Abstract. Three species of nephropid lobsters have been rec­ Assignment of Homarus capensis ognized in the genus Homarus: the American and European lobsters, (Herbst, 1792), the Cape lobster of H. americanus and H. gammarus of the northwestern and northeast- South Africa, to the new genus em Atlantic, respectively, and the Cape lobster of South Africa, H. Homarinus (Decapoda: Nephropidae) capensis, few specimens of which have been studied until recently. Analysis of new specimens allows Irv Kornfiefd reconsideration of the systematic Department of Zoology and Center for Marine Studies status of this species and a subse­ University of Maine, Orono. Maine 04469 quent transfer to a monotypic new genus Homarinus. Far smaller than its northern relatives, with a Austin B. XUWWams maximum observed carapace length of 47 mm, the Cape lobster National Marine Fisheries Service Systematics Laboratory has first chelae adorned with a National Museum of Natural History, Smithsonian Institution thick mat of plumose setae and less Washington. DC 20560 abundant setae on the carapace, tail fan, and abdominal pleura, whereas these setae are absent in Robert S. Steneck Homarus. Relative length and Department of Oceanography and Ira C. Darling Center shape of the carpus on pereopod 1, University of Maine, Walpole, Maine 04573 tooth pattern on cutting edges of first chelae, shape of the linguiform rostrum, large size of oviducal openings, and structure of male pleopods differ from corresponding features in Homarus. Comparative analysis of DNA from the mito­ Until now, three species of neph­ tend the r£inge to Transkei (Kado et chondrial 16s rRNA gene demon­ ropid lobsters have been recognized al., 1994). strated considerable sequence di­ in the genus Homarus Weber, 1795 Regardless of its rarity, sufficient vergence of the Cape lobster O.Vy^) (see Holthuis, 1991): H. americanus specimens of the Cape lobster, liv­ from its putative congeners. The H. Milne-Edwards, 1837, the north­ ing and preserved, are now avail­ magnitude of this estimate relative to that between the two North At­ western Atlantic American lobster; able for analysis of its distribution, lantic species (1.39^) further sug­ H. gammarus (Linnaeus, 1758), the morphological, and genetic at­ gests that taxonomic revision is northeastern Atlantic-Mediterra­ tributes, and systematic status. warranted. nean European lobster; and//, cap­ Results of our studies indicate that ensis (Herbst, 1792), the South Af­ this species should be removed from rican Cape lobster. All are found in Homarus and placed in a genus of cool or cold temperate waters, and its own; this paper provides sup­ the North Atlantic species range porting evidence for this action and into subarctic waters. The northern offers supplementary descriptive H. americanus and H. gammarus information on the species. are well-known, abundant, and eco­ nomically valuable species, but the southern H. capensis has long been Homarinus, new genus problematic because only a few Figs. 1-4 specimens (13 males, 1 female) were known to exist in collections Type species—Homarus capensis (Barnard, 1950; Wolff, 1978; Hol­ (Herbst, 1792) by present designa­ thuis, 1991). Gilchrist (1918) had tion and monotypy. seen only three specimens and re­ marked (p. 46) that "it is a very rare Description—Carapace moderately species, and is not even known to compressed, narrower than deep, Cape Fishermen." Kensley (1981) sparsely setose, middorsal carina recorded its distribution in the Cape barely evident on gastric region, ob­ Province as Table Bay to East Lon­ Manuscript accepted 25 September 1994. solescent on thoracic region posterior Fishery Bulletin 93:97-102 (1995). don, and recent new collections ex­ to deep cervical groove. Rostrum 97 Vb Fishery Bulletin 93(1), 1995 Figure 1 Homarinus capensis (Herbst). Living male, carapace length 3.41 cm, photographed in an aquarium in Sea Fisheries Research Institute, Cape Town, South Africa, by Robert Tarr. (a) Left lateral; (6) dorsal. Kornfield et al.: Cape lobster taxonomy 99 a d 1 — / 2 — Figure 2 Male pleopods (pi); mesial views of pi 1 (slight lateral folds on tips not shown in these views), and mesial views of appendix masculina on mesial ramus of pi 2: (c and b) Homarinus capensiv, left (USNM 251452); (c and d) Homarus americanus, right fUSNM 13952); (e and f) H. gammarus, right (USNM 2085). Scale is 1 mm: bar 1 applies to c through f; bar 2 applies to a and b. linguiform in dorsal view, broad at base where mar­ gins coalesce with orbits, margins bearing 4-6 small spines and gradually tapering anteriorly to rather abruptly pointed or narrowly rounded tip, reaching distal 1/3 of penultimate article of antennular pedimcle, shallow dorsal concavity running its entire length. Tel son and uropods with thick fringe of plumose 4^^ 0\ setae on distal margin and with scattered non- plumose long setae dorsally on these appendages and '•^ •J sixth abdominal segment. Telson as wide at base as long, with lateral margins slightly sinuous and subparallel bearing obsolescent spines and rugae, each side ending in