DNA Methylation Patterns at Relapse in Adult Acute Lymphocytic Leukemia1

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Vol. 8, 1897–1903, June 2002 Clinical Cancer Research 1897 DNA Methylation Patterns at Relapse in Adult Acute Lymphocytic Leukemia1 Guillermo Garcia-Manero,2 Carlos Bueso-Ramos, Conclusions: In summary, DNA methylation patterns Jerry Daniel, Jason Williamson, are stable in a majority of patients with relapsed ALL, but a subset of patients acquire new methylation changes, in Hagop M. Kantarjian, and Jean-Pierre J. Issa particular affecting cell cycle regulatory genes. Departments of Leukemia [G. G-M., J. D., J. W., H. M. K., J-P. J. I.] and Hematopathology [C. B-R.], University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 INTRODUCTION DNA methylation refers to the addition of a methyl group to the cytosine in a cytosine-guanosine pair (CpG). CpG pairs ABSTRACT are underrepresented in eukaryotic genomes but can be found at Purpose: Aberrant DNA methylation of promoter- near-expected frequency in intergenic repetitive sequences such associated CpG islands is an epigenetic DNA modification as Alu repeats or in the proximity of gene promoters. Methyl- observed in acute leukemias that in certain cases has been ation of these promoter-associated areas has been associated associated with a poor prognosis and increased relapse rates. with gene silencing and is a physiological compensatory dosage To study the role of DNA methylation in relapse mecha- mechanism in X-linked and imprinted genes. By silencing func- nisms in acute lymphocytic leukemia (ALL), we have com- tionally relevant genes, aberrant DNA methylation has been pared the methylation status of five genes at the time of linked to diverse human pathologies (1), including cancer (2) initial presentation and at first relapse in 25 adult patients and aging (3). Aberrant methylation of multiple promoter-asso- with ALL. ciated CpG islands has been found in acute leukemias (4–6). Experimental Design: Genes studied included the estro- These studies have revealed that subgroups of patients with gen receptor (ER), multidrug resistance gene 1 (MDR1), p73, acute leukemia are characterized by a hypermethylator pheno- p15, and p16. DNA was extracted from paraffin-embedded type defined by the simultaneous methylation of multiple genes. bone marrow biopsies. DNA methylation was analyzed using This is similar to the CpG island methylator phenotype de- PCR of bisulfite-modified DNA. scribed in colon cancer (7) and suggests that aberrant methyla- Results: Results indicate that methylation at the time of tion is an important oncogenic mechanism in acute leukemias. relapse was stable in 92% of patients for p73, 88% for ER, Methylation of several genes has been associated with poor 80% for p16, 72% for MDR1, and 60% for p15. Only one prognosis in patients with acute leukemia. Hypermethylation of the calcitonin gene has been associated with poor prognosis and case had p16 methylation at initial presentation, whereas 6 3 had methylation at relapse. Three disease progression in ALL (8–10). This phenomenon has also (0.0001 ؍ patients (P cases had concomitant methylation of p15 and p16 at re- been observed for HIC1 (11) and WT-1 (12) in AML. In con- trast, hypermethylation of ER has been associated with a better lapse. The degree of MDR1 methylation inversely correlated prognosis in AML (13), although abnormal methylation of this with the presence of MDR1 expression as detected by im- gene is also found at the time of relapse (14). In bladder cancer, munohistochemistry. Eighteen patients (72%) had acquired hypomethylation of the MDR1 gene has been associated with no or one methylation change, whereas the rest (28%) had protein reexpression and a chemoresistant phenotype at relapse methylation changes in two or three genes. No clinical- (15). p15 and p16, two cell cycle regulatory genes, are consid- biological correlations were found between methylation of ered tumor suppressor genes. Diverse abnormalities of these two any particular gene or pattern. genes, including p15 methylation, have been shown to be ac- quired at the time of relapse in pediatric ALL (16). Methylation of p15 has been shown to confer poor prognosis and to predict the risk of relapse in patients with acute leukemias (17, 18). Received 11/15/01; accepted 3/14/02. Methylation of p16, a rare event in human leukemias (6, 19), has The costs of publication of this article were defrayed in part by the been associated with disease progression in adult T-cell leuke- payment of page charges. This article must therefore be hereby marked mia (20). Other lymphoid neoplasms, such as non-Hodgkin’s advertisement in accordance with 18 U.S.C. Section 1734 solely to lymphomas, also are characterized by abnormal methylation of indicate this fact. 1 This study was supported in part by a Translational Research Grant these two genes, a phenomenon also associated with relapse from the Leukemia and Lymphoma Society of America and Research Grant RPG-99-098-01 from the American Cancer Society (to J-P. J. I.). G. G-M. is the recipient of a Career Development Award from the American Society of Clinical Oncology and the Peggy Howard Memo- rial Fund. 3 The abbreviations used are: ALL, acute lymphocytic leukemia; AML, 2 To whom requests for reprints should be addressed, at Department of acute myeloid leukemia; MRD, minimal residual disease; ER, estrogen Leukemia, Box 428, University of Texas M. D. Anderson Cancer Cen- receptor; MDR1, multidrug resistance 1; CR, complete remission; MSP, ter, 1515 Holcombe Boulevard, Houston, TX 77030. Phone: (713) 745- methylation-specific PCR; COBRA, combined bisulfite restriction 3428; Fax: (713) 794-4297; E-mail: [email protected]. analysis. Downloaded from clincancerres.aacrjournals.org on September 27, 2021. © 2002 American Association for Cancer Research. 