DOCSLIB.ORG

A Novel Non Radioactive PCR-DNA Probe for the Detection of Aflatoxin Producing Aspergillus Species from Major Food Crops Grown in India*

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Novel Non Radioactive PCR-DNA Probe for the Detection of Aflatoxin Producing Aspergillus Species from Major Food Crops Grown in India* Advances in Microbiology, 2012, 2, 577-586 doi:10.4236/aim.2012.24075 Published Online December 2012 (http://www.SciRP.org/journal/aim) A Novel Non Radioactive PCR-DNA Probe for the Detection of Aflatoxin Producing Aspergillus Species from * Major Food Crops Grown in India S. R. Priyanka, M. Venkata Ramana, K. Balakrishna, H. S. Murali, H. V. Batra# Division of Microbiology, Defense Food Research Laboratory, Siddarthanagar, India Email: #[email protected] Received September 13, 2012; revised October 18, 2012; accepted October 27, 2012 ABSTRACT In the present study, a novel non radioactive digoxigenen labelled PCR-DNA probe was developed targeting nor-1 gene to assess the contamination of aflatoxigenic Aspergillus species in food grain samples from Southern parts of India. The sensitivity of developed PCR-DNA probe was determined to be 10 pg of genomic DNA and 1 pg of purified PCR product. The specificity of the DNA probe was validated by testing against an array of Aspergillus, Fusarium and Peni- cillium spp. A total of 89 Aspergillus isolates were recovered from 152 grain samples of maize, paddy, and groundnut. Among them, maize had the highest (90%) incidence of toxigenic Aspergillus species. When developed PCR-DNA probe was evaluated onto pure cultures of toxigenic and nontoxigenic Aspergillus species, 60 samples were positive for the nor-1 gene probe. DNA probe results unequivocally matched with the HPLC analysis. In conclusion, the novel PCR-DNA probe developed in this study may find its application in rapid detection of aflatoxin-producing Aspergillus isolates from contaminated cereal grains. Keywords: AFB1-Aflatoxin B1; HPLC-High Performance Liquid Chromatography; Nor-1; Norsolorinic Acid Synthase; PCR-Polymerase Chain Reaction 1. Introduction always straight-forward. Molecular techniques have also been widely applied for distinguishing aflatoxigenic and Aflatoxins are common mycotoxins in agriculture and non-aflatoxigenic strains of Aspergillus by targeting one food commodities causing serious health hazards to hu- or several genes involved in the aflatoxin biosynthetic mans and animals leading to great economic losses. pathway with the ability/inability to produce aflatoxins. Among the aflatoxin group produced by Aspergillus spe- Polymerase Chain Reaction (PCR) methods have been cies, Aflatoxin B1 is most potent carcinogen and it was developed for detection of aflatoxigenic fungi. In this classified as group 1 carcinogen by the International respect, several primers have been designed for several Agency for Research on cancer [1]. Although aflatoxin- genes in the biosynthetic pathways of aflatoxins; for production ability has been detected in various species of example, afl, nor, omt, ord, tub, ver [5-9]. It has been the Aspergillus genus, inside and outside the Flavi group, demonstrated that most of the 25 identified genes clus- Aspergillus flavus and Aspergillus parasiticus remain the tered within a specific 70-kb region of the fungal genome most important and representative aflatoxin producers are involved in aflatoxin biosynthesis [10]. Among them, occurring naturally in food commodities [2]. Several nor-1 gene encodes an enzyme that catalyses the ketore- mycotoxicoses cases in humans and animals have been duction of norsolorinic acid (the first stable path-way reported due to the consumption of mycotoxin contami- intermediate) to averantin, plays a major role in aflatoxin nated food and feed [3]. biosynthesis [11]. A large number of probe-based meth- Because of the toxic and potent carcinogenic proper- ods have already been developed for the detection of ties of aflatoxins, many developed countries have estab- various food borne bacterial pathogens and mycotoxi- lished very