Srp55 Regulates a Splicing Network That Controls Human Pancreatic Beta Cell Function and Survival
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Deletion of Endoplasmic Reticulum Stress-Responsive Co-Chaperone P58ipk Protects Mice from Diet-Induced Steatohepatitis
Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2018 Deletion of endoplasmic reticulum stress-responsive co-chaperone p58IPK protects mice from diet-induced steatohepatitis Bandla, Harikrishna ; Dasgupta, Debanjali ; Mauer, Amy S ; Nozickova, Barbora ; Kumar, Swarup ; Hirsova, Petra ; Graham, Rondell P ; Malhi, Harmeet DOI: https://doi.org/10.1111/hepr.13052 Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-144890 Journal Article Accepted Version Originally published at: Bandla, Harikrishna; Dasgupta, Debanjali; Mauer, Amy S; Nozickova, Barbora; Kumar, Swarup; Hirsova, Petra; Graham, Rondell P; Malhi, Harmeet (2018). Deletion of endoplasmic reticulum stress-responsive co-chaperone p58IPK protects mice from diet-induced steatohepatitis. Hepatology Research, 48(6):479- 494. DOI: https://doi.org/10.1111/hepr.13052 Deletion of endoplasmic reticulum stress-responsive co-chaperone p58IPK protects mice from diet-induced steatohepatitis Harikrishna Bandla1, Debanjali Dasgupta1, Amy S. Mauer1, Barbora Nozickova2, Swarup Kumar3, Petra Hirsova1, Rondell P. Graham4, Harmeet Malhi1* 1. Division of Gastroenterology and Hepatology, Mayo Clinic, Rochester, MN 2. Universitatsspital Zurich, 8096, Ramistrasse 100, Zurich, Switzerland 3. Department of Medicine, Saint Vincent Hospital, 123 Summer St, Worcester, MA 4. Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, MN Corresponding author: Harmeet Malhi, M.B.B.S. Associate Professor of Medicine and Physiology Mayo Clinic College of Medicine 200 First Street SW Rochester, MN 55905 Tel: 507 284 0686 Fax: 507 284 0762 Email: [email protected] Funding: This work was supported by DK 97178, DK107402 and DK111378 (H.M.), the Robert and Elizabeth Strickland Career Development Award from the Division of Endocrinology (H.M.), the Gilead Sciences Research Scholars Program in Liver Disease (H.M.) and the Palumbo Foundation (H.M.), the Edward C. -
Computational Genome-Wide Identification of Heat Shock Protein Genes in the Bovine Genome [Version 1; Peer Review: 2 Approved, 1 Approved with Reservations]
F1000Research 2018, 7:1504 Last updated: 08 AUG 2021 RESEARCH ARTICLE Computational genome-wide identification of heat shock protein genes in the bovine genome [version 1; peer review: 2 approved, 1 approved with reservations] Oyeyemi O. Ajayi1,2, Sunday O. Peters3, Marcos De Donato2,4, Sunday O. Sowande5, Fidalis D.N. Mujibi6, Olanrewaju B. Morenikeji2,7, Bolaji N. Thomas 8, Matthew A. Adeleke 9, Ikhide G. Imumorin2,10,11 1Department of Animal Breeding and Genetics, Federal University of Agriculture, Abeokuta, Nigeria 2International Programs, College of Agriculture and Life Sciences, Cornell University, Ithaca, NY, 14853, USA 3Department of Animal Science, Berry College, Mount Berry, GA, 30149, USA 4Departamento Regional de Bioingenierias, Tecnologico de Monterrey, Escuela de Ingenieria y Ciencias, Queretaro, Mexico 5Department of Animal Production and Health, Federal University of Agriculture, Abeokuta, Nigeria 6Usomi Limited, Nairobi, Kenya 7Department of Animal Production and Health, Federal University of Technology, Akure, Nigeria 8Department of Biomedical Sciences, Rochester Institute of Technology, Rochester, NY, 14623, USA 9School of Life Sciences, University of KwaZulu-Natal, Durban, 4000, South Africa 10School of Biological Sciences, Georgia