Increased ID2 Levels in Adult Precursor B Cells as Compared with Children Is Associated with Impaired Ig Locus Contraction and Decreased Bone Marrow This information is current as Output of September 27, 2021. Kristin Jensen, Magdalena B. Rother, Berit Sletbakk Brusletto, Ole K. Olstad, Hans Christian Dalsbotten Aass, Menno C. van Zelm, Peter Kierulf and Kaare M. Gautvik J Immunol 2013; 191:1210-1219; Prepublished online 3 July Downloaded from 2013; doi: 10.4049/jimmunol.1203462 http://www.jimmunol.org/content/191/3/1210 http://www.jimmunol.org/

Supplementary http://www.jimmunol.org/content/suppl/2013/07/03/jimmunol.120346 Material 2.DC1 References This article cites 51 articles, 22 of which you can access for free at: http://www.jimmunol.org/content/191/3/1210.full#ref-list-1 by guest on September 27, 2021 Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Increased ID2 Levels in Adult Precursor B Cells as Compared with Children Is Associated with Impaired Ig Locus Contraction and Decreased Bone Marrow Output

Kristin Jensen,*,† Magdalena B. Rother,‡,1 Berit Sletbakk Brusletto,*,1 Ole K. Olstad,* Hans Christian Dalsbotten Aass,* Menno C. van Zelm,‡ Peter Kierulf,* and Kaare M. Gautvik*,x

Precursor B cell production from bone marrow in mice and humans declines with age. Because the mechanisms behind are still unknown, we studied five precursor B cell subsets (ProB, PreBI, PreBII large, PreBII small, immature B) and their differentiation- stage characteristic gene expression profiles in healthy individual toddlers and middle-aged adults. Notably, the composition of the precursor B cell compartment did not change with age. The expression levels of several transcripts encoding V(D)J recombination Downloaded from factors were decreased in adults as compared with children: RAG1 expression was significantly reduced in ProB cells, and DNA- PKcs, Ku80, and XRCC4 were decreased in PreBI cells. In contrast, TdT was 3-fold upregulated in immature B cells of adults. Still, N-nucleotides, P-nucleotides, and deletions were similar for IGH and IGK junctions between children and adults. PreBII large cells in adults, but not in children, showed highly upregulated expression of the differentiation inhibitor, inhibitor of DNA binding 2 (ID2), in absence of changes in expression of the ID2-binding partner E2A. Further, we identified impaired Ig locus contraction in adult precursor B cells as a likely mechanism by which ID2-mediated blocking of E2A function results in reduced bone marrow http://www.jimmunol.org/ B cell output in adults. The reduced B cell production was not compensated by increased proliferation in adult immature B cells, despite increased Ki67 expression. These findings demonstrate distinct regulatory mechanisms in B cell differentiation between adults and children with a central role for transcriptional regulation of ID2. The Journal of Immunology, 2013, 191: 1210–1219.

ommitment and differentiation of early precursor B cells whereas the production of other hematopoietic lineages seems to to Ig-producing B lymphocytes is a key requirement for continue unchanged (9). With advancing age, the capacity to induce C a competent adaptive immune system. Each differentia- protective Ab responses decreases, leading to reduced ability to deal tion step is tightly controlled by integrated activities of multiple with new and previously encountered pathogens (10). Some studies by guest on September 27, 2021 transcription factors in a complex gene regulatory network (1). In in mice suggest that the impact of aging on lymphoid progenitors is fact, a handful of key transcription factors is used in multiple con- first manifested in hematopoietic stem cells (11, 12). Other studies texts and distinct combinations to initiate and maintain the com- link the waning B cell production in mice to the inability of im- mitment process throughout the lifespan of the B cell (2). mature B cells to replenish the peripheral compartments (6), to Production of B lymphocytes from bone marrow (BM) continues decreased transition of ProB cells into PreB cells (6, 13), and/or to throughout life. Similar to T lymphocytes (3), the precursor B cell microenvironmental changes causing altered Ig gene rearrange- pool is decreasing with age in both humans (4, 5) and mice (6–8), ments (14, 15). The question has also been raised whether specific transcriptionally regulated mechanisms obstruct B cell generation *Department of Medical Biochemistry, Oslo University Hospital, 0407 Oslo, Nor- with age, such as changes in expression of inhibitor of DNA binding † way; Department of Pediatrics, Oslo University Hospital, 0407 Oslo, Norway; 2 (ID2) (16–20), a physiological regulator of the essential transcrip- ‡Department of Immunology, Erasmus MC, University Medical Center Rotterdam, 3015GE Rotterdam, The Netherlands; and xInstitute of Basic Medical Sciences, tion factor E2A. E2A protein levels in mice have been reported to University of Oslo, 0407 Oslo, Norway decrease with age (17), but, to date, no age-related changes were 1M.B.R. and B.S.B. contributed equally to this study. found for ID2 protein using in vitro expanded ProB/early PreB cells Received for publication December 31, 2012. Accepted for publication May 29, from aged and young mice (16). 2013. In contrast to mouse studies, the effects of aging on human This work was supported by grants from Torsteds legat, Rakel og Otto Kr. Bruuns precursor B cell development have been scarcely studied to date. legat, and Olav Raagholt og Gerd Meidel Raagholts stiftelse for forskning. This work was also supported by ZonMW/NWO Veni Grant 916.110.90 (to M.C.v.Z.). Global gene expression has only been studied in successive mat- The microarray data cited in this article were deposited in the ArrayExpress database uration stages of precursor B cells in children (21) and adults (22), (http://www.ebi.ac.uk/arrayexpress/) under accession number E-MTAB-1422. separately. We have previously reported that the total pool of Address correspondence and reprint requests to Dr. Kristin Jensen or Dr. Menno C. van precursor B cells in human BM decreased rapidly during the first Zelm, Departments of Medical Biochemistry and Pediatrics, Oslo University Hospital, 2 y of life concomitantly with reduced expression of RAG1 (5). HF Ulleva˚l, 0407 Oslo, Norway (K.J.) or Department of Immunology, Erasmus MC, Dr. Molewaterplein 50, 3015 GE Rotterdam, The Netherlands. (M.C.v.Z.). E-mail addresses: Still, these studies were unable to address the issue of decreased [email protected] (K.J.) or [email protected] (M.C.v.Z.) BM output of B cells. Therefore, we analyzed precursor B cell The online version of this article contains supplemental material. subsets and their gene expression profiles in BM from healthy Abbreviations used in this article: BM, bone marrow; CDK, cyclin-dependent kinase; young children and adults. Through differentiation stage-dependent ID2, inhibitor of DNA binding 2; IRF, IFN regulatory factor; KREC, recombination analysis of five precursor B cell subsets and pairwise comparisons excision circles. between children and adults, we identified several mechanisms that Copyright Ó 2013 by The American Association of Immunologists, Inc. 0022-1767/13/$16.00 suggest tighter checkpoint control in adult precursor B cells. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1203462 The Journal of Immunology 1211

Materials and Methods DNA probe preparation and three-dimensional BM samples immunofluorescence in situ hybridization We obtained BM samples from healthy children aged 18 6 2 mo (mean 6 The three-dimensional DNA immunofluorescence in situ hybridization was range) and healthy adults aged 50 6 5 y (mean 6 range). The children were performed, as described previously (23, 24), with fosmid clones 761A10 and eligible for minor surgery, and the adults for elective orthopedic surgery. 3777B2 (BACPAC Resources, Oakland, CA), BAC clones 47P23, 101G24 Both groups were hematologically healthy, and none of the middle-aged (BACPAC Resources), and 3087C18 (Open Biosystems, Huntsville, AL) adults had active inflammatory disease requiring regular anti-inflammatory recognizing regions within the human IGH locus. Probes were either di- medication. Written informed consent was obtained using protocols ap- rectly labeled with Chromatide Alexa Fluor 488-5 dUTP or Chromatide proved by the Regional Medical Research Ethics Committee of Eastern Alexa Fluor 568-5 dUTP (Invitrogen) using Nick Translation Mix (Roche Norway (REK Øst, accession number 473-02132) (https://helseforskning. Diagnostics); or they were indirectly labeled using DIG-Nick Translation etikkom.no/). The study was performed according to the Norwegian Health Mix (Roche Diagnostics). Just prior to use, the probes were precipitated and Regulations. a hybridization mixture was prepared containing 600 ng each labeled probe, 4 mg human Cot-1 DNA (Invitrogen), 5 mg salmon sperm DNA dissolved in Isolation of CD10-positive cells 23 SSC, 50% formamide, and 10% dextran sulfate. The probes were BM aspirates (∼20 ml from children and 120 ml from adults) were subjected denatured at 75˚C for 5 min prior to hybridization. m 3 6 to Ficoll density gradient centrifugation (Ficoll-Paque PLUS). CD10+ pre- Approximately 100 l1 10 cells/ml suspension of freshly sorted cursor B cells were positively selected using streptavidin-coated Dynabeads cells was directly attached to poly(L-lysine)–coated coverslips. The cells FlowComp Flexi (Invitrogen Dynal AS, Oslo, Norway) and biotin-labeled were fixed in 4% paraformaldehyde; permeabilized in PBS, 0.1% Triton X- CD10 Ab (SN5c; Abcam, Cambridge, MA). Subsequently, five precursor 100, and 0.1% saponin solutions; and subjected to liquid nitrogen im- B cell subsets were purified from single individuals on a FACSAria cell mersion following incubation in PBS with 20% glycerol. The nuclear sorter (BD Biosciences) (Fig. 1A) after staining with the following Abs: membranes were permeabilized in PBS, 0.5% Triton X-100, and 0.5% IgM-FITC (G20-127), CD19-allophycocyanin (HIB19), CD20-PE (2H7), saponin prior to hybridization with the DNA probe mixture for 5 min in Downloaded from CD22-allophycocyanin (IS7), CD123-PE (6H6), CD10-PE-Cy7 (HI10a), a HYBrite machine at 75˚C. The coverslips were sealed with nail polish and CD34-PerCP (8G12). The membrane marker CD123 was used in com- and incubated for 48 h at 37˚C. Subsequently, the coverslips were washed bination with CD22 to distinguish precursor B cells from basophilic pro- and incubated with Cy5-conjugated mouse anti-digoxigenin Abs (Jackson genitor cells (CD1231), which also appear in the lymphogate. ImmunoResearch Laboratories) to detect digoxigenin-labeled probes. Fi- nally, the coverslips were washed, mounted on slides with 10 ml Prolong RNA isolation gold antifade reagent (Invitrogen), and sealed with nail polish.

Total RNA was extracted and purified from each precursor B cell subset Image acquisition, distance calculations, and statistics http://www.jimmunol.org/ using the miRNeasy Mini Kit (Qiagen) and Phase Lock Gel Heavy (5 PRIME, Hamburg, Germany). RNA was quantified with a NanoDrop ND- Pictures were captured with a Leica SP5 confocal microscope (Leica Microsystems). Using a 363 lens (NA 1.4), we acquired images of ∼70 1000 Spectrophotometer (Saveen Werner, Malmo¨, Sweden), and in case of m concentrations using the RiboGreen method (Invitrogen, Eugene, OR). serial optical sections spaced by 0.15 m. The data sets were deconvolved Quality was assessed with Agilent 2100 Bioanalyzer using either the and analyzed with Huygens Professional software (Scientific Volume Im- Agilent RNA 6000 Nano or Pico Kit (Agilent Technologies, Palo Alto, aging, Hilversum, The Netherlands). The three-dimensional coordinates of CA) depending on sample concentration. The samples concentrations the center of mass of each probe were input into Microsoft Excel, and the 5 distances separating each probe were calculated using the following equa- ranged from 3.9–149.5 ng/ml and from 6.4–9.9 (mean 8.4, n 39) for √ 2 2 2 2 2 2 Bioanalyzer RIN indicating high RNA purity and integrity. tion: (Xa Xb) +(Ya Yb) + (Za Zb) , where X, Y, Z are the coordinates of object a or b. Differences in distances between each two

Microarray analyses and statistical analysis of data groups of cells were performed with the nonparametric Mann–Whitney U by guest on September 27, 2021 test using GraphPad Prism version 5.0. Microarray analyses were performed on subsets from single individuals us- ing the GeneChip Human Exon 1.0 (Affymetrix, Santa Clara, CA). A quantity Quantitative RT-PCR for key differentially expressed amounting to 5 ng total RNA was used to generate cDNA with the Ovation transcripts PicoWTASystemprotocol (NuGEN).MinElute SpinColumns(Qiagen)were used for purification of amplified cDNA. Sense strand cDNA was generated TaqMan gene expression assays (384-well plates; Applied Biosystems) were from 3 mg cDNA with the WT-Ovation Exon Module Version 1.0 (NuGEN), used for quantitative PCR for selected differentially expressed genes. The according to the manufacturers’ protocols for whole genome gene expression arrays were run on the ViiA 7 real-time PCR system (Applied Biosystems). The relative mRNA expression was calculated with the comparative CT analysis. The resulting sense strand cDNA was fragmented and biotinylated 2DD CT b using the Encore Biotin Module (NuGEN). The labeled cDNA was hybrid- method (fold change = 2 ) using 2-microglobulin as endogenous ized on the array, washed, and stained. The arrays were scanned using the control (25). Additional primer/probe sets were used for ID2 that covered 9 Affymetrix Gene Chip Scanner 3000 7G. The scanned images were pro- the 5 end of the transcript (Supplemental Table I); two sets for exon I; and cessed using the Affymetrix GeneChip Command Console Software, and the one set for exon II, because the custom ID2 assay covered only the exon II CEL files were imported into Partek Genomics Suite software (Partek). The and III boundary, which was partially outside the protein-coding area. Robust Multichip Analysis algorithm was applied for generation of signal IGH and IGK junctional region analysis values and normalization. On each array, 21,989 transcripts could be detected. Transcripts were analyzed in core mode (see http://www.affymetrix. DNAwas isolated from sorted PreBI and small PreBII cells of healthy children com) using signal values of ,22.6 across arrays as threshold to filter for low or healthy adults using a GenElute genomic DNA extraction kit (Sigma- and nonexpressed genes yielding 15,830 expressed genes. For expression Aldrich, St. Louis, MO). Multiplex PCR was performed to amplify com- comparisons of different groups, profiles were compared using a one-way plete IGH gene rearrangements from PreBI cells and IGK gene rearrange- ANOVA model. The results were expressed as fold change. Gene lists were ments from small PreBII cells with V subgroup-specific forward primers and generated with the criteria of fold change $2 and p values , 0.05. For a consensus J primer, and cloned into the pGEM-T Easy vector (Promega analysis of genes involved in the V(D)J process and in B cell commitment Benelux BV, Leiden, The Netherlands) (21). Individual clones were se- and differentiation, fold change ,|2| was shown. The complete gene ex- quenced on an ABI Prism 3031 XL fluorescent sequencer (Applied Bio- pression material is available online at ArrayExpress (http://www.ebi.ac.uk/ systems, Carlsbad, CA). The size and composition of the junctional region arrayexpress/) with accession number E-MTAB-1422. with regard to deletions and P- and N-nucleotides were analyzed using the international ImMunoGeneTics information system (http://imgt.cines.fr/) Ingenuity Pathway Analysis (26). Statistical analyses were performed using the Mann–Whitney U test. Gene networks and canonical pathways representing key genes were iden- Replication history analysis using the recombination excision tified using Ingenuity Pathways Analysis (www.ingenuity.com). Briefly, the circles assay data set containing gene identifiers and corresponding fold changes and p values was uploaded into the web-delivered application, and each gene The replication history of sorted precursor B cell subsets was determined identifier was mapped to its corresponding gene object in the Ingenuity with the k-deleting recombination excision circles (KREC) assay, as de- Pathway Analysis software (www.ingenuity.com). The functional analysis scribed previously (27). Briefly, the amounts of coding and signal joints of identified the biological functions and/or diseases that were most significant the IGK-deleting rearrangement were measured by real-time quantitative– to the data sets. Fisher’s exact test was performed to calculate a p value PCR in DNA from sorted precursor B cell populations on an ABI Prism assigning probability to each biological function. 7000 (Applied Biosystems). Signal joints, but not coding joints, are diluted 1212 AGE-RELATED CHANGES IN PRECURSOR B CELL REGULATION

2-fold with every cell division (27). To measure the number of cell divi- expression in children and adults, in this study allowing fold sions undergone by each population, we calculated the ratio between the change values ,|2|. Of 164 transcripts previously described to number of coding joints and signal joints. The previously established be precursor B cell associated (21), 23 transcripts were differen- control cell line U698 DB01 (InVivoScribe) contains one coding and one tially expressed between children and adults (Table I) (mean fold signal joint per genome and was used to correct for minor differences in 2 efficiency of both real-time quantitative–PCR assays. change 2.14, range 1.22–5.81; mean p value 0.02, range 7 3 10 6 –0.04). Results Among genes higher expressed in children were multiple genes The relative distribution of precursor B cells in BM does not involved in V(D)J recombination. The recombination-activating change with age gene RAG1 was 1.5 higher expressed (p = 0.03) in pediatric Within the total leukocyte populations in BM from children and ProB cells, whereas for the other subsets, we found no age-related adults, we found considerable variations in lymphocyte frequencies, differences. RAG1 and RAG2 mRNA were specifically upregu- but no age-related differences (mean 6 2 SD): adults 49.7% 6 8.9, lated in PreBI and small PreBII cells of both children and adults, and children 41.3% 6 16.6, respectively. In contrast, the number of fitting with their involvement in Ig H and L chain gene rear- isolated BM-restricted CD10+ cells (mean 6 2 SD) was signifi- rangements (Fig. 3A). The nonhomologous end-joining factors cantly higher (p , 1025)inchildren(8.23 106/ml 6 1.2 3 106/ml) Ku80 and DNA-PKcs (28) were both 1.5-fold higher (p = 0.01 and than in adults (2.7 3 106/ml 6 2.2 3 106/ml). 0.02, respectively) in pediatric PreBI cells than in adults (Fig. 3B). To study whether the decrease in adults was due to impaired B cell Of transcripts encoding DNA ligation components, XRCC4 showed differentiation, we analyzed progenitor B cell subsets using a panel a 1.7-fold higher expression (p = 0.03) in PreBI cells in children, Downloaded from of seven membrane markers (Fig. 1B). The relative sizes of the whereas LIG4 (encoding DNA ligase IV) was similarly expressed five major subsets, ProB, PreBI, PreBII large, and PreBII small and in all subsets in children and adults (Fig. 3C). IGK@, representing k immature B cells, varied individually, but were not related to age the Ig C region, was significantly higher expressed in adult ProB 3 26 3 26 (Fig. 1C). About 20% of the compartment consisted of the early (3.6-fold up, p =7 10 ) and PreBI (4.2-fold up, p =4 10 ) CD34+ ProB and PreBI progenitor cells, whereas PreBII large and cells. The template-independent DNA polymerase TdT, inserting . small cells were dominating (∼70%). Immature B cells constituted random nucleotides during V(D)J recombination, was 3.2-fold ∼12%. This indicates a seemingly similar profile of precursor B cell higher expressed (p = 0.02) in adult immature B cells than in http://www.jimmunol.org/ differentiation with age. children (Fig. 3C). To study whether the reduced RAG expression and increased Stage-dependent global mRNA expression in precursor B cells TdT and IGK@ levels affected V(D)J recombination, we analyzed from children and adults IGH and IGK gene rearrangements. To avoid the impact of se- To study whether transcriptional regulation of precursor B cell dif- lection, we analyzed IGH gene rearrangements in PreBI cells and ferentiation was affected by age, we analyzed the gene expression IGK gene rearrangements in small PreBII cells (Fig. 3D) (21). profiles of all five precursor B cell stages in four children and four Because IGH D-J junctions are formed in ProB cells (21), this adults. First, differences in gene expression levels were determined analysis allowed us to study the Ig gene rearrangement process in per cell stage in children and adults separately using cutoff p value three differentiation stages, as follows: ProB, PreBI, and PreBII by guest on September 27, 2021 ,0.05 and fold change .62 (Supplemental Table II). Between small. The analyzed rearrangements did not show differences for ProB and PreBI, PreBI and PreBII large, PreBII large and PreBII deletions and P-nucleotides between children and adults (data not small, and PreBII small and immature B, respectively, a total of shown). Both D-J and V-D rearrangements showed high numbers 141, 279, 31, and 697 transcripts had an ANOVA p value ,0.05 in of N-nucleotides, reflecting the high TdT levels in ProB and PreBI children (Fig. 2). These 0.2–4.4% of the transcripts describe the stages. N-nucleotide additions in IGK gene rearrangements were differentiation processes from one stage to the next. Corresponding much lower and did not differ significantly between children and numbers in adults were 294, 683, 174, and 525, representing 1.9, adults. Thus, the low levels of TdT in PreBII small as compared 4.3, 1.1, and 3.3% of all transcripts present on the array, respec- with ProB and PreBI cells result in fewer TdT insertions, but the tively. Therefore, the total number of transcripts changing expres- difference in TdT levels between children and adults in PreBII sion during differentiation from ProB to PreBI, PreBI to PreBII small does not affect N-nucleotide insertions in PreBII small. large, and further to PreBII small was ∼2- to 5-fold higher in adults Transcripts encoding pre-BCR components and downstream than in children. Only in the last passage from PreBII small to signaling molecules immature B, ∼25% more transcripts were differentially expressed in children than in adults. Several components of the (pre)BCR were significantly differen- A striking difference was upregulation of 529 transcripts in the tially expressed between children and adults. CD79A expression PreBI to PreBII large transition in adults versus 111 transcripts in was significantly higher in childhood PreBI and PreBII small cells children. Of these, ∼1/6 of the transcripts in adults and 2/3 of the than in adults (Table I). Furthermore, IGLL1 (Ig l-like polypeptide transcripts in children were shared. The other cell transitions in- 1) was slightly higher expressed (fold change 1.3, p , 0.05) in volved a more equal number of upregulated transcripts with age ProB cells in children than in adults, but similar during further (Fig. 2A). The number of downregulated transcripts also showed differentiation. VPREB1, however, was 1.7-fold higher expressed marked age-related differences (Fig. 2B). Notably, in the last dif- (p , 0.002) in adult immature B cells than in children, but oth- ferentiation step, 36% more transcripts were downregulated in erwise showed no age differences. We also analyzed key tran- children (Fig. 2B). Common transcripts in this step represented ∼1/2 scripts in the pre-BCR signaling pathway (29) and found no age- of the transcripts in children and 3/4 in the adult group. related differences in the proliferation inhibiting transcripts B cell linker and Bruton´s tyrosine kinase or other components, except Differences in transcripts essential in V(D)J recombination for a sole 1.3-fold higher expression (p , 0.05) of SYK (spleen and their effects on Ig gene rearrangements tyrosine kinase) in PreBII large cells in children. These results We first examined whether transcripts reported to be involved in strongly suggest that pre-BCR signaling in humans, as evaluated precursor B cell commitment and differentiation showed similar through these pathways, is predominantly unchanged with age. The Journal of Immunology 1213

FIGURE 1. Precursor B cell subset definition and distribution in childhood and adult BM. (A)Sort strategy to define five precursor B cell subsets from Downloaded from CD10+-enriched BM cells according to van Zelm et al. (21). (B) Nomenclature and membrane marker defini- tion of the five precursor B cell subsets. (C) Distribu- tion of precursor B cell subsets in BM. Shown are frequencies within the total CD10+ precursor B cell compartment (mean 6 SD) obtained from four chil-

dren and four adults. http://www.jimmunol.org/ by guest on September 27, 2021

Differences in transcripts essential in B cell commitment and (p = 0.01), and Aiolos (IKZF3), which was 2.1-fold up in PreBI differentiation and the effects on IGH locus contraction cells (p = 0.0001; Fig. 4A). Furthermore, the differentiation in- Multiple transcription factors involved in B cell commitment and hibitor ID2 was upregulated in adult ProB (2.5-fold, p = 0.028) 25 differentiation were differentially expressed between children and and PreBII large cells (5.8-fold, p , 9 3 10 ). In children, ID2 adults. These included transcription factors Helios (IKZF2) (30), was expressed at relatively low levels with no significant change which was 2-fold up in ProB (p = 0.01) and 2.2-fold up in PreBI from one stage to another (Fig. 4B). In adults, a 3.1-fold increase

FIGURE 2. Differentially expressed genes in each of the four stage transits. Number of mRNAs (A) upregulated and (B) downregulated in each dif- ferentiation step in children (black) and adults (gray), respectively. 1214 AGE-RELATED CHANGES IN PRECURSOR B CELL REGULATION

Table I. Genes encoding B cell commitment and differentiation factors that are differentially expressed between children and adults

ProB PreBI PreBII L PreBII s Immature B

ID Gene p Value Fold Change p Value Fold Change p Value Fold Change p Value Fold Change p Value Fold Change 3327143 RAG1 0.03 1.48 0.72 1.07 0.29 1.20 0.40 1.16 0.69 21.07 2563785 IGK@ 7 3 1026 23.58 4 3 1026 24.16 0.43 1.21 0.61 21.13 0.99 21.00 2597867 IKZF2 0.01 1.99 0.01 2.23 0.48 1.20 0.07 1.62 0.83 21.06 3755862 IKZF3 0.40 1.17 1 3 1023 2.08 0.21 1.27 0.14 1.33 0.17 1.30 2818454 XRCC4 0.69 21.09 0.03 1.68 0.54 21.14 0.94 1.02 0.60 1.12 2526980 XRCC5 (Ku 80) 0.90 1.02 0.01 1.50 0.33 21.13 0.79 21.03 0.49 21.09 3134034 DNA-PKcs 0.94 1.01 0.02 1.46 0.08 21.29 0.80 21.04 0.19 21.21 3820921 SMARCA4 0.26 21.13 0.03 21.29 0.33 21.11 0.09 21.20 0.02 21.30 3834502 CD79A 0.24 21.24 0.01 21.79 0.36 21.18 0.04 21.47 0.75 1.06 2563785 IGK@ 7 3 1026 23.58 4 3 1026 24.16 0.43 1.21 0.61 21.13 0.99 21.00 3178952 SYK 0.98 21.00 0.85 21.02 0.01 1.30 0.06 1.22 0.68 1.04 4011844 IL2RG 0.13 21.30 0.70 21.07 0.02 21.55 0.21 21.24 0.22 1.24 2468622 ID2 0.03 22.45 0.54 21.29 9 3 1025 25.81 0.06 22.16 0.16 21.75 3655109 CD19 0.58 1.05 0.17 21.15 0.26 1.11 0.04 1.22 0.93 1.01 3834502 CD79A 0.24 21.24 0.01 21.79 0.36 21.18 0.04 21.47 0.75 1.06 3820921 SMARCA4 0.26 21.13 0.03 21.29 0.33 21.11 0.09 21.20 0.02 21.30