stringent regulations limiting the maximum genic fungi [12,13]. In the present study, a novel non- allowable amount of aflatoxins in food and feed [4]. radioactive digoxigenen labelled PCR-DNA probe was Classical mycological analysis based on morphological developed targeting nor-1 gene to assess the contamina- and biochemical characters is time-consuming and not tion of aflatoxigenic Aspergillus species in contaminated * food grain samples. To know the incidence of toxigenic Authors do not having any conflict of interest in present study. #Corresponding author. Aspergillus species and aflatoxin concentrations, a sur- Copyright © 2012 SciRes. AiM 578 S. R. PRIYANKA ET AL. vey was conducted among the cereal grain growing re- carried out with minor modifications of Ramana et al. gions in Southern India. Developed PCR-DNA probe [14]. The DNA was dissolved in 50 µL of 2 mM Tris- was evaluated on to an array of fungal species recovered EDTA and stored at –20˚C. DNA concentrations were from contaminated food grains. For practical usefulness, determined using a NanoDrop-ND-1000 spectrophoto- the developed PCR-DNA probe was co evaluated with meter (Nanodrop Technologies, Wilmington, USA). the chemical analysis of aflatoxins by HPLC. 2.3. Species Specific PCR Assays: Primers and 2. Material and Methods Polymerase Chain Reaction (PCR) 2.1. Fungal Strains, Media and Culture Conditions Conditions Species specific PCR assays were carried out by using The list of Standard strains used in the present study was reported primers PEPO1, PEPO2 and AnF, AnR were given in (Table 1). Standard fungal strains were obtained used for specific detection of A. flavus and A. niger re- from culture collection centers at the Microbial Type spectively [28,29]. Primer sequence and references were Culture Collection (MTCC), Chandigarh, the National given in (Table 2). Collection of Industrial Microorganisms (NCIM), Pune and the Indian Type culture Collection (ITCC), New 2.4. Design of Nor-1 Gene Specific Delhi, India. Aspergillus isolates were recovered from Oligonucleotide Primers and PCR Assay infected food grains (maize, paddy and groundnut) col- One set of oligonucleotide primers were designed target- lected from different regions of Southern India including ing nor-1 gene involved in aflatoxin biosynthesis for Andhra Pradesh, Kerela, Karnataka and Tamilnadu. A developing PCR-DNA probe. The nor-1 gene sequence total of 62 maize, 50 paddy and 40 groundnut samples was obtained from NCBI database (accession No. AY- were subjected to standard blotter method (International 510451.1). Gene runner software, version 3.1 Seed Testing Association. 1996) to assess the incidence (www.generunner.com) was used to design optimal of Aspergillus species and were sub cultured on to potato primers: NOR1 F dextrose agar (PDA; Himedia, Mumbai, India) for 7 days 5’ACCGCTACGCCGGCGCTCTCGGCAC 3’ and NOR at 25˚C and single spore cultures were lyophilized and 1 R 5’GTTGGCCGCCAGCTTCGACACTCCG 3’. PCR maintained at 4˚C. amplification was performed in a 20 μL reaction volume with 0.5 μM each forward and reverse primers, 2 μL of 2.2. Molecular Detection of Aspergillus Species 10 × PCR buffer, 1.5 mM of MgCl2, 80 μM of each DNA Extraction dNTP’s, and 1 U of Taq polymerase (MBI Fermentas) in The DNA isolation from standard strains and grains was Eppendorf master thermal cycler (Hamburg, Germany). Table 1. Standard isolates used in this study. S No. Strain name and source DNA probe result HPLC result 1 Aspergillus flavus ATCC 46283 + + 2 Aspergillus flavus NCIM 152 + + 3 Aspergillus flavus NCIM 645 + + 4 Aspergillus flavus NCIM 650 + + 5 Aspergillus flavus MTCC 2798 + + 6 Aspergillus Parasiticus MTCC 2797 + + 7 Aspergillus Parasiticus MTCC 2796 + + 8 Aspergillus parasiticus NCIM 898 + + 9 Aspergillus niger MTCC 9687 – – 10 Fusarium moniliforme MTCC 156 – – 11 Fusarium sporotrichoides MTCC 2081 – – 12 Fusarium graminearum MTCC 2089 – – 13 Fusarium verticelloides MTCC 3693 – – 14 Penicillium chrysogenum MTCC 6479 – – Copyright © 2012 SciRes. AiM S. R. PRIYANKA ET AL. 579 Table 