Abstract. Three species of nephropid lobsters have been rec­ Assignment of Homarus capensis ognized in the genus Homarus: the American and European lobsters, (Herbst, 1792), the Cape lobster of H. americanus and H. gammarus of the northwestern and northeast- South Africa, to the new genus em Atlantic, respectively, and the Cape lobster of South Africa, H. Homarinus (Decapoda: Nephropidae) capensis, few specimens of which have been studied until recently. Analysis of new specimens allows Irv Kornfiefd reconsideration of the systematic Department of Zoology and Center for Marine Studies status of this species and a subse­ University of Maine, Orono. Maine 04469 quent transfer to a monotypic new genus Homarinus. Far smaller than its northern relatives, with a Austin B. XUWWams maximum observed carapace length of 47 mm, the Cape lobster National Marine Fisheries Service Systematics Laboratory has first chelae adorned with a National Museum of Natural History, Smithsonian Institution thick mat of plumose setae and less Washington. DC 20560 abundant setae on the carapace, tail fan, and abdominal pleura, whereas these setae are absent in Robert S. Steneck Homarus. Relative length and Department of Oceanography and Ira C. Darling Center shape of the carpus on pereopod 1, University of Maine, Walpole, Maine 04573 tooth pattern on cutting edges of first chelae, shape of the linguiform rostrum, large size of oviducal openings, and structure of male pleopods differ from corresponding features in Homarus. Comparative analysis of DNA from the mito­ Until now, three species of neph­ tend the r£inge to Transkei (Kado et chondrial 16s rRNA gene demon­ ropid lobsters have been recognized al., 1994). strated considerable sequence di­ in the genus Homarus Weber, 1795 Regardless of its rarity, sufficient vergence of the Cape lobster O.Vy^) (see Holthuis, 1991): H. americanus specimens of the Cape lobster, liv­ from its putative congeners. The H. Milne-Edwards, 1837, the north­ ing and preserved, are now avail­ magnitude of this estimate relative to that between the two North At­ western Atlantic American lobster; able for analysis of its distribution, lantic species (1.39^) further sug­ H. gammarus (Linnaeus, 1758), the morphological, and genetic at­ gests that taxonomic revision is northeastern Atlantic-Mediterra­ tributes, and systematic status. warranted. nean European lobster; and//, cap­ Results of our studies indicate that ensis (Herbst, 1792), the South Af­ this species should be removed from rican Cape lobster. All are found in Homarus and placed in a genus of cool or cold temperate waters, and its own; this paper provides sup­ the North Atlantic species range porting evidence for this action and into subarctic waters. The northern offers supplementary descriptive H. americanus and H. gammarus information on the species. are well-known, abundant, and eco­ nomically valuable species, but the southern H. capensis has long been Homarinus, new genus problematic because only a few Figs. 1-4 specimens (13 males, 1 female) were known to exist in collections Type species—Homarus capensis (Barnard, 1950; Wolff, 1978; Hol­ (Herbst, 1792) by present designa­ thuis, 1991). Gilchrist (1918) had tion and monotypy. seen only three specimens and re­ marked (p. 46) that "it is a very rare Description—Carapace moderately species, and is not even known to compressed, narrower than deep, Cape Fishermen." Kensley (1981) sparsely setose, middorsal carina recorded its distribution in the Cape barely evident on gastric region, ob­ Province as Table Bay to East Lon­ Manuscript accepted 25 September 1994. solescent on thoracic region posterior Fishery Bulletin 93:97-102 (1995). don, and recent new collections ex­ to deep cervical groove. Rostrum

97 Vb Fishery Bulletin 93(1), 1995

Figure 1 Homarinus capensis (Herbst). Living male, carapace length 3.41 cm, photographed in an aquarium in Sea Fisheries Research Institute, Cape Town, South Africa, by Robert Tarr. (a) Left lateral; (6) dorsal. Kornfield et al.: Cape lobster taxonomy 99

a d 1 — / 2 — Figure 2 Male pleopods (pi); mesial views of pi 1 (slight lateral folds on tips not shown in these views), and mesial views of appendix masculina on mesial ramus of pi 2: (c and b) Homarinus capensiv, left (USNM 251452); (c and d) Homarus americanus, right fUSNM 13952); (e and f) H. gammarus, right (USNM 2085). Scale is 1 mm: bar 1 applies to c through f; bar 2 applies to a and b.