3078348 EZH2 0.95 1.01 0.37 1.19 0.60 21.10 0.93 21.02 0.03 21.51 Downloaded from 3938792 VPREB1 0.53 1.11 0.44 21.15 0.24 21.22 0.38 21.16 0.00 21.77 2793951 HMGB2 1.00 21.00 0.36 1.25 0.87 1.04 1.00 1.00 0.01 21.83 3312490 Ki67 0.70 1.09 0.47 1.20 0.65 21.11 0.97 21.01 3 3 1024 22.57 3259503 TdT 0.91 1.05 0.94 21.04 0.23 21.76 0.20 21.82 0.02 23.22 Differentially expressed genes involved in precursor B cell commitment and differentiation are shown. A positive fold change indicates higher expression in children and vice versa. Bold text indicates fold change .2. http://www.jimmunol.org/

(p = 0.01) in ID2 expression was seen in the transition from PreBI target of ID2, E2A, was similarly expressed during differentiation to PreBII large and a corresponding 3.0-fold decrease (p = 0.008) in children and adults (Fig. 4B), although with a slightly higher in the subsequent transition to PreBII small, followed by a further expression, 20% (p = 0.02), in pediatric ProB cells and a similar, 2.4-fold decrease (p = 0.03) differentiating into immature B cells but not significant (p = 0.06) increase in large PreBII cells. Fur- (Fig. 4B). The ID2 expressional pattern was confirmed with thermore, other transcription factors involved in B cell differen- quantitative RT-PCR (Fig. 4E, 4F, Supplemental Table III). The tiation showed strikingly similar expression in children and adults by guest on September 27, 2021

FIGURE 3. V(D)J gene rearrangement processes in precursor B cells of children and adults. Expression levels of (A) RAG1 and RAG2, causing DNA double strand breaks, (B) the DNA-PKcs/Ku70/Ku80 complex signaling the DNA damage, and (C) the DNA repair machinery DNA ligase4/XRCC4 and the DNA polymerase TdT. Dotted lines represent children, and solid lines adults. Significant differences in expression for a specific stage are indicated with an asterisk. (D) N-nucleotide additions in IGH gene rearrangements from purified PreBI cells and IGK gene rearrangements from PreBII small cells of two healthy children and two healthy adults. Data from children are reproduced from Nodland et al. (24); adult IGH (n = 70) and IGK (n = 82) gene rear- rangement data were newly generated. The Journal of Immunology 1215 in all differentiation stages (Fig. 4C, 4D). These included the was also more contracted than in adult PreBII cells. Importantly, following: EBF1, PAX5, IFN regulatory factor (IRF) 4, IRF8, and in both stages, the distances between distal VH and CH regions POU2AF1. were larger than in their childhood counterpart (Fig. 5B, 5C). The The upregulation of ID2 in adults, without differences in E2A, distances between distal VH and proximal VH between childhood PAX5 and EBF1 expression levels, suggests that, of these critical and adult cells were not different, but the distance between factors, only E2A function is potentially reduced. E2A is impli- proximal VH and CH regions in adult PreBII cells was significantly cated in regulating Ig gene rearrangements (reviewed in Ref. 31). larger than in children. Thus, the IGH locus was more contracted The IGH locus was previously found to contract prior to the ini- in childhood than in adult precursor B cells. tiation of complete V to DJ rearrangements in mouse and human PreBI cells (23, 24, 32–34). To study whether reduced E2A ID2-interacting molecules are involved in DNA replication, function might be contributing to reduced B cell production in recombination and repair, cell cycle progression, and adults as compared with children, we measured the spatial dis- checkpoint control tances between three probe sets recognizing distal VH, proximal We further analyzed functional annotations of other transcripts VH, and CH regions (Fig. 5A). Spatial distances between distal VH changing with ID2 in the PreBI to PreBII large transition in adults and CH regions, distal VH and proximal VH regions, and proximal by building a network starting with ID2 and E2A using Ingenuity VH and CH regions were short in childhood PreBI cells and sig- Pathway Analysis. The resulting network consisted of 36 tran- nificantly larger in small PreBII cells (Fig. 5B, 5C), confirming scripts involved in DNA replication, recombination, repair, and cell previous observations (24). The IGH locus of adult PreBI cells cycle progression (Fig. 6). Of these transcripts, 28 were upregu- Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 4. (A–D) Expression levels of transcription factors essential in B cell commitment and differentiation. Dotted lines represent children, and solid lines adults. Relative levels of ID2 mRNA were confirmed with quantitative RT-PCR using (E) a commercial ID2 assay and (F) a custom-designed primer/ probe set targeted to the 59 end of the transcript. Significant differences in expression between children and adults for a specific stage are indicated with an asterisk. 1216 AGE-RELATED CHANGES IN PRECURSOR B CELL REGULATION lated concomitantly with ID2 and 6 downregulated. Eleven of the work of transcripts involved in DNA replication and cell cycle upregulated molecules were transcription factors, and 6 were ki- regulation is concomitantly activated or repressed. This is in con- nases. The cell cycle regulators cyclin-dependent kinase (CDK) 1 trast to children, in which only five transcripts in this network were and CDK2 were located centrally in the interacting hub. Together significantly upregulated (LYN, IRF4, TFDP2, PTPN6, HDAC9) with cyclin E, these kinases regulate the G1/S phase transition, in and four significantly downregulated (SLC22A16, ITPR1, ELK3, collaboration with cyclin A the S/G2 phase traverse, and with DNTT) (Supplemental Table II). Thus, the differential upregulation cyclin B 1 and 2 the G2/M (mitosis) transition. Both CDK1 and of ID2 in adult PreBII large cells ties in with an ensemble of other CDK2 complexes are able to phosphorylate ID2, assumed to re- known cell cycle checkpoint regulators, supporting the hypothesis lieve its inhibitory effects on E2A. Notably, it has been suggested of the PreBII large stage as an important restriction step in adults. that the E2A protein level is modulated by both the abundance and phosphorylation status of ID2 (35). The network also includes the Adult immature B cells do not show signs of compensatory important regulator CHEK1, which is involved in several check- proliferation points of the cell cycle (Fig. 6). Other transcripts upregulated in In addition to the upregulation of cell cycle regulators CDK1 and the network are key factors in DNA replication, such as DNA CDK2 in adult PreBII large cells, Ki67 was upregulated in adult polymerase a (POLA1) and d (POLD3) and the primases PRIM1 immature B cells (Fig. 7A). Adults and children both showed and PRIM2, which add RNA primers to Okazaki fragments on the strong upregulation in their PreBII cells of this marker for cells lagging strand during DNA synthesis (36). Downregulated tran- that are in cycle (38). However, immature B cells of adults showed scripts included the cell cycle regulator cyclin D2, possibly caused significantly higher expression of Ki67 than children (2.6-fold up, 2 by ID2, as previously documented (37). Altogether, it seems that p =33 10 4) (39). The upregulation of proliferation markers Downloaded from with increased ID2 expression in adult PreBII large cells, a net- could suggest that adult precursor B cells undergo proliferation to http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 5. Three-dimensional spatial organization of the IGH locus in precursor B cells of children and adults. (A) Schematic representation of the human IGH locus and the combinations of bacterial artificial chromosome clones used as three-dimensional immunofluorescence in situ hybridization probes are shown. The distance separating each of the three probes and their positions within the IGH locus were determined from the ImMunoGeneTics database (26). Numbers in the rectangles represent the size of the regions recognized by the probes, and the numbers below the arrows represent genomic distances between probe sets. (B) Scatter plots showing the distances in micrometers (y-axis) separating distal VH, proximal VH, and CH regions in sorted pediatric and adult PreBI and PreBII small cells. For each condition, two independent sorts were performed on material from one to three donors each, and at least 900 alleles were analyzed per population. Red horizontal lines represent median distances between indicated probes in each population. The nonparametric Mann–Whitney U test was used to calculate significance levels between paired populations (horizontal bars). *p , 0.05, **p , 0.01, ***p , 0.001. (C) Representative images of IGH loci in the different populations. The Journal of Immunology 1217

FIGURE 6. Functional network of ID2-interact- ing molecules. Red denotes upregulated and green downregulated transcripts in the differentiation step PreBI to PreBII large stage in adults. Nodes are dis- played using various shapes that represent the func- tional class of gene products. Downloaded from http://www.jimmunol.org/

compensate for reduced B cell production. To study this, we de- tivity of precursor B cells in adults and children, and identified termined the replication history of small PreBII and immature differences in V(D)J recombination factors, ID2, and cell cycle

B cells of children and adults using the KREC assay (27). In line genes that could underlie the marked reduction in the human by guest on September 27, 2021 with previous observations (27), we did not observe any cell precursor B cell compartment occurring with age (4, 5). Functional divisions in precursor B cells of children (Fig. 7B). Furthermore, analysis of potentially involved mechanisms indicated that up- PreBII small and immature B cells of adults did not show signs of regulation of ID2 in adults inhibited E2A-mediated Ig locus con- proliferation either. Thus, despite the differences in gene expres- traction to reduce efficient V(D)J recombination and precursor B sion levels of Ki67, adult immature B cells do not undergo pro- cell differentiation. liferation to compensate for the reduced production of B cell Our cellular analysis of precursor B cells in BM revealed a 67% progenitors. decrease in their absolute number in adults as compared with 2-y- old children. This decrease in BM precursor B cell numbers Discussion corresponded to the decline in the absolute size of the B cell B cell precursors are committed to differentiation or apoptosis. In population in peripheral blood of adults (40). Importantly, the this study, we characterized the differences in transcriptional ac- relative composition of the various subsets was unchanged with

FIGURE 7. Proliferation in precursor B cells from children and adults. (A) Expression levels of Ki67 mRNA in the five precursor B cell subsets. Significant differences in expression between children and adults for a specific stage are indicated with an asterisk. (B) The replication history of PreBII and immature B cells from children and adults determined with the KREC assay. Each gray dot represents the replication history in a sorted subset from a single donor. Red horizontal lines represent median distances. 1218 AGE-RELATED CHANGES IN PRECURSOR B CELL REGULATION age and in accordance with previous reports from both humans Bordon et al. (44), in contrast, demonstrated fluctuations in ID2 and mice (4, 5, 40). Thus, the reduced output from BM seemed the mRNA expression during precursor B cell differentiation in adult result of lower numbers of all B cell progenitors and not restricted wild-type and transgenic mice overexpressing POU class 2- to a specific differentiation stage. associating factor 1 (OBF1), concordant with our findings in humans. The issue whether RAG1 and RAG2 expression decrease with age To study whether the high ID2 gene expression levels indeed in precursor B cell subsets has been explored in several studies in negatively affected E2A function, we analyzed one of the processes mice (4, 14, 15, 41), but very few reports exist from humans. To in which E2A is involved: Ig locus contraction. Indeed, we ob- our knowledge, only one human study (42) has reported, based on served decreased contraction of IGH in PreBI and small PreBII RT-PCR and agarose gel electrophoresis, that there was no change cells in adults. These subsets were analyzed, because they are in transcription of RAG1 and RAG2 in precursor B cells from fetal poised to undergo complete Ig gene rearrangements (21). ID2 and adult BM. This contrasts more recent experimental studies in transcripts were significantly higher in adults in ProB and large mice (14, 15), adopting transgenic and knockin RAG2 reporter PreBII cells, the stages that directly precede the subsets analyzed animals showing that the frequency of ProB cells expressing RAG2 for Ig locus contraction. Still, high ID2 transcript levels are likely was significantly lower in aged mice as compared with young. We to affect the subsequent differentiation stage, because the resulting found a 50% higher (p = 0.03) RAG1 expression in pediatric protein products function to decrease E2A activity. Because E2A ProB cells as compared with adults, a result that should be con- transcript levels are not upregulated with age, the effect of high firmed due to the present small cohort size. Of other transcripts ID2 transcripts is not compensated for. Thus, in addition to re- involved in the V(D)J rearrangement process, DNA-PKcs, Ku80, duced RAG activity, the efficiency of V(D)J recombination in and XRCC4 showed a 50–70% higher expression (p = 0.01–0.03) adult precursor B cells is further reduced by ID2 inhibition of Ig Downloaded from in PreBI cells in children as compared with adults. TdT, in con- locus contraction. trast, was 3.2-fold upregulated (p = 0.02) in adult immature With increased ID2 mRNA expression in adult PreBII large B cells. Despite these differences in gene expression levels, we did cells, we identified a concomitant upregulation of transcripts not observe differences in IGH and IGK gene rearrangements involved in cell cycle progression and control (51, 52), as previously regarding N-nucleotides, P-nucleotides, and deletions between reported. As PreBII large cells are characterized by a transient

children and adults. These suggest that processing and repair of proliferative burst (21), we observed a similar transcriptional ac- http://www.jimmunol.org/ RAG-induced dsDNA breaks are not affected by age. Still, the tivity in this subset in children and adults by using Ki67 as a pro- reduced RAG1 expression levels in adults could negatively affect liferation marker. In contrast, there was a clear upregulation of cell the efficiency of Ig gene rearrangements. Because reduced RAG cycle and checkpoint-associated genes in the adult subset, con- function is not apparent from junction analysis [reviewed in (43)], cordant with a more stringent cell cycle regulation and control. this may contribute to the lower output of precursor B cells from Only at the immature B cell stage we found differential expression normal BM with age. of the mitotic marker Ki67 with a 2.6-fold (p = 3.4 3 1024) higher We then analyzed transcriptional activity of genes required for expression in adults indicating a higher fraction of cycling cells. In commitment and differentiation of precursor B cells. The most 2005, Cancro (8) suggested a decreased turnover rate in the im- striking finding was the temporal increase in ID2 mRNA levels mature B cell subset in adult mice as a homeostatic mechanism by guest on September 27, 2021 restricted to PreBII large cells in adults, and only once reported counteracting the reduced production rate. Our expression data, previously in mice (44). As an E2A inhibitory protein, ID2 is as- however, rather suggest an expansion with age of the immature sumed to have a central role in modulating the E2A-dependent B cell subset, possibly to compensate for reduced production rate. transcriptional regulatory networks, and hence inhibit B cell line- This was not supported by our studies on the relative composition of age commitment and differentiation (45, 46). ID2 has been shown the immature B cell subset and of the replication history of PreBII to negatively regulate B cell differentiation in mice spleen (47, 48), small and immature B cells. Thus, the increased levels of Ki67 and knockdown by shRNA in hematopoietic progenitor cells indicate that more cells are in cell cycle, but these cells do not show promoted B cell differentiation and induction of B cell lineage- signs of (extensive) proliferation to compensate for the reduced specific genes (49). In aged, but not in young murine B cell pre- production of B cells in adults. cursors, reduced E2A protein expression was seen in the presence In conclusion, the human precursor B cell pool, although of maintained E2A mRNA levels (17, 18, 50). The reduced E2A smaller, does not show major compositional variations with age, protein levels in aged murine precursor B cells seemed to be due to and comprises dynamic subpopulations held at steady state to accelerated degradation, because it was effectively blocked support a lifelong production of B lymphocytes. Elevated mRNA by proteasome inhibitors indicating involvement of the ubiquitin/ levels of the differentiation inhibitory molecule ID2, along with proteasome pathway (18). Frasca et al. (16) were unable to detect a network of transcripts related to cell cycle checkpoint control ID2 protein using in vitro expanded aged and young precursor in adult PreBII large cells, indicate restriction in precursor B cell B cells, but found E2A protein levels decreased in adults. We found differentiation. Moreover, the increased ID2 levels are a likely no age-related decrease in E2A mRNA expression in any B pre- cause for the observed impaired Ig locus contraction due cursor subsets in agreement with the situation in mice (16). No- to limited E2A function. These findings demonstrate distinct tably, the above referred study (16) analyzed only ProB/early regulatory mechanisms in B cell differentiation between adults PreB cells for ID2 expression and no further maturation stages. and children with a central role for transcriptional regulation In our study, a striking age-related difference in ID2 expression of ID2. was seen first in PreBII large cells, a subpopulation more mature than the subsets analyzed in mice. We also found a smaller, but Acknowledgments significantly higher expression in adult ProB cells, a difference that We thank all participating adults, children, and parents for trust and gener- probably would have been blurred if ProB and PreBI subsets had ous help, and S.J.W. Bartol and F.S. van de Bovenkamp for technical sup- been analyzed together (16). Another difference between the port. studies by Frasca et al. (16) and our study was that they analyzed ID2 protein levels in cultured precursor B cells, whereas we an- Disclosures alyzed ID2 mRNA expression in freshly isolated precursor B cells. The authors have no financial conflicts of interest. The Journal of Immunology 1219

References 26. Alamyar, E., P. Duroux, M. P. Lefranc, and V. Giudicelli. 2012. IMGT() tools for the nucleotide analysis of immunoglobulin (IG) and T cell receptor (TR) V-(D)-J 1. Matthias, P., and A. G. Rolink. 2005. Transcriptional networks in developing and repertoires, polymorphisms, and IG mutations: IMGT/V-QUEST and IMGT/ mature B cells. Nat. Rev. Immunol. 5: 497–508. HighV-QUEST for NGS. Methods Mol. Biol. 882: 569–604. 2. Nutt, S. L., and B. L. Kee. 2007. The transcriptional regulation of B cell lineage commitment. Immunity 26: 715–725. 27. van Zelm, M. C., T. Szczepanski, M. van der Burg, and J. J. van Dongen. 2007. 3. Dorshkind, K., E. Montecino-Rodriguez, and R. A. Signer. 2009. The ageing Replication history of B lymphocytes reveals homeostatic proliferation and ex- immune system: is it ever too old to become young again? Nat. Rev. Immunol. 9: tensive antigen-induced B cell expansion. J. Exp. Med. 204: 645–655. 57–62. 28. Ochi, T., B. L. Sibanda, Q. Wu, D. Y. Chirgadze, V. M. Bolanos-Garcia, and 4. Rossi, M. I., T. Yokota, K. L. Medina, K. P. Garrett, P. C. Comp, A. H. Schipul, T. L. Blundell. 2010. Structural biology of DNA repair: spatial organisation of Jr., and P. W. Kincade. 2003. B lymphopoiesis is active throughout human life, the multicomponent complexes of nonhomologous end joining. J. Nucleic Acids but there are developmental age-related changes. Blood 101: 576–584. 2010: 1–19. 5. Jensen, K., L. Schaffer, O. K. Olstad, A. G. Bechensteen, M. Hellebostad, 29. Hendriks, R. W., and S. Middendorp. 2004. The pre-BCR checkpoint as a cell- G. E. Tjønnfjord, P. Kierulf, K. M. Gautvik, and L. T. Osnes. 2010. Striking autonomous proliferation switch. Trends Immunol. 25: 249–256. decrease in the total precursor B-cell compartment during early childhood as 30. John, L. B., and A. C. Ward. 2011. The Ikaros gene family: transcriptional evidenced by flow cytometry and gene expression changes. Pediatr. Hematol. regulators of hematopoiesis and immunity. Mol. Immunol. 48: 1272–1278. Oncol. 27: 31–45. 31. Bossen, C., R. Mansson, and C. Murre. 2012. Chromatin topology and the 6. Johnson, K. M., K. Owen, and P. L. Witte. 2002. Aging and developmental regulation of antigen receptor assembly. Annu. Rev. Immunol. 30: 337–356. transitions in the B cell lineage. Int. Immunol. 14: 1313–1323. 32. Jhunjhunwala, S., M. C. van Zelm, M. M. Peak, S. Cutchin, R. Riblet, J. J. van 7. Allman, D., and J. P. Miller. 2005. The aging of early B-cell precursors. Dongen, F. G. Grosveld, T. A. Knoch, and C. Murre. 2008. The 3D structure of Immunol. Rev. 205: 18–29. the immunoglobulin heavy-chain locus: implications for long-range genomic 8. Cancro, M. P. 2005. B cells and aging: gauging the interplay of generative, interactions. Cell 133: 265–279. selective, and homeostatic events. Immunol. Rev. 205: 48–59. 33. Kosak, S. T., J. A. Skok, K. L. Medina, R. Riblet, M. M. Le Beau, A. G. Fisher, 9. Henry, C. J., A. Marusyk, and J. DeGregori. 2011. Aging-associated changes in and H. Singh. 2002. Subnuclear compartmentalization of immunoglobulin loci hematopoiesis and leukemogenesis: what’s the connection? Aging 3: 643–656. during lymphocyte development. Science 296: 158–162.

10. Siegrist, C. A., and R. Aspinall. 2009. B-cell responses to vaccination at the 34. Rolda´n, E., M. Fuxa, W. Chong, D. Martinez, M. Novatchkova, M. Busslinger, Downloaded from extremes of age. Nat. Rev. Immunol. 9: 185–194. and J. A. Skok. 2005. Locus ‘decontraction’ and centromeric recruitment con- 11. Rossi, D. J., D. Bryder, J. M. Zahn, H. Ahlenius, R. Sonu, A. J. Wagers, and tribute to allelic exclusion of the immunoglobulin heavy-chain gene. Nat. I. L. Weissman. 2005. Cell intrinsic alterations underlie hematopoietic stem cell Immunol. 6: 31–41. aging. Proc. Natl. Acad. Sci. USA 102: 9194–9199. 35. Hara, E., M. Hall, and G. Peters. 1997. Cdk2-dependent phosphorylation of Id2 12. Cho, R. H., H. B. Sieburg, and C. E. Muller-Sieburg. 2008. A new mechanism modulates activity of E2A-related transcription factors. EMBO J. 16: 332–342. for the aging of hematopoietic stem cells: aging changes the clonal composition 36. Bae, S. H., K. H. Bae, J. A. Kim, and Y. S. Seo. 2001. RPA governs endonuclease of the stem cell compartment but not individual stem cells. Blood 111: 5553– switching during processing of Okazaki fragments in eukaryotes. Nature 412: 5561.

456–461. http://www.jimmunol.org/ 13. Kline, G. H., T. A. Hayden, and N. R. Klinman. 1999. B cell maintenance in 37. Lasorella, A., A. Iavarone, and M. A. Israel. 1996. Id2 specifically alters regu- aged mice reflects both increased B cell longevity and decreased B cell gener- ation. J. Immunol. 162: 3342–3349. lation of the cell cycle by tumor suppressor proteins. Mol. Cell. Biol. 16: 2570– 14. Labrie, J. E., III, A. P. Sah, D. M. Allman, M. P. Cancro, and R. M. Gerstein. 2578. 2004. Bone marrow microenvironmental changes underlie reduced RAG- 38. Hoffmann, R., T. Seidl, M. Neeb, A. Rolink, and F. Melchers. 2002. Changes in mediated recombination and B cell generation in aged mice. J. Exp. Med. gene expression profiles in developing B cells of murine bone marrow. Genome 200: 411–423. Res. 12: 98–111. 15. Labrie, J. E., III, L. Borghesi, and R. M. Gerstein. 2005. Bone marrow micro- 39. Bendall, S. C., E. F. Simonds, P. Qiu, A. D. Amir, P. O. Krutzik, R. Finck, environmental changes in aged mice compromise V(D)J recombinase activity R. V. Bruggner, R. Melamed, A. Trejo, O. I. Ornatsky, et al. 2011. Single-cell and B cell generation. Semin. Immunol. 17: 347–355. mass cytometry of differential immune and drug responses across a human he- 16. Frasca, D., D. Nguyen, E. Van der Put, R. L. Riley, and B. B. Blomberg. 2003. matopoietic continuum. Science 332: 687–696. The age-related decrease in E47 DNA-binding does not depend on increased Id 40. Comans-Bitter, W. M., R. de Groot, R. van den Beemd, H. J. Neijens, W. C. Hop, inhibitory proteins in bone marrow-derived B cell precursors. Front. Biosci. 8: K. Groeneveld, H. Hooijkaas, and J. J. van Dongen. 1997. Immunophenotyping by guest on September 27, 2021 a110–a116. of blood lymphocytes in childhood: reference values for lymphocyte sub- 17. Frasca, D., D. Nguyen, R. L. Riley, and B. B. Blomberg. 2003. Decreased E12 populations. J. Pediatr. 130: 388–393. and/or E47 transcription factor activity in the bone marrow as well as in the 41. Linton, P. J., and K. Dorshkind. 2004. Age-related changes in lymphocyte de- spleen of aged mice. J. Immunol. 170: 719–726. velopment and function. Nat. Immunol. 5: 133–139. 18. Van der Put, E., D. Frasca, A. M. King, B. B. Blomberg, and R. L. Riley. 2004. 42. Nunez, C., N. Nishimoto, G. L. Gartland, L. G. Billips, P. D. Burrows, H. Decreased E47 in senescent B cell precursors is stage specific and regulated Kubagawa, and M. D. Cooper. 1996. B cells are generated throughout life in posttranslationally by protein turnover. J. Immunol. 173: 818–827. humans. J. Immunol. 156: 866-872. 19. Frasca, D., A. M. Landin, S. C. Lechner, J. G. Ryan, R. Schwartz, R. L. Riley, 43. Berkowska, M. A., M. van der Burg, J. J. van Dongen, and M. C. van Zelm. and B. B. Blomberg. 2008. Aging down-regulates the transcription factor E2A, 2011. Checkpoints of B cell differentiation: visualizing Ig-centric processes. activation-induced cytidine deaminase, and Ig class switch in human B cells. J. Ann. N. Y. Acad. Sci. 1246: 11–25. Immunol. 180: 5283–5290. 44. Bordon, A., N. Bosco, C. Du Roure, B. Bartholdy, H. Kohler, G. Matthias, 20. Frasca, D., and B. B. Blomberg. 2011. Aging impairs murine B cell differenti- A. G. Rolink, and P. Matthias. 2008. Enforced expression of the transcriptional Aging Dis. ation and function in primary and secondary lymphoid tissues. 2: coactivator OBF1 impairs B cell differentiation at the earliest stage of devel- 361–373. opment. PLoS One 3: e4007. 21. van Zelm, M. C., M. van der Burg, D. de Ridder, B. H. Barendregt, E. F. de Haas, 45. Kee, B. L. 2009. E and ID proteins branch out. Nat. Rev. Immunol. 9: 175–184. M. J. Reinders, A. C. Lankester, T. Re´ve´sz, F. J. Staal, and J. J. van Dongen. 46. Greenbaum, S., and Y. Zhuang. 2002. Regulation of early lymphocyte devel- 2005. Ig gene rearrangement steps are initiated in early human precursor B cell opment by E2A family proteins. Semin. Immunol. 14: 405–414. subsets and correlate with specific transcription factor expression. J. Immunol. 47. Becker-Herman, S., F. Lantner, and I. Shachar. 2002. Id2 negatively regulates 175: 5912–5922. 22. Hystad, M. E., J. H. Myklebust, T. H. Bø, E. A. Sivertsen, E. Rian, L. Forfang, B cell differentiation in the spleen. J. Immunol. 168: 5507–5513. E. Munthe, A. Rosenwald, M. Chiorazzi, I. Jonassen, et al. 2007. Character- 48. Gore, Y., F. Lantner, G. Hart, and I. Shachar. 2010. Mad3 negatively regulates ization of early stages of human B cell development by gene expression pro- B cell differentiation in the spleen by inducing Id2 expression. Mol. Biol. Cell filing. J. Immunol. 179: 3662–3671. 21: 1864–1871. 23. Sayegh, C. E., S. Jhunjhunwala, R. Riblet, and C. Murre. 2005. Visualization of 49. Ji, M., H. Li, H. C. Suh, K. D. Klarmann, Y. Yokota, and J. R. Keller. 2008. Id2 looping involving the immunoglobulin heavy-chain locus in developing B cells. intrinsically regulates lymphoid and erythroid development via interaction with Genes Dev. 19: 322–327. different target proteins. Blood 112: 1068–1077. 24. Nodland, S. E., M. A. Berkowska, A. A. Bajer, N. Shah, D. de Ridder, J. J. van 50. Riley, R. L., B. B. Blomberg, and D. Frasca. 2005. B cells, E2A, and aging. Dongen, T. W. LeBien, and M. C. van Zelm. 2011. IL-7R expression and IL-7 Immunol. Rev. 205: 30–47. signaling confer a distinct phenotype on developing human B-lineage cells. 51. Iavarone, A., P. Garg, A. Lasorella, J. Hsu, and M. A. Israel. 1994. The Blood 118: 2116–2127. helix-loop-helix protein Id-2 enhances cell proliferation and binds to the reti- 25. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression noblastoma protein. Genes Dev. 8: 1270–1284. data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. 52. Zebedee, Z., and E. Hara. 2001. Id proteins in cell cycle control and cellular Methods 25: 402–408. senescence. Oncogene 20: 8317–8325. Supplementary table I

