Biology and Clinical applications of Estrogen Receptor Beta Isoforms
in Endocrine-Related Cancers
By Ming-tsung Lee, B.Sc., M.Phil
Molecular Biotechnology, the Chinese University of Hong Kong, Hong Kong, HKSAR 2004
Biology, the Chinese University of Hong Kong, Hong Kong, HKSAR 2006
For partial requirement of Doctor of Philosophy in Environmental Genetics and Molecular
Toxicology from the Department of Environmental Health, University of Cincinnati College of
Medicine
Thesis Committee:
Shuk-Mei Ho, PhD; Thesis Committee Chair
Divaker Choubey, PhD
Ying Xia, PhD
Xiaoting Zhang, PhD
Yuet-kin Leung, PhD
Abstract
Breast cancer (BCa) is the leading cause of cancer-related death in women worldwide, while
prostate cancer (PCa) is the second-leading cause of cancer-related death in men in the U.S.A. We urge
to understand molecular mechanisms of cancer progression in order to develop effective treatments.
Both cancers are considered to be endocrine-related cancers because sex hormones are responsible for their tumorigenesis, and there is growing evidence estrogens play an important role in promoting PCa and BCa pathogenesis. Estrogen actions are mainly mediated through estrogen receptors (ERs), which are divided into 2 subtypes, α and β1. Of these, ERβ1 is known for its protective role in PCa and BCa due to its antiproliferative and proapoptotic actions. Recently, different splice variants of ERβ1 have been discovered. Differential expression patterns and transcriptional activities of ERβ1 and its isoforms in endocrine-related cancers revealed that they possess distinct functions. The purpose of my study is to understand the mechanisms of regulation and molecular actions of ERβ1 and its isoforms.
Chapter 1 gives a brief background on the development of PCa and BCa and the relationship between estrogens and their pathogenesis. The structure and molecular actions of estrogen receptors are described, while the roles of ERβ1 and its isoforms in these cancers are also introduced. Chapter 2 focuses on the regulatory mechanisms of differential expression patterns of ERβ1 and its isoforms,
ERβ2 and 5, during PCa progression. Our data shows that the expression of ERβ1 is preferentially controlled by alternative promoter usage at transcriptional level, whereas that of ERβ2 and 5 is determined by complex interplay between transcriptional and post-transcriptional regulation. Chapter 3 examines the modulation of ERβ1 transcriptional activity by its coregulator, Tip60, at different DNA- binding sequences. Tip60 was found to be a dual-function coregulator of ERβ1 in a cis-regulatory element-dependent manner. It enhanced ERβ1 transactivation at activator protein 1 (AP-1) binding site but suppressed its transactivation at various estrogen response elements (EREs) in an estrogen-
1
independent manner. Chapter 4 investigates a novel role of ERβ5 in the apoptosis of BCa cells. It was shown to confer sensitivity of BCa cells to chemotherapeutic agent (doxorubicin and cisplatin)-induced apoptosis through its interaction with a Bcl-2 family member, Bcl2L12. Chapter 5 summarizes the results, experimental limitations, future directions, significance and perspective of the studies. Also, the prospect of using ERβ1 and its isoforms as the therapeutic targets of PCa and BCa will be discussed.
My thesis tries to provide more information about the molecular biology and clinical applications of ERβ. I uncovered the mechanisms by which the distinct expression patterns of ERβ isoforms are regulated during PCa progression. The differential transcriptional activity of ERβ1 at different cis-regulatory sequences was shown to be determined by a dual-function coregulator.
Moreover, a novel ERβ5- and Bcl2L12-mediated apoptotic pathway in BCa cells was discovered.
Collectively, my data reveal that ERβ1 and its isoforms possess distinct regulatory mechanisms and signaling pathways which contribute to their unique functional roles in PCa and BCa.
2
3
Acknowledgements
Thesis Mentor
Dr. Shuk-Mei Ho
I would like to express my appreciation and special thanks to you. I am truly grateful to you
for the opportunity to study and work in your lab. Throughout my PhD study, I have learnt much more
than I thought six years ago. You have taught me how to think scientifically, critically and
independently. Moreover, you have given me tremendous freedom for conducting research in different projects. You always remind me that you have high expectations for me in order to push me forward to meet the high standard of being a brilliant scientist. I will never forget the days I worked in your lab and will miss our meetings about my work progress, the lab meetings and also our discussions on improving
my manuscripts. Last but certainly not least, thank you for encouraging me to apply for grant funding and facilitating the planning of experiments and grant writing. I have been fortunate to be awarded a
Department of Defense predoctoral traineeship award which would not have happened without your sincere support and encouragement.
With my extensive training from your lab, I believe I am nurtured to be an independent researcher and well prepared for my future career in science. Thank you very much for giving me a invaluable chance to pursue my PhD degree under your guidance.
Thesis Committee Members
Dr. Divaker Choubey
Your expertise in molecular biology and prostatic diseases is undoubtedly invaluable for
improving my research. Your research planning, advice skills and enthusiasm for science has encouraged me to become a productive researcher. I am so grateful to you for the constructive
4
suggestions and providing me the samples of responses to the editors of journal. Thank you for serving as my thesis committee chair.
Dr. Ying Xia,
Your expertise in kinase signaling pathways and broad knowledge of biology provided a different prospective to my studies in the transcriptional activity of estrogen receptor beta. Your suggestions and publications have always given me new directions for my projects. Thank you for your generous support and advices in thesis committee meetings.
Dr. Xiaoting Zhang
Your expertise in estrogen signaling and the interaction between estrogen receptors and coregulators is definitely invaluable for my different research projects. I appreciate for your sharing of plasmids and reagents with me. Special thanks to you for being so helpful and approachable to review my paper about ERβ1 and Tip60. Your suggestions in our meetings are extremely useful for improving my studies.
Dr. Yuet-kin Leung
I would like to express my keen appreciation to you for your excellent guidance and encouragement on my research. Every piece of your advice facilitates me to accomplish my PhD study.
Thank you for teaching me as an independent researcher and a helpful colleague in Dr. Ho's lab. I cannot express how grateful I am to you for illustrating me the importance of diligence, time management and literature review. I will never forget what you have shown me about conducting productive research and good scientific writing.
5
Professors, Post-docs and research assistant
Dr. Pheruza Tarapore
Special thanks for your willingness to offer tremendous help for my research. Without your advices and critical review of my experimental data, my Tip60 and Bcl2L12 manuscripts cannot be accomplished. Your expertise in molecular biology, cancer and cell biology is incredibly helpful to my projects. Thank you for giving me a chance to learn the techniques of handling rats and work with you on your animal studies.
Dr. Xiang Zhang
Thank you for letting me involve in your PMP24 paper. Your enthusiasm for science encouraged to be a serious scientist. Moreover, I appreciate for teaching me the concept and techniques of next generation sequencing.
Dr. Neville Tam and Bin Ouyang, MD
Thank you for your input and suggestions to better develop my projects.
Dr. Vinothini Janakirim
Thank you for teaching me how to handle rats in the animal studies.
Dan Song, B.Sc.
Thank you for your help in the immunohistochemical studies and teaching me how to handle rats in the animal studies.
Family
I would like to thank my fiancée Ka-Man Ng for her sincere and generous support and great patience throughout my Ph.D. study. Special thanks to her for maintaining long-distance relationship
6
with me for six years. My parents, Fu-hung Lee and Sui-hing Ng, my brother Ming-him Lee and my dog
Ding Dong have given me their unlimited support and care.
Funding Agency
I am grateful to the Army Department of Defense, U.S.A. that provided my stipend to carry out the studies outlined in this dissertation through the following training grants: Army Department of
Defense Congressionally Directed Medical Research Program predoctoral traineeship award.
7
Table of Contents
Page Section
17 Chapter 1: General Introduction
17 The Development of Prostate Cancer
18 The Relationship between Prostate Cancer and Estrogens
20 The Development of Breast Cancer
21 The Relationship between Breast Cancer and Estrogens
23 Structure and Molecular Actions of Estrogen Receptors and the Role of
Estrogen Receptor Beta in Prostate and Breast Cancer
23 Structural Features of Estrogen Receptors
25 Signaling Pathways of Estrogen Receptors
27 Effects of different Ligands on the Activity of Estrogen Receptors
28 Protein-protein Interaction of Estrogen Receptors
31 Post-translational Modification of Estrogen Receptors
33 The Roles of Estrogen Receptor Beta in Prostate and Breast cancer
34 Estrogen Receptor Beta Isoforms and their Relationship with Prostate and
Breast cancer
39 Chapter 2: Differential expression of estrogen receptor beta isoforms in prostate
cancer through interplay between transcriptional and translational regulation
39 Abstract
40 Introduction
42 Materials and Methods
47 Results
8
53 Discussion
67 Chapter 3: Transactivation of Estrogen Receptor Beta (ERβ1) is Differentially
Modulated by an Acetytransferase Tip60 in a Regulatory Element–Dependent Manner
67 Abstract
68 Introduction
70 Materials and Methods
77 Results
85 Discussion
106 Chapter 4: Estrogen-receptor Beta Isoform 5 (ERβ5) confers sensitivity of breast
cancer cells to chemotherapeutic agent–induced apoptosis through interaction with
Bcl2L12
106 Abstract
107 Introduction
109 Materials and Methods
115 Results
120 Discussion
138 Chapter 5: General Discussion
138 Summary of Data
140 Experimental Limitations and Future Directions
142 Significance and Perspective of the studies
146 References
9
List of Figures
Page Figure Description
26 Figure 1.1 Structural domains of estrogen receptors
36 Figure 1.2 Genomic arrangement of wild-type ERβ1 and its isoforms, ERβ2 and
β5
57 Figure 2.1 Differential expression of estrogen receptor beta isoforms in
prostate cancer through interplay between transcriptional and
translational regulation
58 Figure 2.2 Schematic diagram summarizes the location of exon 0N, 0K and
different combinations of exon 0K and 0Xs in the 5′ UTRs of ERβ in
the prostate.
59 Figure 2.3 Promoter 0K- or 0N-initiated ERβ transcripts are expressed in normal
and cancerous tissues.
60 Figure 2.4 Promoter 0K and 0N differentially regulate the transcription of
different ERβ isoforms.
61 Figure 2.5 The 5′ UTRs of ERβ inhibit the translational efficiency to different
extents.
62 Figure 2.6 Sequence analysis of exon 0N, 0K and various exon 0Xs which were
present in the 5’UTR of promoter 0K-initiated ERβ transcripts.
63 Figure 2.7 uORFs in exon 0K and 0Xs are responsible for inhibition of
translational efficiency.
64 Figure 2.8 Schematic diagram shows the transcriptional and post-transcriptional
10
regulation of ERβ-isoform expression lead to the different outcomes of
prostate cancer progression.
92 Figure 3.1 ERβ1 can interact with Tip60 in either the absence or presence of
estrogen.
94 Figure 3.2 Hinge domain (HD) of ERβ1 is responsible for the interaction with
Tip60.
95 Figure 3.3 Tip60 differentially regulates ERβ1 transactivation at ERE and AP-1
sites, but has minimal effect on other transcription factor binding sites.
97 Figure 3.4 Various ligands modulate Tip60-mediated regulatory effects on ERβ1
transactivation.
98 Figure 3.5 ERβ1 cannot be acetylated by Tip60 and preferentially interacts with
unacetylated Tip60.
99 Figure 3.6 HAT activity of Tip60 is not necessary for regulation of the ERβ1
transactivation at AP-1 and ERE sites.
100 Figure 3.7 Tip60 interacts with GRIP1 to enhance ERβ1 transactivation at the
AP-1 site synergistically.
101 Figure 3.8 Tip60 differentially regulates ERβ1-target genes possessing ERE or
AP-1 sites at their cis-regulatory regions in PC-3 cells.
103 Figure 3.9 A model of the differential functions of Tip60 on regulating ERβ1
activity at heterologous response elements
124 Figure 4.1 Ectopic expression of ERβ5 in BCa cell lines does not alter the rate of
cell proliferation.
125 Figure 4.2 Ectopic ERβ5 sensitizes MCF-7 to doxorubicin-induced apoptosis.
11
126 Figure 4.3 Ectopic ERβ5 sensitizes MDA-MB-231 to doxorubicin-induced
apoptosis.
128 Figure 4.4 Ectopic ERβ5 sensitizes MCF-7 to cisplatin-induced apoptosis.
129 Figure 4.5 Ectopic ERβ5 sensitizes MDA-MB-231 to cisplatin-induced apoptosis.
130 Figure 4.6 Bcl2L12 specifically interacts with ERβ5 in an estradiol (E2)-
independent manner.
131 Figure 4.7 Bcl2L12 specifically interacts with ERβ5 but not ERβ1 or ERα.
132 Figure 4.8 Expression of Bcl2L12 was significantly reduced by gene-specific
siRNAs in MCF-7 and MDA-MB-231.
133 Figure 4.9 Knockdown of Bcl2L12 sensitizes MCF-7 and MDA-MB-231 to
doxorubicin- and cisplatin-induced apoptosis.
135 Figure 4.10 Knockdown of Bcl2L12 by siL12-2 sensitizes doxorubicin-induced
apoptosis in MCF-7 and MDA-MB-231.
136 Figure 4.11 ERβ5 inhibits the interaction between Bcl2L12 and caspase 7.
137 Figure 4.12 Schematic diagram shows the role of ERβ5 in the apoptosis of breast cancer
(BCa) cells.
12
List of Tables
Page Figure Description
65 Table 2.1 Primers used in different experiments of chapter 2
66 Table 2.2 Primers used in different experiments of chapter 2
104 Table 3.1 Primers used in the experiments of domain-deletion study of ERβ1 and
site-directed mutagenesis of Tip60
105 Table 3.2 Primers used in the experiments of quantitative RT-PCR and ChIP
real-time PCR
13
List of Abbreviations
Abbreviations Expansions
5’RACE 5’ Rapid amplification of cDNA ends a.a Amino acid
AF-1 Activation function 1
AF-2 Activation function 2
AP-1 Activator protein 1
API Apigenin
BCa Breast cancer
Bcl-2 B-cell lymphoma 2
Bcl2L12 Bcl2-like 12
BPA Bisphenol A
BPH Benign prostatic hyperplasia
Caspase Cysteine-aspartic protease
CDDP Cis-diamminedichloroplatinum(II)
ChIP Chromatin immunoprecipitation
COMT Catechol-O-methyltransferase
CXCL12 Chemokine (C-X-C motif) ligand 12
DAI Daizein
DBD DNA-binding domain
DFS Disease free survival
DHT Dihydrotestosterone
14
Dox Doxorubicin
DPN Diarylpropionitrile
E1 Estrone
E2 17-β estradiol
EQ Equol
EGFR Epidermal growth factor receptor
ERα Estrogen receptor alpha
ERβ Estrogen receptor beta
ERK Extracellular signal regulated kinase
FACS Fluorescence-activated cell sorting
GAPDH Glyceraldehyde 3-phosphate dehydrogenase
GEN Genistein
GRIP1 Glucocorticoid receptor interacting protein 1
GST Glutathione S-transferase
GSTP1 Glutathione S-transferase M1
HD Hinge domain
IP Immunoprecipitation
LBD Ligand-binding domain
MAPK Mitogen activated protein kinase
NFκB Nuclear factor kappa-light-chain-enhancer of activated B cells
NPrEC Normal prostate epithelial cell line
OS Overall survival
15
PARP Poly ADP ribose polymerase
PCa Prostate Cancer
PI3K Phosphoinositide 3-kinase
PIN Prostatic intraepithelial neoplasia
POM Postoperative survival
RALO Raloxifene
RFS Relapse free survival
ROS Reactive oxygen species
SERM Selective estrogen receptor modulator
Sp1 Specificity protein 1
SRC1 Steroid receptor coactivator 1
TAM 4-hydroxy-tamoxifen
TF Transcription factor
Tip60 Tat-interactive protein 60kDa
uORF Upstream open reading frame
UTR Untranslated region
16
Chapter 1: General Introduction
The Development of Prostate Cancer
Prostate cancer (PCa) is the most common cancer in men apart from skin cancer in America.
Moreover, it is the second-leading cause of cancer-related death in men (1). PCa is classified as
adenocarcinoma, which is a cancer originated from the epithelium of glandular tissue (2). The
development of high-grade prostatic intraepithelial neoplasia (PIN) is considered to be the precursor of
PCa, but not other abnormal development of prostate, such as benign prostatic hyperplasia (BPH),
atypical adenomatous hyperplasia (AAH) or proliferative inflammatory atrophy (PIA) (3,4). It is
because cells of PIN and PCa possess similar morphology, genetics and expression of biomarkers (5).
PIN is defined as neoplastic transformation of prostatic secretory lining, acini and ducts (4), while it is mainly localized at the peripheral area of the prostate (6). Moreover, they are both multifocal and found in the same gland and similar localizations (7). High-grade PIN was shown to be more frequently detected in the malignant prostate (8). It is characterized by continuous proliferation of epithelial cells with large nuclei and distinguished nucleoli with ducts and acini (4). The proliferation of epithelium is different between high-grade PIN and benign region. Basal-cell compartment undergoes proliferation in benign epithelium, whereas the proliferation in high-grade PIN is normally at the luminal side of ducts and acini (9).
When high-grade PIN gradually progresses to carcinoma, the basal cell layer of prostate gland is disrupted and cancerous epithelial cells start to invade the stroma (10). Moreover, the density of microvessel increases during PCa progression and metastasis (11,12). If PCa is originated from the high- grade PIN, its foci consist of dense and pseudo-stratified epithelium (13). Similar to high-grade PIN,
PCa is multi-centric and found in the peripheral region of prostate gland. The cancerous cells are highly
proliferative, undergo oxidative stress and lose contact with extracellular matrix and the membrane of
17
basal cell (14,15). At the early stage of PCa, different sized infiltrating tumor glands are present between benign regions. Cancerous glands gradually lose the expression of basal cell markers. Moreover, characteristics of low-grade PCa such as perinuclear invasion and extraprostatic extension can be found
(16). When PCa progresses to higher grade, the glands are still discrete but their lumina are hardly recognizable. Some of the high-grade PCa (Gleason grade 4) are small glands with irregular contour, whereas large cancer foci with round and regular contour are also graded as Gleason pattern 4 (16). At the later stage of PCa, cancerous glands are not only lined by columnar epithelium and elongated lumina, but are also found with intraluminal necrosis. They should be considered as Gleason grade 5
PCa (16). During the advanced stage of PCa, cancerous cells detach from malignant tumor, travel blood circulation or lymphatic system, and metastasize to other parts of body, such as bones, brain, liver, lungs and lymph nodes. Moreover, rectum, bladder and lower ureters may be other targets of PCa metastasis
(17).
The Relationship between Prostate cancer and Estrogens
PCa is considered to be hormone-induced cancer. The normal and malignant developments of prostate require male sex hormone, androgens (18). However, increasing evidence shows that another sex hormone, estrogens, is also responsible for PCa pathogenesis. Epidemiologic studies clearly show that the incidence of PCa in western countries is higher than that in Asian regions. It can be explained by the difference in the level of estrogens among various geographical locations and races. People in North
America and Europe possess higher incidence of PCa than those in Asia and South America (1,19). For example, Japanese men were shown to have lower level of circulating estrogen and also PCa incidence compared with Dutch men (20). Moreover, higher level of estrogen and the PCa incidence rate was found in African-Americans than Caucasians in America (1,21,22). In a global analysis, African-
18
American and African old men had higher levels of estrogens compared with Caucasian and Asian men
with similar ages (23). In addition, a positive correlation between the level of estrone (E1) and PCa incidence rate was established in a cohort of men with the average age over 70 years old (24). Thus, the influence of estrogens in middle-aged men on the PCa risk cannot be neglected.
