DOCSLIB.ORG

Subject Index

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Subject Index 585 Subject Index A A. fulgidus see Archaeoglobus fulgidus ALOX5 373 A. thaliana see Arabidopsis thaliana – activity 374 abandoned samples 518 alternative splicing 240 Abbe’s Diffraction Limit, DNA sequencing 160 aMAZE 442 ABC see ATP-binding cassette permeases AmiGO GOst server 337 ABI1 gene 111 amino-modified oligonucleotide sequences 228 ABI3 gene 111 Aminoactyl-tRNA Synthetase Database 442 ABI4 gene 111 amplicon, DNA microarrays 229, 232–234 academic secrecy, commercialization of biobank amplified fragment length polymorphism 107 resources 542 analysis of intact proteins 203 acceptable uses of genetic technologies 541 analytic models 472 access by third parties, genetic information 514 anion-exchange prefractionation, Mass accountability 551 Spectrometry 202 ACeDB 31 anion transporters 372 acetyl-CoA synthase 19 anion-transporting polypeptides 372 Acidobacter, model organisms 51 AnnAt1, plants 69 acute lymphoblastic leukemia 255 anomalous dispersion, multiple wavelength 274 acute myeloid leukemia 255 anonymization process, samples 520 acute promyelocytic leukemia 373 anonymized samples, DNA 510, 517 adaptive automation, DNA sequencing 153 ANTHEPROT 334 additives, protein crystallography 278–279 anti-cancer drug screen study, Bioinformatics 359 adenomatous polyposis coli 93 antiapopotic gene 94 Adh1 locus 116 antimicrobials 53 adiponectin receptor 366 antisense RNA expression 76 adverse drug effects 366, 368 Apache affinity tagging 262, 277 – Batik 406 Affymetrix 223, 357, 417, 421 – software, JAVA-based 406 AFLP see amplified fragment length – Xalan-Java 409 polymorphism – Xerces 406 agarose gel simulation, MAGPIE 403 APC AGAVE XML 412 – gene 93 age of enlightment 566 – protein 93 Agilent Technologies 417, 421 Apium graveolens, model organisms 64 AHEC 523 apo-calmodulin 289 Albers-Schonberg disease, type II 364 Aquifex aeolicus, model organisms 17 albuterol 357 Arabidopsis thaliana 4 alignment, Bioinformatics 301–302 – comprehensive genetic map 26 Alkaloid biosynthesis 471 – duplicated segments 29 allelic heterogeneity, human genome 87 – favorable feature 26 Handbook of Genome Research. Genomics, Proteomics, Metabolomics, Bioinformatics, Ethical and Legal Issues. Edited by Christoph W. Sensen Copyright © 2005 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim ISBN: 3-527-31348-6 586 Subject Index – functional genomics 30 ASD 356 – Genome Initiative 27 ASEdb 442 – model organisms 25, 59, 110, 239, 411 Asilomar conference 6 – plant-specific functions 29 ASN.1 466 – potential functional assignments 29 – tools 438 – repeats of transposeable elements 28 Asparagales, model organisms 64 – repetitive elements 28 assembly lines, genome research 576 – sequencing strategy 27 Assistance Publique-Hopitaux de Paris 546 – stock centers 27 association studies 88 – tandem repeats 29 Asterand 542 archaea 16 at-risk information, automatic communication – halophilic 49 526 Archaeoglobales 16 ATH1 GeneChip 121 Archaeoglobus fulgidus, model organisms 3 ATNOS 287 – carbon source 19 ATP-binding cassette permeases 11 – characterization of the genome 18 attrition, protein crystallography 275 – electron-micrograph 16 Australian Health Ethics Committee 523 – gene density 19 Australian Law Reform Commission 522–523 – genes for RNA 18 AutoAssign 286 – genome size 17 automated microscopes 279 – iron sulfide 16 automated sequencers, DNA sequencing 138 – IS elements 18 automatic communication of at-risk information – isoelectric point 19 526 – long coding repeats 18 autonomic neuropathy 85 – minimum sequence coverage 17 autosomes 84 – non-coding repeats 18 – Caenorhabditis elegans 31 – paralogous gene families 19 average difference 422 – putative functions 19 award, 21st Century Achievement Award 359 – regions with low G+C content 18 AXR1 gene 111 – regulatory networks 