Institute of Technology, Atlanta, GA, 30032, USA 11African Institute of Bioscience Research and Training, Ibadan, Nigeria v1 First published: 20 Sep 2018, 7:1504 Open Peer Review https://doi.org/10.12688/f1000research.16058.1 Latest published: 20 Sep 2018, 7:1504 https://doi.org/10.12688/f1000research.16058.1 Reviewer Status Invited Reviewers Abstract Background: Heat shock proteins (HSPs) are molecular chaperones 1 2 3 known to bind and sequester client proteins under stress. Methods: To identify and better understand some of these proteins, version 1 we carried out a computational genome-wide survey of the bovine 20 Sep 2018 report report report genome. -
Edinburgh Research Explorer
Edinburgh Research Explorer International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list Citation for published version: Davenport, AP, Alexander, SPH, Sharman, JL, Pawson, AJ, Benson, HE, Monaghan, AE, Liew, WC, Mpamhanga, CP, Bonner, TI, Neubig, RR, Pin, JP, Spedding, M & Harmar, AJ 2013, 'International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list: recommendations for new pairings with cognate ligands', Pharmacological reviews, vol. 65, no. 3, pp. 967-86. https://doi.org/10.1124/pr.112.007179 Digital Object Identifier (DOI): 10.1124/pr.112.007179 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Pharmacological reviews Publisher Rights Statement: U.S. Government work not protected by U.S. copyright General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 02. Oct. 2021 1521-0081/65/3/967–986$25.00 http://dx.doi.org/10.1124/pr.112.007179 PHARMACOLOGICAL REVIEWS Pharmacol Rev 65:967–986, July 2013 U.S. -
Fkbp10 (NM 010221) Mouse Untagged Clone – MC201811 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MC201811 Fkbp10 (NM_010221) Mouse Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Fkbp10 (NM_010221) Mouse Untagged Clone Tag: Tag Free Symbol: Fkbp10 Synonyms: AI325255; FKBP-10; FKBP-65; Fkbp-rs1; Fkbp1-rs; Fkbp6; FKBP65; Fkbprp Vector: PCMV6-Kan/Neo E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 Fkbp10 (NM_010221) Mouse Untagged Clone – MC201811 Fully Sequenced ORF: >BC029546 sequence for NM_010221 GTCCGCTCTCACTGCCGGCGTCCCTGGTCTGGGCACCATGTTCCTTGTGGGGTCCTCCAGCCACACCCTC CATCGGCTCCGCATACTGCCGTTGCTGTTGCTTCTACAGACCTTGGAGAGGGGACTGGGCCGTGCCAGCC CGGCCGGAGCCCCCTTGGAAGATGTGGTCATCGAGAGATACCACATCCCTCGGGCCTGTCCCCGAGAAGT GCAGATGGGGGATTTTGTGCGTTACCACTACAATGGCACTTTCGAAGACGGGAAAAAGTTTGACTCCAGC TATGACCGTAGCACCCTGGTGGCCATCGTTGTGGGCGTAGGCCGCCTCATCACCGGCATGGACCGGGGTC TCATGGGCATGTGTGTCAACGAGCGCCGCCGCCTCATTGTGCCTCCCCACCTGGGCTACGGCAGCATCGG TGTGGCGGGCCTCATCCCCCCTGATGCCACCCTCTATTTTGACGTGGTCCTGCTGGACGTGTGGAACAAA GCAGACACGGTGCAGTCAACTATCCTCCTGCGCCCTCCCTACTGCCCCCGAATGGTGCAGAACAGTGACT TTGTGCGCTATCACTACAATGGCACTCTGCTGGATGGCACTGCCTTTGACAACAGCTACAGTAGGGGAGG CACTTATGACACCTACATCGGCTCTGGTTGGCTGATCAAAGGCATGGACCAGGGGCTGCTGGGCATGTGC -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen, -
Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short
bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. -
Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice
University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia. -
Snf2h-Mediated Chromatin Organization and Histone H1 Dynamics Govern Cerebellar Morphogenesis and Neural Maturation