Estrogen normally exerts its function through binding to its receptors (see below). However,
its metabolites may also relate to the carcinogenesis of prostate. Natural estrogens, including estrone
(E1) and estradiol (E2), can be metabolized to 2- and 4-hydroxyl catechol estrogens, which
intermediates act as chemical carcinogens (25). The carcinogenicity of these intermediates is due to their
ability of forming DNA adducts and causing genetic damage (26). They are also able to induce oxidative
stress through promoting the formation of reactive oxygen species (ROS), which damage nucleic acids,
proteins and lipids (27). These estrogen-derived carcinogens are generated through the enzymatic action
of CYP1A1 and CYP1B1. In addition, estrogen can be produced in situ from androgen by aromatase
(28); thus, the use of aromatase inhibitors as the treatment of PCa has been tested in clinical trials
(29,30). In contrast, the catechol estrogens can be reversibly inactivated by catechol-O-
methyltransferase (COMT) (31-33). Moreover, the methoxyestrogens produced by COMT were shown
to possess apoptotic activity in PCa cells and they may be new anticancer agents for PCa (34).
Estrogens exert its effects on the pathogenesis of PCa in men during their middle age as well
as early life. "Estrogen imprinting" can determine the PCa risk through the early-life exposure to
estrogenic compounds. In the animal-model studies, different adverse outcomes were present in mice
and rats under the perinatal and neonatal exposure of estrogenic compounds, including stromal
hypertrophy, inflammation and an increase in the proliferation of epithelium of the adult prostate (35-
37). Our previous study showed that the exposure of E2 or an environmental estrogen bisphenol A
(BPA) during the developmental stage of rats sensitizes the prostate to estrogen-induced carcinogenesis
19
of prostate in adulthood (38). Additionally, this early-life exposure of estrogenic compounds epigenetically modifies methylation status of the promoter of Pde4D4 which regulates the breakdown of cAMP (38). Although the evidence for "estrogen imprinting" of PCa risk in human lacks, some epidemiologic findings are consistent with the results in animal models. African-Americans possess higher PCa risk than Caucasians, while African-American pregnant women are found to have higher level of circulating estrogen (39). Newborn babies with high birth weight and jaundice, which are characteristics of pregnant women with high estrogen level, are associated with increased PCa risk
(40,41). To conclude, PCa risk can be affected as early as the perinatal stage. Therefore, the early exposure of estrogen, such as intake of high estrogen-level medication during pregnancy, maternal and infant use of BPA-containing products should be avoided.
The Development of Breast Cancer
Breast cancer (BCa) is the most common cancer in women apart from skin cancer in America and also the second-leading cause of cancer-related death in women (1). BCa is also classified as adenocarcinoma. Unlike PCa, BCa is classified from stage 0 to IV. The stage of the cancer is determined by several criteria, including the size, invasiveness, lymph node status and the metastatic status of cancer. At the stage 0 of BCa, tumor cells are non-invasive and confined to the original position of breast tissue. Cells grow abnormally at the milk duct or lobules of the mammary gland and so the stage is known as ductal carcinoma in situ (DCIS) or lobular carcinoma in situ (LCIS) (42). DCIS is a very early stage of BCa and may be described as precancerous stage which is highly curable (43). When BCa progresses to stage I, the malignant cells start to invade the surroundings of mammary gland apart from duct lining. However, those cells still have not migrated to other organs beyond the breast tissues. There are two sub-stages known as stage IA and IB. At stage IA, tumor size is less than 2 cm in diameter and
20
no tumor cells are found in lymph nodes. The patients with stage IB BCa possess small clusters of
cancer cells smaller than 2 cm in lymph nodes, whereas tumors may or may not be present in breast
tissues (44). Without proper treatment, BCa gradually progresses to invasive stage II cancer. Similar to
stage I, stage II of BCa is divided into two sub-categories. They are categorized by the presence of breast tumor (more than 2 cm but smaller than 5 cm in diameter) and cancer cells in axillary lymph nodes (44). When BCa progresses to stage III, cancer cells become more invasive and are found more commonly in lymph nodes (45,46). Nonetheless, cancer cells have not yet spread to other distant organs.
There are three sub-categories of stage III BCa, which are identified by their increased size of primary
tumor at the breast tissues and also higher number of axillary lymph nodes with cancer cells present
(47). Finally, when BCa progresses to stage IV, tumors are not only found in mammary gland and nearby lymph nodes, but also metastasize through blood circulation system and lymphatic system to
other parts of body, such as brain, lungs, liver, bones, and distant lymph nodes (48).
The Relationship between Breast Cancer and Estrogens
Estrogens are suspected mammary carcinogens (49). The elevated level of estrogen
positively associated with the risk of BCa is extensively studied (50,51). The concentration of estrogen
in malignant breast tissue was shown to be higher than that in non-malignant tissue (52). Moreover,
much higher level of estrogen in mammary tissue compared with its circulating level implies that local
production of estrogen in breast may be responsible for BCa risk (31). A number of risk factors
contribute to the increase in endogenous estrogen level in women. One of the well-studied factors is
obesity. The increased activity of adipose-associated aromatase leads to higher production of estrogen in
situ in the adipose tissue of breast (53,54). Aromatase is also able to convert androgens, such as
21
testosterone and androstenidione, to estrogens; thus, higher level of circulating androgens also
contributes to increased BCa risk (55).
Several mechanisms of BCa tumorigenesis induced by estrogen have been proposed (56,57).
First, estrogens upregulate estrogen receptor α (ERα)-mediated transcriptional activity and thus increase the proliferation of mammary cells. Expression of ERα is consistently high in proliferative cells of atypical ductal hyperplasia (ADH), lobular in situ neoplasia (LIN), ductal carcinoma in situ (DCIS) and advanced stages of BCa (58). Moreover, estrogen-bound ERα was shown to increase the transcription of numerous genes involved in cell proliferation and survival, inhibition of apoptosis, eventually leading to uncontrolled cell division and growth and mammary tumorigenesis (59,60). Besides the classical E2-
activated genomic pathways, ERα has extensive crosstalk with other signaling pathways, such as
epidermal growth factor receptor (EGFR), mitogen-activated protein kinase (MAPK) and
phosphoinositide 3-kinase (PI3K) (61-63). ERα utilizes these signaling cascades to exert physiological
effects on BCa cells through rapid E2-mediated non-genomic pathways. However, another ER subtype,
ERβ, is dominant in normal breast tissues and able to antagonize the activity of ERα (64,65). The
structure and molecular actions of different ER subtypes were described in details in the subsequent
sections of introduction.
Estrogens can also be metabolized to genotoxic catechol estrogens which stimulate the
production of ROS causing genetic damage. In addition, estrogen-induced ROS are able to regulate the
enzymatic activities of redox signaling which consequently favor the carcinogenesis (57). Similar to
their effect on prostate carcinogenesis, estrogens and their catechol metabolites are also potential
carcinogens of mammary gland (51,66,67). Estrogens and different estrogen metabolites were shown to
cause neoplastic transformation of non-tumorigenic mammary cell line, MCF-10F (68), oxidative
damage to BCa cell lines (69,70) and tumor development in animal models (67,71). Moreover,
22
epidemiologic studies of the correlation between BCa risk and polymorphisms of genes involved in
estrogen biosynthesis or metabolism provide evidence for the role of estrogens and their metabolites in
mammary carcinogenesis (72,73). For example, polymorphisms of estrogen biosynthesis genes CYP17
and CYP19 can increase the gene expression and are associated with higher BCa risk (74-76). CYP1A1
and CYP1B1 catalyze the oxidative metabolism of estrogens to 2-hydroxylcatechol estrogen, which is
chemical carcinogen (32,77). Genetic polymorphisms in their genes may cause the increase in the
enzymatic activity and correlate with increased BCa risk (73,74,78). In contrast, COMT and glutathione
S-transferase M1 (GSTP1) inactivate estrogen metabolites. The polymorphisms which lead to the
decrease in their activity are positively associated with BCa risk (73,79,80).
Structure and molecular actions of estrogen receptors and the role of estrogen receptor β in
prostate and breast cancer
Structural features of estrogen receptors
In humans, effects of estrogen are mainly mediated through estrogen receptors (ERs), which
are divided into two subtypes, ERα and β1 (81,82). They are respectively encoded by different genes,
ESR1 and ESR2, which are located on different chromosomes. ESR1 is located on chromosome 6 and is
about 66kDa, while ESR2 is located on chromosome 14 and the molecular weight of protein is about
60kDa (82-85). ERs belong to nuclear receptor family and act as transcription factors (TFs) to control
the expression of target genes (86).
ERα and ERβ1, similar to other hormone receptors, possess same arrangement of structural
domains (Fig. 1.1). The receptors include activation function 1 (AF-1), DNA-binding domain (DBD),
hinge domain (HD), ligand-binding domain and activation function 2 (AF-2) sequentially (87-89). One of ERs' functions is activate the transcription of target genes by binding to estrogen responsive elements
23
(EREs), which are found in promoter regions of target genes or in distant cis-regulatory sequences (90).
Since their DBDs are highly homologous with 97% amino acid (a.a.) identity, they are able to bind to
similar cis-regulatory sequences to activate the transcription (87-89). Studies are limited about the role of HDs which are not conserved and only with 30% a.a. identity. HD was shown to be related to nuclear translocation of ERs (91) and recently found to be important for the synergy between AF-1 and AF-2 domains to respond to estrogen-mediated action (92). Moreover, their dissimilar AF-1, LBD and AF-2 domains lead to functional disparities. When LBD and AF-2 domain bind to agonists or antagonists, the ligands change the position of AF-2 domain's helix 12 and thus modify the structure of ERs' C-termini.
The conformational change can affect the interaction between ERs and different co-regulators (93,94).
For example, binding of agonists recruits coactivators to receptors but inhibits the interaction between corepressors and ERs. Activated ERs function as TFs to transcribe their target genes (93). On the other hand, antagonists alter the structure of LBD and AF-2 domain to be unfavorable for interacting with coactivators and so inactivate ERs (94). Since LBD and AF-2 domain of ERα and ERβ1 only share about 56% and 30% a.a. homology respectively, two ERs have differential binding affinities for various agonists and antagonists (95-97). Apart from C-terminus, N-terminal AF-1 domain is the most variable region between ERs and recruits coregulators to activate or inhibit ERs in a ligand-independent manner
(98). The distinct roles of ERα and ERβ1 may be due to their specific recruitment of coregulators and availability of ligands in various cell types, leading to the utilization of different signaling pathways and thus their functional divergence (99-101).
24
Fig. 1.1 Structural domains of estrogen receptors.
Signaling pathway of ERs
ERs have diverse biological functions which are mediated by several distinct signaling pathways. Typically, estrogen signaling is mediated by ligand-bound ERs. The active ERs then dimerize, interact with other coregulators and bind to EREs to regulate the gene expression (102).
Moreover, ERs are able to act in cis with other nearby TFs such as p53 and Sp1 to regulate transcription
synergistically (103,104). Apart from binding to DNA sequences, ERs exert their functions through
interacting with other TFs and act as their “coregulators”. For example, ERs form transcriptional
complex with Sp1 and AP-1 to promote the transcription (60,105-108). Although activation of
transactivation at ERE and Sp1 sites by ERs requires estrogen (105,109), antiestrogens or selective ER
modulators (SERMs) act as agonists of ERβ to activate the AP1-mediated transcription (106,108).
Nonetheless, estrogens, but not antiestrogens and SERMs, is required to activate ERα at AP-1 site (108), implying that ligands initiate distinct cellular responses in the presence of different ER subtypes.
25
Moreover, the activity of ERs is tightly controlled by coregulatory proteins (110). Although ERs share many common coregulators, the differential interaction between these coregulators (coactivators and corepressors) and ERs are also responsible for their distinct functions (111); thus, the interplay between the binding of ligands and coregulators is the key to regulate the activation of receptors. In our study, we explored the functional relationship between ERβ1 and Tip60. Tip60 is a well-studied ERα coactivators and acts as an acetyltransferase. It enhances ERα transactivation at ERE sites (112,113) and thus increases the expression of certain ERα target genes in an E2-dependent manner (113,114). In contrast, we found that Tip60 was able to interact with ERβ1 in the absence or the presence of E2. It either enhanced or inhibited ERβ1 transactivation, depending on the cis-regulatory sites. Moreover, the transactivation at the AP-1 site was synergistically augmented by Tip60 and another ERβ1’s coactivator,
GRIP1. We also showed that ERβ1 is not a substrate of acetylation by Tip60 and thus that the regulation of ERβ1 activity by Tip60 is independent of its (histone acetyltransferase (HAT) activity. In conclusion,
Tip60 is the first identified dual coregulator of ERβ1, which transactivation is differentially regulated in a regulatory element–dependent manner. The details of this study can be found in the chapter 2 of my
thesis.
Many signaling pathways of ERs are activated by ligand binding. However, they were shown
to function in ligand-independent pathways. One of the most characterized ligand independent activation
is mediated by growth factor signaling (115). Epidermal growth factor and insulin growth factor are able
to activate MAPK and so ERα through phosphorylation (115). Moreover, the kinase phosphorylates ERβ
to enhance the interaction between ERβ and co-activator SRC1 and thus stimulate its transactivation
(116). Osmotic shock can also lead to activation of p38 kinase (117) which phosphorylate ERβ (118).
Although ERs normally function as TFs in nucleus to transcriptionally control gene expression, they can
mediate estrogen signaling through non-genomic pathways. ERs were found to be localized at plasma
26
membrane (119,120), mitochondrion (121,122) and cytoplasm (123-125) apart from nucleus (126). They are able to exert rapid effects in these compartments through activation of other cellular responses, such as regulation of ion channel activity (123,127) and kinase signal cascade (124,128,129). In conclusion, multifarious molecular pathways are involved in the action of ERs. ERs not only function in estrogen- mediated genomic pathways, but also ligand-independent genomic and non-genomic signaling. The discovery of ERβ isoforms, which are assumed to be ligand-insensitive or have low ligand-binding affinity (130), renders us new directions of exploring novel signaling pathways of ERβ isoforms.
Effects of different Ligands on the Activity of Estrogen Receptors
The distinct functions of two ERs can be explained by their differential interaction with
various ligands. E2 and diethylstilbestrol (DES) activate ERα-mediated transcription at the AP-1 site but
inhibit the transcriptional activity of ERβ1. Thus, typical agonists of ERβ1, such as E2 and DES may act
as negative regulators of ERβ1-regulated genes which possess AP-1 binding sites (108). By contrast,
antiestrogen (e.g. ICI182780) and SERMs (e.g. tamoxifen (TAM) and raloxifene(RAL)), which
inhibited ERβ1 activity at ERE sites, act as the transcriptional activators of ERβ1 at AP-1 sites
(108,131).
Since ligands differentially regulate the activities of ERα and β1, we can expect that unique
sets of target genes can be activated through binding of different ligands to ERs. Genome-wide
microarray analysis of E2- or SERMs-bounded ERα and β1 showed that there was little overlapping of
genes regulated by E2, tamoxifen and raloxifene (132). Moreover, chromatin immunoprecipitation
(ChIP)-chip experiment also revealed that tamoxifen and raloxifene regulate larger amount of genes than
E2 (133). Although the magnitude of activation by tamoxifen-bounded ERα was stronger than ERβ1,
raloxifene was more effective for gene activation in the presence of ERβ1 (133). The conformational
27
change elicited by the SERMs might lead to different binding affinities of ERs to the DNA sequences and also coregulators (134). On the other hand, ERβ1, but not ERα, can also be an active transcription factor in the absence of ligand. Recently, large number of cis-regulatory regions of ERβ1 regulated genes was found to be occupied by both ERβ1 and AP-1 in a BCa cell line MCF-7, while ERβ1 was recruited to the chromatin of these genes in the absence of ligand (135). Another study showed that unliganded ERβ1 regulates large number of genes, which the AP-1 binding sites are particularly enriched in their regulatory regions (136). These studies reveal that unliganded ERβ1 is important for mediating the transcription of certain genes, especially those possessing AP-1 motifs.
Besides altering the conformation of ERs, ligands also modulate expression of ER transcripts and the turnover rate of their proteins (137). For example, E2 and a phytoestrogen, genistein (GEN), induced the expression of ERβ1 and differentially regulate the transcript level of ERβ isoforms in different BCa cell lines (138). On the other hand, the degradation of ERs and their transcriptional activities are inter-dependent on each other (139). After each round of transcription, ligand-bounded
ERα is ubiquitinated and then releases from the promoter. This allows the next activated ERα to reside on the promoter to continue the transcription (140). Similarly, proteasomal degradation of ERβ1 is E2- dependent and so its activity is tightly controlled by E2 level. The trigger for its degradation by the reduced level of circulating E2 leads to the decrease in transcriptional activity (141). Moreover, the protein level of ERβ1 was found to be differentially regulated by its ligands. Although E2 and BPA are both considered as the agonists of ERs, they have opposing roles in regulation of ER degradation (142).
BPA is inhibitory to the proteasomal degradation of ERβ1 but not ERα (142).
Protein-protein Interaction of Estrogen Receptors
28
Apart from homo- or hetero-dimerizing with other ER subtypes, ERs can mediate the estrogen signaling by interacting with other transcription factors, such as AP-1, CREB, NFkB, p53,
RUNX1, SP-1, and STAT5 (60,105,106,143). These interactions allow ERs to regulate the transcription
via the classical or non-classical pathway by acting as tethering factors to other non-ERE sites.
However, only small amount of genes (about 20%) are commonly regulated by both ERα and ERβ. One of the reasons may be their differential binding affinities to other transcription factors (144,145).
Besides binding to transcription factors, most of the interacting partners shared by two ER isoforms are the coregulators. Different strength and specificity of ER-coregulator interactions on DNA binding sequences confer the functional diversity of the two receptors. Most coregulators possess enzymatic activity and post-translationally modify ERs. They may contain acetyltransferase domain
(SRC1, TIF2 and ACTR) (146-148), bromodomain (e.g. CBP, p300 and TRIM24); methyltransferase
domain (e.g. CARM1 and PRMT1); or SANT domain (e.g. SMRT and NCoR) (110,149). Moreover,
other ER-binding proteins can affect the differential interaction of ERs with coregulators. Cyclin D1 can act as a bridging factor between ERα and SRC1 in a ligand-independent manner (150). Although SMRT
is a corepressor of many hormone receptors (151,152), it can interact with the coactivators SRC3 to
synergistically enhance transcriptional activity of ERα (153).
The interplay between the binding of ligands and coregulators to ERs also determines the
activity of receptors. ER agonists change the conformation of LBD of ERs, rendering the AF-2 domain
favorable for the binding of coactivators, whereas antagonists do the reverse (154). SRC1, which potentiates ERα activity with E2, can upregulate ERβ1 activity in the absence or presence of the ligand
(155). GEN can induce binding of ERβ1 to SRC1 and TIF2 (155). Although ERα and ERβ1 preferentially bind to their coactivator SRC1 in the presence of E2, they interact with their corepressor
SMRT, which reduces the transactivation in the presence of TAM (156,157). Moreover, TAM induced
29
the interaction between SRC3 and ERα and increased the recruitment of SRC3 to ERE (158). In addition
to ligands, cis-regulatory sequences determine the interaction between ERs and coregulators by acting as allosteric modulator to alter the conformation of ERs (159,160). The strength of interaction between unliganded ERs and different coregulators is in an ERE-dependent manner (111,161). When ERβ bound to the ERE sites, both TIF2 and SRC3 were differentially recruited to ERβ1 due to the change in the conformation of ERβ1 (162).