1898 Methylation Profiling in Relapse ALL Table 1 Genes studied Gene accession Restriction enzyme Annealing temperatures number Primers (coordinates) Restriction sites (no. of cycles) ER GGTTTTTGAGTTTTTTGTTTTG (300) BstUI 60 (3), 57 (4), 54 (5), 51 (25) X03635 AACTTACTACTATCCAAATACACCTC (505) 1 p15 GGAGTTTAAGGGGGTGGG (24747) BstUI 59 (37) AC000049 CCTAAATTACTTCTAAAAAAAAAC (24918) 2 MDR1 GTTATAGGAAGTTTGAGTTT (140829) TaqI 54 (3), 51 (4), 48 (5), 45 (26) AC002457 AAAAACTATCCCATAATAAC (141001) 1 p73 methylated ACCCCGAACATCGACGTCCG 60 (34) (Ref. 24) GGACGTAGCGAAATCGGGGTTC p73 unmethylated ATCACAACCCCAAACATCAACATCCA 60 (34) (Ref. 24) AGGGGATGTAGTGAAATTGGGGTTT p16 methylated TTATTAGAGGGTGGGGCGGATCGC 60 (34) (Ref. 19) GACCCCGAACCGCGACCGTAA p16 unmethylated TTATTAGAGGGTGGGGTGGATTGT 60 (34) (Ref. 19) CAACCCCAAACCACAACCATAA (21). These findings suggest that aberrant methylation may have to UpG without modifying methylated sites. This allows their a role in leukemic relapse. Knowledge of the dynamics of differentiation by allele specific PCR (MSP), restriction diges- methylation patterns at the time of relapse may have important tion (COBRA) or sequencing. Bisulfite treatment of genomic implications, including the understanding of cellular clonal DNA was performed as described (23). DNA was extracted changes during disease progression, the development of assays using standard phenol-chloroform methods after samples had to detect MRD, and the development of targeted therapies using been deparaffinized using xylene and ethanol followed by di- hypomethylating agents for high-risk patients. gestion with proteinase K. After extraction, 2 ␮g of DNA were We have previously studied the methylation status of ER, used for bisulfite treatment. DNA was denatured in 0.2 N NaOH MDR1, p73, p15, p16, THBS1, THBS2, CD10, c-abl, and Myod at 37°C for 10 min and incubated with 3 M sodium bisulfite at in 80 patients with ALL (6). We have selected five of them, ER, 50°C for 16 h. DNA was then purified using the Wizard cleanup MDR1, p73, p15, and p16, to study the methylation patterns system (Promega) and desulfonated with 0.3 N NaOH at 25°C both at the time of initial presentation and at relapse in 25 for 5 min. DNA was then precipitated with ammonium acetate patients with relapsed ALL who had achieved complete remis- and ethanol, washed with 70% ethanol, dried, and resuspended sion after initial induction chemotherapy. Our results indicate in H2O. that the methylation patterns of patients with relapsed ALL are Primer Design. Primer sequences, coordinates, Gen- stable in a majority of patients, but that a subgroup of patients Bank accession numbers, number of expected restriction acquire new methylation changes, in particular of genes in- fragments, and PCR conditions are shown in Table 1. For p73 volved in cell cycle regulation. and p16, we used MSP as described elsewhere (19, 24). For p15, MDR1, and ER, we used COBRA (25). To minimize MATERIALS AND METHODS overestimation of methylated alleles when using this method, Samples. Paraffin-embedded bone marrow biopsies from the following points were followed: (a) primers were de- 25 adult patients with ALL obtained at the time of original signed to contain a minimum number of CpG dinucleotides in diagnosis and at first relapse have been analyzed in this study. their sequence to avoid biased amplification of methylated Patients were selected from a cohort of 80 patients studied alleles. If primers contained CpG sites, they were designed to previously (6). Selection was based on evidence of relapse and amplify methylated and unmethylated equally (with a mix- sample availability (both at initial presentation and relapse). All ture of C or T used for the sense strand or G or A for patients had been treated with the hyper-CVAD chemotherapy antisense primers); (b) primers were designed to contain a program (protocol DM92-048) at the University of Texas M. D. maximum number of thymidines converted from cytosines to Anderson Cancer Center (22). Patient characteristics and results avoid amplification of the nonconverted genomic sequence; of this program have been reported elsewhere (22). Consent for (c) amplification of genomic DNA not treated with bisulfite sample collection was obtained from all patients following was always carried out to monitor lack of nonspecific ampli- institutional guidelines. This study was reviewed and approved fication; (d) primers were designed to be within 300 bp of by the Institutional Review Board.
Recommended publications
  • The P53/P73 - P21cip1 Tumor Suppressor Axis Guards Against Chromosomal Instability by Restraining CDK1 in Human Cancer Cells

