Genetic Diversity of Lilium Auratum Var. Platyphyllum Endemic to the Izu Archipelago and Its Relationship to a Nearby Population of L

The Horticulture Journal 86 (3): 379–388. 2017. e Japanese Society for doi: 10.2503/hortj.OKD-006 JSHS Horticultural Science http://www.jshs.jp/

Genetic Diversity of Lilium auratum var. platyphyllum Endemic to the Izu Archipelago and its Relationship to a Nearby Population of L. auratum var. auratum by Morphological and SSR Analysis

Sho Yamamoto1, Tetsuri Kikuchi1, Yutaka Yamagiwa2 and Takashi Handa3*

1Graduate School of Agriculture, Meiji University, Kawasaki 214-8571, Japan 2Shizuoka Research Institute of Agriculture and Forestry, Izu Agricultural Research Center, Higashi-Izu, Shizuoka 413-0411, Japan 3School of Agriculture, Meiji University, Kawasaki 214-8571, Japan

Lilium auratum var. auratum Lindl. is distributed in the eastern part of Honshu, the main island of Japan. L. auratum var. platyphyllum Baker is endemic to the Izu archipelago, which consists of nine large islands located in south of Honshu’s Izu peninsula. Both varieties have been used as important parents of Oriental hybrid lily cultivars. They have large white flowers with yellow central stripes and colored spots on their tepals. L. auratum var. platyphyllum has larger flowers and wider leaves than L. auratum var. auratum. L. auratum var. platyphyllum has yellow spots, whereas L. auratum var. auratum has red or brown ones. Natural hybridization between these two taxa has been suggested on the basis of spot colors of populations in the Izu archipelago and the Izu peninsula. However, their genetic diversity and hybridity in nature have not been reported. We performed morphological analysis using 72 individuals of L. auratum var. auratum from seven populations and 72 individuals of L. auratum var. platyphyllum from six populations. We also performed simple sequence repeat (SSR) analysis using 102 individuals of L. auratum var. auratum from seven populations and 134 individuals of L. auratum var. platyphyllum from six populations. Both analyses revealed that L. auratum var. auratum and L. auratum var. platyphyllum are genetically different and that L. auratum var. platyphyllum has genetic diversity among populations in the archipelago.

Key Words: geographical type, insular endemic plant, lily, morphological characteristics, population diversity.

The Izu archipelago consists of nine large islands: Introduction Izu-Oshima, To-shima, Kouzu-shima, Nii-jima, Lilium auratum has two varieties: L. auratum var. Shikine-jima, Miyake-jima, Mikura-jima, Hachijyo- auratum Lindl. and L. auratum var. platyphyllum Baker jima, and Aoga-shima, from north to south, and several (syn. L. platyphyllum Makino). L. auratum var. auratum small islands (Fig. 1). Izu-Oshima is the largest island is distributed in the eastern part of Honshu (Fig. 1), the and is approximately 20 km from the Izu peninsula. The Japanese mainland (Shimizu, 1987). L. auratum var. altitudes of the highest points of the Izu archipelago platyphyllum is indigenous to the Izu archipelago, lo- range from 109 m (Shikine-jima) to 854 m (Hachjio- cated in south of Honshu’s Izu peninsula. The natural jima). The archipelago was formed as volcanic islands distribution of L. auratum var. platyphyllum in five is- during the Pleistocene era and has never been connect- lands of the archipelago (Izu-Oshima, To-shima, ed to Honshu (Karig, 1975). The islands themselves Kouzu-shima, Miyake-jima, and Mikura-jima) was de- have been separated by ocean since Quaternary glacia- fined by Kikuchi and Kuramoto (2008). tions 20000–80000 years ago when sea levels were 100–120 m lower (Gornitz, 1995). Eighteen plant spe- Received; April 19, 2016. Accepted; September 1, 2016. cies, 21 varieties, one form and two hybrids are endem- First Published Online in J-STAGE on November 3, 2016. ic to the Izu archipelago (Ohba and Akiyama, 2002). This work was supported by by funding from the graduate school of Ohba and Iwatsuki (2006) indicated that the plant spe- Meiji university and from Japanese Society for the Promotion of Science Grants-in-Aid for Scientific Research (No. 15K07301). cies of the Izu archipelago originated in the Honshu. * Corresponding author (E-mail: [email protected]). The relationship of populations in this archipelago and

Fig. 1. Map of the 7 populations of L. auratum var. auratum and 6 populations of L. auratum var. platyphyllum used in this study. 1, Tateyama; 2, Zushi; 3, Miura; 4, Manazuru; 5, Matsuzaki; 6, Higashi-Izu; 7, Shimoda; 8, Izu-Oshima; 9, To-shima; 10, Kouzu-shima; 11, Miyake-jima; 12, Mikura-jima; 13, Aoga-shima. 1–7, L. auratum var. auratum; 8–13, L. auratum var. platyphyllum.

