alternative splicing in lymphocytic leukemia and uveal melanomas.8, 9 78 However, the impact of these factors in the clinical setting has not been well established in breast 79 cancer, and their clinical utility is not clear. 80 SF3B1 is one of the 35 most frequently mutated genes using next-generation sequencing 81 on 510 breast tumors.5 However, the frequency is low (2% of all tumors). Of the 15 nonsilent 82 mutations, the majority were missense mutations. Patients with ER-positive and HER2 subtypes 83 harbored the majority of these mutations. The SF3B1 was also amongst the 18 significantly 84 mutated genes in untreated ER-positive breast tumors from 77 patients accrued from two 85 neoadjuvant aromatase inhibitor clinical trials.10 Taken together, these studies indicate the 86 potential role of SF3B multiprotein complex in ER-positive breast cancers. 87 SF3B1 encodes the largest subunit of the SF3B protein complex, a key component of the 88 core spliceosome complex essential for the accurate excision of introns from premessenger RNA 89 to form mature mRNA. SF3B1 interacts with other SF3B subunits including SF3B3.11-14 Based 4 90 on the preclinical data, SF3B1 mutation (R1074H) confers resistance to spliceosome inhibitors, 91 such as pladienolide, and impairs its binding to SF3B complex.15 Furthermore, SF3B1 and 92 SF3B3 interactions are believed to be necessary to form a binding site for this class of 93 inhibitors.15, 16 Therefore, these genes may serve as potential new therapeutic targets in ER- 94 positive breast cancer. However, there is a relative lack of data regarding the expression and 95 prognostic value of these genes in ER-positive breast cancer and their clinical utility in endocrine 96 therapy. Despite the presence of SF3B1 mutations, no SF3B3 mutations were detected in either 97 The Cancer Genome Atlas or in neoadjuvant aromatase inhibitor clinical trials. Decreased SF3B3 98 expression has been reported in breast cancer, but attributed to loss of 16q, the location of the 99 gene.17 In this study, the expression of SF3B1 and SF3B3 was analyzed in breast cancer cell lines 100 with acquired resistance to endocrine therapy and in a cohort of Oncotype DX cases using qRT- 101 PCR. The findings were further confirmed in publicly available breast cancer datasets, including 102 The Cancer Genome Atlas, and correlated their prognostic relevance and clinical utility for 103 endocrine therapy. Here, we report the clinical relevance of SF3B1 and SF3B3 in development of 104 innate and acquired endocrine resistance in ER-positive breast cancers. 105 106 METHODS 107 Breast cancer cell lines 108 LCC2 (MCF-7/LCC2; resistant to tamoxifen), LCC9 (MCF-7/LCC9; resistant to 109 fulvestrant [Faslodex; ICI 182,780] and cross-resistant to tamoxifen), and AZ (MCF-7/AZ 110 control) cell lines were kind gifts from Dr. R. Clarke (Georgetown University Medical School, 111 Washington DC).18, 19 Cell lines have been carefully maintained in a humidified tissue culture o 112 incubator at 37 C in 5% CO2:95% air atmosphere and stocks of the earliest passage cells have 5 113 been stored. The cell lines were grown in phenol-red–free DMEM containing 5% charcoal- 114 stripped fetal calf serum (CCS) and 100 mg/mL penicillin as described previously.18, 19 115 Oncotype DX samples 116 All protocols were reviewed and approved by the Institutional Review Board of Indiana 117 University. Sixty archival formalin-fixed, paraffin-embedded tumor blocks were obtained from 118 patients with ER-positive (greater than 1% expression as per ASCO-CAP guidelines) node- 119 negative breast carcinomas at the Indiana University Simon Cancer Center based on their 120 Oncotype DX recurrence score (19 low score, 21 intermediate score, and 20 high score). Four of 121 the 60 cases had a lobular histology. Demographic and clinical characteristics of the patients 122 were acquired from medical charts (Suppl Table S1). 123 RNA isolation and qRT-PCR 124 RNA was extracted from 10μm-thick sections of archival paraffin blocks using 125 RecoverAll™ total nucleic acid isolation kit (Life Technologies, Grand Island, NY). For breast 126 cancer cell lines, RNAs were isolated (RNeasy isolation kit, Qiagen, VA) and treated with Turbo 127 DNase® (Ambion, Foster City, CA) to remove contaminating DNA. The quality of RNA was 128 assessed using the Nanodrop® ND-1000 spectrophotometer (ThermoScientific, Wilmington, 129 DE). Total RNAs were reverse-transcribed using the high capacity cDNA reverse transcription 130 kit (Life Technologies) according the manufacturer’s instructions. The mRNA levels of SF3B1 131 and SF3B3 were analyzed by qRT-PCR using TaqMan gene expression assays on an ABI Prism 132 7900 platform (Applied Biosystems, Foster City, CA) with ACTB and GUSB as endogenous 133 controls for normalization. All qRT-PCR reactions from tumor blocks and breast cancer cell 134 lines were performed in duplicates and triplicates, respectively.