2. Primers used in this study. Sl. No Primer name Sequence (5’-3’) Targeted gene TM Target organism Size (bp) References PEPO1 CGACGTCTACAAGCCTTCTGGAAA Aspergillopep-sin Lagotheti et al., 1 56˚C A. flavus 200 PEPO2 CAGCAGACCGTCATTGTTCTTGTC 1st exon 2009 [28] ANF CAGTCGTCCAGTACCCCTAAC Sartori et al., 2 RAPD marker 56˚C A. niger 372 ANR GAGCGAGGCTGATCTAAGT 2006 [29] A standard protocol was used to perform nor-1 gene PCR. membranes were then washed in 50 mL 0.5 × SSC, 0.1% PCR program consisted of an initial denaturation of 4 SDS (pre-warmed to wash temperature) at 58˚C under min at 94˚C followed by 30 cycles denaturation at 94˚C constant agitation. After hybridization and stringent for 40 sec, annealing at 58˚C for 1 min and extension at washes, the membrane was rinsed briefly (1 - 5 min) in 72˚C for 90 seconds. A final extension of 72˚C for 5 min 50 mL washing buffer and incubated for 30 min in 50 was given at the end of the PCR reaction. The amplified mL blocking solution then incubated for another 30 min product was examined by 1% agarose gel electrophoresis in 50 mL antibody solution. After incubation membrane under UV. was washed twice for 15 min in 50 mL washing buffer and then equilibrated for 2 - 5 min in 50 mL detection 2.5. DNA Probe Preparation buffer. The membrane was incubated in 50 mL freshly prepared colour substrate solution in a dark colored con- The DNA probe was synthesized by PCR amplification tainer with a lid in dark cabinet/room. During colour de- of nor-1 gene from the A. flavus. The PCR amplicon was velopment the container was not shaken. The membranes purified using the QIAQuick PCR purification kit were exposed to light for short time periods for colour (Qiagen, Germany) and labeled by randomly priming development monitoring. The reaction was stopped when with alkali label Digoxigenin-11-dUTP nucleotide fol- the desired band intensities were achieved, by washing lowing the manufacturer’s instructions (Roche Diagnos- the membrane for 5 min with distilled water and further tics, India). Briefly, a 15 μL volume of purified nor-1 documented. gene PCR amplicon was boiled for 10 min and immedi- ately chilled in ice to obtain completely denatured 2.7. Specificity and Sensitivity of PCR-DNA strands.
Load more

Recommended publications
  • <I>Aspergillus Flavus</I> and <I>Aspergillus Parasiticus</I
    1395 Journal of Food Protection, Vol. 58, No. 12, Pages 1395-1404 Copyrighl©, International Association of Milk, Food and Environmental Sanitarians Aspergillus flavus and Aspergillus parasiticus: Aflatoxigenic Fungi of Concern in Foods and Feedst: A Review HASSAN GOURAMA* and LLOYD B. BULLERMAN* Department of Food Science and Technology, University of Nebraska, Lincoln, Nebraska 68583-0919 USA Downloaded from http://meridian.allenpress.com/jfp/article-pdf/58/12/1395/1665895/0362-028x-58_12_1395.pdf by guest on 02 October 2021 (MS# 91-230: Received 22 December 19911Accepted 15 May 1995) ABSTRACT isolates are still used as specific names, e.g., Aspergillus capitatus, Aspergillus niger, etc. (98). Aspergillus are com- Aspergillusflavus and the closely related subspeciesparasiticus have long been recognized as major contaminants of organic and mon saprobic molds, which grow in a wide range of natural nonorganic items. A. flavus, a common soil fungus, can infest a wide substrates and climatic conditions. Austwick (8) reported that range of agricultural products. Some A. flavus varieties produce one conidial head may produce up to 50,000 spores. Aspergil- aflatoxins, which are carcinogenic toxins that induce liver cancer in lus spp. are of particular importance to humans. Although laboratory animals. A.flavus var.flavus, A.flavus subsp. parasiticus, many Aspergillus species are considered pathogens or spoil- and A. nomius share the ability to produce aflatoxins. Identification age organisms, many others are beneficial. Some species are of the A. flavus species group is mainly based on the color and used to prepare fermented foods (57). Aspergillus spp. can macroscopic and microscopic characteristics of the fungus.