Honshu has been investigated by the morphology in genetic differences among populations (Haruki et al., some plant species: for example, Campanula punctata 1998). However, the genome size of lilies is large and and C. punctata var. microdantia (Inoue and Kawahara, the C values of Lilium species are variable, ranging 1990; Oiki et al., 2001), Hosta longipes (Yamada and from 22 to 104 pg and averaging 56.3 pg (Peruzzi et al., Maki, 2014), Ligustrum obtusifolium, and 2009). Varshney et al. (2007) suggested that individual L. ovalifolium (Yamada et al., 2014). These studies re- amplified fragment length polymorphism (AFLP) or vealed morphological differentiation and diversity be- RAPD fragments are complex in a large genome tem- tween the Izu archipelago and Honshu. plate, because the band number is large. Microsatellites L. auratum var. auratum and L. auratum var. or simple sequence repeat (SSR) markers are useful platyphyllum have racemose inflorescences and large tools for genetic analysis because of their biparental in- white flowers with yellow central stripes, and colored heritance and hypervariability. Some studies of Lilium spots on recurved tepals. L. auratum var. platyphyllum employed SSR markers. Horning et al. (2003) devel- has larger flowers and wider leaves than those of oped six SSR markers in L. philadelphicum. Arzate- L. auratum var. auratum. L. auratum var. auratum Fernández et al. (2005) applied inter simple sequence shows red or brown spots on tepals. In contrast, repeat (ISSR) markers in L. maculatum var. L. auratum var. platyphyllum has yellow spots on the bukosaense. Kawase et al. (2010) developed three SSR tepals, although some individuals of this variety on Izu- markers in L. japonicum. Lee et al. (2011) developed 19 Oshima have been reported to have red spots (Shimizu, EST-SSR markers in L. regale using an expressed se- 1971, 1987). Our preliminary investigation also found quence tag (EST) database. Yuan et al. (2013) devel- that some L. auratum var. platyphyllum individuals had oped 118 EST-SSR markers in L. regale and related red spots on their tepals (Yamamoto et al., 2014a). It species, and applied them to Lilium cultivars. These has been proposed that L. auratum var. auratum and EST-SSR markers were adopted for a wild population L. auratum var. platyphyllum were hybridized in Izu- of L. auratum in our previous study (Yamamoto et al., Oshima by pollinators flying from the Izu peninsula 2014b). (Shimizu, 1971), although Izu-Oshima is 20 km from Although L. auratum var. platyphyllum is an impor- the Izu peninsula by sea. tant genetic resource of Oriental hybrid lilies, there is Several molecular approaches have been applied to little information about its genetic diversity. The wild the genus Lilium. Randomly amplified polymorphic population of L. auratum var. platyphyllum in the Izu DNA (RAPD) markers applied to L. japonicum showed archipelago has been decreasing and is listed in the red Hort. J. 86 (3): 379–388. 2017. 381 list of threatened species in Tokyo as a vulnerable plant Morphological analysis (Ohba, 2011). The Aoga-shima population was once Twenty-four characteristics were measured at flower- diminished by a volcanic eruption. The populations on ing time: (1) flower diameter; (2) outer tepal length; (3) Hachijyo-jima and Miyake-jima were once destroyed outer tepal width; (4) number of red spots on outer by excessive harvesting by humans for ornamental and tepal; (5) number of yellow spots on outer tepal; (6) edible use, and the Miyake-jima population was re- margin undulation of outer tepal; (7) recurving degree planted from the Mikura-jima population. of outer tepal; (8) shape of outer tepal; (9) inner tepal Our preliminary studies using sequence related am- length; (10) inner tepal width; (11) number of red spots plified polymorphism (SRAP) marker analysis and on inner tepal; (12) number of yellow spots on inner morphological observation suggested that L. auratum tepal; (13) spot size of inner tepal; (14) margin undula- var. platyphyllum has genetic diversity in some population of inner tepal; (15) recurving degree of inner tepal; tions of the Izu archipelago (Yamamoto et al., 2012). (16) shape of inner tepal; (17) stamen length; (18) stig- However, the precise genetic differences among popu- ma length; (19) stigma color; (20) coloration of stem lations in the Izu archipelago are still unclear, and the anthocyanin; (21) distribution of stem anthocyanin; (22) genetic relationship between L. auratum var. auratum leaf arrangement; (23) leaf length; and (24) leaf width. and L. auratum var. platyphyllum have not yet been an- At first these morphological data were measured in four alyzed. L. auratum var. auratum population (Tateyama, 15; In the present study, we aimed to assess the genetic Zushi, 11; Miura, 12; Manazuru, 8) and six L. auratum diversity of a wild population of L. auratum var. var. platyphyllum population (Izu-Oshima, 26; To- platyphyllum by morphological and SSR analysis. We shima, 12; Kouzu-shima, 12; Miyake-jima, 13; Mikura- also clarified the genetic relationship between jima, 3; Aoga-shima, 6). To avoid misleading L. auratum var. auratum and L. auratum var. correlations, which can be affected by climate or annual platyphyllum. changes, we selected 10 characteristics for further sta- tistical analysis: (a) number of red spots on outer tepal; Materials and Methods (b) number of red spots on inner tepal; (c) number of Plant materials for morphological analysis yellow spots on outer tepal; (d) number of yellow spots Seventy-two individuals of L. auratum var. auratum on inner tepal; (e) outer tepal length; (f) outer tepal from seven populations in coastal areas in Honshu near width; (g) inner tepal length; (h) inner tepal width; (i) the Izu archipelago (Tateyama, 15; Zushi, 11; Miura, leaf length; and (j) leaf width. 12; Manazuru, 8; Matsuzaki, 8; Higashi-Izu, 3; We compared these 10 characteristics among popula- Shimoda, 15) were investigated (Table 1; Fig. 1). tions and between two varieties using principal compo- Seventy-two individuals of L. auratum var. nent analysis (PCA) using SPSS 20.0. platyphyllum from six populations, representing six islands (Izu-Oshima, 26; To-shima, 12; Kouzu-shima, Plant materials for SSR analysis 12; Miyake-jima, 13; Mikura-jima, 3; Aoga-shima, 6) A total of 236 individuals were analyzed for SSR were investigated. In total, 144 individuals were used analysis. Samples of L. auratum var. auratum were col- Tablefor morphological 1. Population and observation. the numbers of individuals used for morphological andlected SSR analysis. from seven populations from coastal areas in

Table 1. Population and the numbers of individuals used for morphological and SSR analysis.

