DOCSLIB.ORG

The Mitf/TFE Family of Transcription Factors: Master Regulators of Organelle Signaling, Metabolism, and Stress Adaptation Logan Slade and Thomas Pulinilkunnil

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Mitf/TFE Family of Transcription Factors: Master Regulators of Organelle Signaling, Metabolism, and Stress Adaptation Logan Slade and Thomas Pulinilkunnil Published OnlineFirst August 29, 2017; DOI: 10.1158/1541-7786.MCR-17-0320 Review Molecular Cancer Research The MiTF/TFE Family of Transcription Factors: Master Regulators of Organelle Signaling, Metabolism, and Stress Adaptation Logan Slade and Thomas Pulinilkunnil Abstract The microphthalmia family (MITF, TFEB, TFE3, and TFEC) of mote tumorigenesis is reviewed. Likewise, the emerging function transcription factors is emerging as global regulators of cancer cell of the Folliculin (FLCN) tumor suppressor in negatively regulat- survival and energy metabolism, both through the promotion of ing the MiT/TFE family and how loss of this pathway promotes lysosomal genes as well as newly characterized targets, such as cancer is examined. Recent reports are also presented that relate to oxidative metabolism and the oxidative stress response. In addi- the role of MiT/TFE–driven lysosomal biogenesis in sustaining tion, MiT/TFE factors can regulate lysosomal signaling, which cancer cell metabolism and signaling in nutrient-limiting condi- includes the mTORC1 and Wnt/b-catenin pathways, which are tions. Finally, a discussion is provided on the future directions and both substantial contributors to oncogenic signaling. This review unanswered questions in the field. In summary, the research describes recent discoveries in MiT/TFE research and how they surrounding the MiT/TFE family indicates that these transcription impact multiple cancer subtypes. Furthermore, the literature factors are promising therapeutic targets and biomarkers for relating to TFE-fusion proteins in cancers and the potential cancers that thrive in stressful niches. Mol Cancer Res; 15(12); mechanisms through which these genomic rearrangements pro- 1637–43. Ó2017 AACR. Introduction Lysosomal Expression and Regulation (CLEAR) elements are recognized by the MITF family, which in turn promotes gene MITF is an evolutionarily conserved transcription factor with transcription (9, 10). Genome-wide chromatin immunoprecip- homologs identified in C. elegans and Drosophila (1). The MITF itation sequencing analysis demonstrated direct binding of family encodes four distinct genes; MITF, TFEB, TFE3,and TFEB to CLEAR elements with concomitant increment in lyso- TFEC. Structurally, MITF genes constitute a double helix leucine somalproteins(11).GenesthataremostassociatedwithTFEB zipper motif, a transactivating zone, and a domain responsible regulation contain clusters of multiple CLEAR sequences. for DNA contact and binding. The MiT/TFE family of basic Genome-wide analysis for clustered CLEAR sequences identi- helix-loop-helix (bHLH) transcription factors recognizes the fied 471 direct TFEB targets, which include lysosomal acidifi- transcription initiation or E-box (Ephrussi boxes) sites cation and degradation enzymes along with autophagy, exo-, (CANNTG) in the genome (2). The initial identification of the endo-, and phagocytosis genes. Surprisingly, several gene tar- microphthalmia family of transcription factors revealed that gets of TFEB also included those executing glucose and lipid MiT/TFEs must homodimerize or heterodimerize with another metabolism, perhaps underscoring the direct connection member of the MiT/TFE family to activate transcription (3–6). between lysosomal function and metabolism (Fig. 1; ref. 11). Early studies into the function of these transcription factors Subsequent reports have also identified that both TFE3 and identified that mutations in MITF led to Waardenburg syn- MITF are capable of binding CLEAR sequence elements to drome type II, characterized