Load more

Recommended publications
  • Mutated SF3B1 Is Associated with Transcript Isoform Changes of The
    bioRxiv preprint doi: https://doi.org/10.1101/000992; this version posted July 13, 2014. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Reyes et al. RESEARCH Mutated SF3B1 is associated with transcript isoform changes of the genes UQCC and RPL31 both in CLLs and uveal melanomas Alejandro Reyes1, Carolin Blume2, Vincent Pelechano1, Petra Jakob1, Lars M Steinmetz1,3, Thorsten Zenz2,4 and Wolfgang Huber1* *Correspondence: [email protected] 1European Molecular Biology Abstract Laboratory, Genome Biology Unit, 69117, Heidelberg Germany Background: Genome sequencing studies of chronic lympoid leukemia (CLL) Full list of author information is have provided a comprehensive overview of recurrent somatic mutations in coding available at the end of the article genes. One of the most intriguing discoveries has been the prevalence of mutations in the HEAT-repeat domain of the splicing factor SF3B1. A frequently observed variant is predicted to cause the substitution of a lysine with a glutamic acid at position 700 of the protein (K700E). However, the molecular consequences of the mutations are largely unknown. Results: To start exploring this question, we sequenced the transcriptomes of six samples: four samples of CLL tumour cells, of which two contained the K700E mutation in SF3B1, and CD19 positive cells from two healthy donors. We identified 41 genes that showed differential usage of exons statistically associated with the mutated status of SF3B1 (false discovery rate of 10%).
    [Show full text]
  • SF3B3) and Sin3a Associated Protein 130 (SAP130
    cells Communication Ambiguity about Splicing Factor 3b Subunit 3 (SF3B3) and Sin3A Associated Protein 130 (SAP130) Paula I. Metselaar 1,* , Celine Hos 1, Olaf Welting 1, Jos A. Bosch 2,3, Aletta D. Kraneveld 4 , Wouter J. de Jonge 1 and Anje A. Te Velde 1 1 Tytgat Institute for Liver and Intestinal Research, AGEM, Amsterdam UMC, University of Amsterdam, 1105BK Amsterdam, The Netherlands; [email protected] (C.H.); [email protected] (O.W.); [email protected] (W.J.d.J.); [email protected] (A.A.T.V.) 2 Department of Psychology, University of Amsterdam, 1018WS Amsterdam, The Netherlands; [email protected] 3 Department of Medical Psychology, Amsterdam UMC, University of Amsterdam, 1001NK Amsterdam, The Netherlands 4 Division of Pharmacology, Utrecht Institute for Pharmaceutical Sciences, Faculty of Science, Utrecht University, 3584CG Utrecht, The Netherlands; [email protected] * Correspondence: [email protected] Abstract: In 2020, three articles were published on a protein that can activate the immune system by binding to macrophage-inducible C-type lectin receptor (Mincle). In the articles, the protein was referred to as ‘SAP130, a subunit of the histone deacetylase complex.’ However, the Mincle ligand the authors aimed to investigate is splicing factor 3b subunit 3 (SF3B3). This splicing factor is unrelated to SAP130 (Sin3A associated protein 130, a subunit of the histone deacetylase-dependent Sin3A corepressor complex). The conclusions in the three articles were formulated for SF3B3, Citation: Metselaar, P.I.; Hos, C.; while the researchers used qPCR primers and antibodies against SAP130.