Number of individuals Population codez Population Location Morphology SSR 1 Tateyama Tateyama, Chiba 15 16 2 Zushi Zushi, Kanagawa 11 16 3 Miura Miura, Kanagawa 12 16 4 Manazuru Manazuru, Kanagawa 8 16 5 Matsuzaki Matsuzaki, Shizuoka 8 16 6 Higashi-Izu Higashi-Izu, Shizuoka 3 4 7 Shimoda Shimoda, Shizuoka 15 18 8 Izu-Oshima Izu-Oshima, Tokyo 26 32 9 To-shima To-shima, Tokyo 12 30 10 Kouzu-shima Kouzu-shima, Tokyo 12 10 11 Miyake-jima Miyake-jima, Tokyo 13 13 12 Mikura-jima Mikura-jima, Tokyo 3 38 13 Aoga-shima Aoga-shima, Tokyo 6 11 z 1–7, L. auratum var. auratum; 8–13, L. auratum var. platyphyllum. Table 2. Primer sequences of SSR markers (Lee et al., 2011; Yuan et al., 2013) used in this study. 382 S. Yamamoto, T. Kikuchi, Y. Yamagiwa and T. Handa

Table 2. Primer sequences of SSR markers (Lee et al., 2011; Yuan et al., 2013) used in this study.

Primer sequence Primer sequence Size Number Locus H z Reference (forward) (reverse) range of allele e L20 CCAACAATTTTGATTACATGG ATTCAAGCAATATCTCATCCCTC 218–233 6 0.57 Lee et al. (2011) L59 ACTGGGGAGAATATCAAGAAC AAAAACCAACTACAACACATCA 280–292 5 0.62 Lee et al. (2011) eL16 TTTCTCGCGTTGGCCCCTATG TAAGCATCATATCAAGCATAGC 265–271 3 0.42 Lee et al. (2011) eL42 AAGCATGCTGAGCTGTTGTCAG CTGCTTGAGTTGGTGTTGTTCG 157–166 4 0.24 Lee et al. (2011) ivflmre252 TAGACCTCGTGCCGTTATCA TGGCGTAGCAGTTGTCTTGG 194–212 7 0.56 Yuan et al. (2013) ivflmre294 TTGGCGGTTGATCTTGTTCT TGCAACCCTTTTCTCTCCTC 142–163 9 0.68 Yuan et al. (2013) ivflmre330 AGCACCACCACTGTCTTTATCG ATCTCCTCGTTGTTCGGGTT 228–237 4 0.57 Yuan et al. (2013) ivflmre850 GCAGCGAGTGCGACAAAG AGATCTGGTCATCAGGAGCG 227–233 3 0.49 Yuan et al. (2013) z He: expected heterozygosity.

Honshu near the Izu archipelago (Tateyama, 16; Zushi, The average number of alleles per locus (Na), ob- 16; Miura, 16; Manazuru, 16; Matsuzaki 6; Higashi-Izu, served heterozygosity (Ho), expected heterozygosity 4; Shimoda, 18) (Table 1; Fig. 1). Samples of (He), Nei’s genetic diversity parameter (Nei) (Nei, L. auratum var. platyphyllum were collected from six 1987), and the analysis of molecular variance populations of the Izu archipelago (Izu-Oshima, 32; To- (AMOVA; Excoffier et al., 1992) were calculated with shima, 30; Kouzu-shima, 10; Miyake-jima, 13; Mikura- Arlequin version 3 (Excoffier and Lischer, 2010). A jima, 38; Aoga-shima, 11). neighbor-joining (NJ) tree was generated based on Nei’s genetic distance (Nei et al., 1983) with 1000 boot- SSR analysis strap replicates using Poptree 2 (Takezaki et al., 2010). DNA was isolated from 20 mg of fresh leaf or sta- Principal coordinate analysis (PCoA) among popula- mens by the CTAB method of Doyle (1990). Eight tions was calculated with Genalex 6.5 (Peakall and EST-SSR markers (L20, L59, eL16, eL42, ivflmre252, Smouse, 2006, 2012). Bayesian clustering was calcu- ivflmre294, ivflmre330, and ivflmre850) were selected lated with Structure 2.3.4 (Falush et al., 2007; Pritchard from Lee et al. (2011) and Yuan et al. (2013) (Table 2). et al., 2000). The numbers of distinct clusters (K) varied PCR was performed in reaction mixtures with a final from one to 10. Ten iterations were run for each K, with volume of 5 μL, which contained 0.4 μL of dNTP mix, a burn-in of 200000 and MCMC of 200000 iterations. 0.5 μL 10× reaction buffer, 0.3 μM of each pair of for- The optimal K value was estimated by calculation of ward and reverse primers, 0.025 μL of Ex Taq polymer- ΔK (Evanno et al., 2005). ase (Takara, Tokyo, Japan), 20 ng of DNA and sterile Results distilled water. PCR amplification was performed using a T100 thermal cycler (BioRad, Hercules, CA, USA). Morphological analysis For markers of L20, L59, eL16, and eL42, reaction cy- Morphological variations of ten characteristics in 7 cles consisted of initial denaturation for 94°C for 2 min, populations of L. auratum var. auratum in Honshu and followed by 35 cycles of 94°C for 45 s, 55°C for 45 s, 6 populations of L. auratum var. platyphyllum in the Izu 72°C for 1 min, and final extension for 5 min at 72°C archipelago are shown in Table 3. Honshu populations (Lee et al., 2011). For markers of ivflmre252, of L. auratum var. auratum had red spots only, whereas ivflmre294, ivflmre330, and ivflmre850, a touchdown Izu archipelago populations of L. auratum var. PCR amplification was performed; 94°C for 5 min, fol- platyphyllum had both red and yellow spots, except for lowed by 10 cycles of 94°C for 30 s, 63°C for 30 s (re- the Aoga-shima population, which had only yellow ducing by 0.5°C at each cycle), and 72°C for 45 s. spots. Numbers of red spots on outer and inner tepals Then, 25 cycles of 94°C for 30 s, 58°C for 30 s, and were lower in populations from the Izu archipelago than 72°C for 45 s, and final extension for 5 min at 72°C was in populations from Honshu. Numbers of yellow spots carried out (Yuan et al., 2013). Forward primers of L20, on the outer and inner tepals were significantly higher L59, eL16, ivflmre330, and ivflmre850 were labeled in populations of Aoga-shima and To-shima than in with a fluorescent dye NED, and those of eL42, other populations from the Izu archipelago. Length of ivflmre252, and ivflmre294 were labeled with a fluores- the inner tepal, width of the inner tepal, and length of cent dye HEX (Applied Bio Systems, Carlsbad, CA, the outer tepal, showed no significant differences USA). PCR products were electrophoresed with an in- among populations. ternal size standard (Gene scan-350; Applied Bio Sys- A comparison of mean values of 10 characteristics tems) using a 3100 Genetic Analyzer (Applied Bio between L. auratum var. auratum and L. auratum var. Systems). Genotypes were analyzed using Peak Scan- platyphyllum is shown in Table 3. Tepal width, number ner 1.0 (Applied Bio Systems). of yellow spots on inner and outer tepals, and leaf Table 3. Variance and mean values of ten morphological characteristicsHort. J. 86 (3): of 379–388.7 populations 2017. of L. auratum var. auratum and 6 populations of L. auratum383 var. platyphyllum. Table 3. Variance and mean values of ten morphological characteristics of 7 populations of L. auratum var. auratum and 6 populations of L. auratum var. platyphyllum.