Although ERα and ERβ1 share many common coregulators, the differential transcriptional responses between them can also be explained by the interaction with their unique interacting partners at specific DNA-binding regions. However, there are very few ER-isoform-specific interacting partners identified due to the similarity of their structural domains. A large-scale interaction study of ERβ1 has recently utilized affinity purification followed by liquid chromatography electrospray ionization tandem mass spectrometry (LC-MS/MS) (163). About 300 proteins were isolated in the study. Apart from those
previously isolated coregulators, such as SRC3, PELP1, TRIM24, MED1, proteins involved in post-
transcriptional modification of mRNA and actin filament-based processes were identified as ERβ1
binding partners. It was also shown to interact with proteins related to ribosome organization and
synthesis, mitochondrial protein homeostasis (163). Some apoptotic proteins, including MRPS29 and
BCLAF1, were isolated, revealing the pro-apoptotic role of ERβ1 (164,165). Similar approaches have
been applied by another group to identify different ERβ1-interacting proteins in cell- and ligand-
dependent manners (166). Some binding partners, such as heat shock proteins (Hsp60 and Hsp70),
EGFR, vimentin, histones and calmodulin were isolated in E2-proliferative H1793 and non-E2-
proliferative A549 lung cancer cell lines. In addition, BRCA1 interacts with ERβ1 only in cancerous cell
lines, but not in normal tissues (166).
30
Post-translational Modification of Estrogen Receptors
Post-translational modification (PTM) is defined as the addition of biochemical functional group to amino acids of a protein, such as phosphorylation, acetylation, methylation, nitrosylation, ubiquitination, etc (167-169). PTMs modulate the activity and stability of ERs, leading to the divergent gene regulation in a cell-specific manner (167). Although PTMs of ERα are extensively studied in human, limited information is available for ERβ1. The related studies of ERα in human or findings of
ERβ1 in mouse may give us insights into the effect of PTMs on the functions of ERβ1 in human.
Phosphorylation is the most commonly studied PTMs of ERs. About 7 a.a. residues have been found to be the phosphorylation sites of ERα (170). Phosphorylation of ERα is always associated with an increase in its transcriptional activity (167). While phosphorylation of ERα is mediated through a number of kinase pathways, such as MAP kinase (MAPK), cyclin-dependent kinase (CDK) and protein kinase B (Akt) pathways (171,172), possess the stability and transcriptional activity of phosphorylated ERα are differentially regulated in a ligand-dependent manner (12855746).
Phosphorylation by Akt can inhibit the dimerization and DNA-binding ability of ERα, whereas the inhibition is suppressed in the presence of E2 (173). With regard to ERβ1, our previous findings showed that phosphorylation of ERβ1 at S105 by either extracellular signal regulated kinases (ERKs) or p38 kinase can inhibit migration and invasiveness of BCa cells (118). S105-ERβ1 phosphorylation also correlated with better survival of BCa patients, even for tamoxifen-resistant group (174). In addition, phosphorylation of ERβ1 at S87 by CXCL12 via ERK1/2 pathway may contribute to the increase in its transcriptional activity and thus the expression of its target genes in BCa cells (175). The studies of
ERβ1 phosphorylation in mouse also reveal the importance of this PTM for regulating its functions.
Two phosphorylation sites at the N-terminus of mouse ERβ1 were identified to be essential for the ligand-independent recruitment of its coactivators, SRC1 and CREB-binding protein (CBP) (116,176).
31
Moreover, phosphorylation of ERβ at other a.a. residues promoted its ubiquitination and so the
proteasomal degradation, revealing that the stability and activity of ERβ1 are regulated by the interplay
between different PTMs (177).
As mentioned above, protein degradation of ERs through ubiquitin-proteasome pathway can be modulated by ligands. After each round of transcription, ligand-bounded ERα is ubiquitinated and then releases from the promoter for protein degradation (140), while ERβ1 expression and its activity are also controlled by proteasomal degradation (141). A number of proteins involved in ubiquitin- proteasome pathway, such as SUG1 (178), E6-AP (179), Ubc4 (180) and Ubc9 (10383460) were ER- interacting proteins. Ubc4 increases ubiquitylation and proteasomal degradation of ERα, whereas it enhances ERα binding to promoter and so increases the transcriptional activity of ERα (180). The recruitment of E6-AP and an ubiquitin ligase Mdm2, which are important for proteasomal degradation pathway, is regulated by phosphorylation of ERα at S118 (181). SUG1 interacts with ERα and β1 in an
E2-dependent manner. It facilitates the ubiquitylation and so the proteasomal degradation of both ERs
(142).
S-nitrosylation occurs at the cysteine residue of ERs. Compared to other PTMs, studies of S- nitrosylation in ERs are limited. However, estrogen is able to induce the production of nitric oxide (NO) and S-nitrosylation of other proteins (182,183). ERβ1, but not ERα, was shown to be the mediator of E2- induced S-nitrosylation of other proteins (184,185). A study reveals that S-nitrosylation of ERα leads to a decrease in binding to ERE sites and this may favor the non-genomic signaling pathways of ERα
(186). Recently, our lab has utilized mass spectrometry analysis to identify 3 possible S-nitrosylation sites of ERβ1 and showed that NO modulates its transcriptional activity (unpublished data).
Acetylation always occurs at the lysine residues of a protein (187). Several acetylation sites have been identified in ERα (188,189). Acetylation of ERα at different sites differentially regulates the
32
activity of ERα. The p300-mediated acetylation at K266 and K268 of ERα results in an increase in DNA binding at ERE sites and thus the transcriptional activity of ERα (189). However, the acetylation at
K302 and K303 inhibit its ligand sensitivity (190). Moreover, phosphorylation of ERα at S305 prevents the acetylation at K303 and enhances the estrogen sensitivity of receptor (191). By contrast, many coregulators of ERβ1, including SRC1, SRC3, CBP and p300, possess HAT activity, but none of them was shown to acetylate ERβ1 (106,116,189,192). Acetylation of nuclear receptors is always found at a conserved motif “K/R-X-K-K” (187), which is absent in ERβ1. Tip60, which is an acetyltransferase, is unable to acetylate ERβ1 as shown in the chapter 3 of my thesis. My study and previous findings may reveal that ERβ1 is not post-translationally modified through acetylation.
The Roles of Estrogen Receptor β in Prostate and Breast Cancer
The expression of ERβ1 is gradually lost at the primary site during PCa progression (193-
196), whereas it is re-expressed in bone and lymph nodes in PCa metastasis (197,198). It has been extensively studied about its inhibitory role of proliferation and survival in prostate epithelial cells. In an in vivo study, BPH was developed in the ERβ1 knockout mice (199). Moreover, it was also shown to be proapoptotic in BPH and PCa. ERβ-specific agonist induces apoptosis via extrinsic apoptotic pathway in mouse xenograft model and different prostate cell lines (200). ERβ1 inhibits cell proliferation by causing cell cycle arrest at G1 phase (201). The binding of ICI to ERβ also mediates anoikis of PCa cells, leading to the suppression of tumor growth (202). ERβ1-specific ligand, 3beta-Adiol, was able to reduce the proliferation rate of PCa cells (101). The loss of ERβ1 expression leads to neoplastic transformation and PCa progression as shown in human prostatic clinical specimens (197). After the neonatal exposure of estrogen, ERβ1 expression was down-regulated followed by the development of neoplastic lesions in the prostate of rats (203). Although our previous findings showed that high
33
expression of ERβ is found in metastatic distant sites (197), a number of studies reveal that it may have
anti-metastatic role in PCa. The 3beta-Adiol-bound ERβ1 was shown to inhibit epithelial-mesenchymal- transition (EMT), which is an initial step of metastasis (204). Another group also reported that ERβ1 can be activated by 3beta-Adiol and responsible for the decrease in cell migration and invasiveness in PCa cell lines and xenograft model (101,205).
ERβ1 is the dominant subtype of ERs in normal breast tissue and localized at the nucleus of myoepithelial, stromal and endothelial cells and in lymphocytes (64,206). Similar to its role in PCa, ERβ possess tumor suppressor functions in BCa. Its expression correlated with longer survival of BCa patients and also better response to hormonal therapy, such as tamoxifen treatment (186,207-209). It
also sensitizes BCa cell lines to TAM-induced antiproliferation (210,211). Since ERβ1 heterodimerizes
with ERα and antagonizes the transcriptional activity of ERα, it can suppress the proliferative effect
exerted by ERα (212,213). It also inhibits the proliferation of BCa cell lines and also tumor formation in
xenograft model by inducing cell cycle arrest and modulating the expression of proteins involved in cell
cycle (214-216) , while its inhibitory effect is E2-dependent (214,217,218). ERβ1 also suppresses the
tumor growth by decreasing proangiogenic factors, such as vascular endothelial growth factor (VEGF)
and platelet-derived growth factor beta (PDGFbeta), leading to the inhibition of angiogenesis around
tumor (219). Moreover, it inhibits the motility and invasiveness of BCa cells in a ligand-independent
manner (215,220). Interestingly, the functional roles of ERβ may also be dependent on the ERα status
and cellular context in BCa cells. It was shown to enhance cell proliferation and invasiveness of ERα-
negative BCa cell lines and stimulates metastasis in xenograft model in an E2-independent manner
(221).
ERβ Isoforms and their Relationship with Prostate and Breast cancer
34
Apart from the full-length ERα and ERβ, alternative splicing of ESR1 or ESR2 yields several isoforms respectively. There are two types of spliced isoforms of ERα. ESR1 can be alternatively spliced at the 5’ end of the coding sequence of ERα to form 5’ translated or untranslated sequence. In contrast, another type of splice variants is formed by the deletion of coding exons (exon skipping).
Several exon-deleted ERα isoforms were detected in different PCa and BCa cell lines (222-225). Since
they possess either in-frame or out-of-frame deletions within the coding exons, they may have neither
transcriptional nor dominant-negative activity (223). Nonetheless, one of the ERα spliced variants,
ERα∆5, has been found to express in tumor-adjacent prostate samples (21139866). Another isoform
ERα36 which is localized on plasma membrane can lead to inhibition of apoptosis and enhancement of
proliferation and metastatic factors (226). An AF-1-deleted isoform, ERα46, restores the cell
proliferation inhibited by tamoxifen (227). Thus, ERα splice variants may possess unique functions and
molecular pathways and contribute to the progression of PCa and BCa.
Similar to ERα, ERβ1 has been found to have different types of splice variants. Although
deletion of coding exons is not commonly found in ERβ transcripts, its splice variants are composed of
distinct 5’ untranslated exons or 3’ translated exons. Two major ERβ promoters, namely 0K and 0N,
were identified in prostate and mammary gland, while they possess different 5’-most untranslated exons,
0K and 0N (198,228-230). Interestingly, our current study and previous findings have discovered 8
untranslated exons termed exon 0Xs between exon 0K and 1 of ERβ transcripts in prostate and testis, but
not in other organs (230,231). We speculate that these exon 0Xs may be expressed specifically in male
reproductive tract. Our group not only found that different combinations of exon 0Xs are present in
normal and cancerous prostatic tissues, but we also showed certain combinations are only present in
ERβ isoforms, ERβ2 and 5, which have unique a.a. sequences at their carboxyl-termini. Moreover, exon
0Xs consist of upstream open reading frames (uORFs) which are able to repress protein translation post-
35
transcriptionally (232). Most importantly, our study suggests that expression of wild-type (ERβ1) is regulated primarily at the transcriptional level, whereas that of ERβ2 and ERβ5 is controlled by interplay between transcriptional and post-transcriptional regulation. The details of this study can be found in the chapter 2 of the thesis.
Alternative splicing at the coding exon 8 of ESR2 yields 5 different ERβ isoforms, namely
ERβ1 (wild-type), ERβ2 (ERβcx), ERβ3, 4 and 5. They were isolated and expressed in different organs, including prostate and mammary glands (130,233,234). Due to their unique sequences at LBD and AF-2 domain, they have drastic structural differences at C-terminus compared with ERβ1. The orientation of helix 11 and 12 at the C-terminus of ERβ1 allows the efficient binding of agonists (130). However, the sequences at the C-terminus of ERβ2 constitute helix 11 and 12 with different orientation, leading to low ligand-binding affinity. In addition, absence of helix 12 in ERβ4 and 5 is responsible for their estrogen insensitivity (130). Moreover, ERβ1 is the only fully functional transcription factor. The other ERβ isoforms do not form homodimers and have no transcriptional activities, but are able to modulate the activity of ERβ1 or ERα by hetero-dimerizing with them (130,235). The transcriptional activities of ERs are activated by interplay between binding of ligands and coregulators (235). However, ERβ isoforms are neither responsive to different ligands nor able to interact with coactivators of ERβ1, such as SRC1
(130). Although the exact roles of the isoforms have not been fully understood, increasing evidences show that functions of ERβ2 and 5 are distinct from those of ERβ1 in PCa and BCa.
Fig. 1.2 Genomic arrangement of wild-type ERβ1 and its isoforms, ERβ2 and β5. They are
formed by alternative splicing at the last coding exon (exon 8).
36
Our group used ERβ-isoform specific antibodies to reveal the differential expression of
ERβ1, 2 and 5 during PCa progression. Although the nuclear expression of ERβ1 was gradually lost
from prostatic intraepithelial neoplasia (PIN) to high-grade cancer, its expression restored in
metastasized lymph nodes and bones (198), suggesting that ERβ1 may be a tumor suppressor in
localized PCa but promotes metastasis at distant sites. In another study, ectopic expression of ERβ1 in a
PCa cell line, PC-3, correlated with the reduction of cell migration and invasion (20501637), its nuclear
expression was also associated with neither PCa progression nor metastasis-free survival of patients
(236). Our finding is consistent with that of Mak et al. showing ERβ1 inhibits epithelial-mesenchymal
transition (204). By contrast, the roles of ERβ2 and 5 are opposite to that of ERβ1 during PCa
progression. The expression of ERβ2 was negatively associated with survival of patients with PCa
(237). Nuclear expression of ERβ2 in tumors correlated with postoperative metastasis, shorter recurrence- and metastasis-free survival of patients as well as an increased expression of prostate- specific antigen (PSA). Its distinct function compared with ERβ1 was further confirmed by the increase in cell invasiveness in the same study (236). Moreover, the potential proliferative and pro-metastatic
properties of ERβ2 have recently been determined by an increase in cell proliferation and expression of
proliferation markers upon its ectopic expression (238). Nonetheless, studies about the function of ERβ5
are very limited. Our study showed that its cytoplasmic expression correlated with shorter metastasis-
free survival of patients with PCa (236). Similar to ERβ2, ectopic expression of ERβ5 also enhanced
migration and invasion of PC-3 cells (236). Based on these previous findings, ERβ2 and 5 are speculated
to play contrasting roles with ERβ1 in PCa.
ERβ1 has been widely documented to be antiproliferative and pro-apoptotic in BCa (239-
245). Although ERβ2 and 5 were shown to enhance the invasiveness of PCa cells, they may possess
different functions in BCa and be positively associated with better survival of patients with BCa.
37
Expression of ERβ2 was associated with poor prognosis of BCa (246,247), whereas other studies
revealed its positive correlation with survival of patients (248,249). Nonetheless, there are a number of
studies stating that ERβ2 expression does not have any correlation with any clinical outcome (209,250-
252). Although the clinical studies suggest enigmatic roles of ERβ2 in BCa, similar to the scenario in
PCa, the contradictory observations of those studies can be explained by the expression of ERβ isoforms
in different subcellular compartments. Nuclear expression of ERβ2 correlated with better disease free
survival (DFS) and overall survival (OS) of patients (253), whereas its cytoplasmic expression predicted
the worst survival outcome of patients (247,253). On the other hand, ERβ5 was shown to inhibit the
growth of tumor and correlated with better relapse free survival (RFS) of patients (254-256). Moreover,
Shaaban et al. showed that only its nuclear expression was positively associated with OS of patients
with BCa (253). The data suggest that ERβ5 may be a tumor suppressor during BCa progression. To
explore its functional role in BCa, we constructed ERβ5 stably expressed BCa cell lines. Unlike ERβ1, it
did not alter the proliferation of BCa cells. However, we showed that the ectopic expression of ERβ5 sensitized different BCa cell lines to apoptosis-inducing chemotherapeutic agents, such as doxorubicin and cisplatin. Moreover, we isolated Bcl2L12, which is a member of Bcl-2 family, to be an ERβ5- specific interacting partner. In contrast to ERβ5, Bcl2L12 was shown to be anti-apoptotic towards the drug treatments. We also revealed that the sensitization of BCa cell lines to doxorubicin and cisplatin by
ERβ5 is due to its inhibition of Bcl2L12-caspase 7 interaction, leading to the increase in the cleavage of caspase 7. The details of this study can be found in the chapter 4 of my thesis.
38
Chapter 2: Differential expression of estrogen receptor beta isoforms in prostate cancer through
interplay between transcriptional and translational regulation
Abstract
Estrogen receptor β (ERβ) and its isoforms have different putative functions and expression
patterns in prostate cancer. Current studies on 5′-most exons, 0K and 0N, show that their respective promoters are actively involved in transcription. These data, however, do not explain why ERβ isoforms are differentially expressed in normal and cancerous tissues, since 0K and 0N transcripts are detectable in clinical specimens. Various combinations of 5′ untranslated exons, termed exon 0Xs, associate with promoter 0K only and exon 0Xs accommodate upstream open reading frames (uORFs) reducing protein expression. Moreover, ERβ1, 2, and 5 are transcriptionally linked to promoter 0K; exon 0Xs are spliced only into ERβ2 and ERβ5 transcripts, suggesting that their expressions are regulated post- transcriptionally by exon 0Xs. This study reveals that expression of ERβ1 is regulated primarily at the transcriptional level, whereas that of ERβ2 and ERβ5 is controlled by the interplay between transcriptional and post-transcriptional regulation.
39
Introduction
Hormones are the indispensable factors in prostate carcinogenesis. Apart from androgen,
estrogen also determines the risk of prostate cancer (PCa) (257). Most estrogenic actions are mediated
by two estrogen receptor (ER) subtypes, α and β (82,83). In humans, ERα is not expressed in the
epithelial cells of the prostate where carcinogenesis takes place (193,195), whereas ERβ (referred to as
ERβ1) and its isoforms (130) are expressed at high levels in both basal and luminal epithelial cells in
unique topographic patterns in normal glands (130,197). During the development and progression of
PCa, ERβ1 expression is gradually lost at the primary site (236,258), supporting its proposed anti- proliferative or pro-apoptotic role in PCa cells (200,259). ERβ1 also represses epithelial-mesenchymal transition (EMT) (204), an initial step in metastasis. ERβ2 and ERβ5, in contrast to ERβ1, are found consistently in high-grade PCa and may be involved in promoting progression and invasion (236). Thus,
ERβ1 and its isoforms appear to be independently regulated by different mechanisms, including the alternative use of promoters and post-transcriptional regulation.
Studies of the prostate have revealed that ERβ transcripts are derived primarily from two promoters, 0K and 0N (198,229), although additional promoters (E1 and M) have been identified in other tissues (230,260). The promoters were named by the different 5′-most untranslated exons (0K and
0N) upstream of exon 1 (228,231). Promoter 0N has higher transcriptional activity than 0K in the prostate, and the two promoters are regulated differently (229). Promoter 0N can be silenced by DNA methylation (198,228) that targets a regulatory AP-2 site at its proximal CpG island (229). Promoter 0K has a CpG-rich region but is not the target of DNA methylation (228,229). We showed that ERβ1 is transcribed predominantly from promoter 0N (198,229); however, the contribution from promoter 0K is unclear. Furthermore, the promoter dependency of other ERβ isoforms in the prostate is currently unknown.
40
Differential expression of ERβ1 and its isoforms in the prostate may also be related to post-
transcriptional regulatory mechanisms, such as inhibition of protein translation by upstream open
reading frames (uORFs) (261), as reported in a study of breast cancer cells (230). An mRNA has
multiple uORFs, defined as sequences flanked by a pair of in-frame start and stop codons and within 5’
untranslated region (5’ UTR). Despite the ability of ribosomes to initiate translation at the start codon of
any ORF, attention was often paid to the protein translated from the longest ORF. In this regard, the
ORFs located 5′ of the coding sequence that do not contribute to the main protein expression are called uORFs. They have been shown to inhibit protein translation via mechanisms such as ribosome stalling, premature release of ribosome from the mRNA, and increased mRNA instability (232,261).