Primer and probe sequences for ID2 5´assays covering exon I (assay 1 and 2) and exon II (assay 3) of the mRNA

ASSAY 1 Forward primer: CATCTCCCGGAGCAAAACC Reverse Primer: GTAGCAGTCGTTCATGTTGTATAGCA Probe: TGGACGACCCGATGAG

ASSAY 2 Forward primer CTGTGGACGACCCGATGAG Reverse Primer: ACCAGCTCCTTGAGCTTGGA Probe: ACAACATGAACGACTGCT

ASSAY 3 Forward primer: CTGTCCTTGCAGGCTTCTGAAT Reverse Primer: CCACACAGTGCTTTGCTGTCA Probe: CCCTTCTGAGTTAATGTC

Supplementary table II

Differentially expressed genes during each stage transit in adults and children, respectively (p-value < 0.05, fold change ≥ |2|)

ADULTS

Adult PreBI vs ProB Mean signal Transcript Cluster Gene Symbol p-value fold change ProB PreBI

3578152 TCL1A 0,00007 3,803 11 41 4014387 RPSAP15 0,00806 3,476 10 35 3512948 C13orf18 0,00519 3,358 23 79 2841460 0,04175 3,270 3 9 3928590 KRTAP21-1 0,00930 3,239 7 24 2542972 NDUFAF2 0,03478 3,193 2 7 2674436 0,01686 3,166 4 14 3677187 0,02353 3,098 5 14 3335822 0,00324 3,022 9 28 3958307 0,03095 3,015 13 38 3470354 0,02413 2,976 30 90 3126191 PSD3 0,01657 2,975 29 85 4035833 CD24 0,00600 2,933 30 88 2597867 IKZF2 0,00081 2,815 19 53 3954879 VPREB3 0,00471 2,810 103 288 3524999 LIG4 0,01851 2,801 87 243 2781138 LEF1 0,00588 2,774 127 354 3647421 ABAT 0,00761 2,672 10 26 3286792 C10orf25 0,00936 2,637 23 60 3825154 0,01285 2,636 9 23 3275246 0,01946 2,608 8 22 3966225 RABL2B 0,01796 2,599 36 92 2318867 0,04865 2,564 8 20 3677164 TCEB2 0,04247 2,563 23 59 3402315 CD9 0,02108 2,541 93 236 2563785 IGK@ 0,00108 2,493 135 337 3819749 0,04237 2,489 20 51 2958861 GUSBL2 0,01196 2,475 8 20 2964553 BACH2 0,00094 2,427 63 153 3046556 TARP 0,02016 2,389 32 76 3126368 PSD3 0,01651 2,371 15 35 3205293 PAX5 0,00019 2,363 98 231 3831223 0,03677 2,355 7 17 2875193 P4HA2 0,04007 2,351 46 107 2616596 ARPP21 0,02901 2,349 106 250 3129149 PBK 0,02463 2,346 12 29 2790109 ANXA2P1 0,00043 2,327 9 21 3825153 0,01234 2,321 45 103 3570141 0,00463 2,320 18 41 3855099 0,01681 2,319 7 17 3113894 ZHX2 0,01352 2,304 94 217 2599946 0,01187 2,294 8 18 3766533 CD79B 0,00493 2,262 52 118 2931569 AKAP12 0,03668 2,254 165 373 3226138 AK1 0,00581 2,185 33 72 2832043 0,00830 2,175 16 36 3275586 0,03522 2,171 103 223 3365776 E2F8 0,00522 2,161 34 73 4007899 SYP 0,01582 2,143 11 24 2362282 OR10Z1 0,03211 2,116 8 17 3838385 CD37 0,01555 2,112 27 57 2320088 0,00064 2,108 38 81 3744263 AURKB 0,00005 2,096 60 126 3977886 SSX8 0,02284 2,096 64 135 3809820 0,00415 2,091 14 28 2874739 0,00759 2,081 13 28 3539724 SYNE2 0,01433 2,079 17 36 2459411 0,03659 2,076 10 22 3361040 0,04216 2,067 7 14 2841482 0,01692 2,055 7 15 3666989 CLEC18C 0,03659 2,040 9 18 3850166 S1PR2 0,01240 2,038 8 16 3204648 CD72 0,00486 2,022 45 91 2451200 UBE2T 0,01448 2,013 37 74 3536336 CDKN3 0,02118 2,011 87 175 3819574 0,02847 -2,001 189 95 2564816 ANKRD36B 0,04309 -2,002 100 50 2818517 VCAN 0,03191 -2,006 19 9 2514516 KLHL23 0,00234 -2,011 37 18 3499585 BIVM 0,00718 -2,014 14 7 23200482320059 TARDBP 0,03982 -2,017 274 136 3570089 0,02834 -2,019 32 16 2601414 SERPINE2 0,00729 -2,021 20 10 2883661 0,00778 -2,027 34 17 2854327 FYB 0,03404 -2,033 19 9 2671968 LZTFL1 0,00012 -2,037 65 32 2674422 0,04359 -2,038 6 3 2783473 C4orf3 0,03899 -2,042 374 183 3182984 NIPSNAP3B 0,00029 -2,043 42 21 2955282 SUPT3H 0,00000 -2,044 45 22 3392885 0,02952 -2,054 156 76 2842561 HIGD2A 0,04842 -2,054 150 73 2993727 SNX10 0,00319 -2,058 50 24 3714896 FAM27L 0,00148 -2,059 42 21 3096271 C8orf40 0,00463 -2,059 283 137 3315675 IFITM1 0,01013 -2,061 47 23 3096464 0,02937 -2,062 18 9 3676739 0,03542 -2,063 52 25 3630195 0,00522 -2,070 628 303 2893109 LOC100129033 0,00254 -2,071 20 10 2840676 0,01251 -2,072 59 29 3714177 CYTSB 0,00056 -2,078 70 33 2902444 AIF1 0,00031 -2,084 158 76 3676709 0,03764 -2,085 177 85 3188050 MRRF 0,00027 -2,086 52 25 2356425 PDZK1 0,04124 -2,094 25 12 3217077 HEMGN 0,01519 -2,098 12 6 2971801 MAN1A1 0,00057 -2,103 260 124 2496536 RPL31 0,03239 -2,106 79 38 2565149 0,03512 -2,108 139 66 36997573699773 KARS 0,02237 -2,109 34 16 4011844 IL2RG 0,00032 -2,119 136 64 2734784 AFF1 0,00001 -2,122 478 225 2421121 ODF2L 0,00003 -2,125 38 18 3136178 PLAG1 0,02654 -2,129 21 10 2975741 MAP7 0,00079 -2,132 40 19 3630183 0,02826 -2,141 335 157 2527196 RPL37A 0,00107 -2,144 58 27 2949109 0,04057 -2,147 310 144 2830861 EGR1 0,00058 -2,149 108 50 2318795 0,00505 -2,152 23 11 2908488 0,00448 -2,154 341 158 39596313959653 EIF3D 0,00228 -2,157 481 223 3041816 DFNA5 0,00092 -2,161 17 8 2536380 0,04973 -2,170 23 10 2643217 TF 0,01272 -2,175 33 15 2880361 JAKMIP2 0,00018 -2,197 29 13 2518272 ITGA4 0,00016 -2,201 238 108 3420442 IRAK3 0,00006 -2,203 44 20 2593159 STK17B 0,00026 -2,205 164 75 23200482320077 TARDBP 0,04024 -2,206 92 42 2604390 ARL4C 0,00027 -2,209 57 26 3275166 0,04225 -2,210 92 42 2822215 PAM 0,00001 -2,220 19 8 3959742 0,01541 -2,224 22 10 3746675 CDRT4 0,00624 -2,225 10 4 2993690 0,00683 -2,225 94 42 3136888 TOX 0,00152 -2,226 94 42 2649723 MFSD1 0,00041 -2,226 169 76 3556288 0,00819 -2,232 96 43 2768654 OCIAD2 0,00169 -2,242 84 37 2908500 0,00281 -2,248 259 115 2461473 TARBP1 0,00316 -2,252 144 64 3474541 0,03502 -2,258 95 42 3464912 POC1B 0,00011 -2,261 35 15 2746024 ABCE1 0,00507 -2,268 114 50 2701109 IGSF10 0,00651 -2,270 29 13 3251393 DDIT4 0,00148 -2,273 66 29 3326635 CD44 0,00289 -2,290 103 45 2705266 TNIK 0,00035 -2,292 31 13 2588889 LOC100130691 0,00025 -2,293 25 11 2526806 FN1 0,01380 -2,297 44 19 2348992 VCAM1 0,01441 -2,297 13 6 2924619 TRMT11 0,00110 -2,307 36 16 3617574 GOLGA8B 0,00244 -2,310 97 42 2765935 GAFA3 0,00192 -2,317 217 94 2406311 0,03492 -2,325 11 5 25362982536329 02.sep 0,00076 -2,330 137 59 2421000 COL24A1 0,00480 -2,332 37 16 2517408 AGPS 0,00285 -2,344 333 142 3256560 MINPP1 0,00320 -2,355 20 9 2993686 0,03652 -2,356 35 15 3725856 0,00743 -2,358 32 14 2928461 GPR126 0,00065 -2,363 14 6 2536442 0,04742 -2,366 5 2 2536307 0,02639 -2,386 18 8 3275574 0,04570 -2,394 11 5 3527662 RNASE6 0,00770 -2,406 37 15 2713950 ZNF141 0,00391 -2,408 97 40 2340433 LEPR 0,00006 -2,416 19 8 3630217 0,01143 -2,417 30 12 2742224 SPRY1 0,00045 -2,426 364 150 3740644 0,04297 -2,428 18 7 2938972 SERPINB1 0,00002 -2,430 115 47 2820925 RHOBTB3 0,00110 -2,430 35 15 3725850 0,01664 -2,433 83 34 25999012599903 C2orf24 0,03832 -2,439 71 29 2436196 0,01028 -2,442 85 35 3551855 0,02628 -2,442 170 69 3577078 LGMN 0,01023 -2,443 166 68 3306571 0,02074 -2,444 16 7 2840782 0,04368 -2,449 18 7 3351766 0,04291 -2,454 49 20 2993206 MPP6 0,00079 -2,459 100 41 23284652328501 KHDRBS1 0,02455 -2,474 97 39 2320064 0,03822 -2,475 238 96 2840680 0,02962 -2,476 124 50 2949113 0,00973 -2,477 22 9 2923661 GJA1 0,00228 -2,483 39 16 2991233 AHR 0,00000 -2,483 61 25 3811339 BCL2 0,00071 -2,484 151 61 3020192 TES 0,00054 -2,487 113 45 3076753 KIAA1147 0,00189 -2,488 25 10 2406395 0,00218 -2,488 24 10 3916290 FLJ42200 0,00107 -2,513 18 7 3819761 0,00838 -2,516 146 58 2700244 CP 0,00589 -2,521 10 4 3255506 0,03016 -2,527 28 11 3442854 SLC2A3 0,00059 -2,528 56 22 2665199 SATB1 0,00016 -2,532 357 141 3959684 0,00008 -2,540 490 193 3561110 RALGAPA1 0,00483 -2,547 15 6 3177880 DAPK1 0,00211 -2,547 46 18 2636125 CD200 0,00001 -2,583 84 33 3740580 0,01530 -2,586 47 18 2840656 0,04433 -2,588 78 30 2908487 0,03699 -2,592 83 32 3980926 0,03871 -2,606 43 16 3819669 0,04258 -2,607 84 32 3233049 AKR1C3 0,00103 -2,647 43 16 2841470 0,04306 -2,662 10 4 3980922 0,03544 -2,670 14 5 2774971 ANTXR2 0,00013 -2,671 173 65 2890413 RNF130 0,00029 -2,688 87 32 2686775 0,04609 -2,703 143 53 2325214 0,00898 -2,706 49 18 3475102 0,02913 -2,716 68 25 3699808 0,01474 -2,729 50 18 3740638 0,02710 -2,729 193 71 3556228 0,00797 -2,735 111 41 2557659 0,02548 -2,741 22 8 2727587 KIT 0,00000 -2,748 36 13 2701033 P2RY14 0,00079 -2,750 277 101 36997573699771 KARS 0,00521 -2,755 48 17 2993672 0,00888 -2,779 39 14 2343511 IFI44 0,01907 -2,781 78 28 2591421 TFPI 0,00007 -2,809 15 5 3630197 0,03793 -2,818 9 3 2949059 0,01249 -2,840 59 21 2349402 AMY2B 0,00695 -2,872 113 39 3556266 0,01558 -2,876 68 24 3959651 0,00145 -2,882 134 46 3630225 0,00647 -2,885 84 29 3676745 0,02974 -2,919 116 40 3306557 0,02045 -2,941 13 5 2565211 0,03145 -2,942 35 12 3630219 0,00530 -2,973 33 11 3319347 0,02994 -2,986 9 3 3401704 CCND2 0,00112 -2,998 74 25 3740640 0,04961 -3,006 46 15 2840674 0,02176 -3,022 42 14 2523632 0,01284 -3,027 96 32 3748449 CCDC144A 0,00097 -3,042 85 28 2444283 TNFSF4 0,00004 -3,068 116 38 2638988 PARP15 0,00033 -3,068 39 13 2791197 PDGFC 0,00011 -3,078 39 13 3275272 0,00018 -3,108 128 41 3298738 WAPAL 0,00454 -3,116 94 30 2816506 S100Z 0,00078 -3,127 46 15 3269939 DOCK1 0,00020 -3,130 31 10 2383811 0,04685 -3,139 39 13 3749588 0,02970 -3,164 94 30 3475016 0,03358 -3,174 55 17 2908762 RUNX2 0,00016 -3,196 119 37 3958341 0,00792 -3,214 26 8 3275202 0,01457 -3,243 17 5 2949107 0,01163 -3,262 37 11 2486178 MEIS1 0,00002 -3,283 82 25 3041875 OSBPL3 0,00001 -3,295 99 30 3275274 0,00003 -3,332 142 43 2873785 ALDH7A1 0,01831 -3,398 64 19 2840666 0,01054 -3,439 60 17 3020222 LOC100128868 0,00283 -3,471 19 5 2841342 0,00199 -3,509 49 14 24062452406261 PSMB2 0,03038 -3,525 45 13 2320112 0,01288 -3,591 65 18 2557657 0,00250 -3,614 47 13 3182930 OR13D1 0,00447 -3,620 17 5 3286602 CXCL12 0,00221 -3,632 50 14 2405104 ZBTB8OS 0,00664 -3,647 22 6 38311683831178 CAPNS1 0,00134 -3,670 37 10 3699892 0,00563 -3,678 59 16 3507199 FLT3 0,00130 -3,690 257 70 3364755 0,00031 -3,705 157 42 3477967 MGC16384 0,01962 -3,751 42 11 3556268 0,02993 -3,761 42 11 3725966 0,01175 -3,850 32 8 2372781 RGS1 0,00159 -3,857 25 6 3203382 SMU1 0,00335 -3,877 47 12 3959744 0,00588 -3,993 14 4 3096494 0,02858 -4,021 23 6 2584957 SCN3A 0,00198 -4,047 135 33 3959738 0,02417 -4,070 11 3 3386217 CHORDC1 0,00539 -4,079 45 11 2436198 0,00016 -4,138 33 8 3253452 0,01714 -4,176 19 5 3980930 0,01536 -4,236 12 3 3844035 0,00027 -4,292 36 8 3090209 ADAM28 0,00097 -4,319 42 10 2418078 NEGR1 0,00004 -4,394 88 20 2806468 IL7R 0,00343 -4,405 124 28 3021158 C7orf58 0,00115 -4,454 35 8 3433466 NCRNA00173 0,00143 -4,522 58 13 3740642 0,00295 -4,538 37 8 2925590 TMEM200A 0,00063 -4,551 40 9 2730673 MOBKL1A 0,00000 -4,667 102 22 2443450 SELL 0,00009 -4,706 664 141 34702533470282 SART3 0,03970 -5,132 13 2 3214451 NFIL3 0,00001 -5,267 93 18 2325212 0,00062 -5,734 47 8 3174816 ANXA1 0,00002 -5,785 79 14 3110217 BAALC 0,00014 -6,856 155 23 2761842 PROM1 0,00012 -7,206 68 9 2772566 IGJ 0,00000 -7,363 449 61

Adult PreBII L vs PreBI Mean signal Transcript Cluster Gene Symbol p-value fold change PreBI PreBII L