    The P53/P73 - P21cip1 Tumor Suppressor Axis Guards Against Chromosomal Instability by Restraining CDK1 in Human Cancer Cells

    Oncogene (2021) 40:436–451 https://doi.org/10.1038/s41388-020-01524-4 ARTICLE The p53/p73 - p21CIP1 tumor suppressor axis guards against chromosomal instability by restraining CDK1 in human cancer cells 1 1 2 1 2 Ann-Kathrin Schmidt ● Karoline Pudelko ● Jan-Eric Boekenkamp ● Katharina Berger ● Maik Kschischo ● Holger Bastians 1 Received: 2 July 2020 / Revised: 2 October 2020 / Accepted: 13 October 2020 / Published online: 9 November 2020 © The Author(s) 2020. This article is published with open access Abstract Whole chromosome instability (W-CIN) is a hallmark of human cancer and contributes to the evolvement of aneuploidy. W-CIN can be induced by abnormally increased microtubule plus end assembly rates during mitosis leading to the generation of lagging chromosomes during anaphase as a major form of mitotic errors in human cancer cells. Here, we show that loss of the tumor suppressor genes TP53 and TP73 can trigger increased mitotic microtubule assembly rates, lagging chromosomes, and W-CIN. CDKN1A, encoding for the CDK inhibitor p21CIP1, represents a critical target gene of p53/p73. Loss of p21CIP1 unleashes CDK1 activity which causes W-CIN in otherwise chromosomally stable cancer cells. fi Vice versa 1234567890();,: 1234567890();,: Consequently, induction of CDK1 is suf cient to induce abnormal microtubule assembly rates and W-CIN. , partial inhibition of CDK1 activity in chromosomally unstable cancer cells corrects abnormal microtubule behavior and suppresses W-CIN. Thus, our study shows that the p53/p73 - p21CIP1 tumor suppressor axis, whose loss is associated with W-CIN in human cancer, safeguards against chromosome missegregation and aneuploidy by preventing abnormally increased CDK1 activity.
  • P14ARF Inhibits Human Glioblastoma–Induced Angiogenesis by Upregulating the Expression of TIMP3

    P14ARF Inhibits Human Glioblastoma–Induced Angiogenesis by Upregulating the Expression of TIMP3