Our primary objective is to determine whether ERβ1 and its isoforms are differentially
regulated in the normal and malignant prostatic specimens. Our data show that ERβ1 and 2 are
transcribed from both promoter 0N and 0K, whereas ERβ5 is probably transcribed only from promoter
0K. In addition, we revealed that transcripts from promoter 0K harbor various combinations of
untranslated exons (0X1-8), some named by Hirata et al. as 0Xs (231). Exon 0Xs were shown to constitute a new regulatory mechanism of protein translation for various ERβs. In summary, our findings suggest that differential protein expression of ERβ isoforms is a result of the alternative use of promoters at the transcriptional level and the regulation by untranslated exons at the post-transcriptional level.
41
Materials and Methods
Cell lines and culture conditions
BPH-1, C4-2, DU-145, HEK293, LNCaP, PC-3, RWPE-1, and WPWY-1 were cultured in
ATCC-recommended medium and supplements (ATCC, Manassas,VA). Primary cell culture, PrEC, and immortalized NPrEC were maintained in keratinocyte serum-free medium (KSFM) (Life Technologies,
Carlsbad, CA). All the cell lines were grown with 5% penicillin/streptomycin at 37 °C and in 5% CO2.
5' Rapid amplification of cDNA ends (5' RACE)
Experiments were performed using GeneRacer (Life Technologies) and cDNA from PC-3 cells. The 5'RACE was performed using ERβ exon 1–specific primers. Procedures were the same as described in the manual. The sequences of primers used in the experiment are described in Table 1.
Plasmid construction
The DNA fragments, which were isolated in 5’ RACE experiments and encode exon 0N and different combinations of exon 0K and 0Xs, were gel-purified and subcloned to pCR2.1-TOPO vector
(Life Technologies). DNA sequencing reactions were performed by Macrogen (Seoul, Korea).
Amplicons generated from prostatic clinical specimens were also gel-purified, subcloned, and sequenced. Different combinations of exon 0N, 0K, and 0Xs sequences isolated from clinical specimens were subcloned into pGL3-Promoter vector (Promega, Fitchburg, WI).
In vitro translation study was facilitated by adding T7 promoter to the 5' end of the untranslated exons, which were cloned upstream of the luciferase gene in pGL3-Promoter vector, through PCR reactions.
42
Normal and cancerous human prostate samples
Fourteen pairs of human cancerous and matched non-cancerous prostatic tissues collected previously (Ouyang et al., 2011) were used in the study.
In situ RNA-RNA hybridization (ISH)
In situ RNA-RNA hybridization was performed on human prostate formalin-fixed paraffin-
embedded sections. Sections containing benign, prostatic intraepithelial neoplasia (PIN) or cancerous
prostatic tissues of different Gleason grades from six patient samples were used. Oligonucleotides
encoding the antisense sequence of exon 0K (35 bp) or 0N (36 bp) were annealed with T7 promoter
sequence at 95 °C. Digoxigenin (DIG)-labeled cRNA probes were synthesized using T7 RNA
polymerase according to the protocol (Roche Applied Science, Mannheim, Germany). Probe with
scrambled sequence was used as negative control (Exiqon, Vedbaek, Denmark). Sequences of the probes
are listed in Table 1. The detailed procedures were described in our previous study (262). Positive
signals were developed by incubating with BCIP/NBT substrate (Millipore, Billerica, MA); TSA DNP
(AP) system (Perkin Elmer, Hebron, KY) was used for the amplification of positive signals. Methyl
green (Sigma Aldrich, St. Louis, MO) was used for nuclear counterstaining. Pictures were captured with an Axiovert 200M fluorescent microscope and were analyzed with Axiovision 4.7 software (Carl Zeiss,
Oberkochen, Germany).
PCR amplification
Expression of exon 0K- or 0N-initiated ERβ transcripts in prostatic clinical samples was detected by PCR amplification. The primers used are listed in Table 1. RNAs were extracted by
TRIZOL reagent and were treated with DNase I (Life Technologies). cDNAs of prostatic clinical
43
samples were synthesized using Superscript III reverse transcriptase with oligo d(T) primers according to the manufacturer's protocol (Life Technologies). PCR reactions were performed using Platinum Taq polymerase (Life Technologies).
Nested PCR was used to amplify the regions between 5' UTR and ERβ isoforms. The cDNAs were synthesized with oligo d(T) primer and PCR reactions were performed with Platinum Taq polymerase. Touchdown PCR with annealing temperature dropping gradually from 68 °C to 55 °C was performed in the first and second (nested) round of PCR reactions. Primers used in the experiments are listed in Table 2.
Quantitative reverse transcription (RT)-PCR
The cDNAs were synthesized with random primers and Superscript III reverse transcriptase according to the manufacturer’s protocol (Life Technologies). Quantitative RT-PCR reactions were performed with SYBR Green qPCR SuperMix and ABI7900 real-time PCR system (Life Technologies).
GAPDH was used as the housekeeping gene. The ∆∆Ct method was used to calculate the relative expression levels. Primers used in quantitative RT-PCR are summarized in Table 1. The specificity of primers used in the amplification was determined by the presence of single-band products in gel electrophoresis. Moreover, a discrete peak for each primer pair was observed in melting curve analysis after quantitative RT-PCR.
Prediction of the secondary structure and stability of mRNAs
The modeling program RNA Folding Form (version 2.3 energies) from mfold web server
(RNA Institute, State University of New York at Albany) was used to predict the secondary structure
44
and stability during mRNA folding by thermodynamic methods (263). The algorithm predicts the
stability of mRNA through the free-energy change (∆G) during base pairing and structural folding (263).
Luciferase reporter assay
HEK293 and PC-3 cells were seeded in 24-well plates at 2.8 × 105 and 0.9 × 105, respectively. The pGL3-Promoter vectors containing full-length exon 0N, 0K or different combinations of 0K and 0Xs together with β-galactosidase (CMV-β-gal) were transfected using Lipofectamine2000
(Life Technologies) for HEK293cells or XtremeGene HP (Roche Applied Science) for PC-3 cells. After
48-h of transfection, cells were lysed with Glo lysis buffer (Promega) and luciferase activities were measured with the Bright-Glo luciferase kit (Promega). Normalization of the transfection efficiency was done by measuring β-galactosidase activity with the β-galactosidase assay kit (Promega). Each experiment was carried out in technical triplicates.
In vitro translation and western blotting
Plasmids containing T7 promoter at the 5’ end of exon 0N, 0K, and different combinations of
0K and 0Xs were respectively translated in vitro by the TNT T7-recticulocyte system (Promega). The pGL3-Promoter vector was used as a positive control. Three microliters of reaction products were subjected to SDS-PAGE and western blotting. Mouse monoclonal anti-luciferase (Sigma Aldrich) was used at a 1:1000 dilution. The protein bands were detected with IRDye secondary antibody, and the signals were obtained with the Odyssey Infrared Imaging System (LiCor Bioscence, St. Lincoln, NE).
Band intensities of luciferase in different lanes were measured by ImageJ analysis (NCBI, Bethesda,
MD).
45
Site-directed mutagenesis
Seven single-site mutations and one double-site mutation on the 0K0X2′-pGL3-Promoter construct were generated with the QuikChange lightning site-directed mutagenesis kit as described in the manufacturer’s protocol (Agilent Technologies, Santa Clara, CA). Primers for mutagenesis were designed through the QuikChange primer design program (Agilent Technologies) (Table 2). Briefly, the mutant-strand synthesis was done by PCR reaction with high-fidelity DNA polymerase and mutagenesis primers. The PCR product was treated with restriction endonuclease DpnI to digest the parental DNA template. The mutated single-strand DNA was transformed into competent cells and converted to duplex form in vivo.
Statistical analysis
Student's t-test was applied for statistical analysis with the use of QuickCalcs (GraphPad
Software, La Jolla, CA). All calculated P-values were two-sided, and P<0.05 was considered to be statistically significant.
46
Results
Different combinations of exon 0Xs exist between exon 0K and exon 1 of ERβ in the prostate
So far, four promoters (0N, 0K, and E1) have been shown to be associated with ERβ
expression (231,264). To investigate whether any new promoters are responsible for ERβ expression in the prostate, we performed 5' RACE with PC-3 cells, which is the PCa cell line with the highest expression of ERβ transcript (Fig. 2.1A) (130). Intriguingly, 5’ RACE products of various sizes were
amplified with the primers homologous to oligo adapter at 5’ end and the RACE primers complementary
to exon 1 of ERβ. The 5' RACE products were subjected to DNA sequencing (Fig. 2.1B). Exon 0K and
0N, but not E1, were identified at the 5' end of the ERβ transcripts (Fig. 2.2A). To investigate the
promoter usage of ERβ in PCa clinical specimens, we measured the expression of exon 0N and 0K using
qualitative PCR. Exon 0N was amplified in the majority of normal and cancerous tissues of 14 prostatic
samples (Fig. 2.1C, lower panel), whereas exon 0K was less commonly amplified (Fig. 2.1C, upper
panel), revealing that the transcripts from both promoters had different expression patterns. In some
normal and cancerous samples, PCR products larger than the predicted size (300 bp) between exon 0K
and exon 1 were observed (Fig. 2.1C, upper panel).
The amplicons obtained in 5’ RACE experiments and amplification from clinical specimens were cloned and subjected to DNA sequencing. Sequencing data revealed that eight untranslated exons, termed exon 0Xs, were inserted between exon 0K and exon 1 (Fig. 2.2A and B). Surprisingly, there were many different combinations of alternative splicing between exon 0K and 0Xs. Incomplete exon
0Xs, termed 0Xs', were formed by alternative splicing within exons and found in some promoter 0K-
initiated transcripts (Fig. 2.2A). Moreover, the alternative splicing leading to various combinations of
exon 0K and 0Xs was present in cancerous tissues (3 of 14) and adjacent normal counterparts (8 of 14)
(Fig. 2.1C, upper panel).
47
Promoter 0K and 0N are active in the transcription of ERβ in both normal and cancerous prostatic
tissues
Next, we used in situ RNA-RNA hybridization to determine the cellular localization of exon
0N and 0K’s expressions. By using oligonucleotide probes specific to exon 0K and 0N, we showed that both were expressed abundantly in the benign region, PIN lesion, and Gleason grade 3 cancer foci. Their expression decreased when PCa progressed to the higher grade (Gleason grade 5) (Fig. 2.3). These
results suggest that both promoter 0K and 0N actively contribute to the transcription of ERβ in normal
and cancerous prostatic tissues.
Promoter 0K and 0N differentially regulate the transcription of different ERβ isoforms
To investigate whether promoter 0K and 0N are responsible for the transcription of ERβ and
its isoforms in prostatic cells, we first determined the expression of exon 0K, 0N, and ERβ1, 2 and 5
among different prostate cell lines. Quantitative RT-PCR was performed to measure their relative
expression in normal prostate cells, such as PrEC, NPrEC, RWPE-1, BPH-1, and WPMY-1, and in PCa cell lines, such as DU-145, PC-3, LNCaP, and C4-2 (Fig. 2.4A). Expression of exon 0N was relatively higher in PC-3, LNCaP, and C4-2 (Fig. 2.4A, upper panel, left), whereas expression of exon 0K was relatively higher in RWPE-1, LNCaP, and C4-2 (Fig. 2.4A, upper panel, right). ERβ1, 2, and 5 were also differentially expressed in different cell lines. Expression of ERβ1 was relatively higher in NPrEC,
RWPE-1, and PC-3 (Fig. 2.4A, lower panel, left), whereas expression of ERβ2 was highest in PC-3 (Fig.
2.4A, lower panel, middle). ERβ5 were expressed strongest in BPH-1 (Fig. 2.4A, lower panel, right).
These data demonstrated that ERβ1, 2, and 5 had differential expression patterns, revealing that the extent of their use of the two promoters in the prostate may differ.
48
To determine which promoter regulates the transcription of ERβ1, 2, and 5, we performed
nested long-range PCR with primer pairs specific to exon 0K or 0N and exon 8 of each ERβ isoform
(Fig. 2.4B), because ERβ1, 2 and 5 possess unique sequences only in exon 8. The cDNA of PC-3 was
used, as it exhibits significant expression of these isoforms. The schematic diagram of the experiments is
shown in Fig. 2.4B. PCR products of the expected sizes were formed in the amplification of the
sequences between exon 0N and exon 8 of ERβ1 or ERβ2 but not ERβ5 (Fig. 2.4C, lower panel, left).
The absence of amplification was not due to poor primer design because the primer pair was able to
amplify promoter 0N-initiated ERβ5 transcript in the breast cancer cell line MDA-MB-231 (Fig. 2.4C,
lower panel, right), a finding consistent with that of another group (230). Moreover, BPH-1, which has
high expression of ERβ5 (Fig. 2.4A, lower panel, right), was used to demonstrate that promoter 0N- initiated ERβ5 transcript is absent in prostate cells (Fig. 2.4C, lower panel, left), suggesting that the splicing of exon 0N into the ERβ5 transcript is tissue-specific.
In contrast, DNA fragments of ERβ1, 2, and 5 were amplified with primer sets specific to exon 0K and respective ERβ isoforms in PC-3 (Fig. 2.4C, upper panel). A single band was detected for promoter 0K-initiated ERβ1 transcript, whereas multiple bands were amplified using exon 0K primer and isoform-specific primers of ERβ2 and 5, respectively (Fig. 2.4C, upper panel). Multiple PCR products were also observed for promoter 0K-initiated ERβ5 transcripts using cDNA of BPH-1, but the
number and size were different from those obtained in PC-3 (Fig. 2.4C, upper panel). Since some of the
promoter 0K-initiated ERβ2 or 5 transcripts were larger than expected, we next investigated whether exon 0Xs were present in those amplicons. Sequencing revealed no extra sequence was present between
exon 0K and exon 1 in ERβ1 transcript (Fig. 2.4D, upper panel). Interestingly, different combinations of
exon 0Xs were present between exon 0K and exon 1 in some ERβ2 and 5 transcripts. Exon 0X2, 0X2',
0X5, 0X6, 0X7, and 0X8 were found in ERβ2 transcripts (Fig. 2.4D, middle panel), whereas exon 0X2,
49
0X2', 0X4, and 0X4' were present in ERβ5 transcripts (Fig. 2.4D, lower panel). These data suggested
that promoter 0K and 0N differentially regulate the transcription of different ERβ isoforms in prostate
cells. Both promoters transcribe ERβ1 and 2, although it is not clear which promoter is predominant.
ERβ5 may be transcribed preferentially by promoter 0K in the prostate. Moreover, specific
combinations of exon 0Xs are only present in ERβ2 and 5 transcripts transcribed by promoter 0K.
The 5′ UTRs of ERβ inhibit the translational efficiency to different extents
To investigate whether these newly discovered sequences (ie, 5' UTRs) formed by different
combinations of exon 0Xs may play a role in regulating ERβ expression, we performed the following
studies. Since 5' UTRs have been shown to regulate the translational efficiency of downstream mRNAs
(261,265) through ribosome stalling, premature release of ribosome from the mRNA, and increased mRNA instability (232,261), we first analyzed sequences to identify any known features that would
modulate ribosome loading during protein translation. Sequence analysis revealed the presence of
various elements possibly affecting the translational efficiency in exon 0N, 0K, and 0Xs (Fig. 2.6). The putative regulatory elements include the start and stop codons. A "strong start codon" represents a start codon flanked by a sequence similar to the Kozak consensus sequence (266), while we defined the
region as "similar Kozak consensus sequence" by the presence of three or more identical nucleotides
apart from ATG start codon. Start codon and in-frame stop codon separated by at least nine nucleotides
constitute uORF (266,267). The uORFs are present in all untranslated exons except 0X3 and 0X8. An
internal ribosomal entry site (IRES) was predicted present only in exon 0X8 (Fig. 2.6). Moreover, we
used the computer modeling program mfold to predict the secondary structure and stability of 5′ UTRs
(263). Their stabilities were represented by the free-energy change (∆G). The ∆G value of exon 0X4 is
50
the highest among exon 0K and 0Xs (Fig. 2.6), suggesting that exon 0X4 forms a more stable structure that releases higher energy during mRNA folding and thus possesses a larger ∆G value.
To determine whether exon 0Xs are able to regulate the translational efficiency of their downstream coding sequence, we selected eight combinations of exon 0K and 0Xs isolated from the clinical specimens (Fig. 2.1C, upper panel). The number of start codons, stop codons, and uORF were analyzed (Fig. 2.5A). We subcloned these exon 0K-0X combinations, as well as full-length exon 0K and
0N, to the upstream of luciferase-coding sequence, and transfected plasmids into HEK293 or PC-3 cells to determine the luciferase activity (Fig. 2.5B). The mRNA expression of luciferase was measured by quantitative RT-PCR. The translational efficiency was determined by normalizing the luciferase activity with its mRNA expression. The inhibitory effect of exon 0K is 3.7-fold and 2.2-fold stronger than that of exon 0N in HEK293 and PC-3 cells, respectively (Fig. 2.5B). Exon 0K in combination with different 0X sequences exerted more remarkable repressive effects (>90% reduction in both cell lines, except for exon 0K-0X4′ in PC-3 cells) (Fig. 2.5B). We also used a cell-free system to transcribe and translate luciferase in vitro to investigate the post-transcriptional regulation of protein expression by these untranslated exons. Since luciferase mRNAs of all constructs are transcribed in vitro by T7 promoter with equal amounts of plasmids, perturbation of protein expression could only be due to untranslated exons. Relative expression of luciferase was determined by western blotting and densitometric analysis
(Fig. 2.5C). The expression of luciferase with exon 0N at the 5' end was higher than that with exon 0K, whereas the presence of different exon 0Xs greatly reduced luciferase expression (Fig. 2.5C). The results were consistent with those from luciferase reporter assays (Fig. 2.5B), implying that the post- transcriptional regulation by different 5'UTRs was independent of the cell context. These data demonstrate that exon 0K together with exon 0Xs significantly inhibits protein expression through the post-transcriptional mechanism.
51
uORFs in exon 0K and 0Xs are responsible for the inhibition of translational efficiency
The uORFs of untranslated exons play an important role in inhibiting protein translation
(232,261). We investigated whether the exon 0Xs repress the translation via uORFs by mutating all the start codons, which possess in-frame stop codons, present in the exon 0K-0X2′ construct. We chose this
5′ UTR because the suppressive effect of this simple exon combination was consistently high in both cell-based and cell-free studies. More importantly, it was identified in the clinical specimens (Fig. 2.1C,
upper panel) and was also present in both ERβ2 and 5 transcripts (Fig. 2.4D, middle and lower panel).
The positions of uORF's start codon are shown in Fig. 2.7A. The start codons were mutated from AUG
to UUG; the numbers indicate the position of adenine of the start codon. We determined the effect of
different uORFs on the translational efficiency by luciferase assay and western blotting of in vitro
translated luciferase. Luciferase expression of all mutants increased compared with that of the wild-type,
although the mutations had different effects on translation (Fig. 2.7B). Most of the mutations in exon 0K
and 0X2' increased translation by ~1.5- to 3-fold (Fig. 2.7B). Again, in vitro translation confirmed that
luciferase expression of the mutants was generally higher than that of the wild-type (Fig. 2.7C), although
the extent differed. Our data suggest that uORF is one of the key features in exon 0K and 0Xs
responsible for the inhibition of ERβ translation.
52
Discussion
Our laboratory previously showed that the temporal expression patterns of ERβ1 and its
isoforms during PCa progression differ (197,236). ERβ1 is strongly expressed in the normal prostate
epithelium but is lost in high-grade cancer. In contrast, both ERβ2 and 5 continue to be expressed in
high-grade cancer foci (236). Moreover, these ERβ isoforms are differentially localized among various cell types in the normal prostate (197,236). We thus have hypothesized that ERβ1 and its isoforms differentially utilize different promoters for their regulation in the prostate, which is supported by our findings.
Multiple putative promoters (0N, 0K, and E1) have been reported in the literature (231,264).