3755862 IKZF3 0,00000 11,525 13 149 3904691 SAMHD1 0,00000 10,343 11 113 3578152 TCL1A 0,00000 7,797 41 320 2823880 CAMK4 0,00000 7,753 9 73 2782545 CAMK2D 0,00000 6,273 28 177 3648391 TNFRSF17 0,00002 6,134 6 37 2772566 IGJ 0,00002 6,101 61 372 3844035 0,00002 5,817 8 48 2766192 TLR10 0,00001 5,774 21 122 3098977 LYN 0,00000 5,713 24 138 2638988 PARP15 0,00000 5,535 13 71 2860178 CD180 0,00000 5,334 15 82 3298738 WAPAL 0,00010 5,282 30 159 3275166 0,00012 5,233 42 218 4016193 TMSB15A 0,01308 5,195 13 69 2524653 ADAM23 0,00000 5,189 14 75 25999012599903 C2orf24 0,00043 5,125 29 149 2597867 IKZF2 0,00000 4,939 53 261 35565563556580 DAD1 0,00852 4,871 10 47 2688717 BTLA 0,00002 4,854 8 38 3590341 CHP 0,00000 4,850 79 381 2366884 C1orf129 0,00008 4,774 4 21 3669552 VAT1L 0,00000 4,754 21 98 3945545 APOBEC3B 0,00003 4,568 11 49 2372858 RGS2 0,00179 4,513 212 959 3386217 CHORDC1 0,00377 4,360 11 48 3577256 C14orf142 0,00063 4,302 16 69 3980930 0,01563 4,219 3 11 2388085 KMO 0,00000 4,185 12 49 2621570 0,04844 4,181 16 67 3593575 SLC27A2 0,00000 4,173 7 28 2363618 SDHC 0,00231 4,157 6 26 3555887 0,00390 4,142 17 72 2908487 0,00284 4,140 32 133 3470470 0,00728 4,081 7 28 3470549 CORO1C 0,00017 4,055 40 161 2328565 0,00525 4,008 6 23 3203382 SMU1 0,00275 4,004 12 48 3630197 0,00722 3,961 3 12 3173673 PIP5K1B 0,00000 3,946 10 41 3291435 RTKN2 0,00002 3,910 14 54 2806468 IL7R 0,00663 3,898 28 109 25362982536350 02.sep 0,02703 3,885 7 29 3288013 BMS1P1 0,01451 3,840 3 11 3844039 0,03551 3,784 5 21 3253459 0,00291 3,780 3 12 3475026 0,01789 3,772 7 27 2320134 0,01161 3,735 4 15 2891341 IRF4 0,00001 3,729 55 204 2747893 ARFIP1 0,00006 3,725 9 34 2698565 TFDP2 0,00000 3,719 114 423 3175971 PSAT1 0,00009 3,603 8 29 2993658 0,00178 3,577 9 34 3275574 0,00493 3,570 5 17 33627193362765 EIF4G2 0,00304 3,499 6 23 2523632 0,00562 3,489 32 110 3197955 GLDC 0,00005 3,471 44 153 2844293 0,03511 3,441 5 16 3699892 0,00821 3,441 16 55 3464983 ATP2B1 0,00000 3,406 35 118 3815399 CNN2 0,00059 3,398 9 32 3924041 ADARB1 0,00001 3,393 23 78 23284652328501 KHDRBS1 0,00339 3,383 39 133 2565149 0,00122 3,352 66 221 3129149 PBK 0,00222 3,343 29 97 36997573699771 KARS 0,00118 3,342 17 58 24062452406261 PSMB2 0,03762 3,340 13 42 2686775 0,01808 3,305 53 175 2467194 0,03569 3,287 3 11 2908500 0,00004 3,287 115 379 2319340 SLC25A33 0,01395 3,268 32 103 3203855 DCAF12 0,00001 3,265 36 118 2638676 EAF2 0,00000 3,258 81 263 3708826 EIF4A1 0,00269 3,255 39 128 2325212 0,01485 3,252 8 27 3651478 ACSM3 0,00031 3,251 16 51 3629103 KIAA0101 0,00143 3,250 92 298 2680819 SUCLG2 0,00123 3,241 20 66 2389062 FAM36A 0,02992 3,237 27 88 3973839 CYBB 0,00260 3,218 17 54 2724671 RHOH 0,00001 3,209 57 182 2500275 BCL2L11 0,00007 3,192 30 97 3538213 DAAM1 0,00003 3,188 20 63 2565211 0,02206 3,172 12 38 2565200 0,01955 3,164 10 31 3556290 0,00587 3,158 11 34 3699808 0,00599 3,152 18 58 2468622 ID2 0,01015 3,148 43 137 3329983 PTPRJ 0,00000 3,147 12 38 3630225 0,00357 3,143 29 92 3474952 0,02154 3,126 10 33 3239584 MYO3A 0,00000 3,106 7 21 2768654 OCIAD2 0,00004 3,092 37 115 3470398 0,01610 3,083 7 23 3301218 PDLIM1 0,00000 3,081 111 341 3959744 0,02244 3,074 4 11 3551725 0,03536 3,055 10 31 2775259 RASGEF1B 0,00003 3,050 46 141 38074873807501 RPL17 0,04227 3,047 29 88 3902743 C20orf112 0,00123 3,044 19 58 2828135 LYRM7 0,00502 3,035 26 79 3003143 MRPS17 0,00661 3,027 62 188 2417528 DEPDC1 0,00249 3,002 16 49 3203162 NDUFB6 0,00100 3,002 48 146 2688605 GCET2 0,00004 2,995 46 139 2689286 KIAA1407 0,00000 2,983 13 40 3556058 0,00363 2,969 4 12 2373842 PTPRC 0,00000 2,962 93 276 3096271 C8orf40 0,00008 2,957 137 406 2557659 0,01730 2,948 8 24 2837479 THG1L 0,00005 2,934 39 115 2674472 0,04294 2,931 7 21 2898597 GMNN 0,00013 2,931 47 139 3559690 HEATR5A 0,00182 2,930 8 23 2969289 WASF1 0,01061 2,925 53 154 2320064 0,01550 2,925 96 281 3555521 GAFA1 0,00093 2,920 10 28 3809705 0,02030 2,915 9 25 3595979 CCNB2 0,00543 2,912 53 154 3248289 CDK1 0,00146 2,905 17 50 3346548 BIRC3 0,00089 2,887 9 26 3980926 0,02432 2,860 16 47 38311683831178 CAPNS1 0,00774 2,854 10 29 2914777 TTK 0,00064 2,845 19 55 2766492 C4orf34 0,00000 2,845 106 301 3696697 NOB1 0,00015 2,822 14 38 2440354 CD48 0,00019 2,807 90 252 3590086 RAD51 0,00067 2,802 44 124 3837731 EMP3 0,00002 2,798 29 81 3214451 NFIL3 0,00236 2,788 18 49 3625761 MNS1 0,00097 2,775 32 89 38195433819609 HNRNPM 0,02767 2,769 60 166 2742985 PLK4 0,00033 2,761 39 107 2855058 OXCT1 0,00001 2,757 42 117 3044753 LSM5 0,00634 2,752 21 58 2893392 LY86 0,00138 2,752 16 44 3384321 RAB30 0,00083 2,739 14 39 28746862874696 HINT1 0,00867 2,714 60 164 2553730 MTIF2 0,00001 2,714 29 78 3982560 P2RY10 0,00001 2,711 10 27 3433747 RFC5 0,00001 2,711 50 137 2722377 STIM2 0,00000 2,709 67 181 2416218 ITGB3BP 0,00335 2,701 51 137 2565243 0,01679 2,701 68 184 4052881 FAM72D 0,00112 2,696 41 112 2320112 0,04919 2,692 18 49 3869847 ZNF468 0,02632 2,683 9 24 2835792 GM2A 0,00051 2,683 38 103 3082590 LOC286161 0,00204 2,681 51 138 3776139 NDC80 0,00773 2,660 56 149 2838656 HMMR 0,00713 2,659 61 161 3256560 MINPP1 0,00097 2,659 9 23 3375999 C11orf48 0,00259 2,657 69 185 2908488 0,00050 2,654 158 420 3556266 0,02472 2,648 24 62 2897172 RNF144B 0,00006 2,645 31 82 2709606 RPL39L 0,00073 2,644 157 415 2968375 0,00614 2,642 14 36 2565219 0,01402 2,636 29 76 2920962 FIG4 0,00000 2,633 26 67 3728037 SCPEP1 0,00000 2,623 37 97 2585933 SPC25 0,01911 2,622 106 279 3408505 LRMP 0,00000 2,620 88 230 2652675 ECT2 0,00058 2,619 28 74 2901699 0,01424 2,618 29 77 3145107 CCNE2 0,00103 2,610 49 128 3676739 0,00673 2,607 25 65 3275524 0,00231 2,602 10 25 2450345 KIF14 0,00032 2,597 32 84 2733483 BMP3 0,00025 2,584 25 64 2780172 CENPE 0,00154 2,582 29 75 3428845 C12orf48 0,00008 2,579 9 23 2406722 LSM10 0,00183 2,577 8 21 3275588 0,04703 2,565 17 44 3633794 ETFA 0,00007 2,565 68 173 3212277 C9orf64 0,00003 2,565 8 20 2933522 GTF2H5 0,01438 2,564 15 39 2557657 0,02184 2,562 13 33 2818454 XRCC4 0,00029 2,561 38 97 3328069 HSD17B12 0,00038 2,547 19 48 3279058 ACBD7 0,02488 2,546 12 31 2364438 NUF2 0,00554 2,546 78 197 3699767 0,00021 2,545 88 224 2859667 CENPK 0,00630 2,543 68 173 2783473 C4orf3 0,00854 2,538 183 465 2940920 EEF1E1 0,00220 2,535 10 24 33627193362764 EIF4G2 0,00040 2,525 72 183 4015763 GLA 0,00007 2,518 29 74 2363852 FCRLA 0,00014 2,517 17 43 2515369 HAT1 0,00225 2,514 79 199 2413423 TMEM48 0,00028 2,510 33 83 3551778 0,02130 2,506 29 73 3807569 ACAA2 0,00003 2,505 84 210 2339872 ROR1 0,00005 2,504 18 45 4013828 HMGN5 0,00026 2,504 23 58 3508330 HSPH1 0,00016 2,500 73 182 3556024 0,04054 2,497 6 15 3013952 ACN9 0,00193 2,493 23 57 3809685 0,02123 2,491 41 102 3096214 VDAC3 0,00006 2,487 155 386 2840782 0,04059 2,485 7 18 3658925 ORC6L 0,00007 2,480 69 171 3512948 C13orf18 0,03140 2,475 79 195 3141346 PEX2 0,00043 2,474 14 36 3551786 0,01147 2,474 33 81 3020192 TES 0,00059 2,470 45 112 3020222 LOC100128868 0,02468 2,469 5 13 2589868 CCDC141 0,00007 2,463 14 34 3066436 PUS7 0,00018 2,462 7 17 3389450 CASP1 0,02974 2,462 48 118 2565147 0,00019 2,461 93 230 3773312 EIF4A3 0,00001 2,458 82 201 23187362318743 PARK7 0,00044 2,452 102 250 3318009 RRM1 0,00009 2,451 85 208 3012064 CDK14 0,00909 2,447 47 114 3275154 0,01193 2,447 83 204 3527514 PNP 0,00025 2,446 36 89 2620256 KIF15 0,00454 2,438 75 184 2346399 CDC7 0,00163 2,437 52 127 2406420 CLSPN 0,00708 2,435 86 209 2409904 EIF2B3 0,00096 2,430 33 80 3630219 0,02026 2,430 11 27 3689880 SHCBP1 0,00039 2,429 61 148 25999012599907 C2orf24 0,02759 2,426 16 40 3417146 CDK2 0,00006 2,420 67 163 2813414 CCNB1 0,00253 2,417 121 293 2778980 EIF4E 0,00343 2,416 51 123 2877378 CDC25C 0,00188 2,413 18 44 2610241 FANCD2 0,00000 2,409 32 77 3331903 FAM111B 0,00232 2,406 116 280 3403092 PTPN6 0,00000 2,406 57 138 3570089 0,00743 2,402 16 37 2971678 MCM9 0,00062 2,401 30 73 2924619 TRMT11 0,00071 2,396 16 38 3204648 CD72 0,00073 2,393 91 217 34702533470259 SART3 0,00541 2,392 23 54 2841342 0,02523 2,392 14 33 2411228 STIL 0,00095 2,391 23 54 3004768 ZNF273 0,00603 2,384 12 28 2401643 FUCA1 0,00008 2,382 13 30 4045780 SFRS13A 0,00116 2,381 89 212 2840640 0,00012 2,380 337 801 3419849 TBK1 0,00000 2,377 32 75 3223687 PHF19 0,00024 2,377 9 20 3257338 KIF20B 0,00079 2,377 38 91 3255506 0,04206 2,375 11 26 2328613 0,00856 2,373 10 23 3448152 ITPR2 0,00000 2,372 62 147 3854218 HAUS8 0,00012 2,372 28 67 2729667 STAP1 0,00330 2,372 32 77 2842561 HIGD2A 0,01957 2,372 73 173 2975655 FAM54A 0,02133 2,371 65 155 3875195 MCM8 0,00025 2,370 56 132 3258168 KIF11 0,01310 2,370 78 185 3958341 0,04395 2,368 8 19 32751323275175 GDI2 0,00246 2,362 125 296 3991698 HPRT1 0,00098 2,360 62 147 3354210 SPA17 0,00100 2,357 21 49 3699764 0,00015 2,353 85 201 2318759 0,03259 2,351 7 17 3764002 MRPS23 0,00022 2,346 35 81 3301011 NOC3L 0,00038 2,343 18 42 3105430 LRRCC1 0,00082 2,340 24 57 2946268 HIST1H2BC 0,03107 2,340 109 254 3781980 TTC39C 0,00003 2,335 33 76 3556228 0,02323 2,331 41 95 2379754 SMYD2 0,00003 2,330 32 75 3554851 CRIP1 0,04773 2,325 30 70 2339414 USP1 0,00552 2,323 71 164 3076489 MRPS33 0,00741 2,323 38 89 3258910 HELLS 0,00191 2,321 90 208 33627193362739 EIF4G2 0,02339 2,320 54 126 2753952 ING2 0,00125 2,318 36 84 2438482 ISG20L2 0,00003 2,318 38 89 3470342 0,03751 2,317 9 20 3351775 TRAPPC4 0,00161 2,317 28 64 2952679 GLO1 0,00301 2,312 93 215 3367338 KIF18A 0,00128 2,307 27 62 2853275 CAPSL 0,00019 2,307 16 37 3168508 MELK 0,00342 2,306 44 101 2717165 TBC1D14 0,00001 2,305 114 262 2784027 ANXA5 0,03840 2,304 92 212 3539724 SYNE2 0,00592 2,303 36 84 3212300 0,03049 2,303 128 296 2521479 HSPE1 0,01524 2,299 29 66 2709486 RFC4 0,00279 2,298 91 209 3040967 RAPGEF5 0,00013 2,296 27 63 37257793725803 MYST2 0,04298 2,295 25 58 2754582 SNX25 0,00099 2,295 26 60 2577896 MCM6 0,01079 2,292 126 289 3275578 0,04091 2,292 36 84 3570109 0,04668 2,290 19 44 2766456 UGDH 0,00283 2,289 36 82 3516639 PCDH9 0,00005 2,289 27 62 2665572 SGOL1 0,00140 2,288 66 151 3364755 0,01493 2,287 42 97 3461341 CPM 0,00044 2,286 12 27 2908501 0,00036 2,286 208 475 3322072 0,02575 2,285 48 110 2991395 HDAC9 0,00000 2,282 24 54 2616932 MLH1 0,00022 2,282 50 113 2768145 COMMD8 0,00280 2,280 8 17 2451200 UBE2T 0,00467 2,280 74 169 3750785 SPAG5 0,00004 2,278 31 71 2374956 TIMM17A 0,00159 2,272 100 228 3565663 DLGAP5 0,00661 2,272 103 235 2881860 CCDC69 0,00009 2,271 80 182 3910785 AURKA 0,00729 2,270 38 87 3011454 DBF4 0,00038 2,269 11 25 3387483 MTMR2 0,00001 2,267 33 75 3335798 0,01061 2,267 38 86 3504617 SKA3 0,00385 2,264 40 91 3472089 RPL6 0,01908 2,264 16 35 3720896 CDC6 0,01081 2,261 94 212 3485863 EXOSC8 0,00162 2,260 43 98 2758686 LYAR 0,00595 2,256 31 70 3309383 PRDX3 0,00001 2,255 42 96 2826343 SNX24 0,00013 2,254 10 23 2840002 CCDC99 0,00398 2,253 87 195 3728964 PRR11 0,00094 2,251 49 111 2485176 MDH1 0,00013 2,249 39 87 3959657 0,01561 2,248 71 160 3513995 DLEU2 0,00358 2,248 13 28 2841392 0,03241 2,246 103 230 25362982536329 0,00118 2,245 59 132 2388219 EXO1 0,00554 2,244 62 139 2974635 VNN2 0,00065 2,244 11 24 2425118 SASS6 0,00072 2,243 29 66 2469094 TAF1B 0,00099 2,242 10 22 3471224 GPN3 0,00181 2,240 24 55 3621623 ELL3 0,00002 2,239 21 46 3150715 DSCC1 0,00397 2,238 41 92 2595443 WDR12 0,00707 2,238 51 113 3235789 MCM10 0,00090 2,237 48 108 3758317 BRCA1 0,00029 2,236 35 77 24062452406253 PSMB2 0,00475 2,235 106 237 23336582333677 ATP6V0B 0,04818 2,234 39 88 2349129 S1PR1 0,00087 2,232 16 35 3340697 UVRAG 0,00010 2,232 52 116 3683806 ERI2 0,00035 2,231 22 50 3515965 DIAPH3 0,00359 2,229 35 79 3958269 0,00044 2,226 43 96 2480992 MSH2 0,00029 2,225 71 158 2911413 PRIM2 0,00129 2,222 15 34 35700493570053 ERH 0,00460 2,222 67 149 2496536 RPL31 0,02268 2,221 38 84 3397589 ETS1 0,00000 2,220 80 178 3829687 GPI 0,00026 2,217 43 94 3512874 LCP1 0,00001 2,214 356 788 2871717 CCDC112 0,00037 2,213 15 34 2894689 TMEM14C 0,00046 2,210 20 44 2559696 TPRKB 0,00185 2,209 31 69 2720251 NCAPG 0,00657 2,207 138 305 3236538 RPP38 0,00312 2,206 9 19 2565221 0,02362 2,206 13 28 2866543 CETN3 0,00333 2,206 62 138 2463515 CHML 0,00010 2,203 44 97 3311157 OAT 0,00227 2,199 27 60 2633460 C3orf26 0,00043 2,197 46 102 33627193362762 EIF4G2 0,00969 2,195 73 160 2868283 RIOK2 0,00019 2,194 38 83 2687979 KIAA1524 0,00181 2,193 20 44 2993690 0,00780 2,193 42 93 2403470 DNAJC8 0,01540 2,192 80 176 2406766 MRPS15 0,00017 2,190 59 129 3468301 PMCH 0,01297 2,184 8 18 3340269 POLD3 0,00093 2,182 152 331 34749353474950 ANAPC5 0,04545 2,182 32 69 3056414 RFC2 0,00050 2,181 50 108 3113456 MTBP 0,00164 2,180 14 31 4011743 SLC7A3 0,00040 2,175 32 70 3505449 MIPEP 0,00000 2,175 24 53 3726934 NME1 0,00003 2,172 100 218 3347615 ACAT1 0,00014 2,172 21 46 2687840 IFT57 0,00053 2,172 25 54 2517013 MTX2 0,00787 2,172 11 25 3458133 PRIM1 0,00106 2,171 52 113 3477917 SLC15A4 0,00016 2,169 35 75 3743524 0,04495 2,168 12 27 3228097 TTF1 0,00033 2,167 19 42 3060245 SLC25A40 0,00855 2,165 21 46 3261923 AS3MT 0,01026 2,163 8 17 25651432565145 STARD7 0,00003 2,162 312 675 3494137 LMO7 0,00000 2,162 15 33 4050485 TUBB2C 0,04986 2,161 26 57 2746024 ABCE1 0,00801 2,157 50 109 3672489 IRF8 0,00050 2,157 25 55 3082181 NCAPG2 0,00197 2,156 43 92 3505937 CENPJ 0,00039 2,155 49 105 2783715 MAD2L1 0,03006 2,154 91 197 2974671 C6orf192 0,00094 2,154 14 30 2830638 KIF20A 0,00397 2,153 29 62 3409330 MRPS35 0,00038 2,153 41 88 2858592 DEPDC1B 0,01272 2,151 78 168 3607537 FANCI 0,00110 2,150 81 174 3959651 0,01652 2,150 46 100 3630217 0,02636 2,148 12 27 3301512 ALDH18A1 0,00126 2,148 33 71 3916290 FLJ42200 0,00529 2,148 7 16 3618736 RASGRP1 0,00005 2,145 38 82 2674418 0,01748 2,145 12 26 3352503 ARHGEF12 0,00231 2,143 14 30 3485074 RFC3 0,00086 2,140 127 271 2526759 ATIC 0,00054 2,140 73 156 3945572 APOBEC3C 0,00157 2,138 37 79 2878246 PFDN1 0,00007 2,138 25 54 3391816 USP28 0,00053 2,135 28 61 3429857 C12orf75 0,00173 2,132 110 235 2992963 CCDC126 0,00062 2,129 13 29 3333443 ASRGL1 0,00495 2,128 20 42 3608298 BLM 0,00027 2,126 64 135 2570616 BUB1 0,00155 2,124 65 138 2558595 FAM136A 0,00012 2,120 22 46 3179359 CENPP 0,00182 2,118 29 61 3090697 CDCA2 0,00186 2,116 30 63 3289031 TIMM23 0,00210 2,115 175 370 2565148 0,00003 2,114 269 568 2878446 NDUFA2 0,00990 2,113 128 271 2436141 0,00667 2,113 157 332 3460584 LLPH 0,00327 2,112 43 91 2913277 KCNQ5 0,00018 2,108 33 70 3752258 EVI2B 0,00011 2,108 79 166 2494484 NCAPH 0,00471 2,107 64 135 3707990 TXNDC17 0,00015 2,106 111 234 3145567 UQCRB 0,01363 2,105 9 20 2427720 DRAM2 0,00220 2,104 59 124 3881443 TPX2 0,00656 2,103 125 262 2908486 0,00335 2,102 265 557 3139950 LACTB2 0,00041 2,102 9 19 35700493570052 ERH 0,00018 2,100 193 406 38421413842156 RPL28 0,01796 2,100 39 83 2967650 RTN4IP1 0,00042 2,099 30 64 2571457 CKAP2L 0,00941 2,098 68 143 2594535 PPIL3 0,00060 2,097 94 198 3980917 0,00051 2,097 105 221 2860666 TAF9 0,00901 2,097 20 43 2612813 PLCL2 0,00011 2,095 78 163 2853768 NUP155 0,00083 2,095 69 144 3556966 HAUS4 0,00001 2,092 62 129 2635263 DZIP3 0,00000 2,091 19 39 3722060 VPS25 0,00919 2,089 56 117 39582533958267 C22orf28 0,00641 2,089 81 170 2748198 KIAA0922 0,00050 2,088 139 291 2805581 SUB1 0,00009 2,087 66 138 3468261 NUP37 0,00124 2,087 49 102 3240012 MASTL 0,00547 2,085 59 123 2378937 DTL 0,00712 2,085 207 432 2796510 MLF1IP 0,02985 2,085 84 175 2413685 SSBP3 0,00343 2,084 14 29 2347023 CCDC18 0,00455 2,081 48 99 3224591 STRBP 0,00002 2,079 158 329 2449559 ASPM 0,01597 2,078 80 167 3109201 SPAG1 0,00001 2,077 10 21 3589697 BUB1B 0,00239 2,077 141 292 2711644 ATP13A3 0,00004 2,075 58 120 2604254 HJURP 0,00224 2,074 67 139 2463425 FH 0,00053 2,072 31 65 2417174 SERBP1 0,03368 2,071 207 428 2737596 BANK1 0,00034 2,070 46 95 3306299 XPNPEP1 0,00025 2,070 137 284 2502300 DDX18 0,00279 2,068 112 231 3888133 CSE1L 0,00050 2,067 104 214 3591365 ADAL 0,00248 2,064 21 43 3428088 ACTR6 0,00285 2,062 17 36 25651432565160 STARD7 0,00037 2,062 485 1001 3742627 C17orf87 0,03207 2,062 13 27 3728776 RAD51C 0,00059 2,059 72 148 3630195 0,00559 2,057 303 624 3497790 IPO5 0,00008 2,055 109 223 2761151 RAB28 0,00812 2,055 16 34 2428501 SLC16A1 0,00804 2,052 75 155 3354799 CHEK1 0,00900 2,051 110 226 2365958 MPZL1 0,00002 2,051 46 94 2636695 ZDHHC23 0,00020 2,050 22 44 3374934 MS4A6A 0,00465 2,050 13 27 2531233 SP140 0,00208 2,050 7 14 3401804 RAD51AP1 0,00168 2,050 197 403 3628469 RPS27L 0,02888 2,049 47 97 2784113 CCNA2 0,00593 2,049 85 175 2766262 TLR6 0,01045 2,049 6 12 2965674 NDUFAF4 0,02698 2,046 49 100 2691575 POLQ 0,00400 2,046 44 91 3563395 POLE2 0,00421 2,045 13 26 3435362 KNTC1 0,00130 2,045 53 109 3841756 KIR2DL1 0,02233 2,041 10 19 3475020 0,04295 2,041 45 92 3756193 TOP2A 0,01087 2,040 269 549 3968664 HCCS 0,00001 2,039 46 93 3642572 SNRNP25 0,00011 2,038 160 326 3219621 CTNNAL1 0,00415 2,036 43 88 2403557 SNORA44 0,00168 2,033 90 182 3541137 EIF2S1 0,00016 2,032 199 404 3828112 CCNE1 0,00026 2,031 32 66 2343025 AK5 0,00072 2,031 20 40 3180263 HIATL1 0,00023 2,031 48 97 2417737 LRRC40 0,00121 2,030 20 40 3365776 E2F8 0,00960 2,029 73 149 2674245 0,03898 2,028 127 258 36997573699779 KARS 0,04494 2,028 55 112 25651432565163 STARD7 0,00935 2,028 173 351 2737840 CISD2 0,02088 2,027 52 105 2837810 UBLCP1 0,00030 2,027 59 119 2379863 CENPF 0,03013 2,026 206 418 2351854 C1orf162 0,00202 2,025 44 88 3725856 0,02488 2,024 14 28 3763270 MMD 0,00124 2,023 31 63 3197528 C9orf46 0,00737 2,023 9 19 3984655 CENPI 0,00309 2,020 25 50 3141809 MRPS28 0,00890 2,020 29 59 3176999 RMI1 0,00081 2,019 50 102 2820622 ANKRD32 0,00647 2,019 25 51 3878533 DTD1 0,00746 2,018 65 132 3752424 C17orf79 0,00064 2,016 23 47 38096713809680 NARS 0,03975 2,016 54 109 3676692 0,02300 2,014 100 201 3972093 POLA1 0,00042 2,014 114 231 2580635 MMADHC 0,01557 2,013 94 189 3703112 GINS2 0,00061 2,012 83 166 3258444 CEP55 0,00386 2,011 27 54 2654091 USP13 0,00109 2,011 35 71 3565571 WDHD1 0,00607 2,011 99 200 3451670 PUS7L 0,00037 2,010 12 24 3765580 BRIP1 0,00072 2,008 65 130 2700500 COMMD2 0,00093 2,008 106 213 3980898 0,02304 2,007 57 113 3591704 WDR76 0,01470 2,005 122 245 3591281 TMEM62 0,00007 2,005 24 47 3421523 YEATS4 0,00162 2,004 126 253 3096456 0,03288 2,004 62 124 2913694 CD109 0,00004 -2,007 27 14 2329341 ZSCAN20 0,01210 -2,009 52 26 3870733 LILRB2 0,00064 -2,012 45 23 2515627 ITGA6 0,00020 -2,015 27 14 3430086 TCP11L2 0,01400 -2,018 52 26 2692447 MYLK 0,00001 -2,025 85 42 2902427 LST1 0,00246 -2,026 93 46 3917582 KRTAP6-3 0,00058 -2,026 80 39 3974019 TSPAN7 0,00382 -2,028 20 10 3357279 VPS26B 0,00097 -2,029 64 31 3841357 LILRA2 0,00283 -2,029 40 20 3307939 ABLIM1 0,00003 -2,031 51 25 3046681 TARP 0,01946 -2,035 27 13 3749654 0,01958 -2,038 25 12 3902552 FOXS1 0,00064 -2,038 31 15 2360206 ATP8B2 0,00004 -2,044 49 24 2406375 0,00054 -2,047 82 40 3401704 CCND2 0,02514 -2,048 25 12 2650393 PPM1L 0,01080 -2,049 40 19 3551713 0,01276 -2,049 98 48 3407096 PLEKHA5 0,00019 -2,053 54 26 3362789 0,02779 -2,054 63 30 2969406 SLC22A16 0,00000 -2,057 34 16 3335808 0,00689 -2,057 526 256 2352106 CTTNBP2NL 0,00043 -2,073 30 14 3774504 0,00984 -2,077 81 39 2766122 FLJ13197 0,00547 -2,079 20 10 2901753 0,01889 -2,086 331 159 3088048 NSAP11 0,00372 -2,099 22 11 2793198 0,04573 -2,100 10 5 3361040 0,03732 -2,107 14 7 3624145 DMXL2 0,00094 -2,108 26 12 2790109 ANXA2P1 0,00143 -2,114 21 10 2716713 STK32B 0,00032 -2,116 71 33 3351461 MLL 0,00080 -2,117 93 44 2969886 FYN 0,00509 -2,124 77 36 2746119 SMAD1 0,01409 -2,137 147 69 3264744 0,00053 -2,141 31 14 3594031 TMOD2 0,00017 -2,148 27 13 3619185 0,00718 -2,156 132 61 2599946 0,01893 -2,157 18 8 3402736 PTMS 0,00000 -2,160 100 46 3147508 KLF10 0,00239 -2,163 101 47 2832045 0,02139 -2,164 110 51 3610958 IGF1R 0,00104 -2,166 76 35 3174816 ANXA1 0,03347 -2,168 14 6 2406351 0,01643 -2,178 113 52 2374746 NAV1 0,00011 -2,185 70 32 2776372 WDFY3 0,00027 -2,194 14 6 3925639 NRIP1 0,00010 -2,200 415 188 2735759 MMRN1 0,00000 -2,205 25 11 2786732 MAML3 0,00000 -2,217 39 17 3699870 0,01090 -2,228 28 12 2985026 GPR31 0,04184 -2,231 13 6 2318865 0,02915 -2,232 18 8 3840883 ZNF761 0,00096 -2,248 90 40 2362282 OR10Z1 0,02133 -2,249 17 8 3722331 0,02072 -2,251 25 11 3405032 ETV6 0,00000 -2,263 189 83 3484060 ALOX5AP 0,02326 -2,266 137 60 3453506 0,00718 -2,279 32 14 3130872 DUSP26 0,00018 -2,284 51 22 2616596 ARPP21 0,03303 -2,298 250 109 3802602 CDH2 0,00005 -2,302 31 13 2615060 RBMS3 0,00757 -2,306 16 7 2745899 HHIP 0,00225 -2,314 34 15 2982319 SOD2 0,01076 -2,316 317 137 3327143 RAG1 0,00011 -2,321 73 32 3145149 TP53INP1 0,00332 -2,322 368 159 2931569 AKAP12 0,03062 -2,324 373 160 4047185 CCRL2 0,01526 -2,331 22 9 3556709 0,00073 -2,344 31 13 2362537 FCER1A 0,00580 -2,353 36 15 3429676 0,00131 -2,360 120 51 3713539 FAM18B 0,00009 -2,364 32 13 3825153 0,00963 -2,399 103 43 2318815 0,01237 -2,411 99 41 3096575 HGSNAT 0,00968 -2,426 130 53 3831223 0,03105 -2,427 17 7 3548050 PRO1768 0,00057 -2,434 86 35 2872047 SEMA6A 0,00019 -2,445 49 20 2439373 SPTA1 0,00130 -2,446 48 20 3126504 CSGALNACT1 0,00188 -2,472 39 16 3740638 0,04467 -2,472 71 29 3951136 RPL23AP82 0,00338 -2,475 20 8 2745547 GAB1 0,00653 -2,475 306 123 3923850 KRTAP10-7 0,00481 -2,492 104 42 3945006 H1F0 0,00005 -2,496 70 28 3676747 0,02981 -2,498 25 10 3695107 TK2 0,00086 -2,500 41 16 2608469 ITPR1 0,00006 -2,521 122 48 3335822 0,01189 -2,522 28 11 2395564 SLC2A5 0,00000 -2,534 42 16 3426257 SOCS2 0,00000 -2,553 107 42 3932261 C21orf87 0,00033 -2,553 28 11 2340529 PDE4B 0,00579 -2,556 122 48 2849992 FAM134B 0,00001 -2,580 56 22 3852944 OR7C1 0,00114 -2,591 14 5 3435192 MLXIP 0,00001 -2,606 124 48 2665199 SATB1 0,00011 -2,607 141 54 3126191 PSD3 0,03270 -2,616 85 33 3286792 C10orf25 0,00959 -2,628 60 23 3569814 ACTN1 0,00000 -2,681 80 30 2491676 VAMP5 0,00003 -2,714 78 29 2777564 FAM13A 0,00006 -2,722 44 16 3126368 PSD3 0,00613 -2,726 35 13 2886595 LCP2 0,00000 -2,728 81 30 4014387 RPSAP15 0,02907 -2,734 35 13 3956589 XBP1 0,00001 -2,735 221 81 3767169 LRRC37A3 0,00208 -2,736 22 8 2784687 ANKRD50 0,00044 -2,740 264 96 37424153742428 SPAG7 0,00206 -2,753 209 76 3825154 0,00959 -2,756 23 8 2444283 TNFSF4 0,00015 -2,766 38 14 3677177 0,01250 -2,810 834 297 2840652 0,00760 -2,850 85 30 2723997 KLF3 0,00012 -2,853 168 59 2701033 P2RY14 0,00051 -2,874 101 35 3383227 GAB2 0,00001 -2,887 193 67 3517251 DACH1 0,00000 -2,890 52 18 3928590 KRTAP21-1 0,01662 -2,922 24 8 2833623 HMHB1 0,00219 -2,960 580 196 2536965 FLJ38379 0,00296 -2,986 159 53 3749606 0,03037 -3,018 42 14 3254609 SH2D4B 0,00005 -3,024 62 20 2742224 SPRY1 0,00002 -3,133 150 48 2633256 ST3GAL6 0,00019 -3,156 35 11 3441849 TNFRSF1A 0,00000 -3,177 85 27 3819749 0,01137 -3,193 51 16 3937967 FLJ26056 0,03637 -3,279 56 17 3230397 LCN6 0,00038 -3,338 92 28 3264621 TCF7L2 0,00000 -3,479 126 36 2542972 NDUFAF2 0,02384 -3,490 7 2 2375706 ATP2B4 0,00000 -3,530 123 35 3811000 RNF152 0,00001 -3,543 65 18 3226138 AK1 0,00004 -3,555 72 20 2678714 FHIT 0,00000 -3,558 219 61 3966225 RABL2B 0,00156 -3,779 92 24 2421995 GBP4 0,00004 -3,969 128 32 3852880 EMR2 0,00000 -4,168 66 16 2571510 IL1B 0,00000 -4,451 74 17 3993360 SPANXB1 0,02237 -4,455 53 12 3046556 TARP 0,00022 -4,458 76 17 2679014 NPCDR1 0,00014 -4,519 108 24 2453307 CD34 0,00000 -4,600 85 18 3427098 ELK3 0,00000 -4,650 221 47 2649824 SCHIP1 0,00002 -4,678 136 29 3031533 GIMAP4 0,00016 -4,978 70 14 3259503 DNTT 0,00215 -5,234 727 139 3766796 PECAM1 0,00000 -5,515 271 49 3624513 MYO5C 0,00000 -5,670 65 11 3012978 GNG11 0,00098 -5,928 20 3 3301782 OPALIN 0,00000 -6,078 78 13 3931765 ERG 0,00001 -6,940 365 53