    [Show full text]
  • What Threatens the Safety of Almonds?
    OCTOBER 2020 ALL ABOUT ALMONDS FOOD SAFETY WHAT THREATENS FOOD SAFETY IN ALMONDS1 Chemical contamination CONTENTS Chemical contaminants include pesticide residues, allergens and mycotoxins. Aflatoxins are a specific form of mycotoxin. Pesticide residues are minimised by the correct use of registered (or permitted) Page 1: Aflatoxins - chemicals contaminants of concern chemicals. Worldwide, nut aflatoxins are of concern. Aflatoxins are natural but toxic by-products of fungi. They are odourless and Page 2: Risk reduction and prevention colourless, and cannot be visually detected in a food product. They may enter the almond food chain in the orchard, in stockpiles or in Page 4: Biological contaminant - Salmonella storage, and persist in finished, raw product. Page 5: Orchard guidelines for aflatoxin and Biological contamination Salmonella management Biological contaminants include parasites and pathogens that are usually fungal, viral, or bacterial in nature. The most important biological food safety contaminants of almonds are bacterial - Introduction Salmonella spp. and Escherichia coli (E. coli). Both are indicative of food Although almonds are not a readily perishable commodity, they are, exposure to faecal material. These organisms have serious human like other fresh foods, subject to contamination of food safety concern. health consequences, and therefore all food production and handling Almond contaminants are categorised as being chemical, biological, or management must ensure such exposure is minimised. physical in nature. Physical contamination The ‘cost’ of contaminated nuts is multi-faceted. Not only is there a Foreign matter of concern in almonds is that which is solid, and capable potential human cost in terms of health (and occasionally, life), but also of causing human injury or illness, e.g.
    [Show full text]
  • Identification and Nomenclature of the Genus Penicillium
    Downloaded from orbit.dtu.dk on: Dec 20, 2017 Identification and nomenclature of the genus Penicillium Visagie, C.M.; Houbraken, J.; Frisvad, Jens Christian; Hong, S. B.; Klaassen, C.H.W.; Perrone, G.; Seifert, K.A.; Varga, J.; Yaguchi, T.; Samson, R.A. Published in: Studies in Mycology Link to article, DOI: 10.1016/j.simyco.2014.09.001 Publication date: 2014 Document Version Publisher's PDF, also known as Version of record Link back to DTU Orbit Citation (APA): Visagie, C. M., Houbraken, J., Frisvad, J. C., Hong, S. B., Klaassen, C. H. W., Perrone, G., ... Samson, R. A. (2014). Identification and nomenclature of the genus Penicillium. Studies in Mycology, 78, 343-371. DOI: 10.1016/j.simyco.2014.09.001 General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. available online at www.studiesinmycology.org STUDIES IN MYCOLOGY 78: 343–371. Identification and nomenclature of the genus Penicillium C.M.