by hypopigmentation and defects induce lysosomal biogenesis and autophagy in a comparable in ectodermal development (7), while murine homozygous manner (12, 13). TFEB knockouts fail to develop due to lack of placental vas- The autophagy–lysosome system is a catabolic cellular process cularization (8). More recently, MITF, TFEB, and TFE3 were for whole organelles, protein aggregates, and other macromole- identified as regulators of lysosomal function and metabolism. cules (14). During carcinogenesis, autophagy exerts an antitu- Numerous lysosomal and autophagy genes with one or more morigenic effect by degrading and/or recycling damaged cellular 10 base pair motifs (GTCACGTGAC) termed as Coordinated organelles, thereby blocking the accumulation of endogenous mutagens, and preventing further genomic alterations. However, following tumor induction, cancer cells coopt autophagy as a cell Department of Biochemistry and Molecular Biology, Faculty of Medicine, Dal- survival mechanism to promote nutrient reallocation for diverse housie University, Dalhousie Medicine New Brunswick, New Brunswick, Canada. cellular needs. Therefore, autophagy can suppress cancer devel- Corresponding Author: Thomas Pulinilkunnil, Department of Biochemistry and opment through its cytoprotective properties; however, once Molecular Biology, Dalhousie University, Dalhousie Medicine New Brunswick, cancer has developed, these same properties sustain survival of 100 Tucker Park Road, Saint John, New Brunswick E2L4L5, Canada. Phone: 1- the tumor (15). Cytoprotective and oncoprotective properties of 506-636-6973; Fax: 1-506-636-6001; E-mail: [email protected] autophagy include managing oxidative stress, preventing DNA doi: 10.1158/1541-7786.MCR-17-0320 damage, and supporting metabolism under nutrient-depleted Ó2017 American Association for Cancer Research. conditions (15, 16). Adaptive metabolic reprogramming of www.aacrjournals.org 1637 Downloaded from mcr.aacrjournals.org on September 29, 2021. © 2017 American Association for Cancer Research. Published OnlineFirst August 29, 2017; DOI: 10.1158/1541-7786.MCR-17-0320 Slade and Pulinilkunnil Figure 1. Regulation and downstream targets of the Microphthalmia family of transcription factors: TFEB, TFE3, and MITF are negatively regulated through phosphorylation by mTORC1, where they are then restricted to the cytosol by chaperone protein 14-3-3. Phosphorylation is reversed by calcineurin (CaN), although no reports have yet investigated whether this is true for MITF, and the dephosphorylated proteins are free to enter the nucleus, where they bind to E-boxes, CLEAR sequences, and M-boxes to promote transcription of associated genes. Genes regulated by TFEB, TFE3, and MITF promote autophagy and lysosomal catabolism, along with mitochondrial biogenesis. Cell processes regulated by the microphthalmia TFs sustain cell metabolism through ensuring a supply of amino acids, which feed protein and nucleotide biosynthesis, while also regulating to supply of energy via mitochondrial oxidative phosphorylation. Gene targets downstream of CLEAR sequences also include those that respond to oxidative stress, such as key components of the glutathione system. cancer cells provides them with the ability to utilize diverse fusion, places TFEB under the control of a more active promoter substrates as the building blocks for molecules necessary for resulting in a 60-fold higher expression (20). Crucially, the proliferation. Indeed, autophagy participates in this program resulting protein products from the gene fusion events still have through degradation of lipids and proteins within lysosomes functional basic helix-loop-helix domains and nuclear localiza- to derive substrates for nucleic acid and membrane biosynthe- tion signals, keeping the transcriptional activation function sis (14, 16). The microphthalmia family of transcription factors intact (18). It has been reported that lysosomal localization, are