Variety Characteristics Tateyama Zushi Miura Manazuru Matsuzaki Higashi-Izu Shimoda Mean

L. auratum var. Number of indivuduals 15 11 12 8 3 8 15 72 auratum Number of red spots on outer tepal 55.47abcdz 56.73abc 74.00ab 66.50abc 66.30ab 64.50ac 85.60a 67.71 Number of red spots on inner tepal 124.60bcd 116.00bcd 142.92ab 126.00abc 108.67abc 150.75ab 177.33a 139.72 Number of yellow spots on outer tepal 0.00de 0.00de 0.00de 0.00de 0.00de 0.00de 0.00de 0.00 Number of yellow spots on inner tepal 0.00c 0.00c 0.00c 0.00c 0.00c 0.00c 0.00c 0.00 Outer tepal length 133.53abc 144.82ab 150.25ab 161.25a 116.00c 137.25ab 145.4ab 143.28 Outer tepal width 34.20ab 37.73ab 37.08ab 41.38a 31.00b 30.38ab 34.73ab 35.57 Inner tepal length 130.53bc 140.45abc 145.92abc 156.88a 112.67c 133.88abc 143.4abc 139.85 Inner tepal width 53.80ab 54.45ab 54.92ab 64.38a 51.33ab 49.75b 57.67ab 55.51 Leaf length 137.60abcd 170.18a 163.83ab 177.50a 146.67abcd 154.88abc 152.60abc 156.81 Leaf width 23.07c 26.55c 22.73c 41.63ab 27.67bc 31.63bc 31.93c 28.64