Adult PreBII s vs PreBII L Mean signal Transcript Cluster Gene Symbol p-value fold change PreBII L PreBII s

2844381 0,00994 6,121 7 43 2841330 0,01957 4,493 17 77 3825154 0,00080 3,550 8 30 3819749 0,01045 2,970 16 47 3012978 GNG11 0,02272 2,949 3 10 3749652 0,01795 2,751 6 15 3749634 0,02882 2,715 9 24 3353876 OR10G9 0,00006 2,630 23 61 2557641 0,02421 2,594 16 40 3046556 TARP 0,00698 2,591 17 44 3337740 0,00229 2,580 5 12 2678714 FHIT 0,00015 2,424 61 149 3392906 0,01168 2,419 9 21 3699870 0,00335 2,390 12 30 3430086 TCP11L2 0,00210 2,315 26 60 3931765 ERG 0,01685 2,271 53 119 2679014 NPCDR1 0,01588 2,266 24 54 2733483 BMP3 0,00063 2,241 64 144 3928590 KRTAP21-1 0,04848 2,235 8 18 3226138 AK1 0,00315 2,187 20 44 3031533 GIMAP4 0,03098 2,178 14 31 3335842 0,03727 2,126 178 379 2362282 OR10Z1 0,02137 2,117 8 16 2362537 FCER1A 0,00870 2,113 15 32 3766796 PECAM1 0,00643 2,097 49 103 2968456 0,04695 2,068 6 13 3301782 OPALIN 0,00649 2,037 13 26 2571510 IL1B 0,00387 2,035 17 34 3335820 0,04773 2,035 17 35 2844299 0,02104 2,034 10 20 2784687 ANKRD50 0,00608 2,008 96 194 3811000 RNF152 0,00281 2,008 18 37 2557633 0,00371 2,003 153 306 2840682 0,04065 -2,001 82 41 3527514 PNP 0,00150 -2,003 89 44 3475020 0,03264 -2,014 92 46 3556202 0,04323 -2,019 19 9 3168508 MELK 0,00672 -2,031 101 50 2775532 0,01218 -2,031 20 10 3658925 ORC6L 0,00048 -2,035 171 84 3409330 MRPS35 0,00037 -2,038 88 43 29016872901714 ABCF1 0,02001 -2,040 38 19 3565663 DLGAP5 0,00975 -2,052 235 115 2908486 0,00229 -2,053 557 271 2828135 LYRM7 0,04199 -2,055 79 38 2968373 0,01059 -2,058 39 19 2758686 LYAR 0,00797 -2,061 70 34 3212300 0,04133 -2,065 296 143 3629103 KIAA0101 0,02560 -2,073 298 144 2521479 HSPE1 0,01997 -2,087 66 32 3577256 C14orf142 0,04547 -2,088 69 33 3844035 0,03107 -2,089 48 23 3556258 0,00554 -2,089 46 22 3513995 DLEU2 0,00405 -2,092 28 14 3464983 ATP2B1 0,00038 -2,095 118 56 3311157 OAT 0,00197 -2,099 60 29 2838656 HMMR 0,02449 -2,101 161 77 3066436 PUS7 0,00063 -2,102 17 8 2914777 TTK 0,00632 -2,105 55 26 2780172 CENPE 0,00599 -2,106 75 35 3428845 C12orf48 0,00051 -2,108 23 11 3672489 IRF8 0,00029 -2,115 55 26 2674355 0,04603 -2,116 40 19 3175971 PSAT1 0,00751 -2,120 29 13 2823880 CAMK4 0,01058 -2,126 73 34 3819602 0,03323 -2,129 253 119 2772566 IGJ 0,02978 -2,130 372 175 3827218 RPSAP58 0,04117 -2,133 32 15 3556292 0,02530 -2,134 76 36 2450345 KIF14 0,00145 -2,145 84 39 2968416 0,03765 -2,150 22 10 3555521 GAFA1 0,00800 -2,153 28 13 36997573699779 KARS 0,02005 -2,157 112 52 3515965 DIAPH3 0,00266 -2,158 79 36 2840712 0,03844 -2,160 61 28 3556194 0,04627 -2,169 47 22 3676692 0,00763 -2,169 201 93 3593575 SLC27A2 0,00030 -2,184 28 13 3743512 0,03551 -2,193 49 22 2417528 DEPDC1 0,01552 -2,204 49 22 3556058 0,01889 -2,207 12 5 3556080 0,01968 -2,208 8 3 3419807 XPOT 0,00116 -2,212 39 18 4052881 FAM72D 0,00382 -2,222 112 50 3260586 SCD 0,00239 -2,224 18 8 3013952 ACN9 0,00293 -2,239 57 26 2844409 0,03651 -2,245 15 7 3291435 RTKN2 0,00225 -2,264 54 24 2831968 0,01340 -2,265 529 234 33627193362739 EIF4G2 0,01653 -2,290 126 55 2840660 0,00916 -2,290 127 56 33357743335789 SART1 0,00233 -2,295 47 20 3625761 MNS1 0,00306 -2,297 89 39 3389450 CASP1 0,02792 -2,327 118 51 3434393 DYNLL1 0,02481 -2,334 396 170 3669552 VAT1L 0,00017 -2,336 98 42 3505319 SACS 0,00062 -2,345 47 20 3749622 0,02679 -2,353 15 7 3840642 ZNF818P 0,01140 -2,358 20 8 3855100 0,00082 -2,359 26 11 3248289 CDK1 0,00464 -2,367 50 21 2766192 TLR10 0,00882 -2,367 122 52 2557567 0,00494 -2,372 114 48 38195433819609 HNRNPM 0,04201 -2,376 166 70 3556036 0,01889 -2,381 37 16 3556668 0,03872 -2,383 16 7 3973839 CYBB 0,01285 -2,389 54 22 3725868 0,04492 -2,401 13 5 2729667 STAP1 0,00149 -2,402 77 32 3676682 0,01559 -2,406 46 19 28746862874696 HINT1 0,01206 -2,409 164 68 2363618 SDHC 0,03195 -2,435 26 11 3556162 0,00393 -2,442 13 5 3298738 WAPAL 0,01383 -2,451 159 65 2737596 BANK1 0,00001 -2,468 95 39 3253461 0,04587 -2,492 18 7 3275588 0,03802 -2,494 44 18 3630197 0,04661 -2,501 12 5 3708826 EIF4A1 0,00975 -2,512 128 51 4013828 HMGN5 0,00010 -2,514 58 23 2514563 KLHL23 0,01220 -2,515 52 21 2320064 0,02292 -2,530 281 111 2686775 0,04398 -2,535 175 69 2496536 RPL31 0,00508 -2,536 84 33 3556100 0,02546 -2,590 20 8 3551784 0,03009 -2,594 36 14 3556138 0,01145 -2,602 76 29 3129149 PBK 0,00746 -2,606 97 37 38096713809680 NARS 0,00349 -2,607 109 42 3197955 GLDC 0,00042 -2,643 153 58 3551868 0,04942 -2,696 26 10 2523632 0,01575 -2,696 110 41 2901699 0,00664 -2,715 77 28 3980922 0,02170 -2,719 10 4 3427847 0,03309 -2,728 65 24 2840674 0,02318 -2,752 24 9 3288013 BMS1P1 0,04136 -2,781 11 4 38096713809692 NARS 0,01075 -2,792 23 8 3279058 ACBD7 0,00882 -2,792 31 11 3742627 C17orf87 0,00172 -2,794 27 10 25235402523572 NBEAL1 0,01711 -2,816 13 4 2328575 0,02500 -2,847 43 15 3135567 LYPLA1 0,03078 -2,873 38 13 2674361 0,01987 -2,904 40 14 3275166 0,00441 -2,907 218 75 2468622 ID2 0,00801 -3,003 137 46 3958307 0,02092 -3,005 73 24 2565221 0,00114 -3,024 28 9 2908487 0,01017 -3,031 133 44 2328555 0,00823 -3,061 83 27 2840688 0,01258 -3,073 96 31 2674494 0,03373 -3,088 24 8 3472089 RPL6 0,00089 -3,090 35 11 2328565 0,01245 -3,111 23 7 3470322 0,02458 -3,115 56 18 2844226 0,01440 -3,139 37 12 2993658 0,00206 -3,193 34 11 3470398 0,00719 -3,252 23 7 33627193362765 EIF4G2 0,00202 -3,375 23 7 3980934 0,01534 -3,552 33 9 2674456 0,00103 -3,582 21 6 2565211 0,00613 -3,692 38 10 3253459 0,00173 -3,694 12 3 2383896 0,02272 -3,780 17 5 2844293 0,01535 -3,794 16 4 3904691 SAMHD1 0,00005 -3,870 113 29 2968289 0,03344 -3,963 12 3 3556290 0,00056 -4,006 34 9 3275574 0,00074 -4,304 17 4 3470394 0,00894 -4,356 55 13 3306591 0,00192 -4,619 27 6 3335844 0,01091 -4,916 35 7 3980910 0,00345 -4,989 22 4 3980926 0,00043 -5,083 47 9

Adult Immature B vs PreBII s Mean signal Transcript Cluster Gene Symbol p-value fold change PreBII s Immature B

2531233 SP140 0,00000 16,997 8 142 3973839 CYBB 0,00000 10,506 22 236 2445982 ANGPTL1 0,00000 7,374 18 131 3346548 BIRC3 0,00000 7,344 26 189 3384321 RAB30 0,00000 7,062 46 327 2369339 RALGPS2 0,00000 7,061 38 265 2688717 BTLA 0,00000 6,957 28 193 2968289 0,00412 6,827 3 21 2968363 0,00129 6,251 5 33 3332403 MS4A1 0,00000 6,194 77 478 3815399 CNN2 0,00000 5,938 20 119 2439052 FCRL2 0,00000 5,866 16 92 3672489 IRF8 0,00000 5,855 26 152 2968438 0,00158 5,815 3 19 2792166 0,00000 5,548 13 74 2439101 FCRL1 0,00000 5,538 62 345 2895945 0,00000 5,281 11 58 3442854 SLC2A3 0,00000 5,239 23 120 3329983 PTPRJ 0,00000 5,236 39 206 2406291 0,01130 5,191 6 33 3335844 0,00964 5,066 7 36 2950145 HLA-DOB 0,00000 5,061 32 161 2766192 TLR10 0,00002 4,904 52 253 2377283 CR2 0,00000 4,742 6 26 3013255 PEG10 0,00000 4,660 25 116 2366884 C1orf129 0,00004 4,631 14 63 2737596 BANK1 0,00000 4,629 39 179 2968444 0,00002 4,597 16 73 2968418 0,03669 4,511 19 87 3268274 PLEKHA1 0,00000 4,391 18 78 3831229 0,00845 4,355 5 22 2764192 SEL1L3 0,00000 4,290 11 46 2968285 0,00188 4,241 26 108 2353988 FAM46C 0,00000 4,170 25 105 2638988 PARP15 0,00001 4,062 49 197 2968357 0,00273 4,057 9 38 3926271 TMPRSS15 0,00000 4,050 4 14 3253452 0,01246 4,032 5 20 3742627 C17orf87 0,00006 4,011 10 39 2968448 0,04828 3,964 11 45 3291601 EGR2 0,00001 3,949 28 112 2968287 0,00883 3,929 42 164 2557651 0,00568 3,895 6 22 3958341 0,00132 3,847 10 39 2968416 0,00067 3,817 10 40 3718930 CCL4 0,00020 3,809 6 25 2734421 ARHGAP24 0,00000 3,746 14 52 2968281 0,00004 3,693 32 117 3151970 MTSS1 0,00000 3,611 58 211 2968295 0,00068 3,547 180 638 3374934 MS4A6A 0,00000 3,539 31 110 3464983 ATP2B1 0,00000 3,505 56 197 2438892 FCRL5 0,00000 3,456 7 25 3335812 0,01276 3,445 68 234 3470322 0,01519 3,443 18 62 3982560 P2RY10 0,00000 3,418 19 67 2968343 0,00919 3,404 11 36 4013460 CYSLTR1 0,00000 3,359 24 80 2582124 NR4A2 0,00032 3,325 14 47 2674309 0,00717 3,315 3 11 3392902 0,00705 3,295 9 31 3090209 ADAM28 0,00318 3,275 10 32 2508520 KYNU 0,00009 3,267 5 15 2362201 CD1C 0,00000 3,262 12 38 2860178 CD180 0,00002 3,222 52 167 2536478 0,00357 3,217 70 224 3173673 PIP5K1B 0,00000 3,217 31 100 25235402523572 NBEAL1 0,00869 3,163 4 14 3250650 0,02111 3,147 6 18 3824874 IFI30 0,00000 3,132 14 43 2766289 TMEM156 0,00027 3,117 19 60 3244622 ALOX5 0,00000 3,116 31 97 3527662 RNASE6 0,00042 3,098 17 54 3392900 0,00599 3,080 18 56 2968373 0,00020 3,077 19 58 2844339 0,00127 3,070 11 33 3740618 0,00334 3,066 6 18 3840642 ZNF818P 0,00144 3,060 8 26 3556668 0,01029 3,006 7 21 2664209 SH3BP5 0,00000 3,001 28 85 2968377 0,00004 2,980 133 398 2565211 0,02012 2,964 10 30 2901751 0,01202 2,963 5 16 2388085 KMO 0,00002 2,961 50 147 3444503 TAS2R31 0,02239 2,950 14 40 3430125 0,00287 2,946 6 17 4017212 MORC4 0,00337 2,944 10 29 3208355 CBWD3 0,02236 2,944 8 22 2830861 EGR1 0,00000 2,930 47 138 2840654 0,01984 2,927 21 62 3306591 0,02435 2,902 6 17 2536422 0,00738 2,894 8 22 3319997 SWAP70 0,00000 2,863 100 285 3275200 0,02160 2,860 6 16 2949091 0,04298 2,852 9 27 3098977 LYN 0,00035 2,840 126 357 3556290 0,00689 2,833 9 24 4044363 CNR2 0,00005 2,829 31 87 3959720 0,02602 2,796 7 19 2600689 EPHA4 0,00002 2,793 13 36 3662387 HERPUD1 0,00000 2,758 99 273 2729667 STAP1 0,00035 2,749 32 88 3403595 CLEC4A 0,00000 2,734 23 62 2531310 SP140L 0,00000 2,721 61 166 2766262 TLR6 0,00030 2,708 8 21 2868265 LIX1 0,00005 2,706 7 19 3725916 0,02786 2,702 26 71 25235402523575 NBEAL1 0,03857 2,698 7 20 3061805 SGCE 0,00000 2,690 11 28 3375648 FTH1 0,00158 2,677 33 90 3725854 0,03678 2,659 14 37 3819701 0,00167 2,658 41 109 4010152 LOC442454 0,04277 2,647 25 66 2790062 TMEM154 0,00010 2,640 8 20 3755903 GSDMB 0,00022 2,593 43 111 2674456 0,01105 2,583 6 15 3699884 0,03184 2,575 4 11 2968293 0,02859 2,568 10 26 3451375 PRICKLE1 0,00021 2,537 21 54 2383781 0,00577 2,534 6 16 3944690 CYTH4 0,00000 2,532 25 64 2518583 DNAJC10 0,00001 2,529 65 165 2792459 GK3P 0,02499 2,517 8 21 2423017 EVI5 0,00206 2,511 23 58 3556138 0,01476 2,506 29 73 3060117 ABCB4 0,00000 2,500 23 58 2373842 PTPRC 0,00000 2,486 215 534 3837731 EMP3 0,00004 2,484 56 138 3470398 0,03384 2,481 7 18 2531377 SP100 0,00000 2,480 73 180 3154263 SLA 0,00004 2,475 24 60 3838385 CD37 0,00217 2,474 104 257 2476671 RASGRP3 0,00000 2,459 8 20 3484060 ALOX5AP 0,00806 2,458 82 202 2974413 MOXD1 0,00000 2,458 7 16 2712147 PPP1R2 0,00541 2,445 51 126 3275574 0,02862 2,439 4 9 3474553 0,02248 2,435 57 139 2984884 RNASET2 0,00014 2,433 66 160 3443891 CLEC2B 0,00016 2,427 47 114 2601287 AP1S3 0,00002 2,422 11 26 3340697 UVRAG 0,00001 2,422 82 199 2968257 0,01471 2,417 21 51 2363689 FCGR2A 0,00008 2,416 7 17 3969081 TLR7 0,00778 2,406 19 45 3822849 CLEC17A 0,00000 2,389 27 65 3222144 TNFSF8 0,00043 2,385 24 58 2482944 0,02152 2,374 9 21 3418086 0,00325 2,372 34 81 2557659 0,03794 2,368 12 29 2841699 CPEB4 0,00000 2,368 42 100 2406289 0,02096 2,363 9 22 2974671 C6orf192 0,00012 2,358 31 74 3748400 USP6 0,00941 2,351 131 309 3940631 ADRBK2 0,00001 2,349 62 146 3141857 TPD52 0,00000 2,342 56 131 2731542 AREG 0,00409 2,336 11 27 3755862 IKZF3 0,00009 2,335 112 261 3181976 NR4A3 0,00001 2,333 13 30 2351854 C1orf162 0,00014 2,325 62 144 2973376 PTPRK 0,00000 2,324 12 28 2593464 ANKRD44 0,00000 2,316 56 130 3474555 0,01591 2,314 19 44 2737318 DAPP1 0,00003 2,308 26 60 3403092 PTPN6 0,00000 2,301 113 259 3061456 SAMD9L 0,00035 2,299 31 72 2968283 0,03341 2,297 21 47 3699854 0,00418 2,289 13 31 2982076 TAGAP 0,00000 2,288 43 99 3333595 GNG3 0,00002 2,285 22 50 2377229 CD55 0,00001 2,274 216 491 2434575 CTSS 0,00004 2,270 55 126 2968379 0,01227 2,267 65 147 3449760 DENND5B 0,00000 2,247 9 21 2774971 ANTXR2 0,00050 2,244 53 118 3212360 0,00135 2,244 61 137 2991395 HDAC9 0,00000 2,234 49 109 2486811 PLEK 0,00054 2,231 8 17 2363808 FCGR2B 0,00001 2,228 26 59 3629811 DENND4A 0,00000 2,228 56 124 3350775 SIDT2 0,00000 2,221 51 114 29682322968247 SNX3 0,00375 2,211 88 194 3699864 0,00189 2,202 22 48 2565343 0,03370 2,199 6 14 3335808 0,00182 2,198 254 558 3556258 0,00336 2,194 22 48 2912649 COL19A1 0,00000 2,189 8 18 3410384 C12orf35 0,00003 2,180 158 345 2968393 0,00101 2,179 83 180 3741547 P2RX5 0,00161 2,174 36 78 3286895 OR13A1 0,00747 2,171 12 26 2563785 IGK@ 0,00241 2,169 494 1071 2326463 CD52 0,00000 2,166 550 1191 2939014 MGC39372 0,00021 2,162 40 87 3959688 0,02006 2,159 20 42 3556288 0,00655 2,154 37 79 3626826 MYO1E 0,00019 2,151 9 19 2895841 CD83 0,00001 2,143 50 108 3362795 RNF141 0,00000 2,143 70 151 2536424 0,00106 2,141 53 113 3749622 0,04733 2,138 7 14 3449910 AMN1 0,00027 2,137 51 109 2589868 CCDC141 0,00021 2,136 31 66 2968420 0,00010 2,133 52 111 2574855 0,00818 2,132 45 96 3522662 GPR183 0,00021 2,125 33 71 2603051 SP110 0,00000 2,125 168 358 3375307 CYBASC3 0,00000 2,124 35 75 2452977 FAIM3 0,00068 2,121 184 390 3740624 0,03472 2,115 13 27 2613293 KCNH8 0,00000 2,114 8 16 2423175 FAM69A 0,00011 2,110 28 59 37424153742426 SPAG7 0,03421 2,101 23 48 2574798 MAP3K2 0,00017 2,098 42 89 3699860 0,01135 2,096 77 161 2536380 0,04357 2,094 13 27 2667809 OSBPL10 0,00000 2,086 25 52 23200482320077 TARDBP 0,03992 2,083 39 82 3922100 MX1 0,01938 2,078 38 78 2903219 0,02472 2,077 47 97 3740201 MYO1C 0,00000 2,075 33 68 2325214 0,03545 2,067 22 45 3401828 DYRK4 0,00001 2,065 19 40 2968269 0,02973 2,058 6 12 3917305 BACH1 0,00003 2,050 56 114 2428855 AP4B1 0,00035 2,047 46 94 2841342 0,04544 2,045 28 57 3212356 0,01355 2,044 50 102 2883440 ADAM19 0,00000 2,042 52 106 2766492 C4orf34 0,00002 2,039 192 392 3839360 MYBPC2 0,00001 2,036 18 37 2536462 0,00003 2,035 204 416 3722321 0,04412 2,031 30 60 2949971 C6orf10 0,00081 2,029 9 18 2689286 KIAA1407 0,00010 2,029 64 130 3752258 EVI2B 0,00008 2,028 96 194 2355591 0,01382 2,026 16 33 2523354 FAM117B 0,00001 2,023 60 122 3471327 HVCN1 0,00003 2,023 29 59 3648412 RUNDC2A 0,00098 2,022 26 53 2378662 TRAF5 0,00003 2,021 25 50 2810764 GAPT 0,00019 2,020 58 117 2536518 0,00350 2,014 37 75 2536428 0,00730 2,011 45 90 2478748 EML4 0,00001 2,007 55 111 2598099 BARD1 0,00003 -2,001 137 68 3474951 0,03457 -2,003 20 10 3625539 NEDD4 0,00209 -2,004 20 10 3699044 RFWD3 0,00004 -2,004 70 35 2974330 CTGF 0,01608 -2,004 67 34 3689880 SHCBP1 0,00200 -2,006 80 40 28784462878455 NDUFA2 0,00003 -2,007 717 358 2838656 HMMR 0,03365 -2,009 77 38 3651018 CP110 0,00079 -2,012 76 38 3736290 BIRC5 0,00003 -2,013 112 55 3773312 EIF4A3 0,00013 -2,014 165 82 3770563 ATP5H 0,01568 -2,016 30 15 3617403 NOP10 0,00004 -2,016 243 121 3980917 0,00039 -2,019 181 90 3804358 C18orf10 0,00011 -2,021 128 63 2332144 CTPS 0,00025 -2,022 145 72 2796510 MLF1IP 0,02487 -2,023 107 53 3096448 0,00840 -2,024 204 101 27754632775500 HNRNPD 0,00000 -2,025 622 307 3150715 DSCC1 0,00605 -2,026 46 23 2742985 PLK4 0,00473 -2,026 54 27 34278203427838 SLC25A3 0,00002 -2,028 589 291 3203855 DCAF12 0,00174 -2,032 121 60 3955815 HPS4 0,00006 -2,033 101 49 2763278 GPR125 0,00142 -2,033 62 30 3651478 ACSM3 0,01238 -2,034 92 45 3289031 TIMM23 0,00169 -2,035 280 138 2436145 0,00018 -2,039 287 141 3975893 PHF16 0,00002 -2,040 49 24 3373845 SLC43A3 0,00001 -2,041 69 34 4052881 FAM72D 0,00852 -2,047 50 25 3427098 ELK3 0,00825 -2,047 91 44 2901913 TUBB 0,00057 -2,049 1208 590 3151534 ATAD2 0,00179 -2,050 79 39 3371719 CKAP5 0,00005 -2,050 162 79 3168508 MELK 0,00609 -2,051 50 24 3335785 0,00988 -2,051 124 60 36997573699776 KARS 0,02670 -2,053 13 7 3417309 PA2G4 0,00001 -2,054 2497 1216 2521479 HSPE1 0,02254 -2,054 32 15 3803120 B4GALT6 0,00402 -2,054 41 20 3434562 UNC119B 0,00223 -2,061 154 75 24361322436147 ILF2 0,00001 -2,062 707 343 3290746 SLC16A9 0,00945 -2,063 45 22 2565283 0,01026 -2,064 28 14 3985523 WBP5 0,00310 -2,064 36 17 2436157 0,00019 -2,066 666 322 3821908 RNASEH2A 0,00000 -2,067 115 56 3258444 CEP55 0,00136 -2,074 30 14 2511820 PKP4 0,00001 -2,079 62 30 3236448 SUV39H2 0,00077 -2,079 51 25 2491661 VAMP8 0,00000 -2,080 924 444 3719962 PSMB3 0,00434 -2,081 107 51 2914777 TTK 0,00692 -2,086 26 13 3046556 TARP 0,03264 -2,087 44 21 2827185 LMNB1 0,00018 -2,089 277 132 3943207 YWHAH 0,00005 -2,089 367 176 3367036 CCDC34 0,00031 -2,090 67 32 3145107 CCNE2 0,00505 -2,093 68 32 2364438 NUF2 0,01584 -2,096 100 48 3264621 TCF7L2 0,00059 -2,096 54 26 3060245 SLC25A40 0,00649 -2,104 35 17 3335798 0,01186 -2,106 80 38 2735221 PKD2 0,00013 -2,108 109 51 3563395 POLE2 0,00149 -2,113 15 7 2444790 MRPS14 0,00368 -2,115 94 44 24361322436156 ILF2 0,00021 -2,120 413 195 3896200 PCNA 0,00052 -2,121 189 89 3253683 ZMIZ1 0,00000 -2,125 69 32 3318009 RRM1 0,00027 -2,132 120 56 3765580 BRIP1 0,00012 -2,134 76 36 3590388 NUSAP1 0,00270 -2,134 418 196 2946268 HIST1H2BC 0,03715 -2,135 225 105 2439944 PIGM 0,00051 -2,139 32 15 3078348 EZH2 0,00022 -2,140 194 90 23838592383890 GUK1 0,00347 -2,140 112 52 3275218 0,01440 -2,140 197 92 3303255 ERLIN1 0,00769 -2,142 72 34 2838598 CCNG1 0,00001 -2,142 90 42 2946353 HIST1H1D 0,00165 -2,143 115 54 3875642 PLCB1 0,00005 -2,143 30 14 2353773 TTF2 0,00016 -2,144 62 29 3015769 POP7 0,00024 -2,144 66 31 3984655 CENPI 0,00071 -2,146 27 13 3980907 0,00000 -2,146 784 365 2784113 CCNA2 0,00189 -2,148 108 50 3340269 POLD3 0,00052 -2,148 187 87 3703112 GINS2 0,00009 -2,152 116 54 2867836 GLRX 0,00246 -2,153 68 32 2406420 CLSPN 0,01130 -2,158 119 55 2714955 TACC3 0,00021 -2,160 106 49 3126368 PSD3 0,02037 -2,161 17 8 2954022 TRERF1 0,00346 -2,163 18 8 3286792 C10orf25 0,02293 -2,170 40 18 4008427 NUDT11 0,01040 -2,170 59 27 35700493570052 ERH 0,00004 -2,171 318 147 3759335 GJC1 0,00739 -2,176 51 23 3554592 BTBD6 0,00058 -2,176 102 47 2901333 ZNRD1 0,00134 -2,176 105 48 2796066 RWDD4A 0,03071 -2,176 62 28 3565571 WDHD1 0,00129 -2,178 118 54 2436194 0,04905 -2,178 43 20 2521278 CCDC150 0,00000 -2,181 21 10 3080283 XRCC2 0,00135 -2,189 44 20 3744263 AURKB 0,00001 -2,191 122 56 2620256 KIF15 0,00654 -2,195 98 45 2965739 C6orf167 0,00076 -2,198 37 17 3390542 RDX 0,00049 -2,199 69 31 3599811 KIF23 0,00081 -2,200 77 35 3258910 HELLS 0,00172 -2,201 111 50 3902489 BCL2L1 0,00006 -2,201 133 61 3587457 ARHGAP11A 0,00546 -2,201 68 31 3301782 OPALIN 0,00287 -2,202 26 12 37404793740494 PRPF8 0,00001 -2,207 383 174 3677176 0,00004 -2,209 418 189 2748830 GUCY1A3 0,00003 -2,211 39 18 3427014 SNRPF 0,00000 -2,211 460 208 2941721 ELOVL2 0,00524 -2,216 23 10 2735598 TIGD2 0,00001 -2,220 29 13 3468301 PMCH 0,00669 -2,221 10 4 3507199 FLT3 0,02525 -2,227 42 19 3722060 VPS25 0,00273 -2,227 124 56 2798538 SDHA 0,00006 -2,227 218 98 3980889 0,00244 -2,230 392 176 2899090 HIST1H3A 0,01210 -2,238 35 16 2946208 HIST1H4B 0,00148 -2,241 1233 550 3382861 PAK1 0,00011 -2,241 89 40 2652675 ECT2 0,00152 -2,243 41 18 3980893 0,00871 -2,245 104 46 34194713419474 RPL14 0,00198 -2,247 173 77 2859667 CENPK 0,00973 -2,252 96 43 3091077 DPYSL2 0,00001 -2,253 124 55 2516023 CDCA7 0,00006 -2,253 59 26 3258168 KIF11 0,01120 -2,267 93 41 3607510 FANCI 0,00066 -2,269 179 79 2411228 STIL 0,00082 -2,270 36 16 3589697 BUB1B 0,00037 -2,271 166 73 3753568 SLFN13 0,00005 -2,276 132 58 3504617 SKA3 0,00188 -2,279 54 24 2358693 MLLT11 0,00180 -2,282 105 46 3182957 NIPSNAP3A 0,00020 -2,297 26 11 2682088 EIF4E3 0,00002 -2,301 68 30 2395490 ENO1 0,00003 -2,303 310 135 3756193 TOP2A 0,00174 -2,308 323 140 3706753 GSG2 0,00005 -2,310 47 21 3407096 PLEKHA5 0,00001 -2,313 31 13 3458133 PRIM1 0,00020 -2,314 70 30 3928590 KRTAP21-1 0,03997 -2,316 18 8 3183111 SLC44A1 0,00079 -2,317 73 31 3744965 GAS7 0,00000 -2,320 251 108 2709486 RFC4 0,00121 -2,330 123 53 2784687 ANKRD50 0,00119 -2,331 194 83 2345929 LRRC8C 0,00000 -2,331 209 90 2783715 MAD2L1 0,01074 -2,338 114 49 2659560 PIGX 0,00271 -2,343 45 19 3178583 CKS2 0,00026 -2,347 216 92 3565663 DLGAP5 0,00263 -2,350 115 49 2469252 RRM2 0,00239 -2,354 1311 557 3920003 CHAF1B 0,00009 -2,355 65 28 3980903 0,02580 -2,359 44 19 2900116 HIST1H2BO 0,00618 -2,360 283 120 3454223 RACGAP1 0,00000 -2,360 264 112 2957126 MCM3 0,00000 -2,361 161 68 2468622 ID2 0,03367 -2,365 46 19 2449559 ASPM 0,00285 -2,369 102 43 3235789 MCM10 0,00018 -2,375 56 23 3720896 CDC6 0,00403 -2,377 126 53 3365776 E2F8 0,00098 -2,378 91 38 3538893 PRKCH 0,00000 -2,394 60 25 3401804 RAD51AP1 0,00009 -2,394 255 106 2678714 FHIT 0,00018 -2,395 149 62 3463112 E2F7 0,00002 -2,405 69 29 2379863 CENPF 0,00470 -2,406 258 107 3624513 MYO5C 0,00042 -2,411 20 8 3728964 PRR11 0,00017 -2,414 70 29 3354799 CHEK1 0,00086 -2,419 124 51 3275334 0,03531 -2,420 11 4 3031533 GIMAP4 0,01533 -2,421 31 13 2520225 NAB1 0,00002 -2,422 37 15 2748163 MND1 0,01012 -2,433 174 71 2946319 HIST1H4D 0,01280 -2,434 53 22 2570616 BUB1 0,00011 -2,443 89 37 2679014 NPCDR1 0,00906 -2,443 54 22 3932131 PSMG1 0,00034 -2,446 110 45 2911372 BAG2 0,00050 -2,460 30 12 2947081 HIST1H4L 0,00518 -2,469 547 222 2319802 PGD 0,00001 -2,474 113 46 3327143 RAG1 0,00001 -2,475 55 22 3312490 MKI67 0,00050 -2,480 387 156 25652622565284 SNRNP200 0,00162 -2,485 138 56 2494484 NCAPH 0,00036 -2,486 90 36 3368707 CD59 0,00000 -2,488 78 31 3683018 RPS15A 0,00015 -2,492 305 122 3515965 DIAPH3 0,00051 -2,496 36 15 2428501 SLC16A1 0,00050 -2,501 93 37 3772187 EPR1 0,00010 -2,502 891 356 2946219 HIST1H2AB 0,02742 -2,505 67 27 2947100 HIST1H2AM 0,00616 -2,505 43 17 2388219 EXO1 0,00094 -2,508 79 32 2720251 NCAPG 0,00095 -2,512 183 73 2946369 HIST1H3G 0,00113 -2,519 137 54 3881443 TPX2 0,00048 -2,520 162 64 2396781 MAD2L2 0,00007 -2,521 163 65 2571457 CKAP2L 0,00076 -2,530 95 37 3921391 WRB 0,00001 -2,530 46 18 3817698 UHRF1 0,00002 -2,532 51 20 2830638 KIF20A 0,00030 -2,541 37 14 2383805 0,01822 -2,554 43 17 3590086 RAD51 0,00079 -2,555 97 38 3938792 VPREB1 0,00000 -2,565 387 151 2899768 HIST1H4I 0,00011 -2,568 59 23 2997376 ANLN 0,00071 -2,571 65 25 3715489 TMEM97 0,00047 -2,584 65 25 3428268 GAS2L3 0,00004 -2,587 50 19 3198346 PTPRD 0,00074 -2,589 44 17 37404793740506 PRPF8 0,00026 -2,593 63 24 3607537 FANCI 0,00004 -2,594 100 39 3219621 CTNNAL1 0,00009 -2,610 51 20 2389130 EFCAB2 0,00415 -2,614 82 31 3980560 KIF4A 0,00002 -2,615 169 65 3829150 0,00014 -2,630 17 6 3749554 0,02694 -2,639 53 20 3775842 TYMS 0,00001 -2,644 696 263 3776139 NDC80 0,00451 -2,650 75 28 2333136 CDC20 0,03055 -2,653 58 22 3811000 RNF152 0,00008 -2,666 37 14 2389789 SCCPDH 0,00000 -2,680 103 38 3595979 CCNB2 0,00555 -2,682 88 33 2417528 DEPDC1 0,00322 -2,684 22 8 2900091 HIST1H2AL 0,00059 -2,701 338 125 2813414 CCNB1 0,00037 -2,704 169 62 3852565 ASF1B 0,00000 -2,712 60 22 3097152 MCM4 0,00002 -2,715 113 42 2454444 NEK2 0,00002 -2,734 93 34 2947073 HIST1H1B 0,00031 -2,735 41 15 3648391 TNFRSF17 0,00478 -2,756 32 12 2899772 HIST1H2AH 0,01304 -2,779 35 12 3960685 DMC1 0,00002 -2,782 15 5 2330773 CDCA8 0,00017 -2,792 60 21 3233049 AKR1C3 0,00025 -2,799 18 6 2975655 FAM54A 0,00374 -2,816 93 33 3003143 MRPS17 0,00604 -2,824 112 40 3936913 CDC45 0,00002 -2,831 143 51 2451200 UBE2T 0,00023 -2,847 107 38 3921068 ETS2 0,00000 -2,853 113 40 3629103 KIAA0101 0,00205 -2,854 144 50 3137875 GGH 0,00027 -2,857 45 16 3764738 SKA2 0,00000 -2,858 251 88 2585933 SPC25 0,00667 -2,860 151 53 2858592 DEPDC1B 0,00044 -2,886 107 37 2900059 HIST1H2BM 0,00106 -2,897 780 269 2838201 PTTG1 0,00002 -2,906 963 331 3707199 PSMB6 0,00134 -2,943 56 19 2947077 HIST1H3I 0,00178 -2,947 737 250 2378937 DTL 0,00007 -2,981 297 100 2709606 RPL39L 0,00008 -2,984 345 116 2604254 HJURP 0,00001 -3,017 99 33 4027585 MPP1 0,00000 -3,033 213 70 2686784 0,04039 -3,051 9 3 2931569 AKAP12 0,00286 -3,061 240 78 3591704 WDR76 0,00010 -3,072 153 50 2946364 HIST1H3F 0,00097 -3,075 474 154 3880827 GINS1 0,00030 -3,142 145 46 2616596 ARPP21 0,00231 -3,158 169 54 2744734 MGST2 0,00000 -3,167 131 41 3536336 CDKN3 0,00013 -3,220 204 63 33065163306527 SMNDC1 0,00255 -3,237 44 13 3931765 ERG 0,00096 -3,280 119 36 2577896 MCM6 0,00022 -3,284 196 60 3129149 PBK 0,00116 -3,321 37 11 2833623 HMHB1 0,00033 -3,373 345 102 3369931 RAG2 0,00019 -3,377 115 34 3046708 TRGV3 0,00634 -3,421 18 5 3210808 GNAQ 0,00002 -3,428 164 48 2946215 HIST1H3B 0,00369 -3,476 320 92 2875193 P4HA2 0,00185 -3,531 142 40 2899102 HIST1H3C 0,00180 -3,675 225 61 4016193 TMSB15A 0,02780 -3,805 51 13 2421995 GBP4 0,00002 -3,908 64 16 3259503 DNTT 0,00161 -4,869 325 67