regulators of the autophagy–lysosome system (Fig. 1), and and thus inhibition, of MiT/TFEs requires the first 30 amino increasing evidence suggests that they also directly regulate acids, corresponding to exon 1 (21). All reported gene fusions metabolic and growth signaling pathways, and as such, re- eliminate exon 1 from the resulting protein, indicating that the present an attractive therapeutic target with wide potential fusion proteins are unlikely to be able to localize to the lyso- cancer. This review will discuss the prospect of MITF, TFEB, and some, suggesting a mechanism of constitutive activation (18). TFE3 as necessary elements for the viability of several cancer Further associating MiT/TFEs in renal neoplasia is a kidney- types with specific emphasis on changes in cellular autophagy specific TFEB overexpression mouse model that developed severe and metabolism. kidney enlargement with multiple cysts at 30 days following birth, while Ki-67–positive neoplastic lesions were detected as soon as 12 days after birth (22). Renal-specific TFEB overexpres- Role of TFEB and TFE3 as Oncogenes sion also resulted in liver metastasis in 23% of mice (22). There A number of studies have determined TFE3 and TFEB as being are no reports about the activity of TFE fusion proteins; however, oncogenes. Chromosomal translocations resulting in gene a case study has identified strong nuclear staining of the TFE3 fusions involving TFE3 or TFEB are implicated in the develop- fusion protein, and a cell line and xenograft model generated ment of sporadic renal cell carcinomas (RCC) and soft tissue from the patient maintained this nuclear localization (23), a sarcomas. These genetic rearrangements cause overexpression of result that has been reproduced in several other IHC screens of the TFE proteins (17–19), and in the case of TFEB-MALAT1 TFE3 and TFEB translocation cancers (17, 24, 25). 1638 Mol Cancer Res; 15(12) December 2017 Molecular Cancer Research Downloaded from mcr.aacrjournals.org on September 29, 2021. © 2017 American Association for Cancer
Load more

Recommended publications
  • Molecular Cytogenetic Analysis for TFE3 Rearrangement In
    Modern Pathology (2014) 27, 113–127 & 2014 USCAP, Inc. All rights reserved 0893-3952/14 $32.00 113 Molecular cytogenetic analysis for TFE3 rearrangement in Xp11.2 renal cell carcinoma and alveolar soft part sarcoma: validation and clinical experience with 75 cases Jennelle C Hodge, Kathryn E Pearce, Xiaoke Wang, Anne E Wiktor, Andre M Oliveira and Patricia T Greipp Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, MN, USA Renal cell carcinoma with TFE3 rearrangement at Xp11.2 is a distinct subtype manifesting an indolent clinical course in children, with recent reports suggesting a more aggressive entity in adults. This subtype is morphologically heterogeneous and can be misclassified as clear cell or papillary renal cell carcinoma. TFE3 is also rearranged in alveolar soft part sarcoma. To aid in diagnosis, a break-apart strategy fluorescence in situ hybridization (FISH) probe set specific for TFE3 rearrangement and a reflex dual-color, single-fusion strategy probe set involving the most common TFE3 partner gene, ASPSCR1, were validated on formalin-fixed, paraffin- embedded tissues from nine alveolar soft part sarcoma, two suspected Xp11.2 renal cell carcinoma, and nine tumors in the differential diagnosis. The impact of tissue cut artifact was reduced through inclusion of a chromosome X centromere control probe. Analysis of the UOK-109 renal carcinoma cell line confirmed the break-apart TFE3 probe set can distinguish the subtle TFE3/NONO fusion-associated inversion of chromosome X. Subsequent extensive clinical experience was gained through analysis of 75 cases with an indication of Xp11.2 renal cell carcinoma (n ¼ 54), alveolar soft part sarcoma (n ¼ 13), perivascular epithelioid cell neoplasms (n ¼ 2), chordoma (n ¼ 1), or unspecified (n ¼ 5).