    [Show full text]
  • Anti-Phospho-SF3B1 (Sap155) (Ser129) Pab
    PD043 Page 1 For Research Use Only. Not for use in diagnostic procedures. Anti-Phospho-SF3B1 (Sap155) (Ser129) pAb CODE No. PD043 CLONALITY Polyclonal ISOTYPE Rabbit Ig, affinity purified QUANTITY 100 L SOURCE Purified IgG from rabbit serum IMMUNOGEN KLH conjugated synthetic peptide, RTMII(pS)PERL (corresponding to amino acid residues 124-133 of human SF3B1) FORMURATION PBS containing 50% Glycerol (pH 7.2). No preservative is contained. STORAGE This antibody solution is stable for one year from the date of purchase when stored at -20°C. APPLICATION-CONFIRMED Western blotting 1:1000 for chemiluminescence detection system SPECIES CROSS REACTIVITY on WB Species Human Mouse Rat Hamster Cell HeLa, Raji NIH/3T3, WR19L Not tested Not tested Reactivity Entrez Gene ID 23451 (Human), 81898 (Mouse) REFERENCES 1) Wang, C., et al., Genes Dev. 12, 1409-1414 (1998) 2) Shi, Y., et al., Mol Cell 23, 819-829 (2006) 3) Tanuma, N., et al., J. Biol. Chem., 283, 35805-35814 (2008) 4) Yoshida, K., et al., Nature 478, 64-69 (2011) 5) Rossi, D., et al., Blood 118, 6904-6908 (2011) 6) Quesada, V., et al., Nat Genet 44, 47-52 (2011) 7) Wang, L., et al., N Engl J Med. 365, 2497-2506 (2011) 8) Biankin, A. V., et al., Nature 491, 399-405 (2012) For more information, please visit our web site http://ruo.mbl.co.jp/ MEDICAL & BIOLOGICAL LABORATORIES CO., LTD. URL http://ruo.mbl.co.jp/ e-mail [email protected], TEL 052-238-1904 PD043 Page 2 P a g RELATED PRODUCTS e PD043 Anti-Phospho-SF3B1 (Sap155) (Ser129) pAb D138-3 Anti-Sap155 (SF3B12) mAb D221-3 Anti-Sap155 (SF3B1)
    [Show full text]
  • Monoclonal B-Cell Lymphocytosis Is Characterized by Mutations in CLL Putative Driver Genes and Clonal Heterogeneity Many Years Before Disease Progression
    Leukemia (2014) 28, 2395–2424 © 2014 Macmillan Publishers Limited All rights reserved 0887-6924/14 www.nature.com/leu LETTERS TO THE EDITOR Monoclonal B-cell lymphocytosis is characterized by mutations in CLL putative driver genes and clonal heterogeneity many years before disease progression Leukemia (2014) 28, 2395–2398; doi:10.1038/leu.2014.226 (Beckton Dickinson) and data analyzed using Cell Quest software. On the basis of FACS (fluorescence-activated cell sorting) analysis, we observed after enrichment an average of 91% of CD19+ cells Monoclonal B-cell lymphocytosis (MBL) is defined as an asympto- (range 76–99%) and 91% of the CD19+ fraction were CD19+/CD5+ matic expansion of clonal B cells with less than 5 × 109/L cells in the cells (range 66–99%). We used the values of the CD19+/CD5+ peripheral blood and without other manifestations of chronic fraction to calculate the leukemic B-cell fraction and reduce any lymphocytic leukemia (CLL; for example, lymphadenopathy, cyto- significant contamination of non-clonal B cells in each biopsy. DNA penias, constitutional symptoms).1 Approximately 1% of the MBL was extracted from the clonal B cells and non-clonal (that is, T cells) cohort develops CLL per year. Evidence suggests that nearly all CLL cells using the Gentra Puregene Cell Kit (Qiagen, Hilden, Germany). 2 fi fi cases are preceded by an MBL state. Our understanding of the Extracted DNAs were ngerprinted to con rm the relationship genetic basis, clonal architecture and evolution in CLL pathogenesis between samples of the same MBL individual and to rule out sample has undergone significant improvements in the last few years.3–8 In cross-contamination between individuals.
