High Genetic Diversity in the Hydroid Plumularia Setacea: a Multitude of Cryptic Species Or Extensive Population Subdivision?
Total Page：16
File Type：pdf, Size：1020Kb
Molecular Phylogenetics and Evolution 76 (2014) 1–9 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev High genetic diversity in the hydroid Plumularia setacea: A multitude of cryptic species or extensive population subdivision? Peter Schuchert Natural History Museum of Geneva, Route de Malagnou 1, CH-1208 Geneva, Switzerland article info abstract Article history: The marine hydroid Plumularia setacea has a near-cosmopolitan distribution. As in other sessile inverte- Received 13 December 2013 brates with limited dispersal abilities, the wide distribution could also be a taxonomic artefact and the Revised 19 February 2014 species might in fact be a complex of sibling species. To investigate this, a set of worldwide samples of Accepted 20 February 2014 P. setacea and several closely related species was examined using the mitochondrial markers 16S and Available online 3 March 2014 COI, as well as the nuclear marker ITS. The results suggest an even higher degree of genetic diversity than expected. Almost all sampled regions had only private haplotypes and the resulting trees split into a mul- Keywords: titude of geographically delimited lineages, this both for the mitochondrial and nuclear markers. In the Intraspecific phylogeny framework of a genealogical species concept, these lineages would qualify as cryptic species. Using alter- Cryptic species Cosmopolitan species native species concepts, the results could be reconciled with traditional taxonomy by regarding P. setacea Nuclear and mitochondrial markers as a single species with an extensive population subdivision. A rapid molecular clock, limited dispersal Species concepts abilities, and localized clonal propagation are likely the factors that explain the high but dispersed genetic Dispersed genetic diversity diversity within this species. Ó 2014 Elsevier Inc. All rights reserved. 1. Introduction siphonophores and trachyline medusae, there are also a number of sessile hydroids known to have a very wide, circumglobal distri- Due to the apparent large scale uniformity of the marine envi- bution. One example is Obelia geniculata, a common sessile hydroid ronment, it has been assumed until quite recently that marine spe- found in nearly all temperate to cold waters and producing a me- cies generally exhibit higher degree of connectivity among dusa with limited dispersal capacity. Govindarajan et al. (2005) geographically distant populations, leading to wide, sometimes could show that this nominal species is likely a complex of three cosmopolitan, distribution patterns. Cosmopolitanism implies high geographically delimited species. Similar observations were made dispersal, colonizing capacity, and tolerance to a wide array of for other genera by Schuchert (2005), Miglietta et al. (2009), Folino environmental conditions. However, the use of genetic methods Rorem et al. (2009), Martinez et al. (2010), Lindner et al. (2011), has shown that many of these ‘‘cosmopolitan species’’ might actu- and Pontin and Cruickshank (2012). Additionally, using a barcod- ally be complexes of sibling species (e.g. Palumbi, 1992, 1994; ing approach, Moura et al. (2008–2012) found that many nominal Knowlton, 1993, 2000; Sanford and Kelly, 2011). This seems partic- hydroid species are composed of distinct lineages, suggesting that ularly true for morphologically simple invertebrates with few taxo- they could be cryptic species. However, the sole existence of nomically exploitable characters and thus with a high potential of distinct and deep mitochondrial lineages alone is not evidence en- hidden speciation (e.g. Ladner and Palumbi, 2012). Numerous stud- ough that a species is composed of several biological- or phyloge- ies have shown this on a regional level, but even on a global scale netic species. Strongly divergent mitochondrial lineages can also there are several examples, e.g. for sponges (Xavier et al., 2010), be found within the same biological species due to persistent an- jellyfish (Dawson and Jacobs, 2001), bryozoans (Gomez et al., cient polymorphisms or genetic introgressions and hybridisations 2007; Nikulina et al., 2007) and chordates (Caputi et al., 2007). (e.g. Ladner and Palumbi, 2012). Only when nuclear genes show Hydrozoans (Cnidaria, Hydrozoa) seem to be no exception. concomitantly the same lineages, sufficient evidence for distinct More than in any other marine invertebrate group, many species is given (using a genealogic species concept; Baum and hydrozoan species have very wide distributions. While this Shaw, 1995; Hudson and Coyne, 2002; Mallet, 2007). is understandable for holopelagic, off-shore species like Similar to Obelia geniculata mentioned above, Plumularia setacea is a common marine hydroid found circumglobally in tropical to temperate seas, usually in very shallow depths. It lacks a medusa E-mail address: [email protected] http://dx.doi.org/10.1016/j.ympev.2014.02.020 1055-7903/Ó 2014 Elsevier Inc. All rights reserved. 