To the best of our knowledge, the promoters used in the transcription of ERβ1 and its isoforms in the prostate have not been identified with certainty. In this study, using an unbiased 5′ RACE analysis, we
showed that only promoter 0K and 0N are used for the transcription of all ERβ transcripts. Previous cell-
based studies suggested that promoter 0N is the dominant promoter for ERβ transcription (229,230).
Using quantitative PCR and in situ hybridization, we found that transcripts from promoter 0K and 0N
are expressed at comparable levels in normal and cancerous epithelial cell lines and in tissue specimens.
The data contrast with previous findings demonstrating that exon 0N is found more consistently than 0K
in multiple normal and malignant tissues (230). Collectively, these data indicate that both promoter 0K
and 0N are regulatory promoters of ERβ expression in the prostate.
Our understanding of ERβ functions has broadened since the discovery of ERβ isoforms
(130,234,236), yet little is known about how these isoforms are regulated in the prostate. We used long-
range nested PCR to determine the promoter usage by different isoforms and found that ERβ1 and 2
were transcribed from both promoters, 0K and 0N, in PC-3 cells whereas ERβ5 was transcribed only
from promoter 0K in PC-3 and BPH-1 cells. Of interest is that in benign and cancerous mammary
53
epithelial cells these isoforms are transcribed from both promoters (230). Alternative promoter usage is
therefore a mechanism for regulating ERβ-isoform transcription and thus explains, in part, the
discordance between the expression patterns of ERβ1 and its isoforms during the progression of PCa.
With the knowledge that ERβ1 is anti-proliferative whereas 2 and 5 are potentially pro-metastatic, future
investigation may focus on factors determining promoter usage, such as cis-regulatory elements and
trans-acting factors.
Discrepancies between abundance of mRNA and the actual expression of protein point to
regulatory mechanisms at work aside from transcriptional control (268-270). Our current study found that ERβ expression is under post-transcriptional control that uses a mechanism involving multiple 5′
untranslated exons. In the 5′ RACE analysis, we identified, in addition to the exon 0K and 0N, non-
coding sequences between exon 0K and exon 1 only in transcripts from promoter 0K. Some of these
sequences match exon 0Xs (0X1 to 0X5) first described in the human testis (231). Moreover, we found
three additional sequences, which we named exon 0X6, 0X7, and 0X8, located 3′ of exon 0X5. These
transcripts from promoter 0K contain highly variable combinations of exon 0Xs. The expression of exon
0Xs may be restricted to the male reproductive tract, as they have not been found in many other tissues
examined (230,231). In this regard, the addition of 0Xs, in various combinations, to the ERβ transcripts from promoter 0K in the prostate would change the sequence context of 5′ UTR and may be the mechanism influencing ERβ translation.
Two commonly reported mechanisms of post-transcriptional regulation are aberrant secondary and tertiary mRNA structure 1) affecting transcript stability and 2) affecting the availability and residence time of ribosomes to protein-coding ORF due to uORFs and IRES (232,271). Prediction analysis of secondary mRNA structure suggested that the stability of transcript initiated from promoter
0N is higher than that initiated from promoter 0K, implying that inhibition of protein translation by exon
54
0N may be stronger than that by exon 0K. This prediction did not support our results from the luciferase
assay and western blot analysis. Thus, we postulate the stability of mRNA structure may not be the most
important feature in the post-transcriptional regulation exerted by untranslated exons.
We performed bioinformatic analyses and identified different numbers of uORF in the
transcripts with various combinations of 0Xs, but only one IRES was predicted in the exon 0X8.
Because none of the transcripts from clinical specimens contained exon 0X8, we chose to focus on the
relationship between uORFs and protein translation. We made artificial constructs according to the
sequences identified from clinical specimens to carry different combinations of exon 0Xs with varying
numbers of uORF. Both luciferase assay and western blot analysis showed an inverse correlation
between ERβ translational efficiency and the number of uORFs in constructs; thus, the construct with
exon 0K, 0X1, 0X2', and 0X4' (9 uORFs) was found to have the lowest translational efficiency. The
direct involvement of uORFs was further illustrated by site-directed mutagenesis experiments.
Abolishment of the start codon in uORFs by mutation restored translation efficiency in all constructs. In the cell-free translation assay, the restoration of translational efficiency was consistent among different constructs; however, in the cell-based assay, we observed more variations. One possible explanation is the presence of cellular factors such as eIF4E and miRNAs, which have been reported to affect the inhibitory action of uORFs in protein translation (230,272,273). In summary, these data support an inhibitory role of uORFs in the various exon 0Xs in ERβ protein translation, a finding that has not been reported previously. Therefore, uORFs in exon 0Xs (0X-uORFs) could be an important mechanism in post-transcriptional regulation of ERβ.
The long-range nested PCR study showed exon 0Xs only in ERβ2 and 5 transcripts — not in
ERβ1 transcripts. We anticipate that 0X-uORFs can suppress protein expression of ERβ2 and 5 but not that of ERβ1. Our previous study showed that ERβ2 and 5 proteins are expressed in both normal tissues
55
and high-grade cancer (236). However, ERβ2 can be transcribed from both promoters 0K and 0N but that ERβ5 is transcribed only from promoter 0K, and yet the activities of these promoters declined in high-grade cancer as compared with that in benign tissues as suggested by our in situ hybridization data.
In addition, exon 0Xs were detected more frequently in cancerous tissues than in normal tissues.
Therefore, the persistence of expression of ERβ2 and 5 in cancerous tissues can be explained in part by
the mode of action 0X-uORFs. In contrast, ERβ1 does not have exon 0Xs and will not be under the
influence of 0X-uORFs. In this regard, transcriptional control may be the key mechanism of ERβ1
regulation. Apropos to this suggestion is the finding that the loss of ERβ1 expression is highly
correlative with the hypermethylation of promoter 0N during PCa progression. On the basis of our
current and previous findings, we propose that the expression of ERβ1 is primarily under transcriptional
and epigenetic regulation, whereas the expression of ERβ2 and 5 are controlled by complex interplay
between transcriptional and post-transcriptional regulation (Fig. 2.8). In this model, alternative use of
promoter is the first level of regulation. If transcription utilizes promoter 0K, the ultimate level of
protein expression is subjected to 0X-uORFs modulation. However, promoter 0N is used primarily for
transcriptional control that is influenced by DNA methylation.
In conclusion, the expression of ERβ1 and that of its isoforms are differentially regulated
during PCa progression. Whereas the expression of ERβ1 is controlled predominantly by transcriptional
regulation, expression of ERβ2 and 5 is tightly regulated at both transcriptional and post-transcriptional
levels. Further research will focus on the identification of the factors determining the promoter usage of
different ERβ isoforms. Moreover, the mechanism incorporating exon 0Xs into transcripts of ERβ
isoforms will be dissected. The molecular events that lead to sustainable expression of ERβ2 and ERβ5
in high-grade PCa will also be investigated.
56
Fig. 2.1 ERβ transcripts possess 5' untranslated regions (5' UTRs) of different sizes in prostate cell line and clinical specimens. (A) Schematic diagram shows the location of 5′RACE primer sets and 5′ UTRs of ERβ. (B) A representative result of 5' RACE using PC-3 cDNA reveals 5' UTRs of different sizes are present. The 5′ end of ERβ transcripts were amplified using primers specific to the oligo adapters and exon 1 of ERβ as shown in panel A. Several nested PCR reactions with different conditions were performed to enhance the specificity of amplifications. The gel photo shown is an example of a single reaction. Arrows indicate the 5' RACE products of different sizes. (C) Promoter 0K- or 0N-initiated ERβ transcripts were detected in 14 matched pairs of prostate cancerous (T) and adjacent normal (N) tissues. PCR reactions were performed by primers specific to exon 0K/0N and exon 1 of ERβ. PCR fragments less than predicted size of 300 bp were considered to be non-specific products.
57
Fig. 2.2 Schematic diagram summarizes the location of exon 0N, 0K and different combinations of exon 0K and 0Xs in the 5′ UTRs of ERβ in the prostate. (A) Two transcription start sites of promoter 0K and 0N are present in exon 0K and 0N respectively. Amplicons from the 5′ RACE experiment (Fig. 1B), together with PCR products amplified from the regions between exon 0K/0N and exon 1 in clinical specimens (Fig. 1C), were subjected to DNA sequencing. Multiple untranslated exons, called exon 0Xs, were located uniquely between exon 0K and exon 1. Three new exon 0Xs (0X6, 0X7, 0X8) were discovered in this study. Various combinations of exon 0K and 0Xs are shown by the lines connecting exons in the diagram. Incomplete exon 0Xs were formed by alternative splicing within exons and are indicated by lines connecting the middle part of exons. (B) A table shows the length of each untranslated exon and the intronic distance between different untranslated exons.
58
Fig. 2.3 Promoter 0K- or 0N-initiated ERβ transcripts are expressed in normal and cancerous tissues. Both transcripts were expressed in benign prostate, prostatic intraepithelial neoplasia (PIN), Gleason grade 3 and 5 prostate cancer in in situ RNA-RNA hybridization experiments. Digoxigenin (DIG)-labeled exon 0K- or 0N-specific oligonucleotide was used to detect the expression of respective transcripts. Positive signals are shown in purple; the nuclei were counterstained with methyl green. Right panels represent the magnified view (×630) of the corresponding boxed region from the left panels (×100) for either exon 0K or 0N-specific probe. Each panel shows the representative picture of six patient samples. The probe with scrambled sequence was used as negative control and no positive signal was shown in different magnifications (×100 or ×320).
59
Fig. 2.4 Promoter 0K and 0N differentially regulate the transcription of different ERβ isoforms. (A) Relative expression of exon 0K, 0N, and ERβ1, 2, and 5 was determined in different prostate cell lines. cDNAs of PrEC, NPrEC, RWPE-1, BPH-1, DU-145, PC-3, LNCaP, C4-2 were used in quantitative RT-PCR. Three consecutive passages of cell lines were used. The relative expression of different targets was normalized to their expression levels in PrEC. Experiments were carried out in technical triplicates, and results were the average of two independent experiments. Data are represented as mean ± SD. (B) Schematic diagram shows the promoter 0K/0N and ERβ-isoform-specific nested PCR amplification. Exon 0K- and 0N- specific forward primers and isoform-specific reverse primers were designed for nested PCR amplification. (C) Nested PCRs of promoter 0K/0N-initiated ERβ-isoform transcripts reveal the differential usage of promoters in the transcription of ERβ isoforms. The amplicons marked with asterisks (*) contained transcripts of ERβ2 or 5 as indicated. Other bands were products of non-specific amplification. (D) Schematic diagram shows the presence of exon 0K, 0N and 0Xs in the transcripts of ERβ1, 2, and 5. After nested PCR analyses stated in panel D, amplicons of different sizes were sequenced. ERβ1, 2, and 5 transcripts which were identified in the current study are displayed diagrammatically.
60
Fig. 2.5 The 5′ UTRs of ERβ inhibit the translational efficiency to different extents. (A) A table shows the sequence analysis of exon 0N, 0K, and various combinations of exon 0K and 0Xs. The combinations of exon 0K and 0Xs were isolated in the clinical specimens in Fig. 1C. The number of start codons, stop codons, and upstream open reading frame (uORF) in different 5' UTRs is shown. Strong ATG contains the flanking sequence similar to the Kozak consensus sequence as described in the result section. uORF is composed of in-frame start and stop codons. ∆G is the free e nergy change during mRNA folding. (B) 5′ UTRs of ERβ inhibited the translational efficiency of luciferase in different cell lines. pGL3-Promoter plasmids containing different 5' UTRs were transfected into HEK293 (upper panel) or PC-3 (lower panel) cells together with pCMV-β-gal. The translational efficiency was defined as the relative luciferase activity per unit of mRNA. Results are the average of three independent experiments. Data are represented as mean ± SD. The statistical significance of the difference in translational efficiency between exon 0K and combinations of exon 0K and 0Xs is shown as *P<0.05, **P<0.01, ***P<0.001. (C) 5′ UTRs of ERβ inhibit the translational efficiency of luciferase in vitro. Plasmids containing T7 promoter were translated in vitro and the lysates were subjected to western blotting. Band intensities were measured and normalized to the value of control vector. Two independent experiments were performed. Results are the average of three measurements in a representative experiment. Data are presented as mean ± SD.
61
Fig. 2.6 Sequence analysis of exon 0N, 0K and various exon 0Xs which were present in the 5’UTR of promoter 0K-initiated ERβ transcripts. The number of start codon, stop codons, upstream open reading frame (uORF) and internal ribosome entry site (IRES) present in different exons are shown. Strong ATG is the start codon containing the flanking sequence similar to Kozak consensus sequence “CCR(A/G)CCATGG”. uORF is composed of in-frame start codon and stop codon. ∆G is the free energy change during the folding of mRNA and was predicted by RNA Folding Form (version 2.3 energies).
62
Fig. 2.7 uORFs in exon 0K and 0Xs are responsible for inhibition of translational efficiency. (A) Schematic diagram shows the position of uORFs' start codons in the construct of exon 0K- 0X2′. The start codons were mutated to non-functional codon UUG. Seven constructs with a single mutation and one construct with double mutation (134,138th) were made. (B) uORFs on the exon 0K-0X2′ differentially inhibited the translational efficiency of luciferase in cells. Eight mutants mentioned in panel A and the wild-type of exon 0K-0X2′ (wt) on pGL3- Promoter plasmids were transfected into HEK293 cells with pCMV-β-gal. The translational efficiency was determined similar to that in Fig. 5B. Results are the average of three independent experiments. Data are presented as mean ± SD. The statistical significance of the difference in translational efficiency between exon 0K-0X2′ wt and each mutant is shown as *P<0.05, **P<0.01, ***P<0.001. (C) uORFs on the exon 0K-0X2′ differentially inhibit the translational efficiency of luciferase in vitro. Exon 0K-0X2′ wt and the eight mutants on pGL3-Promoter plasmids possessing T7 promoter were translated in vitro. The lysates were subjected to western blotting. Band intensities were measured and normalized to the value of exon 0K-0X2′ wt. Two independent experiments were performed. The results are the average of three measurements in a representative experiment. Data are presented as mean ± SD.
63
Fig. 2.8 Schematic diagram shows the transcriptional and post-transcriptional regulation of ERβ-isoform expression lead to the different outcomes of prostate cancer progression. The alternative use of promoter 0K or 0N acts as the first step of controlling the amount of ERβ transcripts. In normal cells, promoter 0N contributes to the high level of ERβ1 to maintain the regular cell proliferation, whereas it is methylated in cancer cells casuing the loss of ERβ1 expression. On the other hand, promoter 0K transcribes ERβ2 and ERβ5 in both normal and cancer cells. Promoter 0K-initiated ERβ2 and 5 transcripts are more likely to be incorporated with exon 0Xs in normal cells than in cancer cells. Translation of the transcripts composed of exon 0K and 0Xs is significantly inhibited due to the presence of uORFs. This is the second step of regulating the protein expression of ERβ2 and 5. In cancer cells, lower proportion of ERβ2 and 5 transcripts consists of exon 0Xs. Their expressions are higher than those in normal cells, resulting in promoting PCa progression, increasing cell invasiveness and metastasis.
64
Table 2.1 Primers used in different experiments
Primers for Sequences
GeneRacer 5’ RACE
5' RACE primer CAGGTAAGGTGTGTTCTAGCGATCTTG
5' RACE nested primer GAAAGGTGCCCAGGTGTTGG
Amplification of 0K, 0N in clinical samples
ERβ-0K-F CTGAATCTGACGCTCAGCAG
ERβ-0K-R GTCTTGAGATAACAGCTGAGAAAACA
ERβ-0N-F AGCCTGAGCTGCAGGAGGTG
ERβ-0N-R AGCCGTGCTCCAGGGGTAA
In situ RNA-RNA hybridization
0K antisense+T7 RNA ACAGTCCGAAGGGTCCGTTAGCGGGTAGAATAAGGACCCTATAGTGAGT polymerase CGTATTACTG
0N antisense+T7 RNA GGACGAGAAGCGGGACGTTCAAAGTTCTCCGTCAACCCTATAGTGAGTC polymerase GTATTACTG
Scrambled GTGTAACACGTCTATACGCCCA
Quantitative RT-PCR
ERβ1-RT-F TGGCTAACCTCCTGATGCTC
ERβ1-RT-R TCCAGCAGCAGGTCATACAC
ERβ2-RT-F AGGCATGCGAGGGCAGAA
ERβ2-RT-R GGCCACCGAGTTGATTAGAGG
ERβ5-RT-F CGGAAGCTGGCTCACTTGCT
ERβ5-RT-R CTTCACCCTCCGTGGAGCAC
Luciferase-1-F ATCCATCTTGCTCCAACACC
Luciferase-1-R TTTTCCGTCATCGTCTTTCC
GAPDH-RT-F GAAGGTGAAGGTCGGAGTCA
GAPDH-RT-R GACAAGCTTCCCGTTCTCAG
65
Table 2.2 Primers used in different experiments
Primers for Sequences
1st- and 2nd-round amplification of sequence between 0K/0N and ERβ isoforms
0K-1st-F CGTCCACACTGGAGAAGGA
0K-2nd-F TGGCCCCTTGAGTTACTGAG
ERβ1-0K-R TCAGCTTGTGACCTCTGTGG
ERβ2-0K-R CTTTGCCTTCCAGGTTCAAG
ERβ5-0K-R TTGCAGACACTTTTCCCAAA
0N-1st-F GGCTTTTTGGACACCCACT
0N-2nd-F CCCCTAATGCGGGAAAAG
ERβ1-0N-R GGGACCACATTTTTGCACTT
ERβ2-0N-R TGATCCCAGAGGGAAATTGA
ERβ5-0N-R CATTCCAAATGAGGCATTCA
Mutagenesis of uORFs start codon on 0K0X2’ (only shows the sense primer)
96th GCGGCAGCTGGGTTGCTGGAGAGGA
134th TTGAGTTACTGAGTCCGTTGAATGTGCTTGCTCTG
138th TGAGTTACTGAGTCCGATGATTGTGCTTGCTCTGC
134138th TTGAGTTACTGAGTCCGTTGATTGTGCTTGCTCTGCTGG
188th CTCAGGTTACAGTCATCCCAATTTGGTTCTGAAGACATC
216th GGTTCTGAAGACATCCAAGTGGAGATTTGGCATTTAAATTC
231st GGAGATATGGCATTTAAATTCTTGAGATTGGATGAGATCCCAC
241st CATTTAAATTCATGAGATTGGTTGAGATCCCACCAAAGGAACA
66
Chapter 3: Transactivation of Estrogen Receptor Beta (ERβ1) is Differentially Modulated by an
Acetytransferase Tip60 in a Regulatory Element–Dependent Manner
Abstract
ERβ1 and ERα have overlapping and distinct functions despite their common use of estradiol
(E2) as the physiological ligand. These attributes are explained in part by their differential utilization of
co-regulators and ligands. Although Tip60 has been shown to interact with both receptors, its regulatory
role in ERβ1 transactivation has not been defined. In this study, we found that Tip60 enhances
transactivation of ERβ1 at the AP-1 site but suppresses its transcriptional activity at the estrogen
response element (ERE) site in an E2-independent manner. However, different estrogenic compounds
can modify the Tip60 action. The corepressor activity of Tip60 at the ERE site is abolished by
diarylpropionitrile, genistein, equol, and bisphenol A, whereas its coactivation at the AP-1 site is
augmented by fulvestrant (ICI 182,780). GRIP1 is an important tethering mediator for ERs at the AP-1
site. We found that coexpression of GRIP1 synergizes the action of Tip60. Although Tip60 is a known
acetyltransferase, it is unable to acetylate ERβ1 and its co-regulatory functions are independent of its
acetylation activity. In addition, we showed the co-occupancy of ERβ1 and Tip60 at ERE and AP-1 sites
of ERβ1-target genes. Tip60 differentially regulates the endogenous expression of the target genes by
modulating the binding of ERβ1 to the cis-regulatory regions. Thus, we have identified Tip60 as the first
dual-function co-regulator of ERβ1.