    [Show full text]
  • (<I>Arachis Hypogaea</I> L.) and Groundnut Cake in Eastern
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln U.S. Department of Agriculture: Agricultural Publications from USDA-ARS / UNL Faculty Research Service, Lincoln, Nebraska 2016 Aspergillus and aflatoxin in groundnut (Arachis hypogaea L.) and groundnut cake in Eastern Ethiopia Abdi Mohammed Haramaya University, [email protected] Alemayehu Chala Hawassa University Mashilla Dejene Haramaya University Chemeda Fininsa Haramaya University David A. Hoisington University of Georgia, [email protected] See next page for additional authors Follow this and additional works at: https://digitalcommons.unl.edu/usdaarsfacpub Part of the Agriculture Commons, and the Agronomy and Crop Sciences Commons Mohammed, Abdi; Chala, Alemayehu; Dejene, Mashilla; Fininsa, Chemeda; Hoisington, David A.; Sobolev, Victor S.; and Arias, R. S., "Aspergillus and aflatoxin in groundnut (Arachis hypogaea L.) and groundnut cake in Eastern Ethiopia" (2016). Publications from USDA-ARS / UNL Faculty. 1809. https://digitalcommons.unl.edu/usdaarsfacpub/1809 This Article is brought to you for free and open access by the U.S. Department of Agriculture: Agricultural Research Service, Lincoln, Nebraska at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Publications from USDA-ARS / UNL Faculty by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Authors Abdi Mohammed, Alemayehu Chala, Mashilla Dejene, Chemeda Fininsa, David A. Hoisington, Victor S. Sobolev, and R. S. Arias This article is available at DigitalCommons@University of Nebraska - Lincoln: https://digitalcommons.unl.edu/ usdaarsfacpub/1809 FOOD ADDITIVES & CONTAMINANTS: PART B, 2016 VOL. 9, NO. 4, 290–298 http://dx.doi.org/10.1080/19393210.2016.1216468 Aspergillus and aflatoxin in groundnut (Arachis hypogaea L.) and groundnut cake in Eastern Ethiopia Abdi Mohammeda, Alemayehu Chalab, Mashilla Dejenea, Chemeda Fininsaa, David A.
    [Show full text]
  • Aflatoxin B1 Production by Aspergillus Parasiticus and Strains Of
    Food Control 43 (2014) 121e128 Contents lists available at ScienceDirect Food Control journal homepage: www.elsevier.com/locate/foodcont Aflatoxin B1 production by Aspergillus parasiticus and strains of Aspergillus section Nigri in currants of Greek origin Paraskevi Kostarelou a, Alexandros Kanapitsas a, Ioanna Pyrri b, Evangelia Kapsanaki-Gotsi b, Panagiota Markaki a,* a Department of Food Chemistry, Faculty of Chemistry, National and Kapodistrian University of Athens, Panepistimiopolis Zografou, GR-15784 Athens, Greece b Department of Ecology and Systematics, Faculty of Biology, National and Kapodistrian University of Athens, Athens, Greece article info abstract Article history: Aflatoxin B1 (AFB1) mostly produced by Aspergillus flavus and Aspergillus parasiticus, is an extremely toxic Received 4 November 2013 and carcinogenic metabolite. Currants are used in the Mediterranean diet as a food with antioxidant Received in revised form properties. Four strains of Aspergillus section Nigri have been isolated from currants originated from Crete 28 January 2014 and Corinth. In this study AFB production by A. parasiticus and the four strains of Aspergillus section Nigri Accepted 8 February 2014 1 in Cretan and Corinthian currants (Vitis vinifera L.) is investigated. AFB determination was performed by Available online 17 March 2014 1 HPLCeFID. Results revealed that the four strains Aspergillus section Nigri, as well as the aflatoxigenic À1 strain A. parasiticus produced AFB1 (0.0052e1.31 mg AFB1 15 g , corresponding to 0.0003e0.087 mg Keywords: À1 AFB1 g ) in both type of currants (Cretan and Corinthian) on the 12th day of observation. Moreover, Aflatoxin B1 Aspergillus parasiticus AFB1 production, by A. parasiticus in the synthetic Yeast Extract Sucrose (YES) medium was also studied.
    [Show full text]
  • Client Name Presentation Title
    DISEASE AND AFLATOXIN MANAGEMENT UPDATE Room 308-309 | December 7 2017 CEUs – New Process Certified Crop Advisor (CCA) Pest Control Advisor (PCA), Qualified Applicator (QA), Private Applicator (PA) • Sign in and out of each session you attend. • Pickup scantron at the start of the day at first • Pickup verification sheet at conclusion of each session you attend; complete form. session. • Sign in and out of each session you attend. • Repeat this process for each session, and each day you wish to receive credits. • Pickup verification sheet at conclusion of each session. • Turn in your scantron at the end of the day at the last session you attend. Sign in sheets and verification sheets are located at the back of each session room. AGENDA • Bob Curtis, Almond Board of California, moderator • Mohammad Yaghmour, UCCE Kern Co. • Jim Adaskaveg, University of Riverside • Themis Michailides, UC Davis/Kearney 3 CAUSAL AGENTS OF ALMOND HULL ROT Mohammad Yaghmour, Orchard Systems Advisor, UCCE Kern Co. DISTRIBUTION OF THE DISEASE IN CALIFORNIA • The disease affects almond orchards in all major almond production areas including Kern County with approximately 217,000 of bearing acres CAUSAL AGENTS AND SOURCES OF INOCULUM Monilinia spp. Rhizopus stolonifer Infected almond and stone fruit twigs, fruits, mummies, etc Soil SYMPTOMS AND SIGNS OF HULL ROT • When the hull is infected and disease H S progress, leaves near the infected fruit S starts to dry and shrivel • Monilinia: Infected hull has a brown area on the outside and either tan fungal growth in the brown area on the inside or outside of the hull • Rhizopus: Black fungal growth on the inside of the hull between the hull and the shell.