2 P. Schuchert / Molecular Phylogenetics and Evolution 76 (2014) 1–9 stage and it is larviparous. Its dispersal capacity via the planula lar- as voucher specimens in the Natural History Museum of Geneva vae appears quite limited (Hughes, 1986). It can be found on sea- (MHNG). The accession numbers of the voucher specimens are weeds and it has rarely been found on man-made objects (Morri given in Table 1. and Boero, 1986). Potentially the colony can therefore also disperse The DNA extracts were assigned unique numbers which are also via floating seaweeds or on ship-hulls. Its broad distribution could used in Table 1 and Figs 1 and 2, thus allowing a comparison of thus be explained by rafting (Cornelius, 1992). Alternatively, its individual isolates in the phylogenetic trees. Some of the ITS putative wide distribution might also be a taxonomic artefact sequences had to be cloned. Their numbering system is composed due to overlapping phenotypes of several distinct species, either of the DNA isolate number followed by the clone number after a allopatric or sympatric ones (Schuchert, 2013a). period. Several species closely resembling Plumularia setacea are also A few specimens and their DNA were obtained from other known, some needing a re-evaluation of their taxonomic status. museums (Table 1). Examples of better known nominal species are: 2.3. PCR – P. warreni and P. strictocarpa only differ in subtle differences of the reproductive organs or strategy; both occur in sympatry All PCR reactions were performed in a final volume of 50 ll with P. setacea and are therefore likely good biological species. using a Taq polymerase and reagents purchased from Qiagen (final – P. gaimardi is rather distinct morphologically (see Schuchert, mixture: 1xPCR buffer, 1 mM dNTP, 1 pmol primers, 1.8 U Taq 2013a) and occurs sympatrically with P. setacea. P. gaimardi it polymerase). is thus likely a distinct species. About 590 bp of the large mitochondrial ribosomal RNA (16S) – P. lagenifera is restricted to the NE Pacific and sympatric with P. was amplified from 1 ll of DNA extract as given in Schuchert setacea. Its taxonomic status has been re-evaluated recently (2005). (Schuchert, 2013a). A fragment of about 660 bp of the mitochondrial Cytochrome Oxidase I (COI) was amplified using the reverse primer HCO2198 More nominal Plumularia species exist that are, however, of Folmer et al. (1994) and a new forward primer CoF TAAACTT- mostly ill known and very rare (comp. Calder et al., 2009). CAGGGTGACCAAAAAATCA (a modified HCO2198 primer of Folmer Their status can only be re-evaluated correctly once it is known et al., 1994). This primer pair worked only in for about 2/3 of the if P. setacea is really a cosmopolitan species or a species complex. samples and more specific, internal primers had to be designed The question of this study was thus: (PF1 ATAAAGATATAGGAACATTATACTTAAT and PR3 TATA- AAATTGGATCCCCTCCTCCTGC). However, even with these im- –IsP. setacea a true, cosmopolitan species (meaning reciprocally proved primers it was not possible to obtain results for all monophyletic to other nominal Plumularia, and with mitochon- specimens. The PCR cycling conditions were 5 Â (94°50 s/45°50 s/ drial and nuclear markers recombining independently as in a 72°60 s) + 35 Â (94°50 s/50°50 s/72°60 s). panmictic population), The complete internal transcribed spacer 1 (ITS1), 5.8S rDNA, –orisP. setacea composed of independently evolving lineages (P. and ITS2 region of the nuclear ribosomal DNA was amplified using setacea is polyphyletic in relation to congeners, the mitochon- primers designed to anneal to the 18S (GTCGCTACTACCGATT- drial and nuclear markers delimit the same sub-lineages and GAATGG) and 28S (CGCTTCACTCGCCGTTACTAGG) ribosomal genes demonstrating thus their genealogic unity). (shortened primers of those given in Martinez et al., 2010). The PCR cycling conditions were 28 Â (94 °C 20 s/51°45 s/72°90 s). To answer these questions, samples of P. setacea and its rela- tives from all oceans were studied using two mitochondrial mark- ers (parts of the 16S and COI gene) and a rapidly evolving nuclear 2.4. Sequencing and alignment marker (ITS, internal transcribed spacer separating the tandemly repeated 18S and 28S ribosomal RNA genes). The PCR products were purified by spin columns and then di- rectly sequenced in both directions by Macrogen, Inc. (Seoul, Kor- ea) with the same primers as used in the amplification reaction. 2. Material and methods About half of the ITS sequences proved to be unreadable due to a mixture of at least two sequences (intragenomic variation). In 2.1. Collection and identification of samples these cases, the PCR product was cloned using the TOPOÒ TA Clon- ing Kit from the Invitrogen Company, following the protocol pro- Plumularia colonies were collected at various localities as given vided by the manufacturer. Each transformation yielded 10–200 in Table 1. Identifications were made based on morphological or more E. coli colonies. Six randomly picked clones were sus- characters using Millard (1975), Cornelius (1995), and other stud- pended each in 100 ll TE buffer and heated to 95 °C for 5 min.