67
Introduction
Estrogen normally exerts its effects via two main receptor subtypes, estrogen receptor α
(ERα) and β (ERβ1) (257). These receptors function as transcription factors and regulate gene expression either by binding directly to estrogen response elements (EREs) within the regulatory region
of target genes (90,274) or by interacting with other transcription factors, such as AP-1, NFκB, and Sp1
(105,106). The activation of ERs is controlled by interplay between the binding of ligands and coregulators (coactivators and corepressors) (275). Most ER signaling pathways require ligand binding
because ligands are able to induce the dimerization of ERs and conformational changes in receptors and
thus to increase the potency of coactivator recruitment (276). However, studies of the ligand-
independent regulation of ERβ1 by coregulators are limited to previous findings demonstrating this
mode of action for SRC1 and GRIP1 (111,192). Global transcriptional profiling also reveals that
unliganded ERβ1 regulates a significant number of target genes (135,136). These findings, taken
together, have stimulated significant interest in the topic of ligand-independent action.
Coregulators regulate the activity of transcription factors through several mechanisms,
including post-translational modification (PTM). Activities of ERs are regulated, for example, by
acetylation, phosphorylation, and ubiquitination (110,187,277). A putative acetylation motif is present in
many hormone receptors conserved among different species (187,278), revealing that acetylation is a
common regulatory mechanism of receptor activity. ERα is acetylated by p300 and SRC1 (189,190),
whereas its hormone sensitivity and transactivation are regulated by acetylation (190). Moreover,
acetylation of ERα modulates or is modulated by other PTMs, such as ubiquitination and
phosphorylation (191,279). However, acetylation of ERβ1 has not yet been reported. On the other hand,
coregulators can act as scaffold proteins to allow tethering of ERs and associated proteins onto other
transcription factors (106,134). For example, AP-1 recruits CBP and p300, which bind to p160
68
coactivators. ERs then tether onto the transcriptional complex of AP-1 through the physical interaction
with p160 coactivators (106,134). In short, the diverse actions of a nuclear receptor such as ERβ1 could
depend largely on its interacting coregulators.
Tip60 [Lysine (K) acetyltransferase 5, KAT5] is a well-studied ERα coregulator. It belongs
to MYST (MOZ, Ybf2/Sas3, Sas2 and Tip60) family. Members of this family possess an
acetyltransferase domain capable of acetylating histones and other proteins (280). Moreover, Tip60
functions as either a coactivator (281-285) or a corepressor (286,287), depending on its interacting
transcription factors. Tip60 enhances ERα transactivation at ERE sites in a ligand-dependent manner
(112,113) and thus increases the expression of certain ERα target genes (113,114). A study also shows
that Tip60 interacts with ERβ1 in the presence of estrogen (288). However, it remains unclear how
Tip60 modulates ERβ1 function.
Our current study investigated the biological function of Tip60 on ERβ1 transactivation,
particular at various cis-regulatory sequences and/or in the presence of different types of ligand. The
dependency of histone acetyltransferase (HAT) domain activity in Tip60 was evaluated with a HAT-
domain mutant. Its interactions with other common coregulators such as SRC-1 and GRIP1 were
determined. Moreover, the differential regulation of endogenous expression of ERβ1 target genes by
Tip60 and the co-occupancy of ERβ1 and Tip60 at cis-regulatory regions were investigated. Here, we showed that Tip60 is a unique dual-function coregulator of ERβ1 in a cis-acting element-dependent manner.
69
Materials and Methods
Cell-culture conditions
HEK293 and DU-145 cells were grown in MEM Eagle medium supplemented with 10%
fetal bovine serum, L-glutamine. PC-3 cells were grown in F-12K medium supplemented with 10% fetal
bovine serum (ATCC, Manassas, VA). All cells were grown in 1% penicillin/streptomycin. The phenol
red–free DMEM medium was supplemented with 10% charcoal-stripped fetal bovine serum (CSS) prior
to the addition of ligands in experiments. Cells were grown at 37 ºC and 5% CO2.
Transfection reagents and chemicals
Transient transfection of plasmids into HEK293 cells was performed using Lipofectamine
2000 (Life Technologies, Carlsbad, CA). Transient transfection of plasmids into PC-3 and DU-145 cells was performed using X-tremeGENE HP (Roche Applied Science, Indianapolis, IN). DharmaFECT 2 was used as the siRNA transfection reagent for PC-3 (Thermo Scientific Dharmacon, Florence, KY).
Chemicals such as estradiol (E2), diarylpropionitrile (DPN), genistein (GEN), equol (EQ), daizein
(DAI), apigenin (API), 4OH-tamoxifen (TAM), raloxifene (RALO), bisphenol A (BPA), anacardic acid
(AnAc), trichostatin A (TSA), and nicotinamide were purchased from Sigma Aldrich (St. Louis, MO).
ICI 182,780 (ICI) was purchased from Zeneca Pharmaceuticals (Cheshire, UK).
Plasmids, siRNAs and recombinant protein
Full-length ERβ1 and ERα were subcloned into pGBKT7 vector, while Tip60 was cloned into pACT2 vector (Clontech, Mountain View, CA). ERβ1 and Tip60 were also cloned into pcDNA-
HisMax (Life technologies) or subcloned into pENTR entry vector (Life technologies) then transferred into destination vector pDEST40 through gateway cloning (Life Technologies). In addition, full-length
70
ERβ1 and ERα were subcloned into pGBKT7 vector, while Tip60 was cloned into pACT2 vector
(Clontech). SRC-1 and GRIP-1, gifts from Dr. Nancy Weigel, Baylor College of Medicine, Houston,
TX, were cloned to pcDNA3.1. ONTARGETplus SMARTpool 4 siRNAs specific to Tip60 were used
for gene knockdown. ONTARGETplus non-targeting siRNA (siNT) was used as the negative control
(Thermo Scientific Dharmacon). Recombinant ERβ1 protein was purchased from Thermo Scientific
Pierce (Florence, KY).
To generate different domain-deleted ERβ1 constructs, c-Myc tag was first added by PCR
reaction to the N-terminus of the full-length ERβ1 coding sequence which was cloned to pDEST40. We
generated different domain-deleted ERβ1 by performing PCR with different sets of primers (Table 1)
and using ERβ1-pDEST40 as the template.
Antibodies
Rabbit polyclonal anti-ERβ (H-150), goat polyclonal anti-Tip60 (N-17 and K-17), goat polyclonal anti-SRC-1 (C-20), rabbit polyclonal anti-GRIP-1 (M-343), mouse monoclonal anti-c-myc
(9E10) and control IgG were purchased from Santa Cruz Biotechnology (Dallas, TX). Mouse
monoclonal anti-ERβ1 was purchased from AbD Serotec (Raleigh, NC). Rabbit polyclonal anti-acetyl- lysine and IgG XP isotype control was purchased from Cell Signaling Technology (Danvers, MA).
EZview red anti-HA and anti-c-Myc affinity gel were purchased from Sigma Aldrich.
Construction of ERβ1 stably expressed cell lines−Stably expressed cell lines were constructed according to the published data (236). Full-length ERβ1 or LacZ (negative control), was subcloned respectively into pLenti6 lentiviral vector by Multisite Gateway Cloning (Life Technologies) and transfected into 293FT for production of lentivirus. The titer of lentivirus was measured, and the multiplicity of the infection of PC-3 cells was determined. Lentivirus-infected PC-3 cells were selected
71
with blasticidin (10 μg/ml) for three weeks. Quantitative reverse transcription (RT)-PCR, western blot,
and β-galactosidase assay were performed to confirm the stable expression of ERβ5 or LacZ.
In vitro co-immunoprecipitation (co-IP)
T7 promoter and HA tag were added to the N-terminus of the coding sequence of Tip60 by
the PCR reaction. pGBKT7 vector containing the full length of ERβ1, ERα and purified PCR product of
Tip60 were respectively translated in vitro by the TNT T7-recticulocyte system (Promega, Fitchburg,
WI) labeled with EasyTag EXPRESS 35S protein labeling mix (Perkin Elmer, Hebron, KY). Tip60 (10
µl) and ERβ1 or ERα (each 10 µl) proteins were mixed at 4 °C for 1 h. Lysates were incubated with 20
µl of EZview red anti-HA affinity gel (Sigma Aldrich, St. Louis, MO) at 4 °C overnight with agitation.
The samples were subjected to SDS-PAGE. The dried gel was exposed to X-ray film for 72 h, and
intensifying screen (Kodak, Rochester, NY) was used for signal enhancement. Films were scanned using
the Odyssey Infrared Imaging System (LiCor Bioscience, Lincoln, NE).
Yeast two-hybrid assays
ERα- or ERβ1-pGBKT7 and Tip60-pACT2 were co-transformed into yeast strain Y187 through the polyethylene glycol-lithium acetate method with the use of the Yeastmaker yeast
transformation system (Clontech). Procedures followed the manufacturer’s protocol. The transformed
yeast cells were grown on quadruple dropout (SD/-Ade-His-Leu-Trp) (QDO) agar with X-α- galactosidase until the appearance of blue colonies.
Ni-NTA purification of His-tagged proteins
72
HEK293 cells were transfected with ERβ1 and Tip60. After 24-h transfection, medium was added with 10 nM estradiol (E2). Cells were lysed in lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10
mM imidazole, 0.1% Tween20) containing complete EDTA-free protease inhibitor cocktail
(Calbiochem, Billerica, MA) followed by sonication. About 1 mg of total lysate was incubated with 20
µl of Ni-NTA agarose beads (Qiagen, Valencia, CA) at 4 ̊°C overnight. Washing and elution procedures followed the manufacturer's protocol. The samples were subjected to western blot analysis. IRDye secondary antibody was used to detect the protein bands and the Odyssey Infrared Imaging System
(LiCor Bioscience) was used to detect the signals. The images were obtained as described above.
Mammalian co-IP
HEK293 cells transfected with plasmids or ERβ1 stably expressed PC-3 cells were used.
Medium was added with or without 10 nM estradiol (E2) as indicated. Cells were lysed in M-PER lysis buffer (Thermo Scientific Pierce) containing protease inhibitor cocktail. Lysates were incubated with 2
µg of Tip60 or ERβ1 antibody at 4 °C overnight and then with protein G Dynabeads (Life Technologies) at room temperature for 1.5 h. The immunoprecipitates were subjected to western blot analysis. The images were obtained by Odyssey Infrared Imaging System as described above.
In the domain-deletion study, full-length and domain-deleted ERβ1 constructs were immunoprecipitated by EZview red anti-c-Myc affinity gel (Sigma Aldrich). IgG XP isotype was used as negative control (Cell Signaling Technology).
Immunofluorescence staining
HEK293 cells or ERβ1 stably expressed PC-3 cells were seeded on a round coverslip.
HEK293 cells were transfected with ERβ1 and Tip60. Cells were fixed in 10% formalin and
73
permeabilized with 1% NP-40. Normal chicken serum was used for blocking. Cells were incubated with rabbit ERβ (H150) and goat Tip60 (N-17) at room temperature for 1 h followed by incubation with different fluorescent-tagged secondary antibodies. DAPI (Sigma Aldrich) was used for nuclear counterstaining. Prolong R Gold anti-fade reagent (Life Technologies) was used for signal enhancement.
Fluorescent images were obtained with an Axiovert 200M fluorescent microscope equipped with an
AxioCam MRm camera and Axiovision 4.8 software (Carl Zeiss, Oberkochen, Germany).
Site-directed mutagenesis
The acetylation-deficient mutant of Tip60, Tip60∆HAT (Q377E/G380E), was generated with the use of Stratagene Quikchange lightning site-directed mutagenesis kit (Agilent Technologies, Santa
Clara, CA) as described in the protocol. Primers for mutagenesis were designed through the QuikChange primer design program (Agilent Technologies) (Table 1). In brief, the mutant-strand synthesis was done by PCR, and products were treated with the restriction endonuclease DpnI to digest the parental DNA.
The mutated single-stranded DNA was converted to the duplex form in vivo through bacterial transformation. Plasmids were extracted and sequenced to confirm the mutations.
In vitro and in vivo acetylation assay
For the in vitro acetylation assay, HEK293 cells were transfected with either wild-type Tip60
(Tip60WT) or Tip60∆HAT. Cells were treated with 3 µM trichostatin A (TSA) and 5 mM nicotinamide for 6 h. Recombinant Tip60 was purified on the Ni-NTA column as described above, and the lysis and wash buffers were added with 1 µM TSA and 5 mM nicotinamide, which are inhibitors of different deacetylase families. The Tip60-bound Ni-NTA column was resuspended in HAT buffer (50 mM Tris-
HCl pH8, 10% glycerol, 100 µM EDTA, 1 mM DTT, 1 mM PMSF, 10 mM sodium butyrate, 5 mM
74
nicotinamide) with 500 µM acetyl-CoA and 500 µg of recombinant ERβ1. The mixture was incubated at
30 °C for 1 h. Lysates were subjected to western blot analysis.
For the in vivo acetylation assay, HEK293 cells were transfected with ERβ1, Tip60WT, or
Tip60∆HAT. Cells were treated with 3 µM trichostatin A (TSA) and 5 mM nicotinamide for 6 h.
Immunoprecipitation was performed with ERβ1 or Tip60 antibody, and the lysis and wash buffers were added with 1 µM TSA and 5 mM nicotinamide. Lysates were subjected to western blot analysis.
Luciferase reporter assay
Different luciferase reporter plasmids were used. The pt109-ERE3-Luc carrying 3X vitellogenin ERE was provided by Dr. Craig Jordan (Fox Chase Cancer Center, Philadelphia, PA). The pAP-1-Luc was purchased from Clontech. The C3 ERE-Luc, c-Fos ERE-Luc, progesterone receptor
(PR) ERE-Luc, pS2 ERE-Luc reporters were gifts from Dr. Carolyn Klinge (University of Louisville,
Louisville, KY). NFκB-Luc and pSp13-Luc were provided by Dr. Francis Chan (University of
Massachusetts Medical School, Worcester, MA). HEK293 cells were seeded on 24-well plates at 2.8 ×
105 in phenol red–free medium supplemented with 10% charcoal-stripped serum (CSS). Expression
plasmids of ERβ1, GFP or Tip60, together with luciferase reporter plasmids and β-galactosidase were transiently transfected into cells. Different ligands, such as E2, DPN, GEN, EQ, DAI, API, TAM,
RALO, ICI, and BPA were added to the medium after 24-h transfection. Transactivation activities of
ERβ1 were measured by using the Bright-Glo luciferase kit (Promega). Normalization of transfection efficiency was done by measuring β-galactosidase activity using the β-gal assay kit (Promega). Each independent experiment was carried out in technical triplicates.
75
Quantitative RT-PCR
Total RNA was extracted with TRIZOL reagent (Life Technologies) and cDNA synthesis
was done with SMART MMLV reverse transcriptase with poly d(T) primer following the
manufacturer's protocols (Promega). Quantitative RT-PCR was performed with ABI7900 real-time PCR system (Life Technologies). The sequences of primers used were summarized in table 2.
Chromatin immunoprecipitation (ChIP) and re-ChIP assays
PC-3-ERβ1 cells were grown in CSS-containing supplemented with 10 nM E2. ChIP assays were performed as described previously (289), except the use of Dynabeads magnetic beads for capturing antibodies (Life technologies). In re-ChIP assays, DNA-containing magnetic beads were incubated in TE buffer with 10 mM dithiothreitol (DTT) to elute the immunoprecipitated DNA after the first ChIP assay. The second ChIP assay was performed with the purified DNA by the second antibody.
The ChIP DNA was amplified by PCR with ABI7900 real-time PCR system. The sequences of primers used in the amplification were summarized in table 2.
Statistical analysis
The Student's t-test of QuickCalcs (GraphPad Software, La Jolla, CA) was used for statistical analysis. P-values calculated were two-sided, and values <0.05 were considered statistically significant.
76
Results
ERβ1 can interact with Tip60 in either the absence or presence of estrogen
To show the physical binding between ERβ1 and Tip60, we performed in vitro Co-IP. Tip60
translated in vitro was incubated with ERα or ERβ in the presence of E2 and immunoprecipitated with
HA antibody. The translated Tip60 interacted with both ERα (Fig. 3.1A, lane 2) and ERβ1 (Fig. 3.1A, lane 6). To confirm the interactions in a cellular system, we co-transformed ERβ1, ERα or empty vector with Tip60 into yeast cells. We were surprised to find that Tip60 interacted with ERβ1 in the absence or presence of E2, as indicated by the growth of blue yeast colonies (Fig. 3.1B, left panel). Consistent with previous findings (113,288), ERα-Tip60 interaction occurred only in the presence of E2 (Fig. 3.1B, middle panel). To verify the interaction in a mammalian system, we transfected HEK293 cells with
Tip60 or empty vector along with ERβ1, followed by immunoprecipitation (Fig. 3.1C). ERβ1 was co- immunoprecipitated with Tip60 in the absence and presence of E2 (Fig. 3.1C, lanes 1 and 3). Their interaction was verified by reciprocal co-IP using ERβ1-specific antiserum. Tip60 was co- immunoprecipitated only when cells were overexpressed with ERβ1 and Tip60 (Fig. 3.1D, lane 1).
However, no Tip60 was co-immunoprecipitated when the cells were only overexpressed with ERβ1
(Fig. 3.1D, lane 2) or Tip60 alone (Fig. 3.1D, lane 3). The interaction was also confirmed in a cell line with high endogenous level of Tip60. A prostate cancer cell line, PC-3, with ectopic expression of ERβ1
(PC-3-ERβ1) was used (290). Tip60 was co-immunoprecipitated with ERβ1 in the absence or presence of E2 (Fig. 3.1E, lanes 1 and 3).
We further determined the presence of ERβ1 and Tip60 in the same subcellular compartments. ERβ1 (red) was shown to be co-localized with Tip60 (green) (Fig. 3.1F) in the nucleus of
HEK293 cells in the absence or presence of E2. Co-localization of the two proteins was also observed in
77
PC-3-ERβ1 (Fig. 3.1G). These data show that ERβ1 physically interacts with Tip60 inside the nucleus in
either the absence or presence of E2.
Hinge domain of ERβ1 is responsible for the interaction with Tip60
We performed interaction analysis of different domains of ERβ1 with Tip60 to further
characterize the interaction between ERβ1 and Tip60. Functional domains of ERβ1 include activation
function 1 (AF-1), DNA-binding domain (DBD), hinge domain (HD), ligand-binding domain (LBD),
and AF-2 domain. We constructed five domain-deleted ERβ1 mutants (ERβ1∆AF-1, ERβ1∆AF-1-DBD,
ERβ1∆AF-1-HD, ERβ1∆LBD -AF-2, and ERβ1∆AF -2) with c-Myc tag at the N-termini (Fig. 3.2A).
Tip60 together with full-length ERβ1 or its domain-deleted mutants were transfected into HEK293 cells
followed by immunoprecipitation. A considerable amount of Tip60 was pulled down simultaneously
with the N-terminal–deleted mutants ERβ1∆AF -1 and ERβ1∆AF -1-DBD (Fig. 3.2B, upper panel) and the C-terminal–deleted mutants ERβ1∆LBD-AF-2 and ERβ1∆AF-2 (Fig. 3.2B, lower panel). However, no Tip60 was co-immunoprecipitated with the ERβ1∆AF -1-HD construct (Fig. 3.2B, lower panel). The data show that the hinge domain of ERβ1 is responsible for interacting with Tip60.
Tip60 differentially regulates ERβ1 transactivation at ERE and AP-1 sites
ERβ1 is a transcription factor controlling gene expression by either directly binding to consensus DNA sequences or tethering on other transcription factors (90,105,108). We were interested in investigating whether Tip60 enhances ERβ1 transactivation and whether the effect is dependent on a cis-regulatory element.