linguiform in dorsal view, broad at base where mar­ gins coalesce with orbits, margins bearing 4-6 small spines and gradually tapering anteriorly to rather abruptly pointed or narrowly rounded tip, reaching distal 1/3 of penultimate article of antennular pedimcle, shallow dorsal concavity running its entire length. Tel son and uropods with thick fringe of plumose 4^^ 0\ setae on distal margin and with scattered non- plumose long setae dorsally on these appendages and '•^ •J sixth abdominal segment. Telson as wide at base as long, with lateral margins slightly sinuous and subparallel bearing obsolescent spines and rugae, each side ending in fixed posterolateral spine; ter­ minal margin beyond spine broadly convex; distal 1/3 of surface bearing obsolescent transverse rugae. Figure 3 Uropods broadly subovate, sparsely setose on dorsal Homarinus capensis (Herbst), tail fan (from figure inH. surface; mesial ramus broadest nesir posterior mar­ Milne-Edwards, 1851). gin with width about 0.73 length, row of obsolescent lateral marginal spines ending in fixed posterolat­ eral spine; lateral ramus with width about 0.72 length, diaresis well behind midlength bearing row ing extensor margin and distributed a distance along of fixed but irregularly worn spines ending in stron­ fixed finger; similar setae on mesial surface of car­ gest spine at posterolateral angle. pus and ventral surface of merus. Fingers not gap­ Chelae of first pereopods with thick coat of long ing; those of major chela with crushing teeth (often plumose setae on upper surface of palm, overhang- worn) opposed from near base to about midlength 100 Fishery Bulletin 93(1). 1995

ing form -inus, resembling. The gen­ Ha ggtcgcaaacttttttgtcgatatgaactctcaaaataaataacgctgtt 50 der is masculine. Hg He n Ha atccctaaagtaacttaaatttttaatcaacaancaanggatcanttaca 100 Homarinus capensis (Herbst, Hg 1792), new combination He ca. c. a. t c. . a. Ha cacnnnnnnaaatatetctgtattttaaatttaaacagttacnnaaatta 150 Synonymy—Holthuis (1986:243, fig. Hg g 1) gave an exhaustive synonymy for He t c t..a a..t Homarus capensis, and a later Ha tatcatcgtcgccccaacgaaataattntagtatataaataatattaaac 200 (1991:59) less inclusive account. Hg c He .. . t ac. . c g t. . These treatments are so recent and readily available that reiteration Ha tttcaactcatctaattatatactaaattattaagctttatagggtctta 250 here would be unnecessarily redun­ Hg . . . t He . . a. . . t g. a dant. Succeeding reference to the species follows. Ha tegtccctttaaaatatttaagccttttcacttaaaagtcaaattcaatt 300 Hg Homarus capensis.—Kado, Kittaka, He c. . tg. a. Hayakawa and Pollock, 1994:72, Ha tttgtgtttgagacagtttgcttcttgtccaaccattcatacaagcctcc 3 50 figs. 2, 3, 4. Hg a.... a.... He ac.t.t..c. Material—Cape Province, South Af­ Ha aattaagagactaatgactatgctaccttc 380 Hg rica. USNM 251451. Id. East Lon­ He g. nn don?, R. Melville-Smith, 92-RMS-O, Nov 1992, regurg., dismembered, Figure 4 carapace length (cl) 26.5 mm, short Peirtial sequence for the mitochondrial 16s rRNA gene. Sequences for Homarus carapace length (scl) 21 mm, abdo­ americanus (Ha), H. gammarus (Hg), and Homarinus capensis (He) have been men length (abdl) 33.0 mm. USNM deposited with GenBank Accession Numbers U11238, U11246, and U11247 respectively. Dots indicate nucleotides identical with Ha; letters indicate nucle­ 251452.16, southwest Dassen Island otide substitutions at the homologous sites. Sites marked 'n' have unresolved [33°26'S, 18°05'E], regurgitated from nucleotides. Sebastichthys capensis, badly crushed and partly dismembered, R.S. Steneck, 92-D-2, 1 Dec 1992, cl 32 mm, scl 25.5 mm. USNM 251453. 