    [Show full text]
  • Aspergillus, Its Sexual States and the New International Code of Nomenclature
    Mycologia, 106(5), 2014, pp. 1051–1062. DOI: 10.3852/14–060 # 2014 by The Mycological Society of America, Lawrence, KS 66044-8897 Aspergillus, its sexual states and the new International Code of Nomenclature John I. Pitt names for their different asexual (anamorph) and CSIRO Animal, Food and Health Sciences, North Ryde, sexual (teleomorph) states. Among the changes NSW 2113, Australia described in the ICN are two aimed at guiding John W. Taylor1 mycologists as they choose one name from among Department of Plant and Microbial Biology, University the several possible asexual and sexual names. These of California, Berkeley, California 94720-3102 are reproduced below: ‘‘Art. 59.1 Note 2. Previous editions of this Code Abstract: The newly adopted International Code of provided for separate names for mitotic asexual Nomenclature for algae, fungi and plants (ICN) morphs (anamorphs) of certain pleomorphic fungi demands that dimorphic fungi, in particular those and required that the name applicable to the whole with both sexual and asexual names, now bear a single fungus be typified by a meiotic sexual morph name. Although priority is no longer associated with (teleomorph). Under the current Code, however, the mode of reproduction, the ICN requires justifica- all legitimate fungal names are treated equally for tion for choosing an asexual name over an existing the purposes of establishing priority, regardless of sexual one. The phylogenetic approach that made the life-history stage of the type (but see Art. 57.2; dual nomenclature for fungi obsolete can be used to see also Art. 14.13). help choose names for large groups of fungi that are ‘‘[Art.] 57.2.
    [Show full text]
  • <I>Aspergillus</I> Section
    702 Journal of Food Protection, Vol. 76, No. 4, 2013, Pages 702–706 doi:10.4315/0362-028X.JFP-12-431 Research Note Distribution and Mycotoxigenic Potential of Aspergillus Section Nigri Species in Naturally Contaminated Almonds JEFFREY D. PALUMBO* AND TERESA L. O’KEEFFE U.S. Department of Agriculture, Agricultural Research Service, Plant Mycotoxin Research Unit, Albany, California 94710, USA MS 12-431: Received 28 September 2012/Accepted 9 December 2012 ABSTRACT In a previous study, inedible almond pick-out samples were assayed for aflatoxin and aflatoxigenic Aspergillus species. These samples contained high populations of black-spored Aspergillus section Nigri species. To investigate whether these species may contribute to the total potential mycotoxin content of almonds, Aspergillus section Nigri strains were isolated from these samples and assayed for ochratoxin A (OTA) and fumonisin B2 (FB2). The majority of isolates (117 strains, 68%) were identified as Aspergillus tubingensis, which do not produce either mycotoxin. Of the 47 Aspergillus niger and Aspergillus awamori isolates, 34 strains (72%) produced FB2 on CY20S agar, and representative strains produced lower but measurable amounts of FB2 on almond meal agar. No OTA-producing strains of Aspergillus section Nigri were detected. Almond pick-out samples contained no measurable FB2, suggesting that properly dried and stored almonds are not conducive for FB2 production by resident A. niger and A. awamori populations. However, 3 of 21 samples contained low levels (,1.5 ng/g) of OTA, indicating that sporadic OTA contamination may occur but may be caused by OTA-producing strains of other Aspergillus species. The California almond industry produces 80% of the fumonisin B2 (FB2), one of several carcinogenic and world’s supply of almonds.