20 – research articles 20 B – sensory networks 20 B-cell lymphoma – sequencing strategy 18 – diffuse large 255 – sulfate reduction 19 –large diffuse 245 archived human biological material 528 B-statistics 253 Ardais 542 B. subtilis see Bacillus subtilis argon ion laser 144 BAC see bacterial artificial chromosomes ARIA 287 BAC fingerprint database 120 Aristotle 537 Bacillus subtilis, model organisms 3, 10, 448 array printing methodology, DNA microarrays – cold shock response 14 241 – collection of mutants 14 array scanners, DNA microarrays 250 – Electron micrograph 10 ArrayAnalyzer 423 – enzyme production 15 arrayers, DNA microarrays 243 – food products, humanization 15 ArrayExpress 420 – foodsupply fermentation 15 ArrayIt SuperFilter plates 232 – functional genomics 13–15 ArrayViewer 420 – gene classes 13 arrhythmias, familial 96 – gene families 11 arrhythmogenic right ventricular cardiomyopathy – genes of completely unknown function 16 96 – genome 11 artifcicial neural nets 339 – hay bacterium 10 artificial intelligence 323 – humanization of the content of food products Asc gene 110 15 ASCII text 466 – iron metabolism 15 Subject Index 587 – leading replication strands 14 Biobank UK 551 – macriarray studies 14 Biobanks 516, 537–559 – natural selection 12 – ethical concerns 538 – normal habitat 10 – for Research 529 – order of the genes 15 – governance 551, 553–554 – osmotic stress 11 – initiatives, viability 551 – proteome 14 – legal concerns 538 – replication 12 – linkage to health information 539 – saltstress response 15 – risk and benefits 537 – strain 168 12 – social concerns 538 – traditional techniques 15 BioCarta 339, 443 – transcription 14 Biocatalysis/Biodegredation Database 443 – transformation 12 biochemical essay simulation, Bioinformatics – truncated tagged protein, Bacillus subtilis 13 384 backcrosses 106 biochemical systems, hierarchical 482 bacterial artificial chromosomes 62, 114 BioChipNet 243 bacteriophage f1 DNA 129 bioconductor project 254, 420 bacteriophage RNA 129 BioCYC 359, 445 bait and prey proteins 203, 496 bioethical discussion 564 band tilt, DNA sequencing 155 biofilm 50 BandCheck 232 – acid mine drainage 50 banking 509 – drinking water 50 barley, model organisms 110, 122 Bioinformatics 299–322 BASE 254, 420 – 2D gel analysis software 324 base calling, DNA sequencing 155–156 – 2D threading 343 bases – 3D threading 343 – individual, DNA sequencing 156 – alignment methods 299–305 – mispairing 249 – alternative splicing variants 356 Bayesian probabilistic approaches 331, 342, 424 – anti-cancer drug screen study 359 BBID 442 – applied 353–381 BDGP see Drosophila Genome Project – assembly engine 387 beamlines 279 – bending in a DNA double helix 312 Belgian Society of Human Genetics 547 – Berkeley Database Manager 385 benefit-sharing 512 – biochemical essay simulation 384 – genetic material 527 – Caenorhabditis elegans 31 – genetic resources 549 – cheminformatics 359 benefits, non-monetary 550 – codon preference statsistics 318 bermuda agreement 583 – codon usage analysis 315 beta-blockers 373 – coiled-coil domains 341 bi-directional sequencing, simultaneous, DNA – coloration of analysis data 386 sequencing 144 – consensus methods 309 Bias 429 – CpG islands 313 BIBAC vector 114 – data mining software 361 biclustering algorithms 426 – database alignment algorithms 333 bifurcation analyzer 482 – databases 353–362 BIND 338, 435 – detection of patterns 311 – data model 435 – disease-oriented target identification 364–365 – database standards 439–440 – display idioms 386 – domains 440 – DNA comparison matrix 301 – see also Biomolecular Interaction Network – domain identification 341 Database – dot plots 300 binding protein, FK506 265 – drug-target discovery 362 BindingdB 442 – dynamic programming 305 bio-ethical questions 567 – EST sequence database 355–356 588 Subject Index – evidence 384 – substitution matrices 333 – exact substring matches 332 – threading 334, 342 – expression database 357–358 – tilting technique 391 – fuzzy matching 332 – transmembrane helices 339 – gaps 301 – transmembrane helics prediction 340 – General Feature Format 385 – two dimensional canvas 385 – genome features 384 – user preferences 385 – global alignment 301 – XML data 384 – globularity 340 – XML documents 384 – graphical display systems 383 BioJava 420 – helical wheels 345 biological material, ownership 538 –hidden Markov model 305, 334 biological samples, forseeable uses 553 – k-tuples 305 Biology, in silicio 579 – local alignment 301–303 biomarker discovery 372–373 – local sequence similarity 332 – projects 188 – localized ungapped alignments 305 biomaterials, commodification 543 – MAGPIE hierarchy 386 BioML 412 – manual user annotations 385 BIOMOBY 405 – Mass Spectrometry 193–195 Biomolecular Interaction Network Database – metabonomic database 354 437–439 – microarray databases 369 BioPAX 440 – modular computer code 385 BioPerl 420 – Needleman-Wunsch 301 BioPNML 478 – neural network analysis 334 biopsies 185 – nucleotide sequence pattern 314 biosynthesis, natural-product 53 – one-letter-code 309 biotech industry, currency 544 – open reading frame 317–318 biotechnology programs, EU 21 – open source effort 321 BioTools 345 – pairwise alignment 300 bladder cancer 256 –panes 391 blanket conset, DNA banking 524 – pathway databases 358 blanket conset 521 – pattern display 386 BLAST 331, 333, 345, 384 – pharmacoepidemology database 376 – database search program 301 – polymorphism databases 356–357 – search 195 – precomputed results 384 Blattner, F. 7 – profile-based similarity searching 363 BLOCKS 336, 384 – Proteomics database 360 blood clotting 95 – reading frame statistics 320–321 blotting, Western 326 – repeat identification 310 Bluejay 384, 404–405 – representation of the responses 386 –
Load more

Recommended publications
  • Evidence of Selection at the Ramosa1 Locus During Maize Domestication
    Molecular Ecology (2010) 19, 1296–1311 doi: 10.1111/j.1365-294X.2010.04562.x Evidence of selection at the ramosa1 locus during maize domestication BRANDI SIGMON and ERIK VOLLBRECHT Department of Genetics, Development, and Cell Biology, Iowa State University, Ames, IA 50011, USA Abstract Modern maize was domesticated from Zea mays parviglumis, a teosinte, about 9000 years ago in Mexico. Genes thought to have been selected upon during the domestication of crops are commonly known as domestication loci. The ramosa1 (ra1) gene encodes a putative transcription factor that controls branching architecture in the maize tassel and ear. Previous work demonstrated reduced nucleotide diversity in a segment of the ra1 gene in a survey of modern maize inbreds, indicating that positive selection occurred at some point in time since maize diverged from its common ancestor with the sister species Tripsacum dactyloides and prompting the hypothesis that ra1 may be a domestication gene. To investigate this hypothesis, we examined ear phenotypes resulting from minor changes in ra1 activity and sampled nucleotide diversity of ra1 across the phylogenetic spectrum between tripsacum and maize, including a broad panel of teosintes and unimproved maize landraces. Weak mutant alleles of ra1 showed subtle effects in the ear, including crooked rows of kernels due to the occasional formation of extra spikelets, correlating a plausible, selected trait with subtle variations in gene activity. Nucleotide diversity was significantly reduced for maize landraces but not for teosintes, and statistical tests implied directional selection on ra1 consistent with the hypothesis that ra1 is a domestication locus. In maize landraces, a noncoding 3¢-segment contained almost no genetic diversity and 5¢-flanking diversity was greatly reduced, suggesting that a regulatory element may have been a target of selection.
    [Show full text]
  • DNA Sequencing
    Contig Assembly ATCGATGCGTAGCAGACTACCGTTACGATGCCTT… TAGCTACGCATCGTCTGATGGCAATGCTACGGAA.. C T AG AGCAGA TAGCTACGCATCGT GT CTACCG GC TT AT CG GTTACGATGCCTT AT David Wishart, Ath 3-41 [email protected] DNA Sequencing 1 Principles of DNA Sequencing Primer DNA fragment Amp PBR322 Tet Ori Denature with Klenow + ddNTP heat to produce + dNTP + primers ssDNA The Secret to Sanger Sequencing 2 Principles of DNA Sequencing 5’ G C A T G C 3’ Template 5’ Primer dATP dATP dATP dATP dCTP dCTP dCTP dCTP dGTP dGTP dGTP dGTP dTTP dTTP dTTP dTTP ddCTP ddATP ddTTP ddGTP GddC GCddA GCAddT ddG GCATGddC GCATddG Principles of DNA Sequencing G T _ _ short C A G C A T G C + + long 3 Capillary Electrophoresis Separation by Electro-osmotic Flow Multiplexed CE with Fluorescent detection ABI 3700 96x700 bases 4 High Throughput DNA Sequencing Large Scale Sequencing • Goal is to determine the nucleic acid sequence of molecules ranging in size from a few hundred bp to >109 bp • The methodology requires an extensive computational analysis of raw data to yield the final sequence result 5 Shotgun Sequencing • High throughput sequencing method that employs automated sequencing of random DNA fragments • Automated DNA sequencing yields sequences of 500 to 1000 bp in length • To determine longer sequences you obtain fragmentary sequences and then join them together by overlapping • Overlapping is an alignment problem, but different from those we have discussed up to now Shotgun Sequencing Isolate ShearDNA Clone into Chromosome into Fragments Seq. Vectors Sequence 6 Shotgun Sequencing Sequence Send to Computer Assembled Chromatogram Sequence Analogy • You have 10 copies of a movie • The film has been cut into short pieces with about 240 frames per piece (10 seconds of film), at random • Reconstruct the film 7 Multi-alignment & Contig Assembly ATCGATGCGTAGCAGACTACCGTTACGATGCCTT… TAGCTACGCATCGTCTGATGGCAATGCTACGGAA.
    [Show full text]
  • New Softwares for Automated Microsatellite Marker Development
    Published online February 21, 2006 Nucleic Acids Research, 2006, Vol. 34, No. 4 e31 doi:10.1093/nar/gnj030 New softwares for automated microsatellite marker development Wellington Martins, Daniel de Sousa1, Karina Proite2, Patrı´cia Guimara˜es2, Marcio Moretzsohn2 and David Bertioli3 Department of Computer Science, Catholic University of Goia´s, Brazil, 1Department of Computer Science, Catholic University of Rio de Janeiro, Brazil, 2Embrapa Genetic Resources and Biotechnology, Brası´lia, Brazil and 3Genomic Sciences and Biotechnology, Catholic University of Brası´lia, Brazil Received November 23, 2005; Revised and Accepted January 31, 2006 ABSTRACT whose unit of repetition is between 1 and 6 bp. They are highly abundant in the genomes of eukaryotes, polymorphic and Microsatellites are repeated small sequence motifs usually co-dominant and transferable between different map- that are highly polymorphic and abundant in the ping populations. Microsatellite markers can also be used in genomes of eukaryotes. Often they are the molecular automated genotyping techniques. Thus, they have become markers of choice. To aid the development of micro- one of the most useful molecular markers for a large number satellite markers we have developed a module that of organisms. integrates a program for the detection of microsatel- Researchers working on the development of microsatellite lites (TROLL), with the sequence assembly and markers need an efficient way to go from usually hundreds or analysis software, the Staden Package. The module thousands of trace and/or text sequence files to the identifi- has easily adjustable parameters for microsatellite cation of new potential markers. However, the softwares lengths and base pair quality control.
    [Show full text]
  • A Tool for Detecting Base Mis-Calls in Multiple Sequence Alignments by Semi-Automatic Chromatogram Inspection
    ChromatoGate: A Tool for Detecting Base Mis-Calls in Multiple Sequence Alignments by Semi-Automatic Chromatogram Inspection Nikolaos Alachiotis Emmanouella Vogiatzi∗ Scientific Computing Group Institute of Marine Biology and Genetics HITS gGmbH HCMR Heidelberg, Germany Heraklion Crete, Greece [email protected] [email protected] Pavlos Pavlidis Alexandros Stamatakis Scientific Computing Group Scientific Computing Group HITS gGmbH HITS gGmbH Heidelberg, Germany Heidelberg, Germany [email protected] [email protected] ∗ Affiliated also with the Department of Genetics and Molecular Biology of the Democritian University of Thrace at Alexandroupolis, Greece. Corresponding author: Nikolaos Alachiotis Keywords: chromatograms, software, mis-calls Abstract Automated DNA sequencers generate chromatograms that contain raw sequencing data. They also generate data that translates the chromatograms into molecular sequences of A, C, G, T, or N (undetermined) characters. Since chromatogram translation programs frequently introduce errors, a manual inspection of the generated sequence data is required. As sequence numbers and lengths increase, visual inspection and manual correction of chromatograms and corresponding sequences on a per-peak and per-nucleotide basis becomes an error-prone, time-consuming, and tedious process. Here, we introduce ChromatoGate (CG), an open-source software that accelerates and partially automates the inspection of chromatograms and the detection of sequencing errors for bidirectional sequencing runs. To provide users full control over the error correction process, a fully automated error correction algorithm has not been implemented. Initially, the program scans a given multiple sequence alignment (MSA) for potential sequencing errors, assuming that each polymorphic site in the alignment may be attributed to a sequencing error with a certain probability.
    [Show full text]
  • A Guide to HIV-1 Reverse Transcriptase and Protease Sequencing for Drug Resistance Studies
    HIV-1 RT and Protease Sequencing for Drug Resistance Studies 1 A Guide to HIV-1 Reverse Transcriptase and Reviews Protease Sequencing for Drug Resistance Studies Robert W. Shafer1, Kathryn Dupnik1, Mark A. Winters1, Susan H. Eshleman2 1 Division of Infectious Diseases, Stanford University, Stanford, CA 94305 2 Dept. of Pathology, The Johns Hopkins Medical Institutions, Baltimore, MD 21205 I. HIV-1 Drug Resistance A. Introduction HIV-1 RT and protease sequencing and drug susceptibility testing have been done in research settings for more than ten years to elucidate the genetic mechanisms of resistance to antiretroviral drugs. Retrospective studies have shown that the presence of drug resistance before starting a new drug regimen is an independent predictor of virologic response to that regimen (DeGruttola et al., 2000; Hanna and D’Aquila, 2001; Haubrich and Demeter, 2001). Prospective studies have shown that patients whose physicians have access to drug resistance data, particularly genotypic resistance data, respond better to therapy than control patients whose physicians do not have access to the same data (Baxter et al., 2000; Cohen et al., 2000; De Luca et al., 2001; Durant et al., 1999; Melnick et al., 2000; Meynard et al., 2000; Tural et al., 2000). The accumulation of retrospective and prospective data has led three expert panels to recommend the use of resistance testing in the treatment of HIV-infected patients (EuroGuidelines Group for HIV Resistance, 2001; Hirsch et al., 2000; US Department of Health and Human Services Panel on Clinical Practices for Treatment of HIV Infection, 2000) (Table 1). There have been several recent reviews on methods for assessing HIV-1 drug resistance (Demeter and Haubrich, 2001; Hanna and D’Aquila, 2001; Richman, 2000) and on the mutations associated with drug resistance (Deeks, 2001; Hammond et al., 1999; Loveday, 2001; Miller, 2001; Shafer et al., 2000b).
    [Show full text]
  • Next-Generation DNA Sequencing Informatics, 2Nd Edition
    This is a free sample of content from Next-Generation DNA Sequencing Informatics, 2nd edition. Click here for more information on how to buy the book. Index Page references followed by f denote figures. Page references followed by t denote tables. A Needleman–Wunsch (NW) algorithm, 49, 54, 110–113 overview, 109–110 Abeel, Thomas, 103 – – – ABI. See Applied Biosystems Inc. Smith Waterman (SW) algorithm, 38, 49, 62 63, 111 113 Ab initio genome annotation, 172, 178, 180t–181t Splign, 182 – TopHat, 43, 182 ab1PeakReporter software, 52 53 – A-Bruijn graph, 133–134 Alignment score, FASTA, 64 65 ABySS (Assembly by Short Sequencing), 134, 142, 147–153 Allele, 52, 354 Allele frequency, 76, 94, 193 effect of k-mer size and minimum pair number on assembly, fi 148–149, 149f Allele-speci c expression, 155, 298 overview of, 147–148 ALLPATHS, 134 quality of assembly, 149–153, 150t, 151f–152f ALN format, 92 α transcriptome assembly (Trans-ABySS), 158t, 160–161, 166 -diversity indices, 319 – – AceView database, 294, 295f Alternative splicing, 182, 293 296, 294f 295f Acrylamide gels Altschul, Stephen, 65 capillary tube, 4 Amazon Elastic Compute Cloud (EC2), 43, 254, 300, 315, – Sanger sequencing and, 2, 3–4 362 364, 366, 369 – ACT, 179t Amino acids, pairwise comparisons, 48 49 Adapter removal, 37–39, 39f, 43 Amplicons, 8, 30, 89, 204, 309, 312 Adapter Removal program, 38 Amplicon Variant Analyzer, 101 Affine gaps, 42, 110, 111–112 AmpliSeq Cancer Panel (Ion Torrent), 206 Algorithms Annotation, 75. See also Genome annotation – – – alignment, 49, 109–124, 129, 223, 338, 344 ChIP-seq peak, 240 242, 255, 259, 262 263, 262f 263f – assembly, 59, 127–129, 133–134, 338 proteogenomics and, 327 328, 328f – database searching, 113–115 of variants, 208 212 development, 364 ANNOVAR, 211 DNA fragment/genome assembly, 127–129, 133–134, 142 Anthrax, 141 dynamic programming, 110–124 Anti-sense RNA, 281 file compression, 79 Application programming interface (API), 368 Golay error-correcting, 31 Applied Biosystems Inc.
    [Show full text]
  • Comparison of DNA Sequence Assembly Algorithms Using Mixed Data Sources
    Comparison of DNA Sequence Assembly Algorithms Using Mixed Data Sources A Thesis Submitted to the College of Graduate Studies and Research in Partial Fulfillment of the Requirements for the degree of Master of Science in the Department of Computer Science University of Saskatchewan Saskatoon By Tejumoluwa Abegunde c Tejumoluwa Abegunde, April/2010. All rights reserved. Permission to Use In presenting this thesis in partial fulfilment of the requirements for a Postgraduate degree from the University of Saskatchewan, I agree that the Libraries of this University may make it freely available for inspection. I further agree that permission for copying of this thesis in any manner, in whole or in part, for scholarly purposes may be granted by the professor or professors who supervised my thesis work or, in their absence, by the Head of the Department or the Dean of the College in which my thesis work was done. It is understood that any copying or publication or use of this thesis or parts thereof for financial gain shall not be allowed without my written permission. It is also understood that due recognition shall be given to me and to the University of Saskatchewan in any scholarly use which may be made of any material in my thesis. Requests for permission to copy or to make other use of material in this thesis in whole or part should be addressed to: Head of the Department of Computer Science 176 Thorvaldson Building 110 Science Place University of Saskatchewan Saskatoon, Saskatchewan Canada S7N 5C9 i Abstract DNA sequence assembly is one of the fundamental areas of bioinformatics.
    [Show full text]
  • Downloading and Will Run As Stand-Alone Software
    BMC Bioinformatics BioMed Central Software Open Access preAssemble: a tool for automatic sequencer trace data processing Alexei A Adzhubei*1,4, Jon K Laerdahl2 and Anna V Vlasova3 Address: 1Norwegian School of Veterinary Science, BasAM – Genetics, P.O. Box 8146 Dep, NO-0033 Oslo, Norway, 2Centre for Molecular Biology and Neuroscience (CMBN) Institute of Medical Microbiology, Rikshospitalet, NO-0027 Oslo, Norway, 3Engelhardt Institute of Molecular Biology, Vavilov St. 32, 117984 Moscow, Russia and 4The Biotechnology Centre of Oslo, University of Oslo, P.O. Box 1125 Blindern, NO-0317 Oslo, Norway Email: Alexei A Adzhubei* - [email protected]; Jon K Laerdahl - [email protected]; Anna V Vlasova - [email protected] * Corresponding author Published: 17 January 2006 Received: 02 August 2005 Accepted: 17 January 2006 BMC Bioinformatics 2006, 7:22 doi:10.1186/1471-2105-7-22 This article is available from: http://www.biomedcentral.com/1471-2105/7/22 © 2006 Adzhubei et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Trace or chromatogram files (raw data) are produced by automatic nucleic acid sequencing equipment or sequencers. Each file contains information which can be interpreted by specialised software to reveal the sequence (base calling). This is done by the sequencer proprietary software or publicly available programs. Depending on the size of a sequencing project the number of trace files can vary from just a few to thousands of files.
    [Show full text]
  • Basecalling, Alignment, Assembly and Deconvolution of Sanger
    Rausch et al. BMC Genomics (2020) 21:230 https://doi.org/10.1186/s12864-020-6635-8 SOFTWARE Open Access Tracy: basecalling, alignment, assembly and deconvolution of sanger chromatogram trace files Tobias Rausch1,2,3*† , Markus Hsi-Yang Fritz2†, Andreas Untergasser1,4† and Vladimir Benes1 Abstract Background: DNA sequencing is at the core of many molecular biology laboratories. Despite its long history, there is a lack of user-friendly Sanger sequencing data analysis tools that can be run interactively as a web application or at large-scale in batch from the command-line. Results: We present Tracy, an efficient and versatile command-line application that enables basecalling, alignment, assembly and deconvolution of sequencing chromatogram files. Its companion web applications make all functionality of Tracy easily accessible using standard web browser technologies and interactive graphical user interfaces. Tracy can be easily integrated in large-scale pipelines and high-throughput settings, and it uses state-of-the-art file formats such as JSON and BCF for reporting chromatogram sequencing results and variant calls. The software is open-source and freely available at https://github.com/gear-genomics/tracy, the companion web applications are hosted at https://www.gear-genomics.com. Conclusions: Tracy can be routinely applied in large-scale validation efforts conducted in clinical genomics studies as well as for high-throughput genome editing techniques that require a fast and rapid method to confirm discovered variants or engineered mutations. Molecular biologists benefit from the companion web applications that enable installation-free Sanger chromatogram analyses using intuitive, graphical user interfaces. Keywords: Chromatogram, PCR, Sanger sequencing, Alignment, Variant calling Background patch a reference sequence based on trace information.
    [Show full text]
  • Gap5—Editing the Billion Fragment Sequence Assembly James K
    Vol. 26 no. 14 2010, pages 1699–1703 BIOINFORMATICS ORIGINAL PAPER doi:10.1093/bioinformatics/btq268 Genome analysis Advance Access publication May 30, 2010 Gap5—editing the billion fragment sequence assembly James K. Bonfield∗ and Andrew Whitwham Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Cambridge, CB10 1SA, UK Associate Editor: Dmitrij Frishman ABSTRACT and memory footprint. However, the solutions typically employed Motivation: Existing sequence assembly editors struggle with the by these programs are only amenable for read-only access, with the volumes of data now readily available from the latest generation of exception of NGSView that can perform some minor editing tasks. DNA sequencing instruments. In addition to algorithmic efficiency, the large increase in Results: We describe the Gap5 software along with the data the number of DNA fragments has put a strain on our storage structures and algorithms used that allow it to be scalable. We requirements. By using data compression methods, the storage demonstrate this with an assembly of 1.1 billion sequence fragments burden can be greatly reduced, with the BAM file format being and compare the performance with several other programs. We one such recent example. When coupled with an index, compressed analyse the memory, CPU, I/O usage and file sizes used by Gap5. BAM files can be randomly accessed. Availability and Implementation: Gap5 is part of the Staden We present the Gap5 program: a sequence assembly viewer and Package and is available under an Open Source licence from http:// editor. This encompasses both base by base editing operations as staden.sourceforge.net. It is implemented in C and Tcl/Tk.
    [Show full text]
  • Download from Ftp:/ Matter of Fashion? Nat Rev Genet 2004, 5:63-69
    BMC Bioinformatics BioMed Central Software Open Access STAMP: Extensions to the STADEN sequence analysis package for high throughput interactive microsatellite marker design Lars Kraemer1,2, Bánk Beszteri2, Steffi Gäbler-Schwarz2, Christoph Held2, Florian Leese2,3, Christoph Mayer3, Kevin Pöhlmann2 and Stephan Frickenhaus*2 Address: 1Institut für Klinische Molekularbiologie, Universität Kiel, Arnold-Heller-Str 3, 24105 Kiel, Germany, 2Alfred Wegener Institute for Polar and Marine Research, Am Handelshafen 12, 27570 Bremerhaven, Germany and 3Animal Ecology, Evolution and Biodiversity, Ruhr University, 44780 Bochum, Germany Email: Lars Kraemer - [email protected]; Bánk Beszteri - [email protected]; Steffi Gäbler-Schwarz - [email protected]; Christoph Held - [email protected]; Florian Leese - [email protected]; Christoph Mayer - [email protected]; Kevin Pöhlmann - [email protected]; Stephan Frickenhaus* - [email protected] * Corresponding author Published: 30 January 2009 Received: 24 September 2008 Accepted: 30 January 2009 BMC Bioinformatics 2009, 10:41 doi:10.1186/1471-2105-10-41 This article is available from: http://www.biomedcentral.com/1471-2105/10/41 © 2009 Kraemer et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Microsatellites (MSs) are DNA markers with high analytical power, which are widely used in population genetics, genetic mapping, and forensic studies. Currently available software solutions for high-throughput MS design (i) have shortcomings in detecting and distinguishing imperfect and perfect MSs, (ii) lack often necessary interactive design steps, and (iii) do not allow for the development of primers for multiplex amplifications.
    [Show full text]
  • The Staden Package Manual Last Update on 22 October 2002
    The Staden Package Manual Last update on 22 October 2002 James Bonfield, Kathryn Beal, Mark Jordan, Yaping Cheng and Rodger Staden Copyright c 1999-2002, Medical Research Council, Laboratory of Molecular Biology. Permission is given to duplicate this manual in both paper and electronic forms. If you wish to charge more than the duplication costs, or wish to make edits to the manual, please contact the authors by email to [email protected]. i Short Contents 1 Sequence assembly and finishing using Gap4.................... 3 2 Searching for point mutations using pregap4 and gap4 .......... 207 3 Preparing readings for assembly using pregap4 ................ 223 4 Marking poor quality and vector segments of readings .......... 291 5 Screening Against Vector Sequences ........................ 293 6 Screening Readings for Contaminant Sequences ............... 305 7 Viewing and editing trace data using trev .................... 309 8 Analysing and comparing sequences using spin ................ 319 9 User Interface ......................................... 401 10 File Formats .......................................... 411 11 Man Pages ........................................... 445 References ............................................... 477 General Index ............................................. 479 File Index ................................................ 491 Variable Index ............................................ 493 Function Index ............................................ 495 ii The Staden Package Manual iii Table
    [Show full text]