    [Show full text]
  • Novel Folliculin Gene Mutations in Polish Patients with Birt–Hogg–Dubé Syndrome Elżbieta Radzikowska1*, Urszula Lechowicz2, Jolanta Winek3 and Lucyna Opoka4
    Radzikowska et al. Orphanet J Rare Dis (2021) 16:302 https://doi.org/10.1186/s13023-021-01931-0 RESEARCH Open Access Novel folliculin gene mutations in Polish patients with Birt–Hogg–Dubé syndrome Elżbieta Radzikowska1*, Urszula Lechowicz2, Jolanta Winek3 and Lucyna Opoka4 Abstract Background: Birt–Hogg–Dubé syndrome (BHDS) is a rare, autosomal dominant, inherited disease caused by muta- tions in the folliculin gene (FLCN). The disease is characterised by skin lesions (fbrofolliculomas, trichodiscomas, acrochordons), pulmonary cysts with pneumothoraces and renal tumours. We present the features of Polish patients with BHDS. Materials and methods: The frst case of BHDS in Poland was diagnosed in 2016. Since then, 15 cases from 10 fami- lies have been identifed. Thirteen patients were confrmed via direct FLCN sequencing, and two according to their characteristic clinical and radiological presentations. Results: BHDS was diagnosed in 15 cases (13 women and 2 men) from 10 families. The mean ages at the time of frst pneumothorax and diagnosis were 38.4 13.9 and 47.7 13 years, respectively. Five patients (33%) were ex- smokers (2.1 1.37 packyears), and 10 (67%)± had never smoked± cigarettes. Twelve patients (83%) had a history of recurrent symptomatic± pneumothorax. Three patients had small, asymptomatic pneumothoraces, which were only detected upon computed tomography examination. All patients had multiple bilateral pulmonary cysts, distributed predominantly in the lower and middle, peripheral, and subpleural regions of the lungs. Generally, patients exhibited preserved lung function. Skin lesions were seen in four patients (27%), one patient had renal angiomyolipoma, and one had bilateral renal cancer.
    [Show full text]
  • The Role of GPNMB in Inflammation
    REVIEW published: 12 May 2021 doi: 10.3389/fimmu.2021.674739 The Role of GPNMB in Inflammation Marina Saade, Giovanna Araujo de Souza, Cristoforo Scavone and Paula Fernanda Kinoshita* Department of Pharmacology, Institute of Biomedical Science, University of São Paulo, São Paulo, Brazil Inflammation is a response to a lesion in the tissue or infection. This process occurs in a specific manner in the central nervous system and is called neuroinflammation, which is involved in neurodegenerative diseases. GPNMB, an endogenous glycoprotein, has been recently related to inflammation and neuroinflammation. GPNMB is highly expressed in macrophages and microglia, which are cells involved with innate immune response in the periphery and the brain, respectively. Some studies have shown increased levels of GPNMB in pro-inflammatory conditions, such as LPS treatment, and in pathological conditions, such as neurodegenerative diseases and cancer. However, the role of GPNMB in inflammation is still not clear. Even though most studies suggest that GPNMB might have an anti-inflammatory role by promoting inflammation resolution, there is evidence that GPNMB could be pro-inflammatory. In this review, we gather and Edited by: discuss the published evidence regarding this interaction. James Harris, Monash University, Australia Keywords: GPNMB, inflammation, neuroinflammation, macrophages, cancer, protection Reviewed by: Michelle Coleman, Seattle Children's Research Institute, United States INFLAMMATION James Vince, Walter and Eliza Hall Institute of Inflammation is a complex response to microbial infections or tissue damage involving interactions Medical Research, Australia between soluble molecules and cellular effectors to restore homeostasis (1–3). Tissue-resident *Correspondence: macrophages and mast cells are relevant to an efficient and rapid immune response that prevents the Paula Fernanda Kinoshita infection from spreading and/or tissue damage.
