International Conference on Chemical, Environmental and Biological Sciences (ICCEBS'2011)

Study on Growth Hormone (GH) Gene of PO Cattle in Indonesia

Aloysius D. Corebima, Mariana Rengkuan

Syntetic Insemination Main Office Singosari and Syntetic Abstract—PO cattle had been maintained in some cattle breeding Insemination Office Lembang are Technical Implementer Unit institutes, among others BBIB Singosari Malang, and UPA Pasuruan which worked replacement dan production of superior bit of East Java. PO cattle kept in BBIB classified as superior quality, had blood continuously by supplying frozen semen. These been utilized to cow in the UPA; their descendants were distributed superior bull PO, that are cared in BBIB Singosari, in Malang, to farmers. The aim of this research is to identify genetic character of Indonesia, are rated superior by the fact of its fenotip GH gene of PO cattle. DNA isolation conducted by salting out technique, followed by PCR-sequencing procedure. Sequencing characteristic then by frozen semen, those are distributed to results showed that 214 nucleotides read in the 13 samples, 58.4% the breeder. In East Java, BBIB Singosari collaborate with was exactly same to each other, while 41.61% was not same some Local Firm Unit, worked in local cattle proliferation, particularly with respect to tree sampels of UPA. 7 sampels of UPA Alliance Firm Unit Pasuruan. UPA Pasuruan, supply cow PO, and the 3 samples of BBIB still have the same base. Related to the which used as parental stock, and by using frozen semen from 13 samples there were found some conserved sequences even to a BBIB, it is inseminated to febull and the result is bull length of 19 nucleotides, that might be used as significant marker of generation. That is the result, which will be given to bredeer. superior PO beef cattle. That bull generation is used by the bredeer as parental cattle and as meat-producing for people. Keywords— Cattle, gh gene, PCR-sekuencing. As described statements above, it is concluded that BBIB Singosari and UPA Pasuruan East Java, Indonesia have an I. INTRODUCTION important role in case of supplying cattle to fulfil the O Cattle is an offspring of Ongole Cattle, which is necessary of meat of people and also important to preserve the Pcome to Indonesia from Madras (India) during 1951 to local cattle in Indonesia. Related to the responsibility to 1929 by means of Ongolisation Programme. Compared to supply beef, then these both instances try their best to provide other cattle that is in husbandry of Indonesia, PO Cattel has superior stock parenatal in terms of morfology by bull cattle some special qualities such as relative low care cost for and its regarded as parental selection in the midst the breeder. tolerant to minimal habitat condition [1]- [ 2]-[3]. Research results showed that selection based on morfology The current problem is the decreasing of PO Cattle criteria are less exact because this characteristic is more population over years as reported by “reference [4]” that in influenced by circumstances and it not derived to its descent year 1991 PO population reach to 4,6 millions from 10 [1]. For it, it is needed a characteristic that could be descended millions of PO Cattle in Indonesia and in year 2002 numbered to its descent, that is genetic characteristic. In recent times, 874 thousands or 7,81 percent. This decrease of PO Cattle is there are many researches focused on genetic study as an distrusted for the increasing need of meat of Indonesian [3]. effort to acquire desirable chracteristics, for example The other quite ironic, found in field, is the breeder opting to economic characteristic like growth and production proliferate the import cattle by reasons that meat production is characteristics. Growth characteristic of livestock is led by higher than local cattle in Indonesia. This fact, if left, will growth controller gene. One of the gene than could influence impact to the preservation of Indonesian local cattle as plasma growth is Growth Hormone Gene. nutfah. Base on that problem, then many efforts are carried Growth Hormone is a peptida hormone which is naturally out by Indonesian Government to proliferate and keep local produced by somatotropes, subclass from acidophilic hipofisa cattle. During this day, proliferate and keep process for local cell, located in fore hipofisa gland [5]. Growth hormone is one cattle is doing by Technical Implementer Unit from of important factor in case of growth and development of Husbandry General Directorate, like BBIB, BIB, and BET. animal cell [6]. Growth hormone of Ruminansia is known responsible to Galactopoiesis and Lactation Persistensi [7], so dairy cattle, that is choosen to produce a high quality milk, is A.D. Corebima is with the Department of Biology, Malang State University (phone: +628164294487; fax: +62341-562180; e-mail: expected relinquish a large amount of GH endogen on an [email protected]). average. M. Rengkuan is with the Department of Biology, Manado State University Gene is a part of DNA Segment included all nukleotida, (phone: +6285234261980; @ [email protected]). which are transcribed into mRNA, then will be modified to protein [8]-[9]”. Part of gen, that give code to amino acids and

346 International Conference on Chemical, Environmental and Biological Sciences (ICCEBS'2011) produce protein, is called coding sequence (CDS) and there supernatan is placed in the new tube, added cold ethanol 2250 are also leader segment and trailer segment which flank CDR. µl at the same tube and after that the tube is inverted 25-30 Some genes of Eukaryot characterized discontinuous exon times until white DNA yarn is visible. Then, it is made (protein-coding) and intron (space internal in protein-coding). sentrifus with a speed of 10.000rpm, 40oC during 15 minutes In transcription process, intron part vanish (splicing) so that and supernatan disposed of. Then, it is added 3 ml cold the alteration process can run well [8]. Bovine Growth ethanol 70%. Continued with pellet by wind-dried process Hormone (bGH) is a single peptide with molecular weight 22 using room temperature and then added 100 µl TE buffer, KDa and codifie 191 amino acids [10], and length of placed in an oven 370oC during 10 minutes and kept in - nucleotide sequence 2856 pb [11]. Bovine Growth hormone 200oC temperature. Gene consist of 5 exon and seperated by four intron by [11] C. DNA Amplification of Growth Hormone and located at chromosome 19 [12]. Growth Hormone Gene (GH) is growth hormone-coding Amplification of hormon gene of PO Cattle growth which is produce by somatotropes, in leader pituitary gland hormone gene is made by Polymerase Chain Reaction (PCR) and have some physiology activities. GH Gene has important method. PCR is made by mixing aquadest steril µl and PCR role in case of regulate growth characterization, reproduction, mix 10 µl. The reaction is started by adding 2 µl DNA sample metabolism, lactation, and mammary glands growth [13]-[14]. for each primer. Amplification is executed to PCR tool (gene Along the development of technology in the field of cycler), programmed in accordance with used paired primer. molecular genetics, various researches reported how the The used primer is 5’-CCCACGGGCAAGAATGAGGC-3’ lingkages between GH Gene and milk production and the as forward and 5’-TGAGGAACTGCAGGGGCCCA-3’ as meat of foreign beef [14]-[15]-[16]-[17]. In Indonesia, as reverse, in which each primer can recognize gene sequence reported [1]-[17]-[18] that GH Gene can be a marker in located in 2054-2074 bp for primer and gene sequence located in 2457-2337 bp [18]. Gene cycler is programmed in undertaking a selection of local beef cattle, included PO Cattle o by a study of GH Gene variation. accordance with used primer, that is hot start at 94 C temperature during 1 minute, denaturation at 94oC Based the data above, then the study of GH Gene of PO o Cattle in Indonesia, especially in BBIB Singosari and UPA temperature during 1 minute, annealing at 60 C temperature during 1 minute, extension at 72oC temperature during 1 Pasuruan, which are the prominent institutes of germ o producing of PO Cattle, is needed to identify it genetically. minute and ended with post extention at 72 C temperature That genetically study is expected contribute some beneficial during 5 minutes. The amount of amplification are 30 cycles. things to prepare bull cattle and its regarded as superior D. Cycle Sequencing parental based on genetic characterization that can be Representative growth hormone genotypes were sequenced descended to its offspring. using a dyelabeled terminator cycle sequencing kit supplied by Applied Biosystems 310 genetic analyzers. The reagents II. MATERIAL AND METHOD used were ABI PRISM BigDye terminator v3.1 cycle A. Cattle sequencing kit. reagent components in the box: ready reaction mix (bigdye terminator), pGEM-3Zf double strand control There are 3 superior bull PO Cattle in BBIB Singosari and DNA templete,-21M13 primer (forward). The performance of 10 cow PO in UPA Pasuruan that used as parental stock in the the kit relies on the terminator premix contain A-, C-, G- and process of reproduction of PO cattle that used by breeder in T-Dye Terminator, dITP, dATP, dCTP, dTTP, Tris- HCl (pH Indonesia. 9.0), MgCl2, thermal stable pyrophosphatase, and AmpliTaq B. DNA Extrcation DNA Polymerase, FS (Applied Biosystems). In enzymatic Isolation is made by saltingout technique. Blood samples sequencing, a dye label is incorporated into the DNA along from vacutainer are moved as much as each 3 ml and put into with the terminating base. Aliquots of 0,2 μl of PCR products polyppropylene tube 15 ml sized, added 9 ml solution lysis (growth hormone gene) of double stranded DNA extracted RBC as much as one time and the tube then is inverted 2–3 from the cloned vector containing an insert of the growth times and incubated in room temperature during 10 minutes. hormone gene, were added into a microcentrifuge tube After that, it is made sentrifuse process 1500 rpm during 10 consisting of 8.0 ul terminator ready reaction mix, 3.2 pmole minutes then pellet and supernatan formed. Formed primer and dH2O adjusted to final volume of 20 μl followed supernatan is disposed of ad added 9 ml RBC one time then by cycle sequencing reaction. The cycle sequencing reaction incubated in a room temperature during 10 minutes and was performed in a thermal cycler as follows: 1). Twenty five o o centrifuged 1500 rpm, 10 minutes and supernatan disposed of. cycles of rapid thermal ramp to 96 C, 96 C for 10 seconds, o o Pellets, in the form of Leukocytes, are added 750 µl Cell rapid thermal ramp to 50 C, 50 C for 5 seconds, rapid thermal o o Lysis Solution then homogenized by the way of pipeting. ramp to 60 C, 60 C for 4 minutes; 2). Rapid thermal ramp to o Then it is incubated 370oC during 15 minutes, added 4 C and hold. Purification of Extension Products Extension precipitation protein as much as 500 µl then made vortex and products were purified using the ethanol/EDTA precipitation. o sentrifus process 7000rpm, 40oC during 15 minutes. Formed The product was then stored at -20 C prior to sequencing.

347 International Conference on Chemical, Environmental and Biological Sciences (ICCEBS'2011)

E. Data Analysis Sampel 13 CAGTCGTGCTTGGGCCCCTGCCGGTGGTGGCA Sampel 13 TCTGCCAGCAG Sampel 12 ...... Sampel 12 ...... The data from PCR result is used to recognize the existence Sampel 11 ...... Sampel 11 ...... Sampel 10 ...... G...... Sampel 10 ...... Sampel 9 ...... G...... Sampel 9 ...... of growth hormone gen, by observing the photo as the result Sampel 8 .....A...... G...ATCATCCT.. Sampel 8 .G..G...... of electroforesis agarosa, whereas the sequencing data is used Sampel 7 ...... G...... Sampel 7 .G...... Sampel 6 ...... G...... Sampel 6 ...... Sampel 5 .....A...... G...ATCATCCT.C Sampel 5 .G.C...... to ensure the sequence resulted by PCR, while the resulted- Sampel 4 .....A...... G...ATCATCCT.C Sampel 4 .G.C...... Sampel 3 ...... G...... Sampel 3 ...... sequence data of each sample traced and confirmed between Sampel 2 ...... G...... Sampel 2 ...... the result of forward primer sequence and reverse primer to Sampel 1 ...... G...... Sampel 1 ...... each gene by using software bioedit and BLAST Programme Fig. 2 Nucleotide sequence of the bovine GH gene (Basic Local Aligment Search Tool), which can be found in NCBI Website, then all the data from entire samples are IV. DISCUSSION paralleled with ClustalW by using Software Mega 5.2. Based on the primers used, the length of the amplification product fragment was 329 bp GH gene, located on exons 3 III. RESULTS and 4. The length of these fragments is same as reported by Resulut of GH gene amplification can be seen in fig.1 and [20] and [18] having 329 bp represented only in a single DNA result of GH gene sekuensing can be seen in fig.2. Base on the band. pair of primer that used in this research, the amplification Sequencing results (Fig. 2) related to locus 2 of GH gene product shows 329 bp in length. showed 214 (of 329) nucleotide is read. Among the 214 nucleotides of the sequencing results read on the 13 samples 58.4% of the nucleotides are exactly same to each other, while 41.61% are not different particularly with respect to sample No. 4, 5 and 8. Sample 1 , 2, 3, 6, 7, 9, 10, 11, 12 and 13 still have the same nitrogen bases. Associated with the 13 samples some conserved sequences were found, even reach a 329bp length of 19 nucleotides. Certain conserved sequence may be

used as a marker of superior beef cattle because of the PO Fig. 1 Results of amplification using the primers GH samples 11, 12 and 13 are the superior PO beef cattle kept in BBIB Singosari East Java. Sequence comparison between genotypes of Growth If the base difference restricted only at one nucleotide hormone gene between all of samples were shown below. The caused by mutation, and if all the 13 samples came from an similarities and differences were shown with or without a dot ancestral strain of PO cattle having the same sequence of sign. This comparisons compare Gh gene sequence of superior bases in the 214 nucleotide, then mutations affected by the bull PO from BBIB and cow PO from UPA. transversion are as much as 76.2 % while that due to the transition as much as 3.28%. Sampel 13 GGGCCTGGGGCGGCCTTCTCCCCGAGGTG Sampel 13 GGAGGTCCTCGGGCAGAGGCCGACCTTGC Sampel 12 ...... Sampel 12 ...... Transition as well as transversion mutations are classified Sampel 11 ...... Sampel 11 ...... Sampel 10 ...... Sampel 10 ...... Sampel 9 ...... Sampel 9 ...... as spontaneous and point mutation [21]. The cause of those Sampel 8 ...... G...... Sampel 8 ...... C...... T...C.G..CG Sampel 7 ...... Sampel 7 ...... Sampel 6 ...... Sampel 6 ...... mutations are related to three factors, including the degree of Sampel 5 ...... G...... Sampel 5 ...T.C.A..CAA..ACCT...C.G.C.G Sampel 4 ...T.C.A..CAA..ACCT...C.G.C.G Sampel 4 ...... G...... Sampel 3 ...... Sampel 3 ...... exposure to mutagenic agents including. Spontaneous and Sampel 2 ...... Sampel 2 ...... Sampel 1 ...... Sampel 1 ...... point mutation is chemical agents such as base analogs like 5-

Sampel 13 GCGGAGGTTGTTGGATGGCAGTGGAGGAT BU and 2-AP as well as vitrous acid, alkylating and Sampel 13 GACTTGGAGCTGCTTCGCATCTCACTGCT Sampel 12 ...... Sampel 12 ...... Sampel 11 ...... hydroxilating agents. Sampel 11 ...... Sampel 10 ...... Sampel 10 ...... Sampel 9 ...... Sampel 9 ...... Sampel 8 T...CCTC..CCC....A..TCCTGCACC Sampel 8 .....A..T.....G.T.C...GT..... Sampel 7 ...... Sampel 7 ...... ACKNOWLEDGMENT Sampel 6 ...... Sampel 6 ...... Sampel 5 T...CCTC..CCC..G.A..TCCTGCACC Sampel 5 ...GGA..T..C..G.T.C...GT.C... Sampel 4 T...CCTC..CCC..G.A..TCCTGCACC Sampel 4 ...GGA..T..C..G.T.C...GT.C... Thanks to State Islamic University which allows the Sampel 3 ...... Sampel 3 ...... Sampel 2 ...... Sampel 2 ...... implementation process in their sequencing laboratory and to Sampel 1 ...... Sampel 1 ...... Higher Education Directorate, the National Education

Sampel 13 GATGGTGGGAGGGCTGCCCCAAGCCCGCG Sampel 13 GCACCCACCGACCACCACCCACCTCATC Department of Indonesia financing this research through a Sampel 12 ...... Sampel 12 ...... Sampel 11 ...... Sampel 11 ...... Sampel 10 ...... Sampel 10 ...... doctoral research grant program. Sampel 9 ...... Sampel 9 ...... Sampel 8 ACC.CCCAC.....G...... G....C Sampel 8 C..G..CG.TG.G.GAGC...... Sampel 7 ...... Sampel 7 ...... Sampel 6 ...... Sampel 6 ...... Sampel 5 ACC.CCCAC....GGC.G.....G..C.. Sampel 5 .G.G...G.TGGGG.AGC...... REFERENCES Sampel 4 ACC.CCCAC....GGC.G.....G..C.. Sampel 4 .G.G...G.TGGGG.AGC...... Sampel 3 ...... Sampel 3 ...... Sampel 2 ...... Sampel 2 ...... [1] Sutarno, A. Junaidi, A.Purwoko, & N. I. Lelana, “Identification and Sampel 1 ...... Sampel 1 ...... Characterization of Growth Hormone Gene Polymorphisms in Bali Cattle, Beef Cattle Madura and Bengala,” Biodiversitas, vol. 3, no. 1, pp. 77-81, Apr. 2005. [2] Z. Abidin, Cattle Fattening, Jakarta: Agro Media Pustaka, 2007, pp. 7- 11.

348 International Conference on Chemical, Environmental and Biological Sciences (ICCEBS'2011)

[3] Soeprapto, Exactly How to Beef Cattle Fattening, Jakarta: Agromedia Biographies Inc, 2008, pp. 20-25. [4] M. Astuti, “Potential and Diversity of Genetic Resources,” Biodiversity, Aloysius Corebima Duran, was born in East vol. 14, no 4, Apr. 2004. [5] C. D.Reis, N. Navas, Pereira, & A. Cravador, “Growth hormone AluI Flores on February 12 in 1949, completed polymorphism analysis in eight portuguese bovine breeds,” Arch. undergraduate biology education at Intitut of Zootec, vol. 50, pp. 41-48, 2001. teaching and Education Scinence in 1976, a [6] M. B. Pierzchala, Tadeusz, & Jolanta K, “Growth rate and carcass Masters in Biology education at Educational quality in relation to GH|MspI and GH|HaeI PCR-RFLP polymorphism,” in pigs. J. Anim. Sci. Papers and Rep. 22 : 57-64. Sciences in 1989, and a Doctorate in the [7] Svennersten-Sjaunja & K. Olsson. “Endocrinology of milk production field of Genetics at the Surabaya Airlangga University in Domest,” Anim. Endocrinol. 29 : 241–258, 2005. 1995. [8] T. A. Brown, Genome, Garland Science Publishing, New York, 1999. He was served as a lecturer and Professor of Genetics at [9] Muladno, Genetic Engineering of Technology. Bogor: Young Enterprises, 2002. the Faculty of mathematics and Science, Malang State [10] M. Wallis, “The primary structure of bovine growth hormone,” FEBS University. He has written several articles published in the Lett. vol. 35, no.1, pp. 11-14, May 1973. field of genetics of the journal Faculty of Mathematics and [11] D. F., D. P. Gordon, C. R.Quick, Ewin, J. E. Donelson, & R. A. Maurer, Science, Malang State University. Has written a related “Nukleotide sequence of the bovine growth hormone chromosomal gene,” Mol. Cell. Endocrinol, vol. 33, pp. 81-95, 1983. sequence DNA marker of sus scrofa are published in [12] R Hediger, S.E. Johnson, W. Barendse, R.D. Drinkwater, S. S. Moore, & international symposium in kualalumpur. The books are J. Hetzel, “Assignment of the growth hormone gene locus to 19q26-qter written, among other things: Mendelian genetics, genetics and in cattle and to 11q25-qter in sheep by in situ hybridization,” Genomics, genetic mutation, sex and recombination are published by vol. 8, pp. 171-174, 1990. [13] E.P.Cunningham, “The use of bovine somatotropin in milk productiona Publishers Pen Hit Poor Solar in 2010 and publisher of review,” Irish Veterinary Journal, vol. 47, pp. 207-210, 1994. Airlangga University Press in 1998. [14] S. Hoj, M. Fredholm, N.J. Larsen, and V.H. Nielsen, “Hormon pertumbuhanGene Polymorphism Associated With Selection For Milk Mariana Rengkuan, was born at Tataaran on Fat Production in Lines of Cattle,” Animal Genetics, vol. 24: 91-96, 1993. March 5 in 1980. Graduated Bachelor in 2003 [15] M.C., Lucy, S.D. Hauser, P.J. Eppard, G.G. Krivi, and J.H. Clark, at the Department of biology, Faculty of “Variants of somatotropin in cattle gene frequencies in major dairy Sciences, Manado State University with breeds and associated milk production,” Domestic Animal cumlaude. In 2009 graduated school of Endocrinology, vol. 10, pp. 325-333, 1993. education Graduate Biology Education, [16] P Schlee, R. Graml, O. Rottmann, and F. Pirchner, “Influence of Growth-Hormone Genotypes on Breeding Values of Simmental Bulls,” Malang State University with cumlaude. Journal of Animal Breeding and Genetics Zeitschrift fur Tierzuchtung In 2003-2007 as a teacher of biology in SMA Katolik und Zuchtungsbiologie, vol. 11, pp. 253-256, 1994. Aquino Manado, and in 2005 was appointed as a staff lecturer [17] Sutarno, “DNA polymorphism and the Nature of Growth Hormone Gene at the Department of biology Faculty of Sciences, Manado in Cattle Production Composite,” Biodiversitas, vol. 2, no 2, pp. 1-5, 2000. State University. The writer is finishing a Doctoral Education [18] Sutarno, “Genetic variations among Indonesian native cattle breeds biology and currently get doctoral research grant program of based on polymorphisms analysis in the growth hormone loci and the National Education Department Indonesia. In 2010- mitochondrial DNA,” Biodiversitas, vol. 11, no 1, 1-5, Jan. 2010. present is entrusted as head editor of the Journal FORMAS- [19] Fatchiyah, Arumingtyas, Widyarti, dan Rahayu, Molecular Biology Analysis, Malang: University of Brawijaya Press, 2005, pp. 10-13. Malang, Indonesia. [20] G. L. Zhou, H. G. Jin, S. L. Guo, Q. Zhu & Y. H. Whu, “Association of genetic polymorphism in GH gene with milk production traits in Beijing Holstein cows,” J. Biosci, vol. 30, pp. 595-598, 2005. [21] E. J. Gardner, M. J. Simmons, D. P. Snustad, Principles of Genetics, New York: John Wiley & Sons Inc, 1991, pp. 299-312.

349