    [Show full text]
  • International Journal of Food Microbiology Aflatoxin B1 (AFB1)
    International Journal of Food Microbiology 296 (2019) 8–13 Contents lists available at ScienceDirect International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro Aflatoxin B1 (AFB1) production by Aspergillus flavus and Aspergillus parasiticus on ground Nyjer seeds: The effect of water activity and T temperature ⁎ Dawit Gizachewa, , Chih-Hsuan Changb, Barbara Szonyic, Sandra De La Torrea, Wei-tsyi Evert Tingb a Department of Chemistry and Physics, Purdue University Northwest, Indiana, USA b Department of Biological Sciences, Purdue University Northwest, Indiana, USA c Independent Consultant, Schererville, Indiana, USA ARTICLE INFO ABSTRACT Keywords: Nyjer oil seed cake supports high levels of aflatoxin B1 (AFB1) production. AFB1 is a secondary metabolite of Aflatoxin Aspergillus flavus and A. parasiticus, classified as a Class 1A carcinogen. The aim of this study was to determine the Nyjer seed effects of temperature (20, 27, and 35 °C) and water activity (0.82, 0.86, 0.90, 0.94, and 0.98 aw) on fungal Oil seed growth and AFB1 production of A. flavus and A. parasiticus on ground Nyjer seeds over a 30-day incubation Mycotoxin period. Aspergillus Linear regression models indicated that both fungal growth and AFB1 production were significantly influ- enced by water activity of Nyjer seeds and incubation temperature. The two fungi did not grow on Nyjer seeds at 0.82 aw at the three incubation temperatures. The most favorable growth conditions for both fungi were 0.90–0.98 aw at 27 °C or 0.90–0.94 aw at 35 °C. The optimum temperature for AFB1 production was 27 °C for both A.
    [Show full text]
  • Aflatoxin Biosynthesis, Genetic Regulation, Toxicity, And
    Journal of Fungi Review Aflatoxin Biosynthesis, Genetic Regulation, Toxicity, and Control Strategies: A Review Rahim Khan 1 , Farinazleen Mohamad Ghazali 1,*, Nor Ainy Mahyudin 2,3 and Nik Iskandar Putra Samsudin 1,4 1 Department of Food Science, Faculty of Food Science and Technology, University Putra Malaysia, Serdang 43400, Malaysia; [email protected] (R.K.); [email protected] (N.I.P.S.) 2 Department of Food Service and Management, Faculty of Food Science and Technology, University Putra Malaysia, Serdang 43400, Malaysia; [email protected] 3 Laboratory of Halal Science Research, Halal Products Research Institute, University Putra Malaysia, Serdang 43400, Malaysia 4 Laboratory of Food Safety and Food Integrity, Institute of Tropical Agriculture and Food Security, University Putra Malaysia, Serdang 43400, Malaysia * Correspondence: [email protected]; Tel.: +60-122-198-912 Abstract: Aflatoxins (AFs) are highly toxic and cancer-causing compounds, predominantly synthe- sized by the Aspergillus species. AFs biosynthesis is a lengthy process that requires as minimum as 30 genes grouped inside 75 kilobytes (kB) of gene clusters, which are regulated by specific transcrip- tion factors, including aflR, aflS, and some general transcription factors. This paper summarizes the status of research on characterizing structural and regulatory genes associated with AF production and their roles in aflatoxigenic fungi, particularly Aspergillus flavus and A. parasiticus, and enhances the current understanding of AFs that adversely affect humans and animals with a great emphasis on toxicity and preventive methods. Citation: Khan, R.; Ghazali, F.M.; Mahyudin, N.A.; Samsudin, N.I.P. Keywords: aflatoxins; biosynthetic pathway; genetic regulation; toxicity; control strategies Aflatoxin Biosynthesis, Genetic Regulation, Toxicity, and Control Strategies: A Review.
    [Show full text]
  • Trends in Phytochemical Research (TPR) Trends in Phytochemical Research (TPR)
    Trends Phytochem. Res. 3(1) 2019 3-52 ISSN: 2588-3631 (Online) ISSN: 2588-3623 (Print) Trends in Phytochemical Research (TPR) Trends in Phytochemical Research (TPR) Volume 3 Issue 1 March 2019 © 2019 Islamic Azad University, Shahrood Branch Journal Homepage: http://tpr.iau-shahrood.ac.ir Press, All rights reserved. Review Paper Bioactive essential oils from the Cameroonian rain forest: A review - Part II Jean Duplex Wansi1,2, , Norbert Sewald3, Lutfun Nahar2, Claire Martin4 and Satyajit Dey Sarker2 1Department of Chemistry, University of Douala, Faculty of Sciences, 24157 Douala, Cameroon ²School of Pharmacy and Biomolecular Sciences, Liverpool John Moores University, James Parsons Building, Byrom Street, Liverpool L3 3AF, UK ³Organic and Bioorganic Chemistry, Department of Chemistry, Bielefeld University, 33501 Bielefeld, Germany ⁴Department of Biological Sciences, Institute of Science and the Environment, St. John’s Campus. University of Worcester, Henwick Grove, Worcester, WR2 6AJ, UK ABSTRACT ARTICLE HISTORY Eighty-nine essential oil analyses carried out on Cameroonian plant material by gas Received: 17 March 2018 chromatography are reviewed, and structures of sixty one main oil compounds are Revised: 15 December 2018 presented. Plant samples had been collected all over the rainforest area and further Accepted: 12 February 2019 northwards, covering forty plant species belonging to ten families. For these plants, ePublished: 10 March 2019 common names, traditional use as well as bioactivity and toxicity of their essential oils in vitro and in vivo are compiled. Data show that oils from leaves, bark, roots, fruit, KEYWORDS rhizome or seeds display their own one to four main essential oil components. Each of them contributing more than 10% to over 90% of the oil´s volume, which sums up to Bioactivity species-unique essential oil fingerprints and decreasing similarity of these fingerprints Cameroon with increasing phylogenetic distance between species.
    [Show full text]
  • Antifungal Properties of Essential Oils and Some Constituents to Reduce Foodborne Pathogen
    Journal of Yeast and Fungal Research Vol. 1(1) pp. 001-008, February, 2010 Available online http://www.academicjournals.org/JYFR © 2010 Academic Journals Full Length Research Paper Antifungal properties of essential oils and some constituents to reduce foodborne pathogen Yaouba Aoudou1, Tatsadjieu Ngouné Léopold2*, Jazet Dongmo Pierre Michel1,3, Etoa François Xavier4 and Mbofung Carl Moses1 1Department of food Sciences and Nutrition, National Advanced School of Agro-industrial Sciences, University of Ngaoundere, P. O. Box 455 Ngaoundere, Cameroon. 2Laboratory of Microbiology, University Institute of Technology, University of Ngaoundere, P. O. Box 455 Ngaoundere, Cameroon. 3Faculty of Sciences, University of Douala, P. O. Box 24157, Douala, Cameroon. 4Department of Biochemistry, Faculty of Science, University of Yaounde I, P. O. Box 812, Yaounde, Centre, Cameroon. Accepted 15 December, 2009 Investigations were conducted to evaluate the antifungal activities of the essential oils of Lippia rugosa, Plectranthus glandulosus, Clausena anisata and Vepris heterophylla and some essential oils compounds as citral, geraniol, nerol, citronellol, fenchone, linalool, 1,8 cineol, nerolidol, terpen 4-ol and -terpinolene on mycelia growth of different strains of Aspergillus, Penicillium and Fusarium genus, common fungi causing spoilage of stored food product. The disc diffusion method was used to evaluate fungal growth inhibition at various concentrations. The strains of fungi exhibited similar susceptibilities (90 mm) to the action of L. rugosa essential oil and different susceptibilities (34 - 90 mm) to P. glandulosus, 0 to 44 mm to C. anisata and 0 to 30 mm to V. heterophylla essential oils. These inhibition halos varied from 0 to 84 mm according to each compound activity.
    [Show full text]