    P14ARF inhibits human glioblastoma–induced angiogenesis by upregulating the expression of TIMP3 Abdessamad Zerrouqi, … , Daniel J. Brat, Erwin G. Van Meir J Clin Invest. 2012;122(4):1283-1295. https://doi.org/10.1172/JCI38596. Research Article Oncology Malignant gliomas are the most common and the most lethal primary brain tumors in adults. Among malignant gliomas, 60%–80% show loss of P14ARF tumor suppressor activity due to somatic alterations of the INK4A/ARF genetic locus. The tumor suppressor activity of P14ARF is in part a result of its ability to prevent the degradation of P53 by binding to and sequestering HDM2. However, the subsequent finding of P14ARF loss in conjunction with TP53 gene loss in some tumors suggests the protein may have other P53-independent tumor suppressor functions. Here, we report what we believe to be a novel tumor suppressor function for P14ARF as an inhibitor of tumor-induced angiogenesis. We found that P14ARF mediates antiangiogenic effects by upregulating expression of tissue inhibitor of metalloproteinase–3 (TIMP3) in a P53-independent fashion. Mechanistically, this regulation occurred at the gene transcription level and was controlled by HDM2-SP1 interplay, where P14ARF relieved a dominant negative interaction of HDM2 with SP1. P14ARF-induced expression of TIMP3 inhibited endothelial cell migration and vessel formation in response to angiogenic stimuli produced by cancer cells. The discovery of this angiogenesis regulatory pathway may provide new insights into P53-independent P14ARF tumor-suppressive mechanisms that have implications for the development of novel therapies directed at tumors and other diseases characterized by vascular pathology. Find the latest version: https://jci.me/38596/pdf Research article P14ARF inhibits human glioblastoma–induced angiogenesis by upregulating the expression of TIMP3 Abdessamad Zerrouqi,1 Beata Pyrzynska,1,2 Maria Febbraio,3 Daniel J.
  • Deciphering the Nature of Trp73 Isoforms in Mouse

    Deciphering the Nature of Trp73 Isoforms in Mouse

    cancers Article Deciphering the Nature of Trp73 Isoforms in Mouse Embryonic Stem Cell Models: Generation of Isoform-Specific Deficient Cell Lines Using the CRISPR/Cas9 Gene Editing System Lorena López-Ferreras 1,2,†, Nicole Martínez-García 1,3,†, Laura Maeso-Alonso 1,2,‡, Marta Martín-López 1,4,‡, Ángela Díez-Matilla 1,‡ , Javier Villoch-Fernandez 1,2, Hugo Alonso-Olivares 1,2, Margarita M. Marques 3,5,* and Maria C. Marin 1,2,* 1 Instituto de Biomedicina (IBIOMED), Universidad de León, 24071 León, Spain; [email protected] (L.L.-F.); [email protected] (N.M.-G.); [email protected] (L.M.-A.); [email protected] (M.M.-L.); [email protected] (Á.D.-M.); [email protected] (J.V.-F.); [email protected] (H.A.-O.) 2 Departamento de Biología Molecular, Universidad de León, 24071 León, Spain 3 Departamento de Producción Animal, Universidad de León, 24071 León, Spain 4 Biomar Microbial Technologies, Parque Tecnológico de León, Armunia, 24009 León, Spain 5 Instituto de Desarrollo Ganadero y Sanidad Animal (INDEGSAL), Universidad de León, 24071 León, Spain * Correspondence: [email protected] (M.M.M.); [email protected] (M.C.M.); Tel.: +34-987-291757 Citation: López-Ferreras, L.; (M.M.M.); +34-987-291490 (M.C.M.) Martínez-García, N.; Maeso-Alonso, † Equal contribution. ‡ Equal contribution. L.; Martín-López, M.; Díez-Matilla, Á.; Villoch-Fernandez, J.; Simple Summary: The Trp73 gene is involved in the regulation of multiple biological processes Alonso-Olivares, H.; Marques, M.M.; Marin, M.C. Deciphering the Nature such as response to stress, differentiation and tissue architecture.
  • TP63 Is Significantly Upregulated in Diabetic Kidney