L. auratum var. Characteristics Izu-Oshima To-shima Kouzu-shima Miyake-jima Mikura-jima Aoga-shima Mean Py platyphyllum Number of indivuduals 26 12 12 13 3 6 72 Number of red spots on outer tepal 29.85cd 33.33cd 73.08ab 40.38bcd 31.67abc 0.00d 37.13 ** Number of red spots on inner tepal 35.00ef 32.25def 73.67cde 44.77def 36.00def 0.00f 39.89 ** Number of yellow spots on outer tepal 22.73c 65.25a 6.33cdef 15.15cd 8.67ce 55.33b 27.85 ** Number of yellow spots on inner tepal 31.12b 58.33ab 37.00b 40.38b 19.33bc 81.83a 42.04 ** Outer tepal length 145.73ab 154.42ab 146.00ab 148.62ab 143.33ab 156.00ab 148.50 ns Outer tepal width 36.69ab 39.67a 37.67ab 38.00ab 34.33ab 38.17ab 37.61 * Inner tepal length 139.19abc 149.92abc 140.00abc 145.69abc 135.33abc 155.00ab 143.44 ns Inner tepal width 59.15ab 62.75ab 61.83ab 63.77ab 61.00ab 59.17ab 61.11 ** Leaf length 109.77d 159.67abcd 124.83bcd 109.15d 132.67abcd 144.83abcd 124.36 ** Leaf width 28.31c 51.00a 29.08c 28.38c 31.00bc 46.167a 33.83 ** z Different letters indicate significant differences (P < 0.05) between populations, as derived by Tukey’s test. y P value by Tukey’s test between varieties. Significant level, ns (non-significant); * (P < 0.05); ** (P < 0.01). Table 4. Factor loadings of ten morphological characteristics in the first three principal components (PCs) of the PCA. length and width of L. auratum var. platyphyllum were Table 4. Factor loadings of ten morphological characteristics in the significantly greater than those of L. auratum var. first three principal components (PCs) of the PCA. auratum. The number of red spots on outer and inner Characteristics PC1 PC2 PC3 tepals was higher in L. auratum var. auratum than Number of red spots on outer tepal −0.31 0.80 −0.04 L. auratum var. platyphyllum. L. auratum var. Number of red spots on inner tepal −0.48 0.75 0.09 platyphyllum had a large variation in the number of red Number of yellow spots on outer tepal 0.61 −0.59 0.26 spots because the Aoga-shima population had only yel- Number of yellow spots on inner tepal 0.61 −0.57 −0.03 low spots. Other characteristics showed no marked dif- Outer tepal length 0.71 0.51 −0.09 ferences between the two varieties. Outer tepal width 0.67 0.41 −0.21 Eigenvalues of principal component 1 (PC1), PC2, Innner tepal length 0.72 0.51 −0.07 and PC3 were 3.48, 2.87, and 1.16, respectively (Table Inner tepal width 0.74 0.32 −0.33 4). The contribution percentages of PC1, PC2, and PC3 Leaf length 0.07 0.44 0.79 were 34.78%, 28.66%, and 11.60%, respectively. The Leaf width 0.62 0.06 0.54 first three contributions cumulatively accounted for Eigenvalue 3.48 2.87 1.16 75.04%. Eigenvalues for PC1 to PC3 are shown in Contribution ratio (%) 34.78 28.66 11.60 Table 4. PC1 explained outer tepal length and width, Cumulative contribution ratio (%) 34.78 63.44 75.04 number of yellow spots, length and width of the inner tepal, and leaf width. PC2 explained number of red spots. PC3 explained leaf length. A two-dimensional scatter diagram of the first and second components for SSR analysis ten morphological characteristics shows that L. auratum The Na and He ranged from three (eL16, ivflmre850) var. auratum and L. auratum var. platyphyllum are sepa- to nine (ivflmre294) and from 0.24 (eL42) to 0.68 rate, but that individuals are not clearly clustered in (ivflmre294), respectively (Table 2). The average Na, populations within each variety (Fig. 2). Ho, He, and Nei’s genetic diversity (Nei) values for the populations are shown in Table 5. Na ranged from 2.80 (Aoga-shima) to 4.86 (Matsuzaki, Shimoda). Ho ranged 384 S. Yamamoto, T. Kikuchi, Y. Yamagiwa and T. Handa from 0.15 (Aoga-shima) to 0.63 (Zushi). He ranged auratum and L. auratum var. platyphyllum on the PC1 from 0.43 (Aoga-shima) to 0.70 (Matsuzaki). Nei axis (Data not shown). ranged from 0.27 (Aoga-shima) to 0.61 (Aoga-shima). In the Bayesian cluster analysis, the highest ΔK was AMOVA showed that variation within populations of 2. When K = 2 (Fig. 4A), individuals of L. auratum var. L. auratum var. auratum and L. auratum var. auratum were assigned to cluster I and those of platyphyllum accounted for 86% and 73%, respectively L. auratum var. platyphyllum were assigned to cluster (Data not shown). AMOVA also indicated that the pro- II. When K = 3 (Fig. 4B), individuals of L. auratum var. portion of variation in populations was larger in auratum were assigned to clusters I. Most individuals L. auratum var. platyphyllum (27%) than L. auratum of Izu-Oshima, To-shima, and Kouzu-shima were as- var. auratum (14%) signed to cluster II. Individuals of Miyake-jima, According to the NJ tree, L. auratum var. auratum Mikura-jima, and Aoga-shima individuals were as- and L. auratum var. platyphyllum were clearly separated signed to cluster III. (Fig. 3). PCoA also clearly separated L. auratum var.

L. auratum var. auratum

L. auratum var. platyphyllum

Fig. 2. Two-dimensional scatter diagram of the first and second components using ten morphological characteristics in 7 populations of Table 5.L. auratum Genetic parametersvar. auratum of and 7 populations 6 populations of L. of auratum L. auratum var. var. auratum platyphyllum and 6 populations. of L. auratum var. platyphyllum by SSR analysis.

Table 5. Genetic parameters of 7 populations of L. auratum var. auratum and 6 populations of L. auratum var. platyphyllum by SSR analysis.

z y x w Variety Population n Na Ho He Nei L. auratum var. auratum Tateyama 16 4.57 0.38 0.64 0.56 Zushi 16 4.71 0.63 0.66 0.58 Miura 16 3.86 0.46 0.56 0.49 Manazuru 16 4.57 0.45 0.62 0.55 Matsuzaki 16 4.86 0.50 0.70 0.61 Higashi-Izu 4 3.33 0.54 0.61 0.46 Shimoda 18 4.86 0.44 0.67 0.58 Mean 4.39 0.49 0.64 0.55 L. auratum var. platyphyllum Izu-Oshima 32 4.63 0.27 0.59 0.59 To-shima 30 3.88 0.29 0.53 0.44 Kouzu-shima 10 3.63 0.38 0.46 0.53 Miyake-jima 13 4.13 0.26 0.62 0.62 Mikura-jima 38 4.38 0.26 0.47 0.47 Aoga-shima 11 2.80 0.15 0.43 0.27 Mean 3.90 0.27 0.51 0.49 z Na: Average number of alleles. y Ho: Observed heterozygosity. x He: Expected heterozygosity. w Nei: Nei’s genetic diversity. Hort. J. 86 (3): 379–388. 2017. 385

L. auratum var. auratum

L. auratum

var. platyphyllum

Fig. 3. Neighbor-joining tree using Nei’s genetic distance of 7 populations of L. auratum var. auratum and 6 populations L. auratum var. platyphyllum by SSR analysis. Numbers on branches are bootstrap values based on 1000 replicates.