CHILDREN

Child PreBI vs ProB Mean signal Transcript Cluster Gene Symbol p-value fold change ProB PreBI

2947040 HIST1H2AJ 0,01349 3,786 4 16 2328527 0,00187 3,542 3 9 3578152 TCL1A 0,00007 3,463 15 51 2325224 0,01987 3,397 11 38 4016193 TMSB15A 0,04705 3,309 8 25 2363074 SUMO1P3 0,02287 3,245 7 21 2597867 IKZF2 0,00010 3,158 37 118 3844051 0,01425 3,085 8 24 3755862 IKZF3 0,00000 3,036 9 27 3904691 SAMHD1 0,00060 2,970 8 25 3197955 GLDC 0,00019 2,835 29 82 3129149 PBK 0,00427 2,808 23 64 2680819 SUCLG2 0,00316 2,661 9 23 3536336 CDKN3 0,00094 2,657 95 253 3565663 DLGAP5 0,00078 2,649 70 185 2782545 CAMK2D 0,00103 2,495 20 50 3428268 GAS2L3 0,00008 2,474 21 52 2899772 HIST1H2AH 0,02615 2,473 9 22 3599811 KIF23 0,00019 2,465 45 110 3743515 0,01028 2,434 6 15 2838656 HMMR 0,00846 2,420 56 134 4035833 CD24 0,01402 2,408 69 165 3512948 C13orf18 0,02482 2,406 38 92 3910785 AURKA 0,00243 2,395 27 64 3248289 CDK1 0,00431 2,387 15 35 3881443 TPX2 0,00107 2,350 82 193 2830638 KIF20A 0,00084 2,330 22 52 2954022 TRERF1 0,00167 2,316 16 38 3301218 PDLIM1 0,00004 2,296 68 156 3258168 KIF11 0,01025 2,293 59 136 2858592 DEPDC1B 0,00480 2,261 50 114 2781138 LEF1 0,01583 2,258 242 546 3595979 CCNB2 0,01980 2,253 50 112 2449559 ASPM 0,00483 2,243 61 137 29016872901723 ABCF1 0,04467 2,223 25 55 3756193 TOP2A 0,00263 2,221 194 430 2450345 KIF14 0,00098 2,215 27 59 3699870 0,00697 2,207 16 34 2813414 CCNB1 0,00350 2,193 115 252 2524653 ADAM23 0,00017 2,182 8 18 2434129 HIST2H2AB 0,00028 2,181 436 952 2784113 CCNA2 0,00165 2,173 62 135 3551778 0,03445 2,171 33 72 2330773 CDCA8 0,00294 2,164 28 60 2620256 KIF15 0,00767 2,157 59 128 3774283 ARHGDIA 0,01615 2,156 20 43 2563785 IGK@ 0,00273 2,144 38 81 2585933 SPC25 0,04345 2,137 82 175 2946364 HIST1H3F 0,01925 2,135 178 380 3365776 E2F8 0,00323 2,135 41 88 2914777 TTK 0,00557 2,132 18 38 2766192 TLR10 0,02074 2,118 33 70 2343025 AK5 0,00016 2,117 19 41 3980560 KIF4A 0,00042 2,112 89 189 2417528 DEPDC1 0,02182 2,106 16 35 2364438 NUF2 0,01527 2,105 64 134 3312490 MKI67 0,00342 2,095 189 395 2878461 DND1 0,03999 2,093 31 64 3587457 ARHGAP11A 0,00876 2,093 46 97 2388085 KMO 0,00201 2,087 9 18 3474541 0,04000 2,081 41 85 3589697 BUB1B 0,00120 2,076 103 214 2722377 STIM2 0,00009 2,057 61 125 3776139 NDC80 0,03048 2,054 47 96 2604254 HJURP 0,00130 2,050 46 95 3258444 CEP55 0,00164 2,044 19 40 2997376 ANLN 0,00770 2,042 46 93 36997573699771 KARS 0,02936 2,037 33 66 2780172 CENPE 0,00958 2,007 29 58 2730673 MOBKL1A 0,00349 -2,005 60 30 3725982 0,00983 -2,024 29 14 3422855 GLIPR1 0,00532 -2,040 247 121 2591421 TFPI 0,00172 -2,047 11 6 2358117 C1orf54 0,00108 -2,055 69 33 3556080 0,03150 -2,065 13 6 2391532 CCNL2 0,00173 -2,071 107 52 3819659 0,01611 -2,075 166 80 2665199 SATB1 0,00091 -2,082 290 139 3233049 AKR1C3 0,00584 -2,085 27 13 2701033 P2RY14 0,00583 -2,103 156 74 3577078 LGMN 0,01925 -2,109 115 55 3326635 CD44 0,00325 -2,131 74 35 2735759 MMRN1 0,00000 -2,153 38 18 2968375 0,01739 -2,155 32 15 3214451 NFIL3 0,01113 -2,165 47 22 3018484 GPR22 0,00370 -2,167 32 15 2514497 PHOSPHO2 0,00807 -2,185 24 11 2816506 S100Z 0,00880 -2,204 29 13 3740618 0,03105 -2,213 13 6 3748449 CCDC144A 0,00776 -2,232 59 26 3269939 DOCK1 0,00291 -2,241 23 10 2742224 SPRY1 0,00052 -2,247 176 78 2565347 0,00319 -2,254 13 6 2854327 FYB 0,00847 -2,303 22 9 2908762 RUNX2 0,00194 -2,327 56 24 2701018 GPR171 0,00166 -2,331 29 12 2406311 0,02278 -2,337 11 5 2674496 0,04281 -2,349 26 11 2635349 TRAT1 0,00052 -2,351 19 8 2486178 MEIS1 0,00040 -2,360 49 21 3474553 0,02565 -2,384 122 51 3401704 CCND2 0,00402 -2,407 54 22 2727587 KIT 0,00000 -2,417 31 13 3551843 0,01720 -2,448 36 15 2901751 0,03508 -2,451 9 4 3507199 FLT3 0,01283 -2,460 173 70 2421000 COL24A1 0,00143 -2,471 31 12 3982612 GPR174 0,03040 -2,491 82 33 2791197 PDGFC 0,00039 -2,541 27 11 3090209 ADAM28 0,01498 -2,596 20 8 2774971 ANTXR2 0,00007 -2,598 139 53 3475112 0,01197 -2,628 42 16 2444283 TNFSF4 0,00010 -2,649 118 45 3177880 DAPK1 0,00052 -2,722 38 14 3092561 0,00389 -2,735 6 2 3475062 0,03036 -2,736 9 3 3973839 CYBB 0,00395 -2,796 40 14 3974019 TSPAN7 0,00003 -2,814 61 22 2557667 0,00464 -2,888 7 3 3174816 ANXA1 0,00253 -2,889 16 6 3475114 0,02454 -2,970 31 10 3740642 0,01730 -2,972 14 5 3749652 0,01094 -2,995 17 6 3217077 HEMGN 0,00022 -3,069 15 5 2925590 TMEM200A 0,00427 -3,112 25 8 2968293 0,00874 -3,162 28 9 2832005 0,04055 -3,192 19 6 2318869 0,00765 -3,222 17 5 3556771 0,01420 -3,257 9 3 3028744 TRY6 0,04738 -3,299 8 2 2565935 ANKRD36B 0,04193 -3,306 9 3 2418078 NEGR1 0,00015 -3,424 68 20 2584957 SCN3A 0,00245 -3,537 101 28 3556066 0,00526 -3,571 39 11 2443450 SELL 0,00009 -4,213 509 121 2832007 0,00454 -4,287 26 6 3110217 BAALC 0,00092 -4,475 76 17 2761842 PROM1 0,00055 -4,956 40 8 3433466 NCRNA00173 0,00029 -5,118 38 7 2968295 0,00001 -6,114 322 53 2772566 IGJ 0,00001 -6,120 354 58

Child PreBII L vs PreBI Mean signal Transcript Cluster Gene Symbol p-value fold change PreBI PreBII L