    [Show full text]
  • SF3B2-Mediated RNA Splicing Drives Human Prostate Cancer Progression
    Published OnlineFirst August 20, 2019; DOI: 10.1158/0008-5472.CAN-18-3965 Cancer Molecular Cell Biology Research SF3B2-Mediated RNA Splicing Drives Human Prostate Cancer Progression Norihiko Kawamura1,2, Keisuke Nimura1, Kotaro Saga1, Airi Ishibashi1, Koji Kitamura1,3, Hiromichi Nagano1, Yusuke Yoshikawa4, Kyoso Ishida1,5, Norio Nonomura2, Mitsuhiro Arisawa4, Jun Luo6, and Yasufumi Kaneda1 Abstract Androgen receptor splice variant-7 (AR-V7) is a General RNA splicing SF3B2 complex-mediated alternative RNA splicing constitutively active AR variant implicated in U2 castration-resistant prostate cancers. Here, we show U2 snRNA that the RNA splicing factor SF3B2, identified by 3’ 3’ in silico and CRISPR/Cas9 analyses, is a critical 5’ 3’ splice site 5’ SF3B7 AR-V7 5’ A U2AF2 AGA Exon ? determinant of expression and is correlated SF3B6(p14) SF3B4 SF3B1 SF3B4 SF3B1 with aggressive cancer phenotypes. Transcriptome SF3B5 SF3B2 SF3B3 SF3B2 SF3B3 and PAR-CLIP analyses revealed that SF3B2 con- SF3A3 SF3B2 complex SF3A3 SF3A1 SF3A1 SF3b complex trols the splicing of target genes, including AR, to AR pre-mRNA drive aggressive phenotypes. SF3B2-mediated CE3 aggressive phenotypes in vivo were reversed by AR-V7 mRNA AR mRNA AR-V7 knockout. Pladienolide B, an inhibitor of CE3 a splicing modulator of the SF3b complex, sup- Drive malignancy pressed the growth of tumors addicted to high While the SF3b complex is critical for general RNA splicing, SF3B2 promotes inclusion of the target exon through recognizing a specific RNA motif. SF3B2 expression. These findings support the idea © 2019 American Association for Cancer Research that alteration of the splicing pattern by high SF3B2 expression is one mechanism underlying prostate cancer progression and therapeutic resistance.
    [Show full text]
  • Flexible, Unbiased Analysis of Biological Characteristics Associated with Genomic Regions
    bioRxiv preprint doi: https://doi.org/10.1101/279612; this version posted March 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. BioFeatureFinder: Flexible, unbiased analysis of biological characteristics associated with genomic regions Felipe E. Ciamponi 1,2,3; Michael T. Lovci 2; Pedro R. S. Cruz 1,2; Katlin B. Massirer *,1,2 1. Structural Genomics Consortium - SGC, University of Campinas, SP, Brazil. 2. Center for Molecular Biology and Genetic Engineering - CBMEG, University of Campinas, Campinas, SP, Brazil. 3. Graduate program in Genetics and Molecular Biology, PGGBM, University of Campinas, Campinas, SP, Brazil. *Corresponding author: [email protected] Mailing address: Center for Molecular Biology and Genetic Engineering - CBMEG, University of Campinas, Campinas, SP, Brazil. Av Candido Rondo, 400 Cidade Universitária CEP 13083-875, Campinas, SP Phone: 55-19-98121-937 bioRxiv preprint doi: https://doi.org/10.1101/279612; this version posted March 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Abstract BioFeatureFinder is a novel algorithm which allows analyses of many biological genomic landmarks (including alternatively spliced exons, DNA/RNA- binding protein binding sites, and gene/transcript functional elements, nucleotide content, conservation, k-mers, secondary structure) to identify distinguishing features.
    [Show full text]
  • Full-Length Transcript Characterization of SF3B1 Mutation in Chronic Lymphocytic Leukemia Reveals Downregulation of Retained Introns
    ARTICLE https://doi.org/10.1038/s41467-020-15171-6 OPEN Full-length transcript characterization of SF3B1 mutation in chronic lymphocytic leukemia reveals downregulation of retained introns Alison D. Tang 1, Cameron M. Soulette 2, Marijke J. van Baren1, Kevyn Hart1, Eva Hrabeta-Robinson1, ✉ Catherine J. Wu 3,4,5 & Angela N. Brooks 1 SF3B1 1234567890():,; While splicing changes caused by somatic mutations in are known, identifying full- length isoform changes may better elucidate the functional consequences of these mutations. We report nanopore sequencing of full-length cDNA from CLL samples with and without SF3B1 mutation, as well as normal B cell samples, giving a total of 149 million pass reads. We present FLAIR (Full-Length Alternative Isoform analysis of RNA), a computational workflow to identify high-confidence transcripts, perform differential splicing event analysis, and dif- ferential isoform analysis. Using nanopore reads, we demonstrate differential 3’ splice site changes associated with SF3B1 mutation, agreeing with previous studies. We also observe a strong downregulation of intron retention events associated with SF3B1 mutation. Full-length transcript analysis links multiple alternative splicing events together and allows for better estimates of the abundance of productive versus unproductive isoforms. Our work demon- strates the potential utility of nanopore sequencing for cancer and splicing research. 1 Department of Biomolecular Engineering, University of California, Santa Cruz, CA 95062, USA. 2 Department of Molecular Cell & Developmental Biology, University of California, Santa Cruz, CA 95062, USA. 3 Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 02215, USA. 4 Broad Institiute of Harvard and MIT, Cambridge, MA, USA.
    [Show full text]
  • Open Data for Differential Network Analysis in Glioma
    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
    [Show full text]
  • Mutations in Splicing Factor Genes in Myeloid Malignancies: Significance and Impact on Clinical Features
    cancers Review Mutations in Splicing Factor Genes in Myeloid Malignancies: Significance and Impact on Clinical Features Valeria Visconte 1, Megan O. Nakashima 2 and Heesun J. Rogers 2,* 1 Department of Translational Hematology and Oncology Research, Taussig Cancer Institute, Cleveland Clinic, Cleveland, OH 44195, USA; [email protected] 2 Department of Laboratory Medicine, Cleveland Clinic, Cleveland, OH 44195, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-216-445-2719 Received: 15 October 2019; Accepted: 19 November 2019; Published: 22 November 2019 Abstract: Components of the pre-messenger RNA splicing machinery are frequently mutated in myeloid malignancies. Mutations in LUC7L2, PRPF8, SF3B1, SRSF2, U2AF1, and ZRSR2 genes occur at various frequencies ranging between 40% and 85% in different subtypes of myelodysplastic syndrome (MDS) and 5% and 10% of acute myeloid leukemia (AML) and myeloproliferative neoplasms (MPNs). In some instances, splicing factor (SF) mutations have provided diagnostic utility and information on clinical outcomes as exemplified by SF3B1 mutations associated with increased ring sideroblasts (RS) in MDS-RS or MDS/MPN-RS with thrombocytosis. SF3B1 mutations are associated with better survival outcomes, while SRSF2 mutations are associated with a shorter survival time and increased AML progression, and U2AF1 mutations with a lower remission rate and shorter survival time. Beside the presence of mutations, transcriptomics technologies have shown that one third of genes in AML patients are differentially expressed, leading to altered transcript stability, interruption of protein function, and improper translation compared to those of healthy individuals. The detection of SF mutations demonstrates the importance of splicing abnormalities in the hematopoiesis of MDS and AML patients given the fact that abnormal splicing regulates the function of several transcriptional factors (PU.1, RUNX1, etc.) crucial in hematopoietic function.