(A) tepals are important ornamental traits in lilies. From our morphological observations, L. auratum var. platyphyllum has fewer red spots on tepals than L. auratum var. auratum, and yellow spots are found only in this variety. Within the Izu archipelago, the Aoga-shima population had only yellow spots. Num- bers of spots varied among population within the Izu archipelago. Numbers of yellow spots on outer tepals were markedly higher in populations from Aoga-shima and To-shima than in other populations. The To-shima population showed a large variation in spot characteris- (B) tics, having both red and yellow spots. In SSR analysis, the NJ tree showed features of the Aoga-shima population not present in other populations. These results show that the Aoga-shima population is genetically different from other populations in the Izu archipelago. A genetic difference of the Aoga- shima population was also suggested by our previous SRAP analysis (Yamamoto et al., 2012). This preliminary experiment showed that the Aoga-shima population is different from those of other islands. Aoga- Fig. 4. Bayesian cluster analysis of 7 populations of L. auratum shima is the southernmost island in the Izu archipelago, var. auratum and 6 populations L. auratum var. platyphyllum by which is approximately 70 km from the nearest island SSR analysis, estimated from data for K = 2 (A) and K = 3 (B). Hachijo-jima. Four of 8 SSR loci (L20, L59, eL16, and Population codes: 1, Tateyama; 2, Zushi; 3, Miura; 4, Manazuru; 5, Matsuzaki; 6, Higashi-Izu; 7, Shimoda; 8, Izu- eL42) were homozygous in the Aoga-shima population. Oshima; 9, To-shima; 10, Kouzu-shima; 11, Miyake-jima; 12, These SSR loci were not homozygous in other Mikura-jima; 13, Aoga-shima. 1–7, Lilium auratum var. L. auratum var. platyphyllum populations. Aoga-shima auratum; 8–13, L. auratum var. platyphyllum. exploded in 1785 and most plant populations disap- peared at that time. Our results indicate that L. auratum var. platyphyllum populations drastically decreased in Discussion number at one point in time, forming a bottleneck. The Miyake-jima population was replanted from the Genetic diversity of L. auratum var. platyphyllum Mikura-jima population after disappearing following L. auratum var. platyphyllum is an endemic variety in excessive harvesting. Our findings also suggested a the Izu archipelago and has been used as genetic re- similarity between the Miyake-jima and Mikura-jima source for lily breeding. Color and number of spots on populations by morphological and SSR analysis. There 386 S. Yamamoto, T. Kikuchi, Y. Yamagiwa and T. Handa was no significant difference in terms of morphological spotted individuals adapted in Aoga-shima. characteristics between the populations of the two islands and results of the NJ tree showed their close rela- Genetic relationships between L. auratum var. tionship. The To-shima population had a higher number platyphylum and nearby populations of L. auratum var. of yellow spots and wider leaves. The results of the NJ auratum tree and structure analysis suggested that the To-shima Shimizu (1971) reported finding populations with red population is close to the Izu-Oshima and Kouzu-shima spots on tepals in Izu-Oshima and suggested that hy- populations. The reason for these differences in To- bridization had been brought about by pollinators flying shima is unknown. from the Izu peninsula. Ogiwara (1962) found red- In our morphological and SSR analysis of L. auratum spotted individuals in Mikura-jima. In view of the dis- var. platyphyllum, there was a significant difference be- tance of Mikura-jima from the Izu peninsula, Mikura- tween the populations from Aoga-shima and those from jima individuals were considered to belong to the other islands of the Izu archipelago. The genetic L. auratum var. platyphyllum. We have observed indi- structure of Prunus lannesiana var. speciosa on the viduals with red spots in locations other than Izu- mainland and in the Izu archipelago has been investi- Oshima. However, there was a marked difference in gated by SSR and AFLP markers (Kato et al., 2011), spot number and color between the mainland and the who found highly significant genetic differentiation be- Izu archipelago. The number of red spots was smaller in tween Hachijyo-jima and other islands. Yamada and the Izu archipelago than in Honshu populations. SSR Maki (2012) investigated the genetic differentiation of analysis also indicated genetic differences between Weigela coraeenisis between the Izu archipelago and Honshu and the Izu archipelago populations. Inoue and the mainland using SSR markers. They also found that Kawahara (1990) distinguished a mainland group and the Hachijyo-jima population formed a distinct cluster an Izu archipelago group in Campanula punctate using in Bayesian cluster analysis results. In our study, the morphological and allozyme analysis. The population results for the Aoga-shima population were similar to of Izu-Oshima was similar to that of the mainland pop- those of other studies for the Hachijyo-jima population. ulation in some morphological characteristics but was The pollinator species of L. auratum var. auratum is closely related to other Izu archipelago populations in a butterfly (Papilio bianor) in the daytime and a hawk their allozyme analysis. Our morphological and SSR moth (Meganonton analis) in the nighttime (Morinaga findings were similar to these findings for Campanula et al., 2009). There is no report regarding the pollinator species. In our study, L. auratum var. platyphyllum had species of L. auratum var. platyphyllum. The number of red spots on tepals, a characteristic similar to that of butterfly species in the Izu archipelago has decreased in L. auratum var. auratum. The SSR analysis showed a comparison with that on the mainland. The number clear difference between the mainland and the Izu ar- ranged from 34 to 112 in Tokyo towns (Nishitama chipelago. These results suggest that L. auratum var. Kontyu Dokokai, 2012). In contrast, 13 to 47 species auratum and L. auratum var. platyphyllum populations were observed in the Izu archipelago. The number of have not been hybridized. Papilio species was eight in Tokyo and three to six in The large difference between mainland and Izu archi- the Izu archipelago. Flowers adapted to nocturnal hawk pelago populations shown by SSR analysis is similar to moth pollination have whitish colors and strong aromas that of Iwata et al. (2006). They investigated the genetic (Miyake, 2010). In our study, the number of red tepal structure of Alunus sieboldiana, Miscanthus sinensis spots was significantly decreased in populations of the ssp. condensatus, and Polygonum cuspidatum var. Izu archipelago. This result indicates a change in polli- terminalis populations in the Izu peninsula and the Izu nator species in the Izu archipelago. L. japonicum, a archipelago. There was a significant correlation be- close relative of L. auratum, has pink flowers without tween genetic and geographical distance in M. sinensis spots. The pollinators of this species have been identi- ssp. condensatus and P. cuspidatum var. terminalis. fied as hawk moths (Acosmeryx naga and Sphinx Three spacer regions in chloroplast DNA showed that constricta) (Inagaki, 2003). These findings suggest that L. auratum var. auratum was close to L. rubrum and the main pollinator species of L. auratum var. that L. auratum var. platyphyllum was close to platyphyllum, which has white flowers with a modest L. japonicum (Nishikawa et al., 2002). These results number of yellow spots, is the hawk moth. L. auratum also suggested a genetic difference between L. auratum var. platyphyllum has flower characteristics more var. auratum and L. auratum var. platyphyllum. adapted to the nocturnal hawk moth than to butterfly Our results indicate that L. auratum var. platyphyllum pollination. The number of Papilio species in Aoga- has high diversity in the Izu archipelago. This variety shima has been reported as three and for the other is- has been used for breeding cultivars. However, there lands of the Izu archipelago as five to eight (Nishitama have been not any studies on wild population diversity. Kontyu Dokokai, 2012). We propose that because of the The present study is the first to perform morphological small number of butterfly species, hawk moths became and SSR analysis of L. auratum var. platyphyllum. the dominant pollinators and that only the yellow- These results provide basic information for this variety, Hort. J. 86 (3): 379–388. 