ARTICLE Received 12 Feb 2014 | Accepted 15 May 2014 | Published 20 Jun 2014 DOI: 10.1038/ncomms5181 OPEN Snf2h-mediated chromatin organization and histone H1 dynamics govern cerebellar morphogenesis and neural maturation Matı´as Alvarez-Saavedra1,2, Yves De Repentigny1, Pamela S. Lagali1, Edupuganti V.S. Raghu Ram3, Keqin Yan1, Emile Hashem1,2, Danton Ivanochko1,4, Michael S. Huh1, Doo Yang4,5, Alan J. Mears6, Matthew A.M. Todd1,4, Chelsea P. Corcoran1, Erin A. Bassett4, Nicholas J.A. Tokarew4, Juraj Kokavec7, Romit Majumder8, Ilya Ioshikhes4,5, Valerie A. Wallace4,6, Rashmi Kothary1,2, Eran Meshorer3, Tomas Stopka7, Arthur I. Skoultchi8 & David J. Picketts1,2,4 Chromatin compaction mediates progenitor to post-mitotic cell transitions and modulates gene expression programs, yet the mechanisms are poorly defined. Snf2h and Snf2l are ATP-dependent chromatin remodelling proteins that assemble, reposition and space nucleosomes, and are robustly expressed in the brain. Here we show that mice conditionally inactivated for Snf2h in neural progenitors have reduced levels of histone H1 and H2A variants that compromise chromatin fluidity and transcriptional programs within the developing cerebellum. Disorganized chromatin limits Purkinje and granule neuron progenitor expansion, resulting in abnormal post-natal foliation, while deregulated transcriptional programs contribute to altered neural maturation, motor dysfunction and death. However, mice survive to young adulthood, in part from Snf2l compensation that restores Engrailed-1 expression. Similarly, Purkinje-specific Snf2h ablation affects chromatin ultrastructure and dendritic arborization, but alters cognitive skills rather than motor control. Our studies reveal that Snf2h controls chromatin organization and histone H1 dynamics for the establishment of gene expression programs underlying cerebellar morphogenesis and neural maturation. -
140503 IPF Signatures Supplement Withfigs Thorax
Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
G Protein-Coupled Receptors
G PROTEIN-COUPLED RECEPTORS Overview:- The completion of the Human Genome Project allowed the identification of a large family of proteins with a common motif of seven groups of 20-24 hydrophobic amino acids arranged as α-helices. Approximately 800 of these seven transmembrane (7TM) receptors have been identified of which over 300 are non-olfactory receptors (see Frederikson et al., 2003; Lagerstrom and Schioth, 2008). Subdivision on the basis of sequence homology allows the definition of rhodopsin, secretin, adhesion, glutamate and Frizzled receptor families. NC-IUPHAR recognizes Classes A, B, and C, which equate to the rhodopsin, secretin, and glutamate receptor families. The nomenclature of 7TM receptors is commonly used interchangeably with G protein-coupled receptors (GPCR), although the former nomenclature recognises signalling of 7TM receptors through pathways not involving G proteins. For example, adiponectin and membrane progestin receptors have some sequence homology to 7TM receptors but signal independently of G-proteins and appear to reside in membranes in an inverted fashion compared to conventional GPCR. Additionally, the NPR-C natriuretic peptide receptor has a single transmembrane domain structure, but appears to couple to G proteins to generate cellular responses. The 300+ non-olfactory GPCR are the targets for the majority of drugs in clinical usage (Overington et al., 2006), although only a minority of these receptors are exploited therapeutically. Signalling through GPCR is enacted by the activation of heterotrimeric GTP-binding proteins (G proteins), made up of α, β and γ subunits, where the α and βγ subunits are responsible for signalling. The α subunit (tabulated below) allows definition of one series of signalling cascades and allows grouping of GPCRs to suggest common cellular, tissue and behavioural responses.