19, Still followed by row of intermittent noncrushing moder­ Bay [34°23'S, 21°27'E], dismembered, R. Melville- ate conical teeth with 4-6 smaller ones in intervals Smith, RMS7, abdl 45 mm. USNM 251454. 19, Still between them; minor chela with latter pattern of Bay, regurg., R. Melville-Smith, RMS8, 5 mm, abdl noncrushing teeth on cutting edge of each finger; tips 47 mm. of fi.ngers on each chela curved toward each other Additional specimens reported to us by R. Melville- and crossing. Smith, Sea Fisheries Institute, Cape Town: 16, North Carpus of major chela elongate; anterior margin Dassen Island, tide pool, RSS, 92-D-l, 3 Feb 1992; with two prominent spines and smaller ones between, 19. Port Alft-ed, RMS 1; 1

Telson with dorsal setae distributed in 3 longitu­ using standard protocols (Kocher et al., 1989). Mito­ dinal tracts, central and submarginal on either side; chondrial DNA's purified by CsCl ultracentrifugation central tufl proximally in midline and another near (Lansman et al., 1981) were amplified by PCR with each anterolateral comer; sparse similar setae on the conserved primers 16sar and 16sbr of Palumbi abdominal pleura; lateral ramus of uropod with ven­ et al. (1991). Following asymmetric amplification tral submarginal row of setae laterally. {Homarus americanus and H. gammarus) or cycle- Eyes with distal edge of cornea slightly exceeding sequencing (Homarinus capensis), DNA's were manu­ level of basicerite tip; this tip reaching to midlength ally sequenced by the dideoxy chain-termination of narrowly rounded antennal scale exceeded by its method of Sanger et al. (1977). Aligned sequences very strong anterolateral spine (rarely doubled) are presented in Figure 4. Sequence divergence be­ reaching distal edge of penultimate article in anten- tween taxa was estimated by using the two-param­ nular peduncle; latter falling short of distal margin eter method of Kimura (1980). Sequence divergence of terminal article in antennal peduncle. between Homarus americanus EUid H. gammarus was Epistome with median anterior spine closely 1.3%, whereas average divergence between these two flanked at either side by shorter rounded spine. species and Homarinus capensis was 9.7%. The 16s Cheliped of pereopod 1 having fixed finger with rRNA gene is one of the most slowly evolving regions narrowed extensor margin set off by shallow submar­ of the mtDNA molecule (Xiong and Kocher, 1994); ginal groove. Palm with compound row of low for­ this conservative property makes it particularly use­ ward pointing spines and tubercles on flexor surface, ful for comparative studies among distantly related similar development on extensor edge originating at taxa. Though there is no formal recognition of equiva­ carpal condyle and running along proximal margin lence between levels of sequence divergence and taxo­ of palm, across its basal end, and distally for a dis­ nomic rank (Hillis and Moritz, 1990), it is clear that tance along palm. the relative magnitude of divergence can be a useful Oviducal opening on coxa of pereopod 3 oval; its taxonomic indicator (Avise, 1994). The magnitude of axes 1.3 X 1.8 mm on measured female noted below. sequence differentiation that we observed between Pleopod 1 with distal article broader than shaft H. capensis and the two North Atlantic taxa strongly and hollov.ed mesially, forming flattened tubular suggested the existence of two discrete clades. Mo­ opening when appressed to opposite member, tip ir­ lecular divergence reinforced our conclusions from the regularly rounded. Pleopod 2 with appendix reexamination of the morphology of these species. masculina on mesial aspect of endopod bearing tuft of strong setae at apex. Remarks—Morphological differences between Uropods with protopodite bearing 2 strong spines Homarinus capensis and the two species of Homarus overhanging proximal end of mesial and lateral ra­ are clear cut. Perhaps the most obvious differences mus respectively. are that Homarinus capensis has a dense coat of se­ tae on the outer surface of the palms and on other Variation—There is minor variation in development articles of the chelipeds (PI), and scattered setae of spines, tubercles, etc., among the two females and distributed over the carapace, tail fan, sixth abdomi­ two males examined. According to Stebbing (1900), nal segment, and pleurae of the remaining abdomi­ sides of the rostrum may have 5, 6, or 7 spines on nal segments; Homarus americanus and H. gam­ the margin. Density of setae on exoskeletal parts is marus are smooth and glabrous. The telson of Ho­ subject to considerable variation, owing perhaps to marinus has subparallel sides and its exposed sur­ recency of molting, age, or abrasion after preservation. face bears many obsolescent transverse rugae (Fig. 3); the telson of Homarus species has sides converg­ Color—Color of a living animal is shown in Figure 1. ing toward the tip, giving a subtriangular shape. Published records summarized by Holthuis (1986) First pleopods are more elongate and slender in indicate that color may depart considerably from that Homarus species than in Homarinus (Fig. 2). shown here: coral-red to tawny or reddish yellow, The two si)ecies of Homarus attain large size (Wolff, which may have resulted from postmortem changes; 1978), whereas Homarinus capensis appears to be or, in the fresh state, "of a rather dark olive colour, much smaller at maturity. No ovigerous females of not dissimilar to that of the Northern lobster" H. capensis have been found, but openings of the Gilchrist (1918:45). oviducts are at least twice the size of those on com­ parably sized specimens of the species of Homarus Molecular characterization—Comparative analysis (see Kado et al., 1994). This suggests that there are of a portion of the 16s ribosomal RNA gene from fewer eggs with accelerated larval development in mitochondrial DNA (mtDNA) was conducted by Homarinus capensis relative to slower larval devel- 102 Fishery Bulletin 93()). 1995

opment from smaller more numerous eggs in 1991. FAO species catalog. Marine lobsters of the world. Homarus species (Kado et al., 1994). An annotated and illustrated catalog of species of interest to fisheries known to date. FAO Fisheries Synopsis 125, 13:viii, 1-292. Kado, R., J. Kittaka, Y. Hayakawa, and D. E. Pollock. Acknowledgments 1994. Recent discoveries of the "rare" species Homarus capensis (Herbst, 1792) on the South African coast. Crus­ taceana 67:71-75. Our conclusions converged independently from two Kensley, B. viewpoints. A. B. W. and other carcinologists have 1981. On the zoogeography of Southern African decapod long understood grounds for generic separation of the Crustacea, with a distributional checklist of the species. Cape lobster from Homarus on the basis of morphol­ Smithsonian Contrib. Zool. 338:i-iii, 1-64. ogy. I. K. and R. S. S. concluded this on the basis of Kiniura,M. 1980. A simple method for estimating evolutionary rate of genetic divergence and were well into their analysis base substitution through comparative study of nucleotide before forces were joined. A. B. W. drafted the sys­ sequences. J. Mol. Evol. 16:111-120. tematic section and assembled the jointly produced Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Edwards, text. Keiko Hiratsuka Moore rendered drawings of S. Paabo, F. X. Villablanca, and A. C. Wilson. the pleopods. G. C. Steyskal provided advice on the 1989. Dynamics of mitochondrial DNA evolution in mam­ mals: amplification and sequencing with conserved choice of a new generic name. The manuscript was primers. Proc. Nat. Acad. Sci. (USA) 86:6196-6200. critically reviewed by W. Glanz, R. B. Manning, and Lansman, R. A., R. D. Shade, J. F. Shapiro, T. A. Munroe. We are indebted especially to colleagues and J. C. Avise. at the Sea Fisheries Institute, Cape Town, South 1981. The use of restriction endonucleases to measure DNA Africa, who helped us in this study; Roy Melville- sequence relatedness in natural populations. HI: Tech­ niques and potential applications. J. Mol. Evol. 17: Smith provided materials and information, and Rob­ 214-226. ert Tarr photographed the living specimen of Cape Linnaeus, C. lobster. George M. Branch, University of Cape Town, 1758. Systems naturae per regna tria naturae, secundum provided logistic support and aided in specimen ac­ classes, ordines, genera, species, cum characteribus, differ- quisition. Yan Kit Tam and Alex Parker provided entiis, synonymis, locis, ed. 10, 1, iii + 824 p. Laurentii sequence data. R. S. S. was supported by grants from Salvii, Holmiae, Stockholm. Milne-Edwards, H. the South African Foundation of Research Develop­ 1837. Histoire naturelle des Crustac^s, comprenant ment, the Visiting Scholar Fimd, and the Student I'anatomie, la physiologic et la classification de ces Fund for Visiting Scholars of the University of Cape animaux. Vol. 2,532 p. Librairie Encyclop6dique de Roret, Town. Molecular work was supported by NCAA Sea Paris. Grant (NA90AAD-SG499) and NSF (EHR-9108766 1851. Observations sur le squelette t6gumentaire des Crustac^s d6capodes, et sur la morphologic de ces and OCE-9203342). animaux. Ann. Sci. Nat., Paris (3, Zool.)16:221-291, pis. 8-11. Paliunbi, S., A. Martin, S. Romano, W. O. McMillan, Literature cited L. Stice, and G. Grabowski. 1991. The simple fool's guide to PCR, v. 2.0. Special pub­ lication of the Univ. of Hawaii Dep. Zoology and Kewalo Avise, J. C. Marine Laboratory, 23 p. 1994. Molecular markers, natural history and evolu­ Sanger, F., S. Nicklen, and A. R. Coulson. tion. Chapman and Hall, NY, 511 p. BAmfird, K. H. 1977. DNA sequencing with chain-terminating inhib­ 1950. Descriptive catalogue of South African decapod itors. Proc. Nat. Acad. Sci. (USA) 74:5463-5467. Crustacea. Ann. South African Mus. 38:1-837. Stebbing, T. R. R. Gilchrist, J. D. F. 1900. South Afincan Crustacea. Mar. Investig. South Af­ 1918. The Cape lobster and the Cape crawfish or spiny rica 1:14-66, pis. 1-4. lobster. Mar. Biol. Rep. South Africa 4:44-53, 2 pis. Weber, F. Herbst, J. F. W. 1795. Nomenclator entomologicus seomdum entomologiam 1792. Versuch einer Naturgeschichte der Krabben und systematicum ill. Fabricii, adjectis speciebus recens Krebs nebst einer systematischen Beschreibung ihrer detectis et varietatibus.... C. E. Bohn, Chilonii [Kiel] et verschiedenen Arten. Vol 2:i—viii, 1-225, pis. 22-46. Hamburgi, viii + 171 p. Hillis, D. IML, and C. Moritz. Wolff, T. 1990. Molecular systematics. Sinauer Associates, 1978. Maximum size of lobsters (Homarus) (Decapoda, Sunderland, MA, 588 p. Nephropidae). Crustaceana 34:1-14, pis. 1-2. Holthuis, L. B. Xiong, B., and T. D. Kocher. 1986. J. C. Fabricius' (1798) species of Astacus, with an 1994. Phylogeny of the sibling species of Simulium account oiHomarus capensis (Herbst) and Eutrichocheles venustum and S. verecurdum (Diptera: Simuliidae) based modestus (Herbst) (Decapoda Macrura). Crustaceana on sequences of the mitochondrial 16s rRNA gene. Mol. 50:243-256. Phyl. Evol. 3:293-303.