2017. 387 the wild population is endemic to the Izu archipelago, lation genetic structure of Lilium japonicum and serpentine and here we analyzed most of the populations of plant L. japonicum var. abeanum by using developed micro- L. auratum var. platyphyllum. satellite markers. Plant Biosyst. 144: 29–37. Kikuchi, T. and N. Kuramoto. 2008. A study of the distribution Acknowledgements characteristics of endemic variety Lilium auratum Lindl. var. platyphyllum Baker on Izu-Oshima island, Japan. J. Japan. We thank Mr. Toru Hishi and Mr. Kazunobu Kogi Soc. Reveget. Tech. 34: 75–80 (In Japanese). of Mikura island tourist information center and Mr. Lee, S. I., K. C. Park, Y. S. Song, J. H. Son, S. J. Kwon, K. J. Na, Mizuki Hara of Tokyo metropolitan Miyake office for J. H. Kim and N. S. Kim. 2011. Development of expressed collecting samples. sequence tag derived-simple sequence repeats in the genus Lilium. Genes and Genomics 33: 727–733. Literature Cited Miyake, T. 2010. How do nocturnal hawkmoths search flowers?: Interaction between vison and olfaction and the evolution of Arzate-Fernández, A. M., M. Miwa, T. Shimada, T. Yonekura and hawkmoth-pollinated flowers. Aroma Res. 41: 34–40. K. Ogawa. 2005. Genetic diversity of Miyamasukashi-yuri Morinaga, S., Y. Kumano, A. Ota, R. Yamaoka and S. Sakai. (Lilium maculatum Thunb. var. bukosanense), an endemic 2009. Day–night fluctuations in floral scent and their effects and endangered species at Mount Buko, Saitama, Japan. on reproductive success in Lilium auratum. Popul. Ecol. 51: Plant Spec. Biol. 20: 57–65. 187–195. Doyle, J. J. 1990. Isolation of plant DNA from fresh tissue. Focus Nei, M. 1987. Molecular Evolutionary Genetics. Columbia Uni- 12: 13–15. versity press, New York. Evanno, G., S. Regnaut and J. Goudet. 2005. Detecting the num- Nei, M., F. Tajima and Y. Tateno. 1983. Accuracy of estimated ber of clusters of individuals using the software phylogenetic trees from molecular data. J. Mol. Evol. 19: STRUCTURE: a simulation study. Mol. Ecol. 14: 2611– 153–170. 2620. Nishikawa, T., K. Okazaki and T. Nagamine. 2002. Phylogenetic Excoffier, L. and H. E. Lischer. 2010. Arlequin suite ver. 3.5: A relationships among Lilium auratum Lindley, L. auratum new series of programs to perform population genetics anal- var. platyphyllum Baker and L. rubellum Baker based on yses under Linux and Windows. Mol. Ecol. Resour. 10: 564– three spacer regions in chloroplast DNA. Breeding Sci. 52: 567. 207–213. Excoffier, L., P. E. Smouse and J. M. Quattro. 1992. Analysis of Nishitama Kontyu Dokokai. 2012. Tokyoto-cho-bunruihyo. molecular variance inferred from metric distances among p. 190–194. In: Nishitama Kontyu Dokokai (ed.). Tokyoto- DNA haplotypes: application to human mitochondrial DNA no-cho (In Japanese). Keyaki Publishing, Tokyo. restriction data. Genetics 131: 479–491. Ogiwara, R. 1962. The karyotypes of Lilium auratum Lindl. and Falush, D., M. Stephens and J. K. Pritchard. 2007. Inference of L. auratum var. platyphyllum Baker. La Kromosomo 53–54: population structure using multilocus genotype data: domi- 1747–1757 (In Japanese with English abstract). nant markers and null alleles. Mol. Ecol. Notes 7: 574–578. Ohba, H. 2011. Syokubutsu (Izushotou-no-reddo-risuto) p. 28. In: Gornitz, V. 1995. Monitoring sea level changes. Clim. Changes Tokyo metropolitan government (ed.). Natural environment 31: 515–544. division, 2011. Red List of Threatened Species in Tokyo is- Haruki, K., T. Hosoki and Y. Nako. 1998. RAPD analysis of land version (In Japanese). Tokyo metropolitan government, Lilium japonicum Thunb. native to Shimane and other pre- Tokyo. fectures, Japan. J. Japan. Soc. Hort. Sci. 67: 785–791 (In Ohba, H. and S. Akiyama. 2002. A synopsis of the endemic spe- Japanese with English abstract). cies and infraspecific taxa of vascular plants of the Izu is- Horning, M. E., S. C. Maloney and M. S. Webster. 2003. Isola- lands. Mem. Nation. Sci. Mus. Tokyo. 38: 119–160. tion and characterization of variable microsatellite loci in Ohba, H. and K. Iwatsuki. 2006. Kantochihou-no-syokubutsusou- Lilium philadelphicum (Liliaceae). Mol. Ecol. Notes 3: 412– sonogaiyou. p. 201–221. In: H. Ohba (ed.). Selected works 413. of Hideaki Ohba Volume 2; Taxonomy, geobotany and ecol- Inagaki, H. 2003. Ecological characteristics of Lilium japonicum ogy (In Japanese). Yasaka Shobo Inc., Tokyo. Thunb. at native habitat. J. Japan. Soc. Reveget. Tech. 29: Oiki, S., T. Kawahara, K. Inoue, M. Ohara and M. Maki. 2001. 80–84 (In Japanese with English abstract). Random amplified polymorphic DNA (RAPD) variation Inoue, K. and T. Kawahara. 1990. Allozyme differentiation and among populations of the insular endemic plant Campanula genetic structure in island and mainland Japanese popula- microdonta (Campanulaceae). Ann. Bot. 87: 661–667. tions of Campanula punctata (Campanulaceae). Am. J. Bot. Peakall, R. and P. E. Smouse. 2006. GENALEX 6: genetic analy- 77: 1440–1448. sis in Excel. Population genetic software for teaching and Iwata, H., T. Kamijo and Y. Tsumura. 2006. Assessment of genet- research. Mol. Ecol. Notes 6: 288–295. ic diversity of native species in Izu islands for a discriminate Peakall, R. and P. E. Smouse. 2012. GenAlEx 6.5: genetic analy- choice of source populations: implications for revegetation sis in Excel. Population genetic software for teaching and of volcanically devastated sites. Conserv. Genet. 7: 399–413. research—an update. Bioinformatics 28: 2537–2539. Karig, D. E. 1975. Basin genesis in the Philippine Sea. p. 857– Peruzzi, L., I. J. Leitch and K. F. Caparelli. 2009. Chromosome 879. In: D. E. Karig and J. C. Ingle (eds.). Initial reports of diversity and evolution in Liliaceae. Ann. Bot. 103: 459– the deep sea drilling project 31. United States Government 475. Printing Office, Washington DC. Pritchard, J. K., M. Stephens and P. Donnelly. 2000. Inference Kato, S., H. Iwata, Y. Tsumura and Y. Mukai. 2011. Genetic of population structure using multilocus genotype data. structure of island populations of Prunus lannesiana var. Genetics 155: 945–959. speciosa revealed by chloroplast DNA, AFLP and nuclear Shimizu, M. 1971. Gosoyudaina-yamayuri-to-sakuyuri. p. 154– SSR loci analyses. J. Plant Res. 124: 11–23. 158. In: M. Shimizu (ed.). Japanese lily (In Japanese). Kawase, D., K. Hayashi, Y. Takeuchi and T. Yumoto. 2010. Popu- Seibundo-shinkosya, Tokyo. 388 S. Yamamoto, T. Kikuchi, Y. Yamagiwa and T. Handa