    [Show full text]
  • Renal Cell Carcinoma – Detection of PRCC-TFE3 and Alpha-TFEB Gene Fusions Using RT-PCR on Tissues (Odes 60153 and 60154) Notice of Assessment
    Renal Cell Carcinoma – Detection of PRCC-TFE3 and Alpha-TFEB Gene Fusions Using RT-PCR on Tissues (odes 60153 and 60154) Notice of Assessment June 2013 DISCLAIMER: This document was originally drafted in French by the Institut national d'excellence en santé et en services sociaux (INESSS), and that version can be consulted at http://www.inesss.qc.ca/fileadmin/doc/INESSS/Analyse_biomedicale/Juin_2013/INESSS_Analyse_15.pdf http://www.inesss.qc.ca/fileadmin/doc/INESSS/Analyse_biomedicale/Juin_2013/INESSS_Analyse_16.pdf It was translated into English by the Canadian Agency for Drugs and Technologies in Health (CADTH) with INESSS’s permission. INESSS assumes no responsibility with regard to the quality or accuracy of the translation. While CADTH has taken care in the translation of the document to ensure it accurately represents the content of the original document, CADTH does not make any guarantee to that effect. CADTH is not responsible for any errors or omissions or injury, loss, or damage arising from or relating to the use (or misuse) of any information, statements, or conclusions contained in or implied by the information in this document, the original document, or in any of the source documentation. 1 GENERAL INFORMATION 1.1 Requestor: Centre hospitalier universitaire de Québec (CHUQ). 1.2 Application Submitted: August 1, 2012. 1.3 Notice Issued: April 12, 2013. Note: This notice is based on the scientific and commercial information (submitted by the requestor[s]) and on a complementary review of the literature according to the data available at the time that this test was assessed by INESSS. 2 TECHNOLOGY, COMPANY, AND LICENCE(S) 2.1 Name of the Technology Reverse transcription of messenger RNA and amplification (RT-PCR).
    [Show full text]
  • Fnip1 Regulates Skeletal Muscle Fiber Type Specification, Fatigue Resistance, and Susceptibility to Muscular Dystrophy
    Fnip1 regulates skeletal muscle fiber type specification, fatigue resistance, and susceptibility to muscular dystrophy Nicholas L. Reyesa, Glen B. Banksb, Mark Tsanga, Daciana Margineantuc, Haiwei Gud, Danijel Djukovicd, Jacky Chana, Michelle Torresa, H. Denny Liggitta, Dinesh K. Hirenallur-Sa, David M. Hockenberyc, Daniel Rafteryd,e, and Brian M. Iritania,1 aThe Department of Comparative Medicine, University of Washington, Seattle, WA 98195-7190; bDepartment of Neurology, University of Washington, Seattle, WA 98195; cClinical Division, Fred Hutchinson Cancer Research Center, Seattle, WA 98109-1024; dDepartment of Anesthesiology and Pain Medicine, Mitochondria and Metabolism Center, Northwest Metabolomics Research Center, University of Washington, Seattle, WA 98109-8057; and ePublic Health Sciences Division, Fred Hutchinson Cancer Research Center, Seattle, WA 98109-1024 Edited* by Robert N. Eisenman, Fred Hutchinson Cancer Research Center, Seattle, WA, and approved December 8, 2014 (received for review July 14, 2014) Mammalian skeletal muscle is broadly characterized by the presence moderate strength and improved resistance to fatigue. Because of two distinct categories of muscle fibers called type I “red” slow slow twitch fibers use predominantly fatty acid oxidation for twitch and type II “white” fast twitch, which display marked differ- energy production, increasing the representation of type I fibers ences in contraction strength, metabolic strategies, and susceptibil- provides increased protection against obesity and related meta- ity to fatigue. The relative representation of each fiber type can bolic disorders including diabetes (2–5). Hence, identifying mol- have major influences on susceptibility to obesity, diabetes, and ecules that regulate fiber type conversion can profoundly impact muscular dystrophies. However, the molecular factors controlling susceptibility to metabolic diseases and can influence the patho- fiber type specification remain incompletely defined.
    [Show full text]
  • Clinical and Genetic Characteristics of Chinese Patients with Birt-Hogg
    Liu et al. Orphanet Journal of Rare Diseases (2017) 12:104 DOI 10.1186/s13023-017-0656-7 RESEARCH Open Access Clinical and genetic characteristics of chinese patients with Birt-Hogg-Dubé syndrome Yaping Liu1†, Zhiyan Xu2†, Ruie Feng3, Yongzhong Zhan4,5, Jun Wang4, Guozhen Li4, Xue Li4, Weihong Zhang6, Xiaowen Hu7, Xinlun Tian4*†, Kai-Feng Xu4† and Xue Zhang1† Abstract Background: Birt-Hogg-Dubé syndrome (BHD) is an autosomal dominant disorder, the main manifestations of which are fibrofolliculomas, renal tumors, pulmonary cysts and recurrent pneumothorax. The known causative gene for BHD syndrome is the folliculin (FLCN) gene on chromosome 17p11.2. Studies of the FLCN mutation for BHD syndrome are less prevalent in Chinese populations than in Caucasian populations. Our study aims to investigate the genotype spectrum in a group of Chinese patients with BHD. Methods: We enrolled 51 patients with symptoms highly suggestive of BHD from January 2014 to February 2017. The FLCN gene was examined using PCR and Sanger sequencing in every patient, for those whose Sanger sequencing showed negative mutation results, multiplex ligation-dependent probe amplification (MLPA) testing was conducted to detect any losses of large segments. Main results: Among the 51 patients, 27 had FLCN germline mutations. In total, 20 mutations were identified: 14 were novel mutations, including 3 splice acceptor site mutations, 2 different deletions, 6 nonsense mutations, 1 missense mutation, 1 small insertion, and 1 deletion of the whole exon 8. Conclusions: We found a similar genotype spectrum but different mutant loci in Chinese patients with BHD compared with European and American patients, thus providing stronger evidence for the clinical molecular diagnosis of BHD in China.
    [Show full text]
  • 22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung
    22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung Ultra-conserved elements in an alignment of multiple genomes are consecutive nucleotides that are in perfect agreement across all the genomes. For aligned vertebrate and fly genomes, we give descriptive statistics of ultra-conserved elements, explain their biological relevance, and show that the existence of ultra-conserved elements is highly improbable in neutrally evolving regions. 22.1 The data Our analyses of ultra-conserved elements are based on multiple sequence align- ments produced by MAVID [Bray and Pachter, 2004]. Prior to the alignment of multiple genomes, homology mappings (from Mercator [Dewey, 2005]) group into bins genomic regions that are anchored together by neighboring homolo- gous exons. A multiple sequence alignment is then produced for each of these alignment bins. MAVID is a global multiple alignment program, and therefore homologous regions with more than one homologous hit to another genome may not be found aligned together. Table 22.1 shows an example of Merca- tor’s output for a single region along with the beginning of the resulting MAVID multiple sequence alignment. Species Chrom. Start End Alignment Dog chrX 752057 864487 + A----AACCAAA--------- Chicken chr1 122119382 122708162 − TGCTGAGCTAAAGATCAGGCT Zebrafish chr9 19018916 19198136 + ------ATGCAACATGCTTCT Pufferfish chr2 7428614 7525502 + ---TAGATGGCAGACGATGCT Fugufish asm1287 21187 82482 + ---TCAAGGG----------- Table 22.1. Mercator output for a single bin, giving the position and orientation on the chromosome. Notice that the Fugu fish genome has not been fully assembled into chromosomes (cf. Section 4.2). The vertebrate dataset consists of 10,279 bins over 9 genomes (Table 22.2).
    [Show full text]
  • A Novel Partner of TFE3 in the Xp11 Translocation Renal Cell Carcinoma: Clinicopathological Analyses and Detection of EWSR1-TFE3 Fusion
    Virchows Archiv (2019) 474:389–393 https://doi.org/10.1007/s00428-018-2509-8 BRIEF REPORT A novel partner of TFE3 in the Xp11 translocation renal cell carcinoma: clinicopathological analyses and detection of EWSR1-TFE3 fusion Hironori Fukuda1 & Ikuma Kato2 & Mitsuko Furuya2 & Reiko Tanaka3 & Toshio Takagi1 & Tsunenori Kondo1,4 & Yoji Nagashima5 Received: 28 August 2018 /Revised: 13 November 2018 /Accepted: 10 December 2018 /Published online: 14 December 2018 # Springer-Verlag GmbH Germany, part of Springer Nature 2018 Abstract The renal cell carcinomas associated with Xp11 translocations (Xp11 translocation RCCs) harbor gene fusions involving TFE3,a member of the microphthalmia-associated transcription factor (MiTF) family. In the present study, we identified a novel partner of TFE3, Ewing sarcoma breakpoint region 1 (EWSR1), in an Xp11 translocation RCC. A 57-year-old Japanese woman without special disease history was referred to us for treatment of an RCC. The resected tumor displayed an alveolar growth pattern with high-grade nuclei. The tumor was diffusely positive for TFE3 and cathepsin K. Anchored multiplex PCR revealed a novel fusion, EWSR1-TFE3. Fluorescent in situ hybridization analysis demonstrated the rearrangements of EWSR1 and TFE3. RT-PCR analysis confirmed the chimeric transcript. No neoplasm with EWSR1-TFE3 has been reported so far, in any organ. The results will expand the genomic spectrums of Xp11 translocation RCCs and contribute to better understanding of the roles of the MiTF family in the oncogenic process. Keywords
    [Show full text]
  • Association Between Birt Hogg Dubé Syndrome and Cancer Predisposition
    ANTICANCER RESEARCH 30: 751-758 (2010) Review Association Between Birt Hogg Dubé Syndrome and Cancer Predisposition RAFFAELE PALMIROTTA1, ANNALISA SAVONAROLA1, GIORGIA LUDOVICI1, PIETRO DONATI2, FRANCESCO CAVALIERE3, MARIA LAURA DE MARCHIS1, PATRIZIA FERRONI1 and FIORELLA GUADAGNI1 1Department of Laboratory Medicine and Advanced Biotechnologies, IRCCS San Raffaele, 00165 Rome, Italy; 2Unit of Skin Histopathology, IRCCS San Gallicano Dermatologic Institute, 00144 Rome, Italy; 3Breast Unit, San Giovanni Hospital, 00184 Rome, Italy Abstract. The Birt Hogg Dubé syndrome (BHD) is a rare Clinically, the BHD syndrome exhibits numerous autosomal dominant genodermatosis predisposing patients to asymptomatic, skin colored, dome-shaped papules over the developing fibrofolliculoma, trichodiscoma and acrochordon. face, neck, and upper trunk. These lesions represent benign The syndrome is caused by germline mutations in the folliculin proliferations of the ectodermal and mesodermal components (FLCN) gene, encoding the folliculin tumor-suppressor of the pilar apparatus (2). Fibrofolliculomas are benign protein. Numerous mutations have been described in the tumors of the perifollicular connective tissue, occurring as FLCN gene, the most frequent occurring within a C8 tract of one or more yellowish dome-shaped papules, usually on the exon 11. This hypermutability is probably due to a slippage in face. Trichodiscomas are parafollicular mesenchymal DNA polymerase during replication, resulting in gains/losses hamartomas of the mesodermal portion of the hair disk, of repeat units, causing cancer predisposition. The main usually occurring as multiple small papules. Acrochordons phenotypic manifestations related to this disease are lung are small outgrowths of epidermal and dermal tissue, which cysts, leading to pneumothorax, and a 7-fold increased risk may be pedunculated, smooth or irregular, flesh-colored and for renal neoplasia, although other neoplastic manifestations benign; they usually appear as pedunculated skin tags, have been described in BHD-affected individuals.
    [Show full text]
  • Endolysosomal Cation Channels and MITF in Melanocytes and Melanoma
    biomolecules Review Endolysosomal Cation Channels and MITF in Melanocytes and Melanoma Carla Abrahamian and Christian Grimm * Walther Straub Institute of Pharmacology and Toxicology, Faculty of Medicine, Ludwig-Maximilians-University, 80336 Munich, Germany; [email protected] * Correspondence: [email protected] Abstract: Microphthalmia-associated transcription factor (MITF) is the principal transcription fac- tor regulating pivotal processes in melanoma cell development, growth, survival, proliferation, differentiation and invasion. In recent years, convincing evidence has been provided attesting key roles of endolysosomal cation channels, specifically TPCs and TRPMLs, in cancer, including breast cancer, glioblastoma, bladder cancer, hepatocellular carcinoma and melanoma. In this review, we provide a gene expression profile of these channels in different types of cancers and decipher their roles, in particular the roles of two-pore channel 2 (TPC2) and TRPML1 in melanocytes and melanoma. We specifically discuss the signaling cascades regulating MITF and the relationship between endolysosomal cation channels, MAPK, canonical Wnt/GSK3 pathways and MITF. Keywords: TPC; two-pore; lysosome; TPC1; TPC2; TRPML; mucolipin; MCOLN; TRPML1; MITF; melanocytes; melanoma; mTOR; TFEB; calcium Citation: Abrahamian, C.; Grimm, C. 1. Introduction Endolysosomal Cation Channels and Melanocytes are neural-crest derived cells that produce melanin, the primary de- MITF in Melanocytes and Melanoma. terminant of skin color. Melanin is also found in hair, in the iris of the eye, and in the Biomolecules 2021, 11, 1021. https:// stria vascularis of the inner ear and, to a lesser degree, in a broad range of other tissues doi.org/10.3390/biom11071021 throughout the body [1]. There are two major types of melanin called eumelanin (dark, brown, black) and pheomelanin (yellow, red, light brown).
    [Show full text]
  • Gpnmb in Inflammatory and Metabolic Diseases
    Functional characterization of Gpnmb in inflammatory and metabolic diseases Dissertation zur Erlangung des akademischen Grades D octor rerum naturalium (Dr. rer. nat.) eingereicht an der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin von M.Sc., Bernadette Nickl Präsidentin der Humboldt-Universität zu Berlin Prof. Dr.-Ing. Dr. Sabine Kunst Dekan der Lebenswissenschaftlichen Fakultät Prof. Dr. Bernhard Grimm Gutachter: Prof. Dr. Michael Bader Prof. Dr. Karl Stangl Prof. Dr. Thomas Sommer Tag der mündlichen Prüfung: 28. Februar 2020 For Sayeeda Summary Summary In 2018, the World Health Organization reported for the first time that “Overweight and obesity are linked to more deaths worldwide than underweight”A. Obesity increases the risk for the development of diabetes, atherosclerosis and cardiovascular diseases. Those metabolic diseases are associated with inflammation and the expression of glycoprotein nonmetastatic melanoma protein b (Gpnmb), a transmembrane protein that is expressed by macrophages and dendritic cells. We studied the role of Gpnmb in genetically- and diet-induced atherosclerosis as well as diet-induced obesity in Gpnmb-knockout and respective wildtype control mice. To this purpose, a mouse deficient in Gpnmb was created using Crispr-Cas9 technology. Body weight and blood lipid parameters remained unaltered in both diseases. Gpnmb was strongly expressed in atherosclerotic lesion-associated macrophages. Nevertheless, the absence of Gpnmb did not affect the development of aortic lesion size. However, macrophage and inflammation markers in epididymal fat tissue were increased in Gpnmb-deficient mice. In comparison to atherosclerosis, the absence of Gpnmb elicited stronger effects in obesity. For the first time, we observed a positive influence of Gpnmb on insulin and glucose plasma levels.
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]