    TP63 Is Significantly Upregulated in Diabetic Kidney

    International Journal of Molecular Sciences Article TP63 Is Significantly Upregulated in Diabetic Kidney Sitai Liang 1, Bijaya K. Nayak 1, Kristine S. Vogel 1 and Samy L. Habib 1,2,* 1 Department of Cell Systems and Anatomy, The University of Texas Health Science Center, San Antonio, TX 78229, USA; [email protected] (S.L.); [email protected] (B.K.N.); [email protected] (K.S.V.) 2 South Texas, Veterans Healthcare System, San Antonio, TX 78229, USA * Correspondence: [email protected]; Tel.: +1-21-0567-3816; Fax: +1-21-0567-3802 Abstract: The role of tumor protein 63 (TP63) in regulating insulin receptor substrate 1 (IRS-1) and other downstream signal proteins in diabetes has not been characterized. RNAs extracted from kidneys of diabetic mice (db/db) were sequenced to identify genes that are involved in kidney complications. RNA sequence analysis showed more than 4- to 6-fold increases in TP63 expression in the diabetic mice’s kidneys, compared to wild-type mice at age 10 and 12 months old. In addition, the kidneys from diabetic mice showed significant increases in TP63 mRNA and protein expression compared to WT mice. Mouse proximal tubular cells exposed to high glucose (HG) for 48 h showed significant decreases in IRS-1 expression and increases in TP63, compared to cells grown in normal glucose (NG). When TP63 was downregulated by siRNA, significant increases in IRS-1 and activation of AMP-activated protein kinase (AMPK (p-AMPK-Th172)) occurred under NG and HG conditions. Moreover, activation of AMPK by pretreating the cells with AICAR resulted in significant down- regulation of TP63 and increased IRS-1 expression.
  • Are Interactions with P63 and P73 Involved in Mutant P53 Gain of Oncogenic Function?

    Are Interactions with P63 and P73 Involved in Mutant P53 Gain of Oncogenic Function?

    Oncogene (2007) 26, 2220–2225 & 2007 Nature Publishing Group All rights reserved 0950-9232/07 $30.00 www.nature.com/onc REVIEW Are interactions with p63 and p73 involved in mutant p53 gain of oncogenic function? Y Li and C Prives Department of Biological Sciences, Columbia University, New York, NY, USA Although still controversial, the presence of mutant p53 in deletion or frameshift mutations resulting in their lack cancer cells mayresult in more aggressive tumors and of expression, however, many tumor-derived p53 muta- correspondinglyworse outcomes. The means bywhich tions are of the missense variety. These mutations are mutant p53 exerts such pro-oncogenic activityare usually located within the central conserved region of currentlyunder extensive investigation and different p53 that binds to DNA in a sequence-specific manner models have been proposed. We focus here on a proposed and result in either direct loss of DNA contact or gross mechanism bywhich a subset of tumor-derived p53 mut- change of the conformation that no longer permits p53 ants physically interact with p53 family members, p63 and to recognize its wild-type DNA targets (reviewed by p73, and negativelyregulate their proapoptotic function. Vousden and Lu, 2002). Approximately 30% of these Both cell-based assays and knock-in mice expressing tumor-derived p53 mutations affect only six ‘hot-spot’ mutant forms of p53 support this model. As more than half residues (175, 245, 248, 249, 273 and 282). In many cases of human tumors harbor mutant forms of p53 protein, tumor-derived p53 mutants are expressed at far higher approaches aimed at disrupting the pathological interac- levels than wild-type p53 protein due in part to their tions among p53 familymembers might be of clinical failure to be degraded by Mdm2.
  • Alterations of P14arf, P53, and P73 Genes Involved in the E2F-1-Mediated Apoptotic Pathways in Non-Small Cell Lung Carcinoma

    Alterations of P14arf, P53, and P73 Genes Involved in the E2F-1-Mediated Apoptotic Pathways in Non-Small Cell Lung Carcinoma

    [CANCER RESEARCH 61, 5636–5643, July 15, 2001] Alterations of p14ARF, p53, and p73 Genes Involved in the E2F-1-mediated Apoptotic Pathways in Non-Small Cell Lung Carcinoma Siobhan A. Nicholson,1 Nader T. Okby,1 Mohammed A. Khan, Judith A. Welsh, Mary G. McMenamin, William D. Travis, James R. Jett, Henry D. Tazelaar, Victor Trastek, Peter C. Pairolero, Paul G. Corn, James G. Herman, Lance A. Liotta, Neil E. Caporaso, and Curtis C. Harris2 Laboratory of Human Carcinogenesis, National Cancer Institute, Bethesda, Maryland 20892 [S. A. N., M. A. K., J. A. W., M. G. M., L. A. L., N. E. C., C. C. H.]; Orange Pathology Associates, Middleton, New York 10940 [N. T. O.]; Armed Forces Institute of Pathology, Washington, DC 20306 [S. A. N., W. D. T.]; Mayo Clinic, Rochester, Minnesota 55905 [J. R. J., H. D. T., V. T., P. C. P.]; and The Johns Hopkins Oncology Center, Baltimore, Maryland 21231 [P. G. C., J. G. H.] ABSTRACT encoded by a separate exon 1␤ that lies ϳ20 kb upstream of exon 1␣ and shares exons 2 and 3 as read in an ARF, giving rise to a protein ARF Overexpression of E2F-1 induces apoptosis by both a p14 -p53- and INK4a ARF completely unrelated to p16 (14). Despite its unrelated structure, a p73-mediated pathway. p14 is the alternate tumor suppressor prod- ARF p14 also is capable of causing cell cycle arrest in G1 and G2. uct of the INK4a/ARF locus that is inactivated frequently in lung carci- ARF nogenesis. Because p14ARF stabilizes p53, it has been proposed that the loss p14 binds to and antagonizes the actions of MDM2, a negative of p14ARF is functionally equivalent to a p53 mutation.
  • Regulation of P27kip1 and P57kip2 Functions by Natural Polyphenols

    Regulation of P27kip1 and P57kip2 Functions by Natural Polyphenols

    biomolecules Review Regulation of p27Kip1 and p57Kip2 Functions by Natural Polyphenols Gian Luigi Russo 1,* , Emanuela Stampone 2 , Carmen Cervellera 1 and Adriana Borriello 2,* 1 National Research Council, Institute of Food Sciences, 83100 Avellino, Italy; [email protected] 2 Department of Precision Medicine, University of Campania “Luigi Vanvitelli”, 81031 Napoli, Italy; [email protected] * Correspondence: [email protected] (G.L.R.); [email protected] (A.B.); Tel.: +39-0825-299-331 (G.L.R.) Received: 31 July 2020; Accepted: 9 September 2020; Published: 13 September 2020 Abstract: In numerous instances, the fate of a single cell not only represents its peculiar outcome but also contributes to the overall status of an organism. In turn, the cell division cycle and its control strongly influence cell destiny, playing a critical role in targeting it towards a specific phenotype. Several factors participate in the control of growth, and among them, p27Kip1 and p57Kip2, two proteins modulating various transitions of the cell cycle, appear to play key functions. In this review, the major features of p27 and p57 will be described, focusing, in particular, on their recently identified roles not directly correlated with cell cycle modulation. Then, their possible roles as molecular effectors of polyphenols’ activities will be discussed. Polyphenols represent a large family of natural bioactive molecules that have been demonstrated to exhibit promising protective activities against several human diseases. Their use has also been proposed in association with classical therapies for improving their clinical effects and for diminishing their negative side activities. The importance of p27Kip1 and p57Kip2 in polyphenols’ cellular effects will be discussed with the aim of identifying novel therapeutic strategies for the treatment of important human diseases, such as cancers, characterized by an altered control of growth.
  • Beyond Traditional Morphological Characterization of Lung

    Beyond Traditional Morphological Characterization of Lung

    Cancers 2020 S1 of S15 Beyond Traditional Morphological Characterization of Lung Neuroendocrine Neoplasms: In Silico Study of Next-Generation Sequencing Mutations Analysis across the Four World Health Organization Defined Groups Giovanni Centonze, Davide Biganzoli, Natalie Prinzi, Sara Pusceddu, Alessandro Mangogna, Elena Tamborini, Federica Perrone, Adele Busico, Vincenzo Lagano, Laura Cattaneo, Gabriella Sozzi, Luca Roz, Elia Biganzoli and Massimo Milione Table S1. Genes Frequently mutated in Typical Carcinoids (TCs). Mutation Original Entrez Gene Gene Rate % eukaryotic translation initiation factor 1A X-linked [Source: HGNC 4.84 EIF1AX 1964 EIF1AX Symbol; Acc: HGNC: 3250] AT-rich interaction domain 1A [Source: HGNC Symbol;Acc: HGNC: 4.71 ARID1A 8289 ARID1A 11110] LDL receptor related protein 1B [Source: HGNC Symbol; Acc: 4.35 LRP1B 53353 LRP1B HGNC: 6693] 3.53 NF1 4763 NF1 neurofibromin 1 [Source: HGNC Symbol;Acc: HGNC: 7765] DS cell adhesion molecule like 1 [Source: HGNC Symbol; Acc: 2.90 DSCAML1 57453 DSCAML1 HGNC: 14656] 2.90 DST 667 DST dystonin [Source: HGNC Symbol;Acc: HGNC: 1090] FA complementation group D2 [Source: HGNC Symbol; Acc: 2.90 FANCD2 2177 FANCD2 HGNC: 3585] piccolo presynaptic cytomatrix protein [Source: HGNC Symbol; Acc: 2.90 PCLO 27445 PCLO HGNC: 13406] erb-b2 receptor tyrosine kinase 2 [Source: HGNC Symbol; Acc: 2.44 ERBB2 2064 ERBB2 HGNC: 3430] BRCA1 associated protein 1 [Source: HGNC Symbol; Acc: HGNC: 2.35 BAP1 8314 BAP1 950] capicua transcriptional repressor [Source: HGNC Symbol; Acc: 2.35 CIC 23152 CIC HGNC:
  • P63 and P73 Isoform Expression in Non-Small Cell Lung Cancer and Corresponding Morphological Normal Lung Tissue