fixed posterolateral spine; ter­ minal margin beyond spine broadly convex; distal 1/3 of surface bearing obsolescent transverse rugae. Figure 3 Uropods broadly subovate, sparsely setose on dorsal Homarinus capensis (Herbst), tail fan (from figure inH. surface; mesial ramus broadest nesir posterior mar­ Milne-Edwards, 1851). gin with width about 0.73 length, row of obsolescent lateral marginal spines ending in fixed posterolat­ eral spine; lateral ramus with width about 0.72 length, diaresis well behind midlength bearing row ing extensor margin and distributed a distance along of fixed but irregularly worn spines ending in stron­ fixed finger; similar setae on mesial surface of car­ gest spine at posterolateral angle. pus and ventral surface of merus. Fingers not gap­ Chelae of first pereopods with thick coat of long ing; those of major chela with crushing teeth (often plumose setae on upper surface of palm, overhang- worn) opposed from near base to about midlength 100 Fishery Bulletin 93(1). 1995 ing form -inus, resembling. The gen­ Ha ggtcgcaaacttttttgtcgatatgaactctcaaaataaataacgctgtt 50 der is masculine. Hg He n Ha atccctaaagtaacttaaatttttaatcaacaancaanggatcanttaca 100 Homarinus capensis (Herbst, Hg 1792), new combination He ca. c. a. t c. a. Ha cacnnnnnnaaatatetctgtattttaaatttaaacagttacnnaaatta 150 Synonymy—Holthuis (1986:243, fig. Hg g 1) gave an exhaustive synonymy for He t c t..a a..t Homarus capensis, and a later Ha tatcatcgtcgccccaacgaaataattntagtatataaataatattaaac 200 (1991:59) less inclusive account. Hg c He .. t ac. c g t. These treatments are so recent and readily available that reiteration Ha tttcaactcatctaattatatactaaattattaagctttatagggtctta 250 here would be unnecessarily redun­ Hg . t He . a. t g. a dant. Succeeding reference to the species follows. Ha tegtccctttaaaatatttaagccttttcacttaaaagtcaaattcaatt 300 Hg Homarus capensis.—Kado, Kittaka, He c. tg. a. Hayakawa and Pollock, 1994:72, Ha tttgtgtttgagacagtttgcttcttgtccaaccattcatacaagcctcc 3 50 figs. 2, 3, 4. Hg a.... a.... He ac.t.t..c. Material—Cape Province, South Af­ Ha aattaagagactaatgactatgctaccttc 380 Hg rica. USNM 251451. Id. East Lon­ He g. nn don?, R. Melville-Smith, 92-RMS-O, Nov 1992, regurg., dismembered, Figure 4 carapace length (cl) 26.5 mm, short Peirtial sequence for the mitochondrial 16s rRNA gene. Sequences for Homarus carapace length (scl) 21 mm, abdo­ americanus (Ha), H. gammarus (Hg), and Homarinus capensis (He) have been men length (abdl) 33.0 mm. USNM deposited with GenBank Accession Numbers U11238, U11246, and U11247 respectively. Dots indicate nucleotides identical with Ha; letters indicate nucle­ 251452.16, southwest Dassen Island otide substitutions at the homologous sites. Sites marked 'n' have unresolved [33°26'S, 18°05'E], regurgitated from nucleotides. Sebastichthys capensis, badly crushed and partly dismembered, R.S. Steneck, 92-D-2, 1 Dec 1992, cl 32 mm, scl 25.5 mm. USNM 251453. 19, Still followed by row of intermittent noncrushing moder­ Bay [34°23'S, 21°27'E], dismembered, R. Melville- ate conical teeth with 4-6 smaller ones in intervals Smith, RMS7, abdl 45 mm. USNM 251454. 19, Still between them; minor chela with latter pattern of Bay, regurg., R. Melville-Smith, RMS8, 5 mm, abdl noncrushing teeth on cutting edge of each finger; tips 47 mm. of fi.ngers on each chela curved toward each other Additional specimens reported to us by R. Melville- and crossing. Smith, Sea Fisheries Institute, Cape Town: 16, North Carpus of major chela elongate; anterior margin Dassen Island, tide pool, RSS, 92-D-l, 3 Feb 1992; with two prominent spines and smaller ones between, 19. Port Alft-ed, RMS 1; 1 <J, Houghham Park, Algoa palmar condyle subcircular and flattened, with sug­ Bay; 16, Dassen Island, west side, RMS 3; 1 d, Cape gestion of spines or tubercles on its anteromesial St. Francis, RMS 4; Id, Cintsa Reef, East London, margin; dorsomesial margin strongly tuberculate and RMS 5; 1 d, Sunday's River mouth, RMS 6; 2 d, Cape partly obscured by setae; shorter dorsolateral mar­ St. Francis, RMS 9 and 10; 19, Haga Haga, Transkei gin also tuberculate but less prominently so; strong coast, RMS 11. low spines on mesioventral margin. Merus bearing subdistal anterolateral spine, well-separated sharp Description—^As for genus with addition of the fol­ tubercles on mesiodorsal margin, and mesioventral lowing details. row of fairly uniform small tubercles. Abdominal pleura well developed, with roimded Minor chela with similar but less developed orna­ angles; pleuron of segment 1 small; pleuron of seg­ mentation; merus with acute spines and spiniform ment 2 broad, overlapping first and third pleura; tubercles. pleura 3-4-5 with anteroventral angle rounded, pos­ terolateral angle subrectangulsu-; pleuron of segment Etymology—^The name Homarinus is derived fi*om 6 rounded ventrally, posterolateral angle rounded French homard, lobster, and the adjectival combin- and confluent with anterolateral angle of telson. Kornfieid et al.: Cape lobster taxonomy 101 Telson with dorsal setae distributed in 3 longitu­ using standard protocols (Kocher et al., 1989).