3648391 TNFRSF17 0,00000 9,034 7 65 3578152 TCL1A 0,00000 7,187 51 369 2524653 ADAM23 0,00000 7,180 18 129 3755862 IKZF3 0,00000 7,029 27 189 3876084 C20orf103 0,00000 6,568 14 89 2772566 IGJ 0,00001 5,962 58 345 2563785 IGK@ 0,00000 5,794 81 469 2688717 BTLA 0,00000 5,451 9 49 3098977 LYN 0,00000 5,032 33 165 2388085 KMO 0,00000 4,414 18 80 3973839 CYBB 0,00010 4,372 14 63 3924041 ADARB1 0,00000 4,272 21 90 2823880 CAMK4 0,00001 4,270 14 60 2891341 IRF4 0,00000 3,984 63 250 3374934 MS4A6A 0,00000 3,813 11 41 2349129 S1PR1 0,00000 3,795 12 47 2832007 0,00879 3,778 6 23 2372858 RGS2 0,00276 3,769 131 496 3982560 P2RY10 0,00000 3,765 8 28 2782545 CAMK2D 0,00001 3,762 50 190 2832005 0,02089 3,753 6 23 3384321 RAB30 0,00001 3,726 18 67 3239584 MYO3A 0,00000 3,696 7 24 2860178 CD180 0,00000 3,617 30 108 2363852 FCRLA 0,00000 3,549 15 53 2366884 C1orf129 0,00046 3,492 4 13 3651478 ACSM3 0,00006 3,466 20 70 2733483 BMP3 0,00000 3,415 33 113 3470549 CORO1C 0,00040 3,319 48 159 2689286 KIAA1407 0,00000 3,227 18 59 2589868 CCDC141 0,00000 3,163 17 54 3173673 PIP5K1B 0,00000 3,108 14 42 3512948 C13orf18 0,00542 3,049 92 282 3904691 SAMHD1 0,00063 2,955 25 74 3470388 0,00405 2,923 8 23 2339872 ROR1 0,00000 2,897 18 51 3837731 EMP3 0,00000 2,885 23 65 3516639 PCDH9 0,00000 2,859 23 66 2897172 RNF144B 0,00001 2,830 39 112 3040967 RAPGEF5 0,00000 2,800 28 79 2766492 C4orf34 0,00000 2,791 118 330 2747893 ARFIP1 0,00049 2,781 11 30 2638988 PARP15 0,00038 2,780 29 81 3556755 0,02117 2,777 12 33 3291435 RTKN2 0,00026 2,752 19 52 3204648 CD72 0,00006 2,735 93 253 2901751 0,01993 2,715 4 10 3346548 BIRC3 0,00080 2,696 9 23 3329983 PTPRJ 0,00000 2,679 15 41 2597867 IKZF2 0,00067 2,655 118 314 2968295 0,00664 2,646 53 139 3815399 CNN2 0,00328 2,563 12 32 3590341 CHP 0,00003 2,549 142 362 3013255 PEG10 0,00004 2,538 16 40 3203855 DCAF12 0,00009 2,534 54 136 3475062 0,04446 2,531 3 8 3151970 MTSS1 0,00001 2,530 22 55 3945545 APOBEC3B 0,00297 2,528 16 42 3379452 C11orf24 0,00000 2,445 23 55 3669552 VAT1L 0,00009 2,433 31 75 2900116 HIST1H2BO 0,00485 2,427 169 411 2638676 EAF2 0,00004 2,421 116 280 3994846 MTMR1 0,00000 2,409 71 171 3461496 BEST3 0,04656 2,369 23 55 3290746 SLC16A9 0,00266 2,354 19 46 3020192 TES 0,00052 2,334 54 125 3744965 GAS7 0,00000 2,325 72 168 3725998 0,04026 2,318 12 27 2439101 FCRL1 0,00887 2,314 28 64 3604147 KIAA1199 0,00001 2,304 15 34 2566848 AFF3 0,00000 2,267 50 112 2688605 GCET2 0,00062 2,246 82 185 3902743 C20orf112 0,00878 2,245 26 59 3881651 HCK 0,00000 2,244 21 47 2344450 NEDD8 0,03716 2,228 11 25 2698565 TFDP2 0,00006 2,226 201 448 2565347 0,00391 2,209 6 13 2435383 S100A10 0,02802 2,189 45 99 2320094 0,00222 2,188 8 18 3759335 GJC1 0,00730 2,178 35 75 3301218 PDLIM1 0,00009 2,165 156 338 2900372 ZNF193 0,00000 2,159 11 24 2724671 RHOH 0,00056 2,158 91 195 3203962 KIF24 0,00055 2,152 12 26 3803418 KLHL14 0,00001 2,146 16 35 3356115 APLP2 0,00002 2,146 76 164 2900051 HIST1H3H 0,00982 2,132 11 24 3403092 PTPN6 0,00000 2,130 65 138 3958399 0,00004 2,122 482 1023 2991395 HDAC9 0,00000 2,119 27 58 2881860 CCDC69 0,00011 2,117 88 186 3397589 ETS1 0,00000 2,117 89 189 2939886 LYRM4 0,04609 2,113 5 10 3154263 SLA 0,00039 2,112 13 28 3690154 NETO2 0,00000 2,111 10 22 3377474 SYVN1 0,00002 2,110 143 301 3060117 ABCB4 0,00003 2,094 11 23 2883440 ADAM19 0,00000 2,093 25 52 3082590 LOC286161 0,01041 2,092 65 137 3082531 FBXO25 0,00000 2,066 30 62 2893392 LY86 0,01049 2,065 21 43 2439052 FCRL2 0,00023 2,054 9 19 2461999 LYST 0,00007 2,051 20 41 3340697 UVRAG 0,00015 2,047 59 121 3377895 0,00013 2,023 78 159 2960399 C6orf155 0,00262 2,018 14 28 2440354 CD48 0,00389 2,017 136 275 3207241 FLJ20444 0,04169 2,006 5 9 2775259 RASGEF1B 0,00234 2,006 42 84 3724505 MYL4 0,00002 2,002 19 38 3333443 ASRGL1 0,00528 2,000 28 57 3941010 SRRD 0,00434 -2,001 44 22 3326938 0,01505 -2,004 49 24 2944491 MBOAT1 0,00006 -2,008 44 22 3307939 ABLIM1 0,00001 -2,010 45 22 3182957 NIPSNAP3A 0,00123 -2,012 49 24 4016001 ZMAT1 0,00065 -2,012 99 49 23200482320077 TARDBP 0,04926 -2,014 92 46 2331505 MACF1 0,00183 -2,019 49 24 2777564 FAM13A 0,00133 -2,023 32 16 3767169 LRRC37A3 0,01605 -2,023 24 12 3403841 RIMKLB 0,00002 -2,024 371 183 2968054 SEC63 0,00008 -2,027 464 229 2884647 C5orf54 0,00236 -2,029 13 6 2343289 DNAJB4 0,00111 -2,032 61 30 3453388 0,01258 -2,035 12 6 2840660 0,02313 -2,037 143 70 2969406 SLC22A16 0,00000 -2,042 28 14 2793198 0,03749 -2,049 9 4 3625539 NEDD4 0,00149 -2,057 36 17 2864449 SERINC5 0,00024 -2,058 85 41 3327143 RAG1 0,00027 -2,060 78 38 3740580 0,04156 -2,070 35 17 3147508 KLF10 0,00184 -2,086 77 37 2443450 SELL 0,02699 -2,088 121 58 2853388 C5orf33 0,00041 -2,098 176 84 2603897 TIGD1 0,02969 -2,102 30 14 2955282 SUPT3H 0,00000 -2,103 26 12 2984884 RNASET2 0,00097 -2,105 94 45 2554975 BCL11A 0,00000 -2,110 180 85 3783723 RNF125 0,00144 -2,113 40 19 3894601 FKBP1A 0,00768 -2,114 123 58 2844339 0,02384 -2,116 40 19 2517737 PLEKHA3 0,00659 -2,116 119 56 3676709 0,02298 -2,117 185 87 3249043 REEP3 0,02973 -2,141 64 30 2982319 SOD2 0,01231 -2,141 242 113 2462329 ERO1LB 0,00115 -2,155 102 47 3198346 PTPRD 0,00486 -2,157 57 27 3331487 CTNND1 0,00000 -2,158 101 47 2748830 GUCY1A3 0,00004 -2,183 61 28 3507199 FLT3 0,02819 -2,190 70 32 3421300 MDM2 0,00049 -2,216 393 178 2565353 0,02631 -2,219 88 40 3852880 EMR2 0,00020 -2,222 35 16 3352948 SORL1 0,00001 -2,223 60 27 2775909 PLAC8 0,00012 -2,223 171 77 3630225 0,02354 -2,224 92 41 2340529 PDE4B 0,01015 -2,230 68 30 3898796 KIF16B 0,00004 -2,233 40 18 3624145 DMXL2 0,00018 -2,233 27 12 2840664 0,00432 -2,239 359 160 3126368 PSD3 0,01559 -2,241 27 12 2380785 LYPLAL1 0,00478 -2,242 34 15 3619183 0,04063 -2,249 57 25 2557657 0,03128 -2,256 52 23 3275574 0,04297 -2,269 13 6 3075550 ZC3HAV1L 0,00510 -2,272 22 10 2840662 0,00794 -2,276 200 88 3145149 TP53INP1 0,00209 -2,279 355 156 2345617 PKN2 0,00006 -2,281 245 107 3204721 TPM2 0,00052 -2,285 107 47 2745547 GAB1 0,00725 -2,287 369 162 3183111 SLC44A1 0,00086 -2,300 123 54 2482944 0,02630 -2,301 21 9 2816459 F2R 0,00000 -2,322 28 12 2549260 MAP4K3 0,00005 -2,326 51 22 3740624 0,01814 -2,332 30 13 3610958 IGF1R 0,00016 -2,338 116 50 3619116 GPR176 0,00005 -2,345 31 13 37424153742428 SPAG7 0,00450 -2,348 135 57 2840700 0,00106 -2,350 76 33 3210808 GNAQ 0,00116 -2,357 265 112 3699884 0,04855 -2,372 7 3 2651165 SERPINI1 0,01636 -2,378 26 11 3955815 HPS4 0,00000 -2,380 174 73 2840772 0,01187 -2,381 281 118 2840702 0,00165 -2,387 214 90 3420442 IRAK3 0,00000 -2,404 18 7 3551853 0,02295 -2,407 177 74 2436184 0,01740 -2,418 7 3 3238491 BMI1 0,00065 -2,427 43 18 3517251 DACH1 0,00001 -2,432 42 17 3426257 SOCS2 0,00000 -2,435 92 38 2867836 GLRX 0,00057 -2,448 126 51 2902444 AIF1 0,00001 -2,448 95 39 3594031 TMOD2 0,00001 -2,454 33 13 3556320 0,00910 -2,457 79 32 3285926 ZNF37B 0,00011 -2,469 31 12 3725868 0,03820 -2,478 8 3 2974330 CTGF 0,00220 -2,494 108 43 2742224 SPRY1 0,00012 -2,517 78 31 2515627 ITGA6 0,00000 -2,519 33 13 2723997 KLF3 0,00020 -2,540 92 36 4008427 NUDT11 0,00257 -2,543 97 38 3509719 SPG20 0,00000 -2,558 31 12 2913694 CD109 0,00000 -2,567 27 10 3548050 PRO1768 0,00012 -2,569 81 31 4001369 SCML2 0,00001 -2,576 50 19 2701033 P2RY14 0,00070 -2,578 74 29 3407096 PLEKHA5 0,00000 -2,641 48 18 2325214 0,00603 -2,651 32 12 3126191 PSD3 0,01944 -2,670 76 29 2949107 0,02218 -2,670 35 13 2375706 ATP2B4 0,00000 -2,678 80 30 2886595 LCP2 0,00000 -2,678 59 22 3031517 GIMAP7 0,00077 -2,695 30 11 3046556 TARP 0,00506 -2,704 65 24 2954022 TRERF1 0,00026 -2,743 38 14 3538893 PRKCH 0,00000 -2,748 125 45 2349402 AMY2B 0,00538 -2,750 55 20 3441849 TNFRSF1A 0,00000 -2,766 68 25 3564620 NID2 0,00385 -2,772 63 23 3286792 C10orf25 0,00350 -2,788 60 22 2421883 GBP1 0,00008 -2,848 28 10 3126504 CSGALNACT1 0,00019 -2,853 38 13 3046708 TRGV3 0,01739 -2,870 38 13 2608469 ITPR1 0,00000 -2,901 114 39 3956589 XBP1 0,00000 -2,901 207 71 2866225 MEF2C 0,00000 -2,911 359 123 2840688 0,01696 -2,913 138 47 2343511 IFI44 0,00819 -2,953 41 14 3031556 GIMAP2 0,00047 -2,956 100 34 2833623 HMHB1 0,00109 -2,958 440 149 38074873807501 RPL17 0,03333 -2,959 125 42 3212344 0,01526 -2,980 87 29 2686806 0,04601 -2,997 68 23 2665199 SATB1 0,00001 -3,001 139 46 2363074 SUMO1P3 0,03102 -3,036 21 7 3556158 0,00287 -3,056 88 29 3255506 0,00547 -3,096 48 15 3980922 0,01008 -3,110 11 4 2872047 SEMA6A 0,00000 -3,153 54 17 2858023 PLK2 0,00006 -3,163 50 16 3383227 GAB2 0,00000 -3,230 146 45 2686808 0,00310 -3,267 79 24 3264621 TCF7L2 0,00000 -3,366 88 26 3749696 0,00290 -3,413 74 22 2849992 FAM134B 0,00000 -3,430 54 16 38096713809690 NARS 0,03258 -3,443 25 7 3925639 NRIP1 0,00000 -3,485 466 134 2969886 FYN 0,00001 -3,495 91 26 3182984 NIPSNAP3B 0,00000 -3,505 33 9 2674440 0,04782 -3,551 47 13 3811000 RNF152 0,00000 -3,595 55 15 3306565 0,00349 -3,717 16 4 3031533 GIMAP4 0,00060 -3,748 41 11 2633256 ST3GAL6 0,00001 -3,798 37 10 2536965 FLJ38379 0,00018 -3,810 66 17 2557659 0,00175 -3,922 26 7 3937967 FLJ26056 0,00906 -4,061 42 10 2902707 HSPA1A 0,00104 -4,136 284 69 2840666 0,00161 -4,285 70 16 2679014 NPCDR1 0,00004 -4,688 135 29 2444283 TNFSF4 0,00000 -4,982 45 9 3624513 MYO5C 0,00000 -4,986 39 8 3301782 OPALIN 0,00000 -5,102 63 12 3012978 GNG11 0,00107 -5,123 35 7 3427098 ELK3 0,00000 -5,185 162 31 3993360 SPANXB1 0,00610 -5,451 55 10 3096575 HGSNAT 0,00000 -5,493 186 34 2649824 SCHIP1 0,00000 -5,497 145 26 2542972 NDUFAF2 0,00086 -6,064 15 2 3766796 PECAM1 0,00000 -6,102 238 39 2421995 GBP4 0,00000 -6,376 150 24 2453307 CD34 0,00000 -7,047 127 18 3259503 DNTT 0,00004 -8,862 701 79 3931765 ERG 0,00000 -8,946 286 32

Child PreBII s vs PreBII L Mean signal Transcript Cluster Gene Symbol p-value fold change PreBII L PreBII s

3862873 CYP2A6 0,02309 3,769 3 10 3470476 0,02668 3,388 8 26 2320134 0,02361 2,950 3 10 3959724 0,03710 2,821 22 63 3551851 0,04581 2,738 10 28 3725910 0,00802 2,639 25 67 2841416 0,00109 2,599 3 8 3335816 0,00234 2,582 18 46 2406293 0,03199 2,543 6 15 3725868 0,03425 2,531 3 8 2599944 0,03879 2,389 8 19 3595909 RNF111 0,01838 2,339 11 25 3699806 0,02815 2,252 31 70 3749696 0,04013 2,250 22 49 2773434 CXCL2 0,01454 2,219 10 22 2318825 0,04569 2,199 6 14 3819643 0,01777 2,172 80 173 2841478 0,01116 2,157 8 16 2841462 0,04429 2,150 100 216 2679014 NPCDR1 0,03077 2,065 29 60 2325214 0,03570 2,064 12 25 2841482 0,01066 2,051 8 16 2328571 0,01799 2,005 14 28 2390322 OR2M5 0,00797 2,002 8 16 3096512 0,02549 -2,007 54 27 4007899 SYP 0,01608 -2,021 18 9 3470388 0,04534 -2,052 23 11 2766262 TLR6 0,00523 -2,080 12 6 3392928 0,02514 -2,388 33 14 3904691 SAMHD1 0,00447 -2,390 74 31 2318867 0,01378 -3,036 19 6

Child Immature B vs PreBII s Mean signal Transcript Cluster Gene Symbol p-value fold change PreBII s Immature B