    P63 and P73 Isoform Expression in Non-Small Cell Lung Cancer and Corresponding Morphological Normal Lung Tissue

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector ORIGINAL ARTICLE p63 and p73 Isoform Expression in Non-small Cell Lung Cancer and Corresponding Morphological Normal Lung Tissue Marco Lo Iacono, PhD, Valentina Monica, MS, Silvia Saviozzi, PhD, Paolo Ceppi, MS, Enrico Bracco, PhD, Mauro Papotti, MD, and Giorgio V. Scagliotti, MD he tumor suppressor p53 is a key transcription factor Background: The TP73 and TP63 genes are members of the p53 regulating the expression of genes influencing cell senes- tumor suppressor family and are expressed in different N-terminal T cence, proliferation, apoptosis, and differentiation. The TP73 isoforms either with proapoptotic (transactivation domain, TA) and and TP63 genes are members of the p53 tumor suppressor antiapoptotic (N-terminally truncated, ⌬N) function. Unlike p53, the family, based on substantial structural and functional homol- role of p73 and p63 in tumor is controversial. It has been recently ogies. Unlike p53, that is a tumor suppressor, the role of p73 hypothesized that altered ⌬N:TA expression ratio, rather than single and p63 in tumor is controversial because of their genomic isoform overexpression, plays a role in the pathogenesis of many locus complexity. Through either alternative exon splicing, or diseases, including lung cancer. a second promoter, TP73 and TP63 genes generate several N- Methods: Isoform-specific, real-time polymerase chain reaction and and C-terminal isoforms. The N-terminal isoforms can be immunohistochemistry analysis on matched cancer and correspond- clustered into two groups: the transactivation competent TA ing normal tissues from surgically resected non-small cell lung proteins (TAp63 and TAp73) and the transactivation-defec- cancers (NSCLCs) have been performed aiming to explore the tive, N-terminally truncated ⌬N proteins (⌬Np63, ⌬NЈp73, expression levels of each p63 and p73 N-terminal isoforms and their ⌬2p73, ⌬2/3p73, and ⌬Np73).1 TAp63 and TAp73, and p53, ⌬N:TA expression ratio.
  • Induction of P57 Expression by P73ß

    Induction of P57 Expression by P73ß

    Induction of p57KIP2 expression by p73␤ Eva´ Ba´ lint*†, Andrew C. Phillips*, Serguei Kozlov‡, Colin L. Stewart‡, and Karen H. Vousden*§ *Regulation of Cell Growth Laboratory, ‡Cancer and Developmental Biology Laboratory, National Cancer Institute, Frederick, MD 21702-1201 Edited by George F. Vande Woude, Van Andel Research Institute, Grand Rapids, MI, and approved January 24, 2002 (received for review September 18, 2001) The p53-related protein p73 has many functions similar to that of expressing p53 and several isoforms of p73 and identified the p53 including the ability to induce cell-cycle arrest and apoptosis. cyclin-dependent kinase inhibitor p57KIP2 (27, 28) as a transcrip- Both p53 and p73 function as transcription factors, and p73 tional target of p73␤ but not p53. activates expression of many genes that also are regulated by p53. Despite their similarities, it is evident that p53 and p73 are not Materials and Methods interchangeable functionally, with p73 playing a role in normal Plasmids. Plasmids expressing N-terminal hemagglutinin (HA)- growth and development that is not shared by p53. In this paper tagged human p73␣, ␤,or␥ (29) and dominant negative p73 we describe the ability of p73␤ but not p53 to activate expression (DDp73␣; ref. 14), murine p57KIP2 (28), and human p57KIP2 (30) of the cyclin-dependent kinase inhibitor p57KIP and KvLQT1, two have been described. genes that are coregulated in an imprinted region of the genome. Our results suggest that p73 may regulate expression of genes Cell Lines and Transfections. U2OS, Saos-2, H1299, and Saos-2 through mechanisms that are not shared by p53, potentially cells inducibly expressing p53, p73␣, p73␤, p73␥, and E2F1 under explaining the different contributions of p53 and p73 to normal the control of a tetracycline-inducible promoter have been development.
  • The Potential Tumor Suppressor P73 Differentially Regulates Cellular P53 Target Genes1