Shimizu, M. 1987. Yamayuri-to-Sakuyuri. p. 65–68 In: M. Yamada, T., K. Kodama and M. Maki. 2014. Floral morphology Shimizu (ed.). The lilies of Japan, species and hybrids (In and pollinator fauna characteristics of island and mainland Japanese). Seibundo-shinkosya, Tokyo. populations of Ligustrum ovalifolium (Oleaceae). Bot. J. Takezaki, N., M. Nei and K. Tamura. 2010. POPTREE2: Soft- Linn. Soc. 174: 489–501. ware for constructing population trees from allele frequency Yamamoto, S., T. Kikuchi and T. Handa. 2012. Genetic diversity data and computing other population statistics with of Lilium auratum var. platyphyllum in Izu archipelago, Windows interface. Mol. Biol. Evol. 27: 747–752. Japan by sequence-related amplified polymorphism markers. Varshney, R. K., M. Thudi, R. Aggarwal and A. Börner. 2007. Acta Hortic. 953: 97–102. Genetic molecular markers in plants: development and appli- Yamamoto, S., T. Kikuchi and T. Handa. 2014a. Morphological cations. p. 13–29. In: R. K. Varshney and R. Tuberosa (eds.). diversity of Lilium auratum var. platyphyllum in Izu archi- Genomics assisted crop improvement: genomics approaches pelago, Japan. Acta Hortic. 1025: 127–132. and platforms, vol. 1. Springer, Dordrecht. Yamamoto, S., Y. Yamagiwa, Z. Inaba and T. Handa. 2014b. Mor- Yamada, T. and M. Maki. 2012. Floral differentiation among phological and microsatellite analysis of putative natural hy- insular and mainland populations of Weigela coraeensis brid population between Lilium japonicum and L. auratum in (Caprifoliaceae). Plant Syst. Evol. 288: 113–125. Izu peninsula, Japan. Acta Hortic. 1027: 47–54. Yamada, T. and M. Maki. 2014. Relationships between floral Yuan, S., G. Liang, L. Chun and J. Ming. 2013. The development morphology and pollinator fauna in insular and main island of EST-SSR markers in Lilium regale and their cross- populations of Hosta longipes (Liliaceae). Plant Spec. Biol. amplification in related species. Euphytica 189: 393–419. 29: 117–128.