2531233 SP140 0,00000 22,396 8 177 2688717 BTLA 0,00000 13,031 27 348 3973839 CYBB 0,00000 9,782 39 381 3332403 MS4A1 0,00000 9,666 68 656 3742627 C17orf87 0,00000 8,470 10 82 2369339 RALGPS2 0,00000 8,253 38 315 2445982 ANGPTL1 0,00000 8,221 16 131 2766192 TLR10 0,00000 8,033 59 470 2792166 01.mar 0,00000 7,760 13 101 2362201 CD1C 0,00000 7,505 12 94 2950145 HLA-DOB 0,00000 7,473 27 204 3442854 SLC2A3 0,00000 7,284 20 145 3672489 IRF8 0,00000 6,985 23 164 3815399 CNN2 0,00000 6,931 26 181 3451375 PRICKLE1 0,00000 6,848 18 122 3484060 ALOX5AP 0,00000 6,299 59 370 2486811 PLEK 0,00000 6,165 6 37 2737596 BANK1 0,00000 6,107 33 204 3926271 TMPRSS15 0,00000 6,046 4 23 2968401 0,00131 5,946 4 22 2353988 FAM46C 0,00000 5,894 18 103 3268274 PLEKHA1 0,00000 5,852 17 98 2766289 TMEM156 0,00000 5,792 19 109 2377283 CR2 0,00000 5,672 5 30 2439052 FCRL2 0,00000 5,647 23 127 3384321 RAB30 0,00000 5,376 58 312 4013460 CYSLTR1 0,00000 5,358 26 138 3329983 PTPRJ 0,00000 5,328 40 215 3346548 BIRC3 0,00000 5,318 34 182 2439101 FCRL1 0,00001 5,259 72 379 2968436 0,00166 5,168 9 46 2790062 TMEM154 0,00000 5,164 8 41 2438892 FCRL5 0,00000 5,086 7 38 2968285 0,00062 5,062 23 117 3740634 0,01484 5,005 14 70 2600689 EPHA4 0,00000 5,005 14 68 2868265 LIX1 0,00000 4,942 7 37 2764192 SEL1L3 0,00000 4,751 10 48 2936657 CCR6 0,00000 4,684 6 30 3982560 P2RY10 0,00000 4,645 20 94 2351854 C1orf162 0,00000 4,644 47 220 2734421 ARHGAP24 0,00000 4,599 13 59 2766262 TLR6 0,00000 4,574 6 27 2476671 RASGRP3 0,00000 4,456 7 31 3013255 PEG10 0,00000 4,387 34 148 2599371 TMBIM1 0,00000 4,164 27 113 3275374 0,00621 4,036 3 13 3374934 MS4A6A 0,00000 3,885 43 167 3403595 CLEC4A 0,00000 3,795 20 76 2968313 0,01573 3,761 6 21 2667809 OSBPL10 0,00000 3,757 24 88 2378662 TRAF5 0,00000 3,705 18 67 2664209 SH3BP5 0,00000 3,680 29 109 3958285 0,03901 3,680 7 27 3389450 CASP1 0,00146 3,609 41 148 3837731 EMP3 0,00000 3,580 52 187 3154263 SLA 0,00000 3,556 20 73 2508520 KYNU 0,00005 3,483 4 15 2973376 PTPRK 0,00000 3,478 10 35 2638988 PARP15 0,00003 3,474 61 212 3244622 ALOX5 0,00000 3,469 31 109 3151970 MTSS1 0,00000 3,461 63 218 2860178 CD180 0,00001 3,449 87 300 3824874 IFI30 0,00000 3,447 13 45 3333595 GNG3 0,00000 3,432 20 68 3291601 EGR2 0,00003 3,413 21 70 2984884 RNASET2 0,00000 3,411 59 202 2723997 KLF3 0,00001 3,379 35 118 2363808 FCGR2B 0,00000 3,378 23 78 3375307 CYBASC3 0,00000 3,361 29 97 3350775 SIDT2 0,00000 3,353 48 162 3131881 PPAPDC1B 0,00000 3,306 42 140 3944690 CYTH4 0,00000 3,248 24 76 3471327 HVCN1 0,00000 3,198 27 87 3096575 HGSNAT 0,00054 3,164 37 118 3982612 GPR174 0,00791 3,140 36 112 3362795 RNF141 0,00000 3,134 63 198 2968383 0,00693 3,132 27 86 3654175 IL4R 0,00000 3,125 26 80 3090209 ADAM28 0,00444 3,120 8 25 2366884 C1orf129 0,00123 3,111 7 22 2922631 DSE 0,00001 3,045 16 49 2968279 0,03046 3,042 9 27 3449760 DENND5B 0,00000 3,033 9 27 3286895 OR13A1 0,00030 3,024 9 26 3718930 CCL4 0,00153 3,010 6 17 2903219 0,00128 3,004 43 128 4011844 IL2RG 0,00000 3,002 46 137 3527662 RNASE6 0,00061 2,975 23 69 3319997 SWAP70 0,00000 2,942 115 338 2968375 0,00150 2,907 21 62 2452977 FAIM3 0,00001 2,900 168 489 3403092 PTPN6 0,00000 2,898 104 300 2766492 C4orf34 0,00000 2,872 199 573 2841699 CPEB4 0,00000 2,870 38 109 3969081 TLR7 0,00202 2,834 21 60 2895945 0,00018 2,833 12 34 2968387 0,00719 2,824 22 61 3839360 MYBPC2 0,00000 2,818 15 43 3511698 EPSTI1 0,02376 2,804 25 69 3229797 QSOX2 0,00000 2,804 19 54 2968432 0,00936 2,791 24 66 3951136 RPL23AP82 0,00052 2,788 9 26 3442785 CLEC4C 0,00000 2,766 12 32 3275202 0,02186 2,762 9 26 3958375 0,02396 2,746 6 16 3061997 PON2 0,00000 2,720 32 86 4044363 CNR2 0,00009 2,682 27 72 3275139 0,00305 2,673 14 36 2774971 ANTXR2 0,00005 2,668 59 158 2368180 GPR52 0,00001 2,666 20 53 2326463 CD52 0,00000 2,664 488 1301 3838385 CD37 0,00109 2,654 111 295 3464983 ATP2B1 0,00001 2,648 75 197 3375648 FTH1 0,00179 2,642 33 87 3940631 ADRBK2 0,00000 2,627 67 177 3156307 PTK2 0,00003 2,612 8 22 2775909 PLAC8 0,00001 2,605 86 223 2536332 0,00957 2,602 9 23 2968281 0,00147 2,602 45 116 2582124 NR4A2 0,00299 2,596 12 31 3061805 SGCE 0,00000 2,585 14 37 2866225 MEF2C 0,00000 2,583 133 344 3275264 0,03631 2,571 8 21 3307939 ABLIM1 0,00000 2,565 23 60 3662387 HERPUD1 0,00000 2,558 104 265 3626826 MYO1E 0,00001 2,544 9 22 2608725 BHLHE40 0,00000 2,531 18 46 3904691 SAMHD1 0,00271 2,526 31 78 2431112 NOTCH2 0,00000 2,515 31 77 2968295 0,00970 2,512 138 346 2968283 0,01966 2,508 15 37 2692060 PARP9 0,00324 2,507 102 255 3306565 0,03482 2,494 5 13 2810764 GAPT 0,00001 2,494 67 166 3766796 PECAM1 0,00118 2,477 55 136 2377035 IL24 0,00003 2,473 25 63 2434575 CTSS 0,00001 2,466 59 146 2968416 0,01575 2,463 25 62 2840656 0,03979 2,463 18 45 3275332 0,04304 2,451 6 14 2968377 0,00048 2,450 176 431 2563785 IGK@ 0,00065 2,435 438 1067 2830861 EGR1 0,00004 2,431 41 99 3726036 0,04933 2,426 3 8 3173673 PIP5K1B 0,00001 2,420 41 100 2841410 0,03828 2,411 5 13 3374402 LPXN 0,00000 2,403 25 60 2518583 DNAJC10 0,00001 2,402 80 192 2968293 0,04141 2,396 12 28 2993727 SNX10 0,00023 2,392 24 58 3222144 TNFSF8 0,00041 2,392 23 56 3379452 C11orf24 0,00000 2,383 48 115 2613293 KCNH8 0,00000 2,378 9 22 3843662 ZNF587 0,03432 2,371 38 90 3061456 SAMD9L 0,00023 2,371 31 73 3608220 CRTC3 0,00000 2,363 25 59 2608469 ITPR1 0,00006 2,357 53 126 2601287 AP1S3 0,00003 2,342 8 20 2557657 0,02500 2,339 23 54 2982076 TAGAP 0,00000 2,337 38 89 3834502 CD79A 0,00006 2,334 105 246 2459411 0,01033 2,331 9 21 2536502 0,00132 2,330 36 84 2835792 GM2A 0,00118 2,319 62 143 3145240 C8orf37 0,00029 2,318 7 15 2443450 SELL 0,01257 2,318 58 134 2903435 HLA-DPB2 0,00001 2,318 15 34 2957596 ELOVL5 0,00002 2,317 152 353 2991395 HDAC9 0,00000 2,305 53 123 2585129 GALNT3 0,00001 2,300 8 18 2604390 ARL4C 0,00006 2,299 30 69 2912649 COL19A1 0,00000 2,294 9 20 3755862 IKZF3 0,00012 2,282 148 338 3281068 PIP4K2A 0,00006 2,282 37 84 3303392 BLOC1S2 0,00000 2,280 44 101 2832029 0,03161 2,277 7 15 2522693 CASP10 0,00001 2,276 14 33 2377229 CD55 0,00001 2,274 214 488 3145957 0,02863 2,268 5 12 2363852 FCRLA 0,00023 2,268 48 110 2959039 KHDRBS2 0,00001 2,265 18 40 2991150 TSPAN13 0,00001 2,263 109 246 2470165 TRIB2 0,00013 2,257 55 124 2531310 SP140L 0,00004 2,254 71 160 2423175 FAM69A 0,00004 2,235 34 77 3449910 AMN1 0,00014 2,235 58 129 2536965 FLJ38379 0,01557 2,231 25 56 2737318 DAPP1 0,00006 2,228 33 74 3922100 MX1 0,01127 2,224 30 68 2949118 LTB 0,00000 2,224 57 127 3202316 MOBKL2B 0,00000 2,222 21 47 3958397 0,00883 2,218 7 15 3850261 ICAM3 0,00001 2,218 23 50 2974413 MOXD1 0,00001 2,218 7 15 3401828 DYRK4 0,00000 2,212 23 51 2478748 EML4 0,00000 2,210 57 125 3060117 ABCB4 0,00001 2,207 34 75 2363689 FCGR2A 0,00030 2,202 8 17 2939014 MGC39372 0,00016 2,199 41 90 2444842 KIAA0040 0,00019 2,188 97 211 3470472 0,01061 2,187 17 37 3946095 GRAP2 0,00012 2,182 12 27 2531377 SP100 0,00001 2,175 78 169 3204680 SIT1 0,00027 2,175 17 37 2968257 0,03027 2,170 24 52 2318795 0,00251 2,168 13 29 2427720 DRAM2 0,00075 2,163 130 281 3451988 PLEKHA9 0,00000 2,154 47 101 2369325 C1orf220 0,00001 2,152 12 25 2593464 ANKRD44 0,00000 2,142 68 145 3918635 IFNGR2 0,00000 2,137 69 147 3740588 0,02942 2,135 44 95 2726072 ATP10D 0,00003 2,133 52 110 3551816 0,00028 2,131 44 94 2553282 PSME4 0,00001 2,126 70 149 2373842 PTPRC 0,00004 2,126 267 568 3475112 0,04563 2,123 16 35 2437554 0,04164 2,113 18 37 2440354 CD48 0,00231 2,111 207 436 3444493 TAS2R19 0,02009 2,108 23 48 3275222 0,04443 2,107 7 14 2388085 KMO 0,00184 2,102 89 187 2423017 EVI5 0,01069 2,100 25 52 2968395 0,00635 2,096 9 19 3556816 SLC7A7 0,00000 2,096 15 32 3978943 KLF8 0,00003 2,096 28 59 3007438 POM121 0,02746 2,095 12 24 3748400 USP6 0,02299 2,092 154 323 2974671 C6orf192 0,00065 2,089 38 79 2881747 ANXA6 0,00001 2,089 44 92 2950329 HLA-DPA1 0,00014 2,088 250 522 29682322968246 SNX3 0,00024 2,084 140 292 2950263 HLA-DMB 0,00119 2,076 136 282 2949971 C6orf10 0,00059 2,075 9 18 2883440 ADAM19 0,00000 2,067 61 126 3023318 TSPAN33 0,00003 2,067 18 38 2715634 ADD1 0,00000 2,064 75 154 2656837 ST6GAL1 0,00001 2,064 50 103 3725856 0,01386 2,061 20 40 3551841 0,00014 2,059 45 93 3275188 0,03892 2,055 10 20 3361040 0,03072 2,051 14 28 2523620 0,00000 2,050 30 61 2926969 PDE7B 0,00000 2,048 11 22 2349129 S1PR1 0,00126 2,046 48 97 3035990 CARD11 0,00000 2,045 24 49 3432438 OAS1 0,00049 2,042 43 89 3548050 PRO1768 0,00222 2,042 33 68 2371065 LAMC1 0,00000 2,040 17 35 3258221 HHEX 0,00000 2,039 63 129 2475678 LBH 0,00000 2,037 62 127 2636483 SIDT1 0,00003 2,036 41 83 2362180 CD1A 0,00004 2,035 12 24 2954527 ZNF318 0,00000 2,026 33 67 3107828 PLEKHF2 0,00719 2,020 95 192 3634071 TSPAN3 0,00000 2,019 81 163 3299585 LIPA 0,00001 2,017 16 33 3275194 0,04998 2,015 68 138 2584787 COBLL1 0,00097 2,009 13 27 3414739 METTL7A 0,00000 2,004 22 44 2374700 RPS10P7 0,01557 2,002 19 38 3302177 ARHGAP19 0,00523 -2,002 160 80 3875642 PLCB1 0,00014 -2,007 24 12 2952679 GLO1 0,00666 -2,015 193 96 2867836 GLRX 0,00505 -2,017 65 32 3268669 BUB3 0,00002 -2,018 337 167 3921391 WRB 0,00037 -2,019 42 21 2645764 ATP1B3 0,00472 -2,030 112 55 2402416 C1orf135 0,00071 -2,030 41 20 2798538 SDHA 0,00027 -2,032 190 94 2597867 IKZF2 0,00972 -2,033 320 158 3781082 SNRPD1 0,00032 -2,034 156 77 2964231 RRAGD 0,00058 -2,035 33 16 3959918 TST 0,00004 -2,037 61 30 2328571 0,01567 -2,038 28 14 2715076 WHSC1 0,00000 -2,039 89 44 2980241 FBXO5 0,00591 -2,042 113 55 3216319 ZNF367 0,00000 -2,047 58 28 2366581 SCYL3 0,00099 -2,048 36 17 3236448 SUV39H2 0,00095 -2,048 51 25 2461891 B3GALNT2 0,00003 -2,048 120 59 3593575 SLC27A2 0,00075 -2,048 15 7 24361322436139 ILF2 0,00013 -2,049 429 209 2735221 PKD2 0,00020 -2,055 104 51 2520225 NAB1 0,00030 -2,056 37 18 2565219 0,04423 -2,058 86 42 3456630 CBX5 0,00000 -2,060 874 424 3819773 0,00652 -2,060 22 10 3921992 FAM3B 0,00043 -2,061 17 8 2864849 SSBP2 0,00033 -2,062 327 159 2746119 SMAD1 0,01163 -2,064 129 63 24062452406253 PSMB2 0,00571 -2,068 146 71 2568968 UXS1 0,00041 -2,070 106 51 3311157 OAT 0,00231 -2,071 28 14 2481142 MSH6 0,00008 -2,074 266 128 3699044 RFWD3 0,00002 -2,075 69 33 2982381 TCP1 0,00027 -2,078 530 255 3065546 DPY19L2P2 0,03276 -2,079 158 76 2335922 CDKN2C 0,00004 -2,080 36 17 4011743 SLC7A3 0,00033 -2,080 62 30 2442858 BRP44 0,00324 -2,081 88 42 3563395 POLE2 0,00179 -2,081 15 7 3334125 COX8A 0,00015 -2,083 148 71 3570057 0,00017 -2,088 466 223 3929775 DONSON 0,00005 -2,090 38 18 3490655 CKAP2 0,00023 -2,095 151 72 2328567 0,00968 -2,096 18 8 3427014 SNRPF 0,00001 -2,096 378 180 2408499 SCMH1 0,00000 -2,097 121 58 3063685 MCM7 0,00001 -2,098 148 70 2946345 HIST1H2BG 0,00320 -2,098 135 64 3932261 C21orf87 0,00159 -2,102 19 9 2763278 GPR125 0,00091 -2,102 70 33 3277751 NUDT5 0,00068 -2,103 38 18 3233049 AKR1C3 0,00528 -2,106 12 6 3431426 IFT81 0,00009 -2,106 29 14 3091077 DPYSL2 0,00002 -2,111 104 49 3421523 YEATS4 0,00036 -2,112 144 68 2665572 SGOL1 0,00175 -2,113 98 47 2521479 HSPE1 0,01805 -2,115 34 16 3747717 COPS3 0,00001 -2,115 180 85 2728189 PAICS 0,00090 -2,116 48 22 3577256 C14orf142 0,04148 -2,120 41 19 2436145 0,00009 -2,121 309 146 2436141 0,00353 -2,122 213 100 3410908 ALG10 0,00384 -2,124 27 13 3573994 C14orf145 0,00022 -2,124 220 104 2842101 SFXN1 0,00003 -2,126 83 39 2900051 HIST1H3H 0,00992 -2,129 18 8 2383829 0,02190 -2,132 33 16 23284652328494 KHDRBS1 0,00575 -2,132 141 66 3422144 LGR5 0,00008 -2,136 16 8 24062452406255 PSMB2 0,00000 -2,136 402 188 2395490 ENO1 0,00011 -2,141 214 100 2339872 ROR1 0,00018 -2,141 67 31 3570055 0,01113 -2,144 194 91 2735409 HERC5 0,00215 -2,145 59 27 3690154 NETO2 0,00000 -2,146 28 13 2841388 0,01749 -2,149 19 9 2353477 ATP1A1 0,00009 -2,149 137 64 3316208 TALDO1 0,00001 -2,150 136 63 3804358 C18orf10 0,00004 -2,158 114 53 2899206 HIST1H2BF 0,00001 -2,160 1604 743 2353773 TTF2 0,00014 -2,160 58 27 2489172 MTHFD2 0,00132 -2,161 77 36 24062452406256 PSMB2 0,00001 -2,162 342 158 3303255 ERLIN1 0,00700 -2,163 85 39 2485257 UGP2 0,00070 -2,164 209 97 2678714 FHIT 0,00068 -2,168 132 61 3556966 HAUS4 0,00000 -2,170 71 33 3453732 TUBA1B 0,00758 -2,170 702 324 2774049 SCARB2 0,00018 -2,173 105 48 3440598 FOXM1 0,00000 -2,173 63 29 2412799 ORC1L 0,00002 -2,175 52 24 2465395 ZNF695 0,00163 -2,176 44 20 3850501 LOC147727 0,00239 -2,176 216 99 3738280 ANAPC11 0,00481 -2,182 94 43 3719702 MRPL45 0,00879 -2,184 70 32 3290210 ZWINT 0,00000 -2,188 33 15 3636522 HDGFRP3 0,00011 -2,189 82 37 4013828 HMGN5 0,00062 -2,192 36 17 3270270 PTPRE 0,00054 -2,195 105 48 2339414 USP1 0,00522 -2,195 105 48 2366422 ATP1B1 0,00009 -2,197 32 14 2832045 0,01194 -2,199 83 38 2910364 TMEM14A 0,00075 -2,200 52 24 2620150 ZNF660 0,00251 -2,202 57 26 3669552 VAT1L 0,00037 -2,204 47 21 3373845 SLC43A3 0,00000 -2,204 55 25 2947063 HIST1H2AK 0,01159 -2,205 230 104 2328517 0,03589 -2,207 72 33 2831975 0,01748 -2,207 16 7 3535674 C14orf166 0,00001 -2,210 575 260 3628469 RPS27L 0,01026 -2,211 70 32 2328511 0,01211 -2,212 161 73 38195433819584 HNRNPM 0,04114 -2,212 122 55 3399545 NCAPD3 0,00000 -2,215 72 32 2635906 PHLDB2 0,00025 -2,217 52 23 2416218 ITGB3BP 0,00974 -2,218 107 48 2644702 FAIM 0,00052 -2,219 46 21 3781429 RBBP8 0,00014 -2,221 95 43 3807569 ACAA2 0,00007 -2,221 137 62 3417485 OBFC2B 0,00013 -2,226 204 92 2435383 S100A10 0,02492 -2,228 80 36 3980898 0,00568 -2,231 101 45 2402459 STMN1 0,00000 -2,233 791 354 3803120 B4GALT6 0,00151 -2,242 34 15 2993672 0,02319 -2,245 26 11 3980896 0,00008 -2,247 173 77 2465493 ZNF670 0,00040 -2,259 36 16 2782230 TIFA 0,00277 -2,261 168 74 3821908 RNASEH2A 0,00000 -2,266 84 37 3446868 LDHB 0,00000 -2,267 713 314 3368707 CD59 0,00002 -2,269 65 29 2784687 ANKRD50 0,00151 -2,282 159 70 3458133 PRIM1 0,00023 -2,289 66 29 3183111 SLC44A1 0,00090 -2,291 62 27 3428268 GAS2L3 0,00023 -2,295 46 20 2549565 SLC8A1 0,00023 -2,295 21 9 3485074 RFC3 0,00014 -2,298 178 78 2757319 SLBP 0,00021 -2,299 77 34 3331903 FAM111B 0,00187 -2,300 185 81 3105430 LRRCC1 0,00045 -2,302 32 14 3286792 C10orf25 0,01492 -2,304 32 14 3502710 TFDP1 0,00000 -2,305 178 77 2500919 SLC20A1 0,00002 -2,308 89 38 3341440 RN28S1 0,00001 -2,309 64 28 3821301 ZNF627 0,00009 -2,310 33 14 2434319 ANP32E 0,00019 -2,321 542 233 3439178 PXMP2 0,00000 -2,322 74 32 3759335 GJC1 0,00395 -2,328 43 19 29016872901715 ABCF1 0,02313 -2,329 56 24 4013434 TAF9B 0,00008 -2,334 73 31 2732273 11.sep 0,00039 -2,338 141 60 2636062 C3orf52 0,00232 -2,338 73 31 3876645 BTBD3 0,00045 -2,342 116 49 3902743 C20orf112 0,00604 -2,345 73 31 3758317 BRCA1 0,00006 -2,346 40 17 2840002 CCDC99 0,00133 -2,349 118 50 3955815 HPS4 0,00000 -2,350 83 35 2744734 MGST2 0,00000 -2,352 116 49 3902489 BCL2L1 0,00002 -2,352 129 55 3507199 FLT3 0,01728 -2,356 25 11 3468301 PMCH 0,00387 -2,358 10 4 3513549 RCBTB2 0,00000 -2,359 48 20 3975893 PHF16 0,00000 -2,360 43 18 2396781 MAD2L2 0,00016 -2,369 122 51 2779486 H2AFZ 0,00005 -2,372 2268 956 3427767 TMPO 0,00004 -2,374 190 80 3593147 DUT 0,00001 -2,375 96 41 3985534 NGFRAP1 0,00000 -2,376 39 17 3197955 GLDC 0,00129 -2,384 64 27 3082181 NCAPG2 0,00026 -2,387 48 20 3534785 PPIL5 0,00022 -2,387 68 29 3651018 CP110 0,00006 -2,393 77 32 3980892 0,00000 -2,394 974 407 3751830 BLMH 0,00000 -2,394 61 25 2947073 HIST1H1B 0,00125 -2,406 40 16 3757970 PSMC3IP 0,00007 -2,408 83 34 3371719 CKAP5 0,00000 -2,413 170 71 2319802 PGD 0,00001 -2,416 87 36 3817501 CHAF1A 0,00000 -2,421 93 38 3319937 WEE1 0,00000 -2,422 82 34 3136888 TOX 0,00024 -2,425 43 18 3980889 0,00096 -2,428 501 206 2413519 HSPB11 0,00051 -2,431 192 79 3658925 ORC6L 0,00003 -2,433 86 35 3254488 C10orf58 0,00012 -2,439 60 24 3744263 AURKB 0,00000 -2,440 108 44 3828112 CCNE1 0,00000 -2,443 42 17 3090697 CDCA2 0,00013 -2,445 39 16 3945545 APOBEC3B 0,00388 -2,454 30 12 2899171 HIST1H1E 0,00038 -2,455 160 65 2965739 C6orf167 0,00018 -2,459 40 16 3683018 RPS15A 0,00018 -2,461 391 159 2345929 LRRC8C 0,00000 -2,468 184 75 2417528 DEPDC1 0,00636 -2,469 21 9 2704143 WDR49 0,00000 -2,472 69 28 2522212 SGOL2 0,00003 -2,477 41 17 2332144 CTPS 0,00001 -2,481 158 64 2830638 KIF20A 0,00039 -2,487 39 16 2330773 CDCA8 0,00062 -2,492 60 24 2389130 EFCAB2 0,00613 -2,492 63 25 3505937 CENPJ 0,00002 -2,495 73 29 2709486 RFC4 0,00055 -2,496 141 56 3570056 0,00155 -2,498 169 67 3716893 ATAD5 0,00006 -2,503 59 24 3402571 NCAPD2 0,00000 -2,505 97 39 2901913 TUBB 0,00003 -2,513 1208 481 3429857 C12orf75 0,00009 -2,514 164 65 3176999 RMI1 0,00001 -2,522 75 30 3240012 MASTL 0,00032 -2,523 70 28 3291435 RTKN2 0,00068 -2,527 33 13 3470310 0,02625 -2,527 22 9 3604147 KIAA1199 0,00000 -2,534 47 19 3984655 CENPI 0,00007 -2,546 28 11 3198346 PTPRD 0,00087 -2,549 33 13 2902178 TCF19 0,00000 -2,560 84 33 2521278 CCDC150 0,00000 -2,561 28 11 2957126 MCM3 0,00000 -2,563 151 59 2971801 MAN1A1 0,00001 -2,565 149 58 2946369 HIST1H3G 0,00091 -2,573 136 53 3430926 UNG 0,00003 -2,581 71 27 2951567 FKBP5 0,00022 -2,593 92 35 2899756 HIST1H2AG 0,00000 -2,598 47 18 3750785 SPAG5 0,00000 -2,601 45 17 2840682 0,00609 -2,606 56 22 2902707 HSPA1A 0,01983 -2,612 54 21 2514563 KLHL23 0,00888 -2,632 36 14 3876084 C20orf103 0,00115 -2,635 128 49 2946219 HIST1H2AB 0,02030 -2,641 64 24 3484641 BRCA2 0,00002 -2,641 25 9 3367338 KIF18A 0,00011 -2,641 32 12 2714955 TACC3 0,00001 -2,654 90 34 2709606 RPL39L 0,00031 -2,654 302 114 2946232 HIST1H1C 0,00039 -2,669 665 249 2823880 CAMK4 0,00129 -2,672 48 18 3817698 UHRF1 0,00001 -2,682 34 13 3706753 GSG2 0,00000 -2,686 46 17 3003143 MRPS17 0,00812 -2,707 90 33 3630099 TIPIN 0,00021 -2,711 193 71 2946353 HIST1H1D 0,00009 -2,713 121 44 2891341 IRF4 0,00019 -2,716 304 112 2900091 HIST1H2AL 0,00054 -2,725 271 99 2697490 CEP70 0,00004 -2,736 62 22 2993690 0,00044 -2,742 74 27 3163728 CNTLN 0,00002 -2,746 18 6 2900116 HIST1H2BO 0,00160 -2,751 268 97 3080283 XRCC2 0,00008 -2,761 50 18 3010439 GNAI1 0,00002 -2,764 81 29 2899090 HIST1H3A 0,00207 -2,769 40 14 2947100 HIST1H2AM 0,00270 -2,773 43 16 2516023 CDCA7 0,00000 -2,789 52 19 3715489 TMEM97 0,00019 -2,798 62 22 3773312 EIF4A3 0,00000 -2,808 174 62 2844257 0,02033 -2,813 33 12 2328465 KHDRBS1 0,02297 -2,818 42 15 2687979 KIAA1524 0,00003 -2,828 29 10 3653072 PLK1 0,00003 -2,829 60 21 3764738 SKA2 0,00000 -2,831 207 73 3985523 WBP5 0,00007 -2,832 33 12 2421995 GBP4 0,00047 -2,836 33 12 2411228 STIL 0,00005 -2,838 34 12 2650199 SMC4 0,00003 -2,838 253 89 3447694 BCAT1 0,00001 -2,838 55 19 3736290 BIRC5 0,00000 -2,841 97 34 3827218 RPSAP58 0,00619 -2,847 40 14 3248289 CDK1 0,00080 -2,860 26 9 3737874 BAHCC1 0,00000 -2,862 389 136 2698565 TFDP2 0,00000 -2,882 438 152 2648677 MME 0,00000 -2,883 604 210 3367036 CCDC34 0,00000 -2,894 72 25 3390542 RDX 0,00001 -2,905 79 27 2511820 PKP4 0,00000 -2,907 57 20 2454444 NEK2 0,00001 -2,909 86 30 2926802 MYB 0,00001 -2,912 583 200 3932131 PSMG1 0,00004 -2,921 87 30 2346399 CDC7 0,00009 -2,928 78 27 3463112 E2F7 0,00000 -2,928 63 21 3433747 RFC5 0,00000 -2,946 83 28 3551800 0,00523 -2,947 10 3 2674488 0,00648 -2,966 83 28 3551778 0,00413 -2,968 79 27 3749682 0,00923 -2,969 35 12 3417146 CDK2 0,00000 -2,982 108 36 2899243 HIST1H4F 0,00116 -2,995 209 70 2793951 HMGB2 0,00004 -3,002 1207 402 2898597 GMNN 0,00004 -3,009 80 27 3920003 CHAF1B 0,00000 -3,074 50 16 3573933 C14orf145 0,00001 -3,078 51 17 2899223 HIST1H2AE 0,00008 -3,079 759 246 3327143 RAG1 0,00000 -3,087 64 21 3435362 KNTC1 0,00000 -3,090 65 21 3749648 0,00878 -3,096 55 18 3896200 PCNA 0,00000 -3,101 154 50 2604254 HJURP 0,00000 -3,119 94 30 3921068 ETS2 0,00000 -3,133 115 37 3504617 SKA3 0,00005 -3,153 56 18 3454223 RACGAP1 0,00000 -3,157 221 70 3078348 EZH2 0,00000 -3,172 190 60 3160175 VLDLR 0,01693 -3,175 38 12 3340269 POLD3 0,00000 -3,177 212 67 3972093 POLA1 0,00000 -3,198 146 46 3318009 RRM1 0,00000 -3,199 112 35 3203855 DCAF12 0,00000 -3,201 143 45 2914777 TTK 0,00007 -3,212 30 9 2781138 LEF1 0,00091 -3,233 346 107 3703112 GINS2 0,00000 -3,242 109 34 2827185 LMNB1 0,00000 -3,258 277 85 2652675 ECT2 0,00002 -3,273 42 13 3137875 GGH 0,00006 -3,278 34 10 2450345 KIF14 0,00001 -3,285 47 14 2389789 SCCPDH 0,00000 -3,288 89 27 2780172 CENPE 0,00005 -3,294 46 14 2688605 GCET2 0,00000 -3,301 191 58 3322251 NUCB2 0,00000 -3,319 184 55 2946194 HIST1H1A 0,00084 -3,326 115 34 2742985 PLK4 0,00001 -3,329 53 16 3219621 CTNNAL1 0,00000 -3,365 53 16 2752725 NEIL3 0,00001 -3,366 48 14 3689880 SHCBP1 0,00000 -3,378 84 25 3960685 DMC1 0,00000 -3,387 16 5 3728964 PRR11 0,00000 -3,399 70 21 2494484 NCAPH 0,00001 -3,418 73 21 3648391 TNFRSF17 0,00086 -3,433 69 20 2679014 NPCDR1 0,00057 -3,442 60 17 3294280 DNAJC9 0,00001 -3,445 319 93 3910785 AURKA 0,00006 -3,454 63 18 3819667 0,02785 -3,457 16 5 3182781 SMC2 0,00000 -3,470 200 58 3401804 RAD51AP1 0,00000 -3,479 209 60 2783715 MAD2L1 0,00038 -3,498 113 32 2428501 SLC16A1 0,00001 -3,508 92 26 3210808 GNAQ 0,00001 -3,508 109 31 3150715 DSCC1 0,00001 -3,512 48 14 3991889 FAM127A 0,01567 -3,526 17 5 3097152 MCM4 0,00000 -3,532 98 28 3325503 RCN1 0,00562 -3,535 134 38 2899768 HIST1H4I 0,00000 -3,597 72 20 2946319 HIST1H4D 0,00063 -3,615 63 17 3565571 WDHD1 0,00000 -3,623 121 33 2570616 BUB1 0,00000 -3,635 93 25 3151534 ATAD2 0,00000 -3,640 85 23 3625761 MNS1 0,00002 -3,665 50 14 2784113 CCNA2 0,00000 -3,676 108 29 3931765 ERG 0,00037 -3,684 56 15 2691575 POLQ 0,00000 -3,691 59 16 2388219 EXO1 0,00001 -3,725 78 21 3235789 MCM10 0,00000 -3,753 60 16 3744965 GAS7 0,00000 -3,773 252 67 3590014 CASC5 0,00000 -3,789 150 40 3290746 SLC16A9 0,00002 -3,812 72 19 2946268 HIST1H2BC 0,00058 -3,824 196 51 2434129 HIST2H2AB 0,00000 -3,833 1126 294 3145107 CCNE2 0,00001 -3,843 70 18 3607537 FANCI 0,00000 -3,867 100 26 3651478 ACSM3 0,00002 -3,877 132 34 2571457 CKAP2L 0,00001 -3,888 90 23 4041113 KPNA2 0,00656 -3,895 24 6 3936913 CDC45 0,00000 -3,896 111 29 2796510 MLF1IP 0,00008 -3,909 108 28 3938792 VPREB1 0,00000 -3,910 334 85 2997376 ANLN 0,00001 -3,913 80 20 2838201 PTTG1 0,00000 -3,917 887 227 3639031 PRC1 0,00000 -3,919 228 58 3683806 ERI2 0,00000 -3,956 41 10 3258444 CEP55 0,00000 -3,972 30 8 3980560 KIF4A 0,00000 -3,978 166 42 4052881 FAM72D 0,00001 -4,009 59 15 4027585 MPP1 0,00000 -4,019 209 52 3595979 CCNB2 0,00022 -4,020 81 20 3599811 KIF23 0,00000 -4,038 81 20 3765580 BRIP1 0,00000 -4,064 75 18 3590388 NUSAP1 0,00000 -4,096 425 104 2859667 CENPK 0,00004 -4,096 110 27 2813414 CCNB1 0,00000 -4,198 192 46 2875193 P4HA2 0,00049 -4,241 172 41 3515965 DIAPH3 0,00000 -4,247 41 10 3365776 E2F8 0,00000 -4,264 103 24 3129149 PBK 0,00014 -4,309 43 10 3587457 ARHGAP11A 0,00001 -4,317 74 17 3258910 HELLS 0,00000 -4,409 126 29 3880827 GINS1 0,00001 -4,448 133 30 2946208 HIST1H4B 0,00000 -4,452 1335 300 2833623 HMHB1 0,00002 -4,499 282 63 3168508 MELK 0,00000 -4,499 54 12 2931569 AKAP12 0,00013 -4,528 249 55 2449559 ASPM 0,00000 -4,611 105 23 2364438 NUF2 0,00001 -4,619 116 25 3178583 CKS2 0,00000 -4,619 253 55 2858592 DEPDC1B 0,00000 -4,633 112 24 2451200 UBE2T 0,00000 -4,657 115 25 3756193 TOP2A 0,00000 -4,664 351 75 2975655 FAM54A 0,00006 -4,698 75 16 4016193 TMSB15A 0,01184 -4,710 44 9 2406420 CLSPN 0,00001 -4,713 124 26 3461496 BEST3 0,00080 -4,727 90 19 3607510 FANCI 0,00000 -4,777 164 34 3591704 WDR76 0,00000 -4,795 158 33 3720896 CDC6 0,00000 -4,816 106 22 3590086 RAD51 0,00000 -4,849 97 20 2720251 NCAPG 0,00000 -4,870 200 41 3536336 CDKN3 0,00000 -4,882 210 43 2947081 HIST1H4L 0,00001 -4,912 540 110 2838656 HMMR 0,00002 -4,921 106 22 3776139 NDC80 0,00002 -4,935 76 15 2616596 ARPP21 0,00006 -4,998 204 41 2946364 HIST1H3F 0,00001 -5,013 436 87 3258168 KIF11 0,00001 -5,060 98 19 3589697 BUB1B 0,00000 -5,068 183 36 2577896 MCM6 0,00000 -5,082 181 36 2806468 IL7R 0,00068 -5,141 95 19 2378937 DTL 0,00000 -5,159 255 49 2620256 KIF15 0,00000 -5,162 108 21 2469252 RRM2 0,00000 -5,170 1400 271 2899102 HIST1H3C 0,00015 -5,212 198 38 2947077 HIST1H3I 0,00001 -5,239 698 133 3753568 SLFN13 0,00000 -5,326 144 27 3881443 TPX2 0,00000 -5,358 161 30 2379863 CENPF 0,00000 -5,375 313 58 2748163 MND1 0,00001 -5,402 175 32 3775842 TYMS 0,00000 -5,488 654 119 3354799 CHEK1 0,00000 -5,525 132 24 2900059 HIST1H2BM 0,00000 -5,582 732 131 3565663 DLGAP5 0,00000 -5,774 143 25 2946215 HIST1H3B 0,00012 -5,789 405 70 3772187 EPR1 0,00000 -5,871 788 134 2621570 0,00981 -5,912 26 4 2946225 HIST1H2BB 0,00292 -6,043 16 3 36766693676671 RNPS1 0,00156 -6,113 32 5 3629103 KIAA0101 0,00000 -6,231 144 23 3312490 MKI67 0,00000 -6,305 383 61 2585933 SPC25 0,00001 -6,552 140 21 3369931 RAG2 0,00000 -7,276 152 21 3259503 DNTT 0,00005 -8,627 179 21 3556735 0,01647 -9,382 75 8

Supplementary table III.

RT-PCR validation of select transcripts in 5 pairwise comparisons adults vs children (Positive fold change means higher in adults).

E2A p-value fold change ∆∆CT ProB 0,0639 9,95 -3,315 PreB I 0,1897 2,05 -1,034 PreBII L 0,1627 0,65 0,619 PreBII s 0,3417 0,75 0,417 Immature B 0,0961 2,95 -1,563

Conclusion: no significant differences

EBF1 p-value fold change ∆∆CT ProB 0,2877 1,12 -0,160 PreB I 0,4543 1,03 -0,036 PreBII L 0,4896 1,01 -0,010 PreBII s 0,0682 0,79 0,341 Immature B 0,2437 1,21 -0,275

Conclusion: no significant differences

ID2 commercial assay p-value fold change ∆∆CT ProB 0,0113 15,49 -3,954 PreB I 0,2195 3,02 -1,593 PreBII L 0,0948 2,10 -1,069 PreBII s 0,3697 0,79 0,344 Immature B 0,0319 3,31 -1,726

Conclusion: no significant differences except for Immature B

ID2 5´ assays p-value fold change ∆∆CT ProB 0,0009 9,25 -3,2100 PreB I 0,1051 2,45 -1,2945 PreBII L 0,0004 5,97 -2,5768 PreBII s 0,0135 2,64 -1,4022 Immature B 0,0030 10,09 -3,3343

Conclusion: significant differences at all stages, except PreBI RAG2 p-value fold change ∆∆CT ProB 0,4827 0,98 0,031 PreB I 0,2482 1,27 -0,350 PreBII L 0,1132 0,35 1,528 PreBII s 0,1777 0,59 0,762 Immature B 0,0521 2,53 -1,339

Conclusion: no significant differences