We therefore transfected Tip60, ERβ1 and different luciferase reporter plasmids into
HEK293 cells. Tip60 reduced ERβ1 transactivation at vitellogenin-ERE site in the absence or presence
78
of E2 (Fig. 3.3A). Moreover, we verified its inhibitory effect at ERE sequences of different ERβ1-target
genes. Tip60 inhibited ERβ1 transactivation at C3- (Fig. 3.3B) and cfos-ERE sites (Fig. 3.3C) in the
absence or presence of E2 and also at pS2- (Fig. 3.3D) and PR-ERE sites (Fig, 3.3E) in the absence of
E2. To determine its mode of regulatory action, we showed that the inhibitory effect of Tip60 on ERβ1
transactivation was concentration-dependent (Fig. 3.3F). Tip60 decreased constitutive and E2-induced
transactivation and also the fold change was similar in the absence and presence of E2 (Fig. 3.3F). Apart
from directly binding to DNA sequences, ERβ1 can interact with coregulators to tether onto other
transcription factors to activate the transcription. Tip60 enhanced ERβ1 transactivation at the AP-1
response element (Fig. 3.3G). Tip60 increased ERβ1 transactivation more significantly in the absence of
E2 than in the presence of E2. The transcriptional regulation by Tip60 required ERβ1 expression
because cells transfected with only Tip60 showed very little luciferase activity (data not shown). In
contrast, no regulatory effect of Tip60 was observed at NFκB and Sp1 binding sites (Fig. 3.3H and I).
Differential regulation of ERβ1 transactivation at vitellogenin ERE and AP-1 sites were also observed in
different prostate cancer cell lines, PC-3 (Fig. 3.3J and K) and DU-145 (Fig. 3.3L and M). These data
suggest that Tip60 enhances ERβ1 transactivation at the AP-1 site but reduces the transactivation at different ERE sites.
Various ligands modulate the regulatory effects by Tip60 on ERβ1 transactivation
Since we found that the regulatory effect of Tip60 at AP-1 site was reduced by E2, we sought to determine whether various ligands could influence its regulation. This was especially relevant since transcriptional activity of ERβ1 responds differently depending on ligands and binding sites (108). We tested four categories of chemicals, estrogens (E2 and DPN), phytoestrogens (GEN, EQ, DAI, API),
SERMs (RAL, TAM), antiestrogen (ICI), and an endocrine disruptor (BPA). As with previous findings
79
(108,111,291), ERβ1 transactivation at the ERE site was enhanced in the presence of estrogens or
phytoestrogens but was suppressed in the presence of TAM, RAL, and ICI (Fig. 3.4A). In stark contrast,
SERMs and antiestrogen stimulated the transactivation at the AP-1 site, whereas estrogens and phytoestrogens inhibited ERβ1 transcriptional activity (Fig. 3.4B). Moreover, we examined the regulatory effect by Tip60 in the presence of these ligands. The transcriptional inhibition by Tip60 persisted at the ERE site in response to all of the ligands except DPN, GEN, EQ, and BPA (Fig. 3.4A).
On the other hand, all the estrogens and phytoestrogens except apigenin downregulated the enhancement of ERβ1 transactivation by Tip60 at the AP-1 site (Fig. 3.4B). SERMs could not further upregulate the effect of Tip60, whereas ICI was the only ligand that increased Tip60 enhancement over that of the control (Fig. 3.4B). Hence, we suggest that various ligands differentially modulate the regulatory effects by Tip60 at ERE and AP-1 sites.
ERβ1 cannot be acetylated by Tip60 and preferentially interacts with unacetylated Tip60
Tip60 was found to acetylate different transcription factors, such as androgen receptor (AR), p53, c-Myc and ATM (283-285,292). To examine whether ERβ1 can be acetylated by Tip60, we performed an in vitro acetylation assay. The structural domains of the Tip60 wild-type (Tip60WT) and
the mutation sites of its HAT-defective mutant (Tip60∆HAT) (Q377E/G380E) are shown in Fig. 3.5A.
His-tagged Tip60WT and Tip60∆HAT proteins were purified on Ni-NTA columns. Recombinant ERβ1
protein and purified Tip60 were incubated with acetyl-CoA. Consistent with the finding by another group (36), we found that Tip60WT, but not Tip60∆HAT, was able to auto -acetylate in vitro (Fig. 3.5B,
lanes 1 and 3). However, ERβ1 could not be acetylated by either Tip60WT or Tip60∆HAT as shown by
the absence of signal when pan acetyl-lysine antibody was used (Fig. 3.5B, lanes 3 and 4).
80
Next, we verified the results in vivo. Either Tip60WT or Tip60∆HAT was expressed simultaneously with ERβ1. The cells were incubated with TSA and nicotinamide to maximize the level of acetylation. Immunoprecipitation was performed with either ERβ1 or Tip60 antibody to isolate different populations of protein complex. Tip60WT, but not Tip60∆HAT, was able to auto -acetylate in vivo, as shown in the input lysate (Fig. 3.5C, right panel). Immunoprecipitation was first performed with
ERβ1 antibody to isolate ERβ1 complexes that may or may not contain Tip60. Although Tip60 was co- immunoprecipitated with ERβ1, no acetylation of ERβ1 or Tip60 was detected (Fig. 3.5C, left panel).
Similarly, Tip60 antibody was then used in the pull-down assay to isolate two populations of Tip60 complexes, including the one with or without ERβ1. As expected, Tip60 and ERβ1 were isolated simultaneously. Although there was no acetylation of ERβ1, auto-acetylation of Tip60WT was detected in the immunoprecipitate (Fig. 3.5C, middle panel), and its unacetylated form may interact preferentially with ERβ1. To conclude, ERβ1 is not acetylated by Tip60 in vitro or in vivo and may preferentially interact with the unacetylated form of Tip60.
HAT activity of Tip60 is not involved in the regulation of ERβ1 transactivation at AP-1 and ERE sites
Acetylation of AR by Tip60 is essential for upregulating the transactivation of AR at androgen response elements (AREs) (283). The inability of Tip60 to acetylate ERβ1 infers that its HAT activity may not be important for regulating ERβ1 activity. Luciferase reporter assays were performed to determine ERβ1 activity with the overexpression of Tip60WT and Tip60∆HAT. Western blot analysis showed that their expression was similar (Fig. 3.6A). At the vitellogenin-ERE site, the two Tip60 proteins were equally effective in reducing ERβ1 transactivation (Fig. 3.6B). However, Tip60∆HAT enhanced ERβ1 transactivation to a greater extent than Tip60WT did at the AP-1 site (Fig. 3.6C). To further determine the significance of the HAT activity of Tip60 to the transcriptional activity of ERβ1,
81
we used a HAT inhibitor, anacardic acid, which inhibits Tip60-dependent acetylation (293). Similar to the results shown in Fig. 3.6B and C, enhancement of ERβ1 transactivation by Tip60 was upregulated at the AP-1 site in the presence of anacardic acid (Fig. 3.6E) but no change was observed at ERE site (Fig.
3.6D). The results suggest that HAT activity of Tip60 is not required to regulate ERβ1 transactivation at
ERE or AP-1 site.
Tip60 interacts with GRIP1 to enhance ERβ1 transactivation at the AP-1 site synergistically
The p160 steroid receptor coactivator (SRC) family consists of three homologous members,
SRC1, GRIP1, and SRC3 (294-296). Of these, SRC1 and GRIP1 are coactivators of ERs at the AP-1
and ERE sites (106,297). Since Tip60 enhanced ERβ1 transactivation at the AP-1 site but diminished
transactivation at different ERE sites, we investigated whether Tip60 has any combinatorial effect with
p160 coactivators. We overexpressed different combinations of Tip60, SRC1, and GRIP1 together with
ERβ1 and determined the regulation of ERβ1 transactivation by these proteins at the ERE and AP-1
sites. SRC1 enhanced ERβ1 transactivation in the absence of E2, whereas Tip60 and GRIP1 reduced
ERβ1 transactivation in the absence or presence of E2. The effect of inhibition persisted when Tip60 and
GRIP1 were overexpressed simultaneously (Fig. 3.7A). At the AP-1 site, all three coregulators were able
to enhance ERβ1 transactivation with or without E2 (Fig. 3.7B). In the absence of E2, co-expression of
Tip60 and GRIP1 had the strongest stimulatory effect on the transactivation. Interestingly,
overexpression of SRC1 abolished the synergistic effects of Tip60 and GRIP1 (Fig. 3.7B). To further
investigate the synergistic effect of Tip60 and GRIP1 on ERβ1 transactivation at AP-1 site, we performed luciferase assays with different ratios of GRIP1 and Tip60 plasmids. Consistent with the results in Fig. 3.7B, co-expression of GRIP1 and Tip60 had a greater enhancement of ERβ1 transactivation compared with expression of GRIP1 alone, while 1:1 ratio of GRIP1 and Tip60 plasmids
82
resulted in the greatest enhancement at AP-1 site (Fig. 3.7C). Next, an immunoprecipitation experiment
was used to determine whether ERβ1, Tip60, and the two p160 coactivators are involved in a
transcriptional complex. Tip60 interacted with ERβ1, GRIP1, and SRC1 (Fig. 3.7D). To conclude, a
multi-protein complex consists of ERβ1, Tip60, GRIP1 and SRC1, whereas Tip60 and GRIP1 synergistically enhance ERβ1 transactivation at the AP-1 site.
Tip60 differentially regulates ERβ1-target genes by modulating ERβ1 binding to their cis-regulatory regions possessing ERE or AP-1 site
In our study, Tip60 either enhances or reduces ERβ1 transactivation at AP-1 or ERE site. To
investigate whether ERβ1-target genes are differentially regulated by Tip60, we determined their gene
expressions in ERβ1 or LacZ stably expressed PC-3 cells (PC-3-ERβ1/PC-3-LacZ) after the knockdown of Tip60. The ectopic expression of ERβ1 and the efficiency of Tip60 knockdown were confirmed by quantitative RT-PCR (Fig. 3.8A and B) and western blotting (data not shown). We found that the expressions of CXCL12 and cyclin D2 were drastically increased in PC-3-ERβ1 compared with the control (PC-3-LacZ) (Fig. 3.8C and D). Moreover, their expressions were differentially regulated upon the knockdown of Tip60 in PC-3-ERβ1 cells. Expression of CXCL12 was further upregulated (Fig.
3.8C), whereas that of cyclin D2 was downregulated after Tip60 depletion (Fig. 3.8D). Cis-regulatory sequence of CXCL12 gene was found to have an ERE site (298) and sequence analysis revealed a predicted AP-1 binding site at the upstream region of cyclin D2 gene (data not shown). In ChIP assays,
ERβ1 and Tip60 were significantly recruited to the respective investigated regions (Fig. 3.8E and F).
Moreover, the co-occupancy of ERβ1 and Tip60 on the respective cis-regulatory regions of CXCL12 and cyclin D2 were confirmed in the re-ChIP assay (Fig. 3.8G). Similar results were observed in the reciprocal re-ChIP assay (data not shown). Next, we investigated the molecular mechanism of
83
differential regulation of ERβ1-target genes by Tip60. Upon the depletion of Tip60, the recruitment of
ERβ1 to the cis-regulatory region of CXCL12 was significantly enhanced, whereas a decrease in the recruitment of ERβ1 to the investigated region of cyclin D2 was observed (Fig. 3.8H). Collectively, our results showed that Tip60 differentially regulates the expression of ERβ1-target genes by modulating the binding of ERβ1 to their respective cis-regulatory regions.
84
Discussion
Estrogen signaling is mediated primarily by ERα and ERβ1, whereas ERβ1 is able to activate
a distinct set of target genes and also to antagonize ERα transactivation (116,218,299-301). Although
ERs share many common coregulators, the differential interaction between the coregulatory proteins and
ERs may be responsible for their distinct functions (111). In this study, Tip60 was found to interact with
ERβ1 in the absence or the presence of E2. Tip60 either enhances or inhibits ERβ1 transactivation,
depending on the cis-regulatory sites. Moreover, Tip60 and GRIP1 enhance the transactivation at the
AP-1 site synergistically. We also showed that ERβ1 is not acetylated by Tip60 and thus that the regulation of ERβ1 activity by Tip60 is independent of its HAT activity. In addition, Tip60 is able to
differentially control the endogenous expression of ERβ1-target genes possessing ERE or AP-1 site by
modulating ERβ1 binding to the respective cis-regulatory regions. On the basis of these data, we suggest
that ERβ1 transactivation is differentially regulated by Tip60 in a regulatory element–dependent
manner.
Tip60 is an interacting partner of some hormone receptors, including ERs, AR, and PR. Their
interactions were shown to require the presence of respective agonists (288). In our current study, we
found that the binding of Tip60 to ERβ1 does not require ligands and that the strength of the interaction
is similar in the absence or presence of E2. The discrepancy between our finding and that from another
group may be due to our use of different ERβ1 sequences and interaction assays. Gaughan et al. used a
construct containing only LBD of ERβ1 in the mammalian two-hybrid assay (288). We used the full- length ERβ1, which is more biologically relevant in terms of protein folding, to show the interaction in yeast two-hybrid assays, in vitro and in vivo co-IP, and subcellular localization studies in different cell lines. It is not uncommon for ligand-independent interactions to occur between ERβ1 and coregulators.
For example, phosphorylation of ERβ1 leads to ligand-independent recruitment of SRC1 (116) and
85
GRIP1 is also recruited by unliganded ERβ1 (111,134,136). Both coactivators stimulated unliganded
ERβ1 transactivation (111,136). Our data suggest that Tip60 interacts with ERβ1 regardless of E2
presence.
The interaction of Tip60 with LBD of ERα in a ligand-dependent manner is well documented
(112,113,288). The distinct mechanisms of recruiting Tip60 by ERα and ERβ1 imply that they may have
different domains interacting with Tip60. We performed domain deletion of ERβ1 followed by
immunoprecipitation to show that the hinge domain of ERβ1 is the interacting region. Although ERs
interact with most coactivators and corepressors at either or both N- and C-termini (302), they also bind to some coregulators at the hinge domain. L7/SPA interacts with the hinge domain of ERα and enhances transactivation of antagonist-occupied ERα at the ERE site (303). ERα also binds to PGC-1 at its hinge domain in a ligand-independent manner (304). Although the hinge domain of ERs is not as well
characterized, it has been shown to affect protein degradation and activity of ERβ1 (305,306), ERα
tethered-mediated AP-1 transactivation (307), and the functional synergy between AF-1 and AF-2 of
ERs (92). Since AF-1 and AF-2 domains are responsible for E2-independent and E2-dependent
activation of the transactivation of ERs (302), we speculate that the atypical interaction interface
between ERβ1 and Tip60 at the hinge domain may contribute to the unique regulation of ERβ1 activity by Tip60.
Tip60 functions as a coregulator of many transcription factors (308). Hence, we determined
its role in the regulation of ERβ1 transactivation by the luciferase assay and used reporter constructs
with different cis-regulatory sequences of the target genes of ERβ1. Tip60 reduced ERβ1 transactivation
at different ERE sequences, such as vitellogenin-, C3-, c-Fos-, pS2- and PR-EREs. Moreover, the inhibitory action of ERβ1 transactivation by Tip60 is in a concentration-dependent but E2-independent manner. Our results imply that Tip60 can inhibit transcription of certain ERβ1-regulated genes
86
possessing ERE sites. In contrast, Tip60 increased the expression of some estrogen-regulated ERα target
genes containing EREs (112,113). Since ERβ1 antagonizes ERα-dependent transcription through hetero-
dimerization (302), Tip60 may be a key factor in determining the antagonism between ERs. ERβ1 also
interacts with other transcription factors to mediate the transcription through tethering. We show that
Tip60 did not regulate ERβ1 transactivation at either the NFκB or the Sp1 site but that it drastically
increased the transactivation at the AP-1 site. Moreover, the enhancement by Tip60 was more drastic in
the absence of E2. It is not surprising for a coregulator to show dual regulation of the activity of
transcription factors. GRIP1 acts as a coactivator of ERα at ERE and AP-1 sites (106,111) but inhibits
the activity of E2-bound ERα, which tethers on c-Jun and NFκB at TNFα promoter (309). In addition,
GRIP1 is either a coactivator or a corepressor of glucocorticoid receptor (GR) in a hormone response
element (HRE)–dependent manner (310). Our study not only shows that the regulation of ERβ1
transactivation by Tip60 occurs in an E2-independent manner but also provides evidence that it can
enhance or inhibit the transactivation at AP-1 response element or ERE, respectively
The modulation by ligands of ERβ1 signaling at different response elements has been well documented (108). We extensively investigated the effects of various steroidal compounds on the transcriptional regulation by Tip60. Consistent with the previous findings (97,108,311), we found that estrogenic compounds (E2 and DPN) and phytoestrogens (GEN, EQ, DAI and API) upregulated ERβ1 transactivation at ERE, whereas SERMs (TAM and RAL) and antiestrogen (ICI) did the opposite.
Surprisingly, DPN, GEN, and EQ abolished Tip60-mediated inhibition at the ERE site. Moreover, all estrogenic chemicals except apigenin significantly inhibited enhancement by Tip60 at the AP-1 site. The discrepancy may be due to differential conformational changes of ERβ1 through binding to different estrogenic chemicals (312,313) and thus affect the formation of the ERβ1 transcriptional complex (312).
Perhaps the binding of these compounds triggers the recruitment of other coactivators to counteract the
87
Tip60-mediated inhibition (276). For example, GEN can recruit SRC1 isoforms to ERβ1 (155,314).
Moreover, all estrogenic chemicals except apigenin significantly inhibited the enhancement by Tip60 at
the AP-1 site. Although Fujimoto et al. suggested that estrogens and phytoestrogens do not exert any regulatory effect on ERβ1-mediated AP-1 transactivation (291), previous findings and our current study
have clearly shown that estrogens or phytoestrogens repress the transactivation at the AP-1 site
(108,315). It is tempting to speculate that these compounds reduce the potency of recruitment of
coactivators, such as Tip60, by ERβ1 at AP-1 site. In contrast, ICI and SERMs were agonists of ERβ1-
mediated AP-1 transactivation, but SERMs did not further upregulate the enhancement by Tip60 as compared with the control. We suggest that SERMs cannot improve the potency of Tip60 recruitment by
ERβ1. Another possible explanation may be that the binding of either Tip60 or SERMs causes a similar conformational change in ERβ1 that is favorable to tethering on the AP-1 site (316-318). Tip60 and
SERMs are thus redundant to the enhancement of ERβ1 transactivation. To conclude, we showed that differential regulation of ERβ1 transactivation by Tip60 at ERE and AP-1 sites is controlled through binding to different ligands.
Tip60 enhances the activities of certain transcription factors through acetylation (308). Thus, we sought to determine whether its regulation of ERβ1 activity is mediated through acetylation. We used different acetylation assays to illustrate that Tip60 is incapable of acetylating ERβ1. This is consistent with studies of other coregulators of ERβ1 that possess HAT activity, but none of them was found to acetylate ERβ1 (116,187,189,192,299). Moreover, acetylation of nuclear receptors is assumed to occur at a conserved motif “K/R-X-K-K” (187), which is absent in ERβ1 (data not shown). These findings suggest that ERβ1 may not be post-translationally modified through acetylation.
In addition to acetylating its interacting partners, Tip60 can auto-acetylate to regulate its activity (319,320). In our in vivo acetylation assays, acetylation of Tip60 was detected only in the
88
immunoprecipitation that used Tip60 antibody but not ERβ1 antibody, revealing that those Tip60
proteins in the ERβ1-Tip60 complex are probably unacetylated. The result implies that ERβ1 may
preferentially interact with unacetylated Tip60, perhaps because auto-acetylation modifies the structure of Tip60 (319). Our study verified that HAT activity of Tip60 does not increase ERβ1 transactivation. In contrast, Tip60∆HAT did not reduce but enhanced ERβ1 activity at the AP -1 site. The result was
confirmed with the use of anacardic acid, which inhibits the HAT activity of Tip60 (37). The
observation may be explained by the increased amount of unacetylated Tip60 that binds to ERβ1. In
fact, HAT activity of Tip60 is not essential to the regulation of the activity of some transcription factors,
such as CREB, STAT3, and PGC-1α (286,287,321). Our data indicate that ERβ1 transactivation is not
regulated through HAT activity of Tip60. Furthermore, the receptor appears to interact preferentially
with unacetylated Tip60.