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name splicing factor 3b, subunit 3, 130kDa Gene Symbol SF3B3 Organism Human Gene Summary This gene encodes subunit 3 of the splicing factor 3b protein complex. Splicing factor 3b together with splicing factor 3a and a 12S RNA unit forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 3 has also been identified as a component of the STAGA (SPT3-TAF(II)31-GCN5L acetylase) transcription coactivator-HAT (histone acetyltransferase) complex and the TFTC (TATA-binding-protein-free TAF(II)-containing complex). These complexes may function in chromatin modification transcription splicing and DNA repair. Gene Aliases KIAA0017, RSE1, SAP130, SF3b130, STAF130 RefSeq Accession No. NC_000016.9, NG_027529.1, NT_010498.15 UniGene ID Hs.514435 Ensembl Gene ID ENSG00000189091 Entrez Gene ID 23450 Assay Information Unique Assay ID qHsaCIP0030454 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000302516, ENST00000310750 Amplicon Context Sequence GAGCCACTGGCATCAGCTTTGCCATTCATGGAAACTTTTCTGGAACCAAACAACA AGAAATTGTTGTTTCCCGTGGGAAGATCTTGGAGCTGCTTCGCCCAGACCCCAA CACTGGCAAAGTACATACCCTACTCACTGTGGAAGTATTCGGTGTTATCCGGTCA CTCATGGCCTTT Amplicon Length (bp) 146 Chromosome Location 16:70560588-70562909 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9986 Page 1/5 PrimePCR™Assay Validation Report cDNA Cq 18.72 cDNA Tm (Celsius) 83 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report.
    [Show full text]
  • Report Summary 4 Clinically Significant Variants & Combinations 0 Relevant Therapies 0 Other Biomarkers
    Inov Klinisches Labor Schützengraben 42, 4051 Basel, Switzerland Tel: +41 61 123 4567 Case ID Patient sex Diagnosis Tumor purity Ordering physician XB-1064 Female Chronic lymphocytic leukemia not specified Dr. Niklaus Marti Patient MRN Patient DOB Sample type Sample collection date Ordering institution MRN1234567 04/08/1957 Blood 10/01/2020 Universitätsklinik Liestal Patient name Patient ethnicity Sample site Sample receipt date Ordering institution ID not specified not specified Blood 10/03/2020 OID123 Report summary 4 clinically significant variants & combinations 0 relevant therapies 0 other biomarkers variant variant variant variant SF3B1 p.K700E NOTCH1 p.P2514fs NPM1 p.W288fs CTNNB1 p.D32Y variant SF3B1 p.K700E VAF 36% RD 67 Tier I-A SF3B1 mutations are associated with worse or intermediate prognosis in CLL (WHO, NCCN, ESMO). These mutations may be present in CHIP (WHO). no approved therapies variant NOTCH1 p.P2514fs VAF 28% RD 25 Tier I-B In a phase III trial, the addition of rituximab to FC chemotherapy showed no benefit in patients with CLL harboring NOTCH1 P2514Rfs*4. NOTCH1 P2514Rfs*4 was associated with poor overall survival, progression-free survival, and treatment risk in clinical studies of CLL patients. no approved therapies variant NPM1 p.W288fs VAF 27% RD 1,590 Tier II-C NPM1 mutations are associated with with a favorable prognosis in cytogenetically normal acute myeloid leukemia (AML), (NCCN), (ESMO), (ELN), (WHO, 2016). Multiple clinical studies have reported that NPM1 mutation is associated with favorable prognosis in AML lacking FLT3 internal tandem duplication or other FLT3 mutation. NPM1 mutation is an important diagnostic marker in AML (NCCN), (WHO), and testing is strongly recommended for certain patients with suspected or confirmed AML (CAP-ASH) to confirm molecular subtype.
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]