    The Potential Tumor Suppressor P73 Differentially Regulates Cellular P53 Target Genes1

    [CANCER RESEARCH 58, 5061-5065. November 15. 1998] Advances in Brief The Potential Tumor Suppressor p73 Differentially Regulates Cellular p53 Target Genes1 Jianhui Zhu,2 Jieyuan Jiang,2 Wenjing Zhou, and Xinbin Chen3 Institute of Molecular Medicine and Genetics, Medical College of Georgia. Augusta, Georgia 30912 Abstract activation and DNA binding domains between p53 and p73, the p53 and p73 signaling pathways leading to tumor suppression are both p73, a potential tumor suppressor, is a p53 homologue. Transient over similar and different. expression of p73 in cells can induce apoptosis and p21, a cellular p53 target gene primarily responsible for p53-dependent cell cycle arrest. To further characterize the role of p73 in tumor suppression, we established Materials and Methods several groups of cell lines that inducibly express p73 under a tetracycline- regulated promoter. By using these cell lines, we found that p73 can Plasmids. cDNAs for p73a. p73ß.and p73«292 (Ref. 3; kindly provided by W. Kaelin) were cloned separately into a tetraeycline-regulated expression induce both cell cycle arrest and apoptosis. We also found that p73 can vector. 10-3, at its Eco RI and Xba I siles, and the resulting plasmids were used activate some but not all of the previously identified p53 cellular target genes. Furthermore, we found that the transcriptional activities of p53, to generate cell lines that inducibly express p73. p73 proteins were tagged at p73a, and p73/3 to induce their common cellular target genes differ among their N-termini with influenza hemagglutinin peptide. one another. These results suggest that p73 is both similar to and different Generation of H1299 Cell Lines that Inducibly Express p73.
  • P73 Overexpression Is Associated with Resistance to Treatment With

    P73 Overexpression Is Associated with Resistance to Treatment With

    [CANCER RESEARCH 61, 935–938, February 1, 2001] Advances in Brief p73␣ Overexpression Is Associated with Resistance to Treatment with DNA-damaging Agents in a Human Ovarian Cancer Cell Line1 Faina Vikhanskaya,2 Sergio Marchini,2 Mirko Marabese, Emanuela Galliera, and Massimo Broggini3 Laboratory of Molecular Pharmacology, Department of Oncology, Istituto di Ricerche Farmacologiche “Mario Negri,” 20157 Milan, Italy Abstract changes in gene expression and the response of these clones to different chemical and physical DNA-damaging agents. We examined the consequences of p73␣ overexpression on gene expres- sion and cellular response to anticancer agents in clones from the human Materials and Methods ovarian cancer cell line A2780. Using microarray filters, the expression of ␣ 588 genes in two clones overexpressing p73 (A2780/p73.4 and A2780/ Cell Culture and Treatment. Clones derived from the human ovarian p73.5) in comparison with empty vector-transfected cells was evaluated. carcinoma cell lines A2780, A2780/pCDNA3, A2780/p73.4, and A2780/p73.5 There were clear differences in gene expression profiles. Both of the clones were obtained and grown as reported previously (12). DDP4 was obtained from showed a marked increase in the expression of genes involved in DNA Bristol Myers Squibb (Syracuse, NY). Topotecan was obtained from Smith, repair, including genes participating in nucleotide excision repair and Kline & Beecham (Brentford, United Kingdom) and MNNG was purchased mismatch repair. This was confirmed by reverse transcription-PCR and from Sigma (Milan, Italy). For clonogenic assay, cells were plated at 250 Northern blot analysis and was associated with an increase in the ability cells/well.