In the current study, we found that ERβ1 activity was enhanced by Tip60 at the AP-1 site.
The ERβ1-mediated transactivation requires the recruitment of CBP/p300 and p160 coactivators at the
AP-1 response element (106), where ERβ1 interacts primarily with p160 coactivators
(106,297,322,323). These observations urged us to investigate whether Tip60 interacts with p160
coactivators to regulate ERβ1 transactivation. We found that Tip60 interacted with SRC1 and GRIP1,
although it only enhanced ERβ1 activity synergistically with GRIP1 at the AP-1 site. Moreover,
expression of different amount of GRIP1 and Tip60 always had a greater enhancement of ERβ1
transactivation compared with expression of GRIP1 alone, revealing that they simultaneously act as
coactivator of ERβ1 at AP-1 site. It is interesting that SRC1 was not synergistic with the other two
coregulators, implying that it may have other mechanisms regulating ERβ1 transactivation. Because
ERβ1 interacts with Tip60 at its hinge domain and GRIP1 binds to AF-1 and AF-2 domains of the
89
receptor (297), we therefore hypothesize that Tip60 and GRIP1 cooperate to modify the conformation of
ERβ1, permitting more efficient tethering on the AP-1 site.
ERβ1 has been studied extensively about its protective role in prostate cancer (257). We used
ERβ1 stably expressed prostate cancer cell line, PC-3-ERβ1 followed by the knockdown of Tip60 to investigate whether Tip60 regulates the endogenous expression of ERβ1-target genes. The expressions of CXCL12 and cyclin D2 were differentially regulated upon the depletion of Tip60. Cyclin D2 was the first time to identify as an ERβ1 target gene and CXCL12 was shown to be regulated by ERβ1 in a previous study (175). In the ChIP and re-ChIP assays, ERβ1 and Tip60 were shown to co-occupy the cis-regulatory region containing an ERE site of CXCL12 or an AP-1 site of cyclin D2, revealing that both of them are recruited to either target region of certain ERβ1- target genes in the intact chromatin during transcription. Moreover, the result of ChIP assays upon the depletion of Tip60 suggests Tip60 modulate ERβ1 binding to different cis-regulatory regions, resulting in a mechanism by which Tip60 differentially regulates ERβ1 transactivation. We speculate that ERβ1-Tip60 interaction might change the conformation of the transcriptional complex which is unfavorable for binding to ERE site but more suitable for tethering to AP-1 site.
In conclusion, we showed that Tip60 modulates ERβ1 action in a regulatory element– dependent manner as exemplified by its opposing roles on ERβ1 transactivation at the ERE and AP-1 sites. Furthermore, its coregulatory action on ERβ1 appears to be E2-independent at both cis-elements, unlike its action on ERα. Contrary to common belief, Tip60 action is not mediated by its HAT activity.
Our data also suggest that the interaction between Tip60 and GRIP1 synergistically enhances ERβ1 tethering on the AP-1 site. Moreover, Tip60 can modulate the recruitment of ERβ1 to ERE and AP-1
regions of ERβ1-target genes which are differentially regulated by Tip60. Collectively, these data put
90
Tip60 into the category of a multifaceted coregulator in the ERβ1 context, similar to GRIP1 in the regulation of the activities of ERα and GR (106,111,309,310).
91
92
Fig. 3.1 ERβ1 can interact with Tip60 in either the absence or presence of estrogen. A, Tip60 interacts with ERβ1 and ERα in vitro. ERβ1, ERα and HA-tagged Tip60 were translated in vitro and labeled with [35S]methionine. The lysates were mixed and incubated with estradiol (E2) and then immunoprecipitated with HA antibody. The immunoprecipitates were resolved by SDS-PAGE and analyzed by autoradiography. B, ERβ1 interacts with Tip60 in yeast cells independent of E2. ERβ1, ERα, or empty vector (pGBKT7) was transformed into yeast with Tip60. The transformed cells were grown on quadruple dropout agar (QDO) containing X-α- galactosidase and DMSO or E2 until the appearance of blue colonies. C, ERβ1 interacts with Tip60 in vivo. HEK293 cells were grown in charcoal stripped serum (CSS)–containing medium and transfected with ERβ1 and His-tagged Tip60 before the addition of E2. Lysates were precipitated on an Ni-NTA column and immunoblotted with ERβ1 or Tip60 antibody. The samples were run on the same gel. D, ERβ1-Tip60 interaction was confirmed by reciprocal co-immunoprecipitation. Procedures were similar as those in panel D, except that lysates were immunoprecipitated with ERβ1 antibody. E, ERβ1 interacts with Tip60 in an E2- independent manner in hormone-sensitive prostate cancer cell line, PC-3. ERβ1 stably expressed PC-3 cells (PC-3-ERβ1) were grown in CSS–containing medium before the addition of DMSO or E2. Lysates were immunoprecipitated by ERβ1 antibody and immunoblotted with ERβ1 or Tip60 antibody. F, ERβ1 co-localized with Tip60 with or without E2. HEK293 cells were grown in CSS–containing medium transfected with ERβ1 and Tip60 followed by the incubation of DMSO (vehicle) (upper panel) or E2 (lower panel). G, ERβ1 co-localized with Tip60 in PC-3. PC-3-ERβ1 cells were grown in full-serum medium transfected. In panels G and H, antibodies to ERβ1 and Tip60 were used for immunostaining, and DAPI was used as the nuclear marker. H, The co-localization of ERβ1 and Tip60 was confirmed by fluorescence- tagged proteins. Cyan-fluorescent-protein (CFP)-tagged ERβ1 and GFP-tagged Tip60 were transfected into HEK293 cells. Propidium iodide (PI) was used as the nuclear marker. The images in panels F, G and H were captured by a fluorescence microscope. Bar = 20 µm.
93
Fig. 3.2 Hinge domain (HD) of ERβ1 is responsible for the interaction with Tip60. A, Schematic diagram shows the domains of full-length ERβ1 and different domain-deleted constructs. The c-Myc tag was added to the N-terminus of each construct. The strength of interaction between different ERβ1 constructs and Tip60 is represented by "+" and "-" signs. "+++" represents the strongest interaction, whereas "-" represents no interaction. AF-1 = activation function 1; DBD = DNA-binding domain; HD = hinge domain; LBD: = ligand- binding domain; AF-2 = activation function 2. B, HEK293 cells were grown in CSS–containing medium and transfected with Tip60 and different domain-deleted ERβ1 constructs. Lysates were immunoprecipitated with c-Myc antibody. Immunoglobulin IgG was used as the negative control. The immunoprecipitates were immunoblotted with c-Myc or Tip60 antibody. Asterisks (*) denote the positions of ERβ1 and its mutants.
94
95
Fig. 3.3 Tip60 differentially regulates ERβ1 transactivation at ERE and AP-1 sites, but has minimal effect on other transcription factor binding sites. A-E, Tip60 reduces ERβ1 transactivation at various ERE site. ERβ1 was transfected with GFP or Tip60 together with pCMV-β-gal and (A) vitellogenin ERE, (B) C3 ERE, (C) c-Fos ERE, (D) pS2 ERE, or (E) progesterone receptor ERE reporter plasmid into HEK293 cells grown in CSS–containing medium. F, The inhibition of ERβ1 transactivation by Tip60 is concentration-dependent. ERβ1 was transfected with different amounts of GFP and Tip60 together with pCMV-β-gal and vitellogenin ERE reporter plasmid. Different ratios of plasmids of Tip60 to GFP were transfected. G-I, Tip60 enhances ERβ1 transactivation at AP-1 site, but has minimal effect on other transcription factor binding sites. ERβ1 was transfected with GFP or Tip60 together with pCMV-β-gal and reporter plasmids containing the binding site of (G) AP-1, (H) NFκB, or (I) Sp1 into HEK293 cells grown in CSS–containing medium. J-M, Tip60 reduces ERβ1 transactivation at ERE site, but increases its transactivation at AP-1 site in different PCa cell lines. ERβ1 was transfected with GFP or Tip60 together with pCMV-β-gal and reporter plasmids containing (J,L) vitellogenin ERE or (K,M) AP-1 binding site into PC-3 or DU-145 cells grown in CSS–containing medium. After the transfection, HEK293, PC-3 and DU-145 cells were added with DMSO or E2. Relative luciferase activity was determined and normalized with the β-gal activity. Results were the average of three independent experiments. All data are represented as mean ± SD. The statistical significance of the difference in luciferase activity between the overexpression of GFP and Tip60 in the presence of DMSO or E2 is shown as *P<0.05, **P<0.01, ***P<0.001.
96
Fig. 3.4 Various ligands modulate Tip60-mediated regulatory effects on ERβ1 transactivation. A,B, ERβ1 was transfected with GFP or Tip60 together with pCMV-β-gal and (A) vitellogenin ERE or (B) AP-1 reporter plasmids into HEK293 cells grown in CSS–containing medium. Various ligands, namely estradiol (E2) (10 nM), diarylpropiolnitrile (DPN) (10nM), genistein (GEN) (1 µM), equol (EQ) (1 µM), daizein (DAI) (1 µM), apigenin (API) (100 nM), 4-hydroxy- tamoxifen (TAM) (1 µM), raloxifene (RAL) (1 µM), ICI182,780 (ICI) (1 µM), and bisphenol A (BPA) (10 nM), were added, respectively, or DMSO was used as the control after transfection for 24 h. Relative luciferase activity was determined as above. The results were the average of at least two independent experiments. All data are represented as mean ± SD. The statistical significance of the difference in luciferase activity between the overexpression of GFP and Tip60 in the presence of each ligand is shown as *P<0.05, **P<0.01, ***P<0.001.
97
Fig. 3.5 ERβ1 cannot be acetylated by Tip60 and preferentially interacts with unacetylated Tip60. A, Schematic diagram shows the structural domains of Tip60 and the substitution of amino acids on the HAT-defective mutant (Q377E/G380E) (Tip60∆HAT). B, ERβ1 is not acetylated by Tip60 in vitro. His-tagged wild-type of Tip60 (Tip60WT) or Tip60∆HAT was transfected, respectively, into HEK293 cells, and Tip60 proteins were purified on an Ni-NTA column. Recombinant ERβ1 protein and Tip60 were incubated in HAT buffer containing acetyl-CoA. The immunoprecipitates were immunoblotted with acetyl-lysine, ERβ1, or Tip60 antibody. Asterisk (*) denotes the nonspecific band that appeared when the blot was immunoblotted with pan acetyl- lysine antibody. C, ERβ1 is not acetylated by Tip60 in vivo and preferentially interacts with unacetylated Tip60. Tip60WT or HAT was transfected with ERβ1 into HEK293 cells. Lysates were immunoprecipitated with either ERβ1 (left panel) or Tip60 (middle panel) antibody. Immunoglobulin IgG was used as the negative control. The immunoprecipitates were immunoblotted with acetyl-lysine, ERβ1, or Tip60 antibody
98
Fig. 3.6 HAT activity of Tip60 is not necessary for regulation of the ERβ1 transactivation at AP- 1 and ERE sites. A, Expression of Tip60HAT was similar to that of Tip60WT. Lysates were extracted and immunoblotted with Tip60 antibody. β-actin was used as the loading control. B, C, HAT activity of Tip60 is not necessary for the regulation of ERβ1 transactivation at AP-1 and ERE sites. GFP, Tip60WT, or Tip60∆HAT was transfected, respectively, with ERβ1, pCMV-β- gal, (B) AP-1, or (C) vitellogenin-ERE reporter plasmids into HEK293 cells before the addition of E2. D,E, GFP or Tip60 was transfected, respectively, with ERβ1, pCMV-β-gal, (D) AP-1, or (E) vitellogenin-ERE reporters into HEK293 cells. After the transfection, DMSO or E2 together with ethanol (vehicle) or anacardic acid (AnAc) was added as indicated. In panels B–D, relative luciferase activity was determined as in Fig. 3. Results are the average of three independent experiments. Data are represented as mean ± SD. The statistical significance of the difference in luciferase activity between the overexpression of GFP and Tip60 in the presence of DMSO or E2 is shown as *P<0.05, **P<0.01, ***P<0.001.
99
Fig. 3.7 Tip60 interacts with GRIP1 to enhance ERβ1 transactivation at the AP-1 site synergistically. A,B, Tip60 and GRIP1 exert a synergistic effect on ERβ1 transactivation at the AP-1 site. Different combinations of GFP, Tip60, GRIP1, and SRC1 were transfected with ERβ1, pCMV-β-gal, (A) AP-1 or (B) vitellogenin-ERE reporter plasmids as indicated. After the transfection, DMSO or 10 nM E2 was added as indicated. C, The synergistic effect of Tip60 and GRIP1 on the ERβ1 transactivation at the AP-1 site is concentration-dependent. GFP or different ratios of plasmids of Tip60 to GRIP1 were transfected. DMSO was added after the transfection. Relative luciferase activity was determined as in Fig. 3. Results were the average of three independent experiments. Data are presented as mean ± SD. The statistical significance of the difference in luciferase activity between overexpressing Tip60, GRIP1, and GFP is shown as *P<0.05, **P<0.01, ***P<0.001. D, Tip60 forms a multi-protein complex with p160 coactivators and ERβ1. HEK293 cells were transfected with Tip60, ERβ1, SRC1, and GRIP1 and grown in CSS–containing medium. Lysates were immunoprecipitated with Tip60 antibody. Immunoglobulin IgG was used as the negative control. The immunoprecipitates were immunoblotted with Tip60, ERβ1, GRIP1, or SRC1 antibody as indicated.
100
101
Fig. 3.8 Tip60 differentially regulates ERβ1-target genes possessing ERE or AP-1 sites at their cis-regulatory regions in PC-3 cells. A,B, Expressions of ERβ1 and Tip60 in ERβ1 and LacZ stably expressed PC-3 cells upon the knockdown of Tip60 were determined. PC-3-LacZ/-ERβ1 cells were grown in CSS–containing medium and transfected with non-targeting control siRNA (siNT) or siRNAs specific to Tip60 (siTip). E2 was added after 24 h. Expressions of (A) ERβ1 and (B) Tip60 were determined by quantitative reverse transcription (RT)-PCR. Human GAPDH was used as the housekeeping gene. C,D, Tip60 differentially regulates ERβ1-target genes. PC- 3-LacZ/-ERβ1 cells were treated as described in panel A and B. Expression of (C) CXCL12 and (D) cyclin D2 were determined by quantitative RT-PCR. The results are the average of three independent experiments. All data are represented as mean ± SD. The statistical significance of the difference in gene expression between different treatments is shown as *P<0.05; **P<0.01; ***P<0.001. E-G ERβ1 and Tip60 are both recruited to the cis-regulatory regions of CXCL12 and cyclin D2. PC-3-ERβ1 cells were grown in CSS–containing medium added with E2. ChIP assays were performed with (E) ERβ1 or (F) Tip60 antibody. (G) Re-ChIP assay was performed with Tip60 antibody followed by the second immunoprecipitation with ERβ1 antibody. The ChIP DNA was amplified by real-time PCR for the target regions containing an ERE site of CXCL12 or an AP-1 site of cyclin D2. The genomic region of ERβ isoform 5 (ERβ5) containing neither an ERE nor AP-1 site was used as the negative control. The fold enrichment of recruitment of ERβ1 and/or Tip60 at the target regions is relative to respective IgG controls. The results are the average of two independent experiments. All data are represented as mean ± SD. The statistical significance of the difference in the recruitment between ERβ1 (and/or Tip60) and IgG is shown as *P<0.05. H Tip60 differentially regulates the recruitment of ERβ1 to the cis-regulatory regions of CXCL12 and cyclin D2. PC-3-ERβ1 cells were grown in CSS– containing medium added with E2 and transfected with siRNAs (siNT or siTip) for 48 h. ChIP assays were performed with ERβ1 antibody. The procedures of the amplification of ChIP DNA were similar to those described in panel E to G. The results are the average of two independent experiments. Data are represented as mean ± SD. The statistical significance of the difference in the ERβ1 recruitment with or without the knockdown of Tip60 is shown as *P<0.05.
102
Fig. 3.9 A model of the differential functions of Tip60 on regulating ERβ1 activity at heterologous response elements N-terminus of ERβ1 interacts with unacetylated Tip60 in a ligand-independent manner. Since DBD of ERβ1 is responsible for direct binding to the ERE sequences, Tip60 inhibits its transactivation through interacting with the N-terminus and render it unfavorable for effective binding. The co-repressive effect persists in the absence or presence of estrogens. In contrast, Tip60 and GRIP1 interact and act as tethering surface for ERβ1 at AP-1 sites. They bind to different regions of ERβ1 and allow it to activate the cfos/cjun-mediated transcription more efficiently. This co-activation is inhibited by estrogens but is promoted by antiestrogens and SERMs.
103
Table 3.1 Primers used in the experiments of domain-deletion study of ERβ1 and site-directed mutagenesis of Tip60
Primers for Sequences
Domain deletion of ERβ1
ERβ1∆AF-1-F CACCATGGAGGAGCAGAAGCTGATCTCAGAGGAG GACCTGTGCGCTGTCTGCAGCGATTA
ERβ1∆AF-1-R TGGATCCTCACTGAGACTGTGGGTTCT
ERβ1∆AF-1-DBD-F CACCATGGAGGAGCAGAAGCTGATCTCAGAGGAG GACCTGGTGAAGTGTGGCTCCCGGAG
ERβ1∆AF-1-DBD-R TGGATCCTCACTGAGACTGTGGGTTCT
ERβ1∆AF-1-HD-F CACCATGGAGGAGCAGAAGCTGATCTCAGAGGAG GACCTGGAGTTGGTACACATGATCAG
ERβ1∆AF-1-HD-R TGGATCCTCACTGAGACTGTGGGTTCT
ERβ1∆LBD-AF-2-F CACCATGGAGGAGCAGAAGCTG
ERβ1∆LBD-AF-2-R TCAAAGCACGTGGGCATTCAGCA
ERβ1∆AF-2-F CACCATGGAGGAGCAGAAGCTG
ERβ1∆AF-2-R TCACTTGTCGGCCAACTTGGTCA
Site-directed mutagenesis of Tip60’s HAT domain
Tip60∆HAT-F GCCTCCCTACGAGCGCCGGGAATACGGCAAGC
Tip60∆HAT-R GCTTGCCGTATTCCCGGCGCTCGTAGGGAGGC
104
Table 3.2 Primers used in the experiments of quantitative RT-PCR and ChIP real-time PCR
Primers for Sequences
Quantitative RT-PCR
ERβ1-RT-F TGGCTAACCTCCTGATGCTC
ERβ1-RT-R TCCAGCAGCAGGTCATACAC
Tip60-RT-F CGGAGGTGGGGGAGATAAT
Tip60-RT-R ATGTCCTTCACGCTCAGGAT
CXCL12-RT-F TTGACCCGAAGCTAAAGTGG
CXCL12-RT-R TGGGCTCCTACTGTAAGGGTT
CyclinD2-RT-F TGAGCTGCTGGCTAAGATCA
CyclinD2-RT-R ACGTTGGTCCTGACGGTACT
GAPDH-RT-F GAAGGTGAAGGTCGGAGTCA
GAPDH-RT-R GACAAGCTTCCCGTTCTCAG
ChIP real-time PCR
CXCL12-ChIP-F AGGCATCACAATGCAAATCA
CXCL12-ChIP-R AGGCTGGTGAGATGCTGAGT
CyclinD2-ChIP-F GTCTCTCCCCTTCCTCCTGG
CyclinD2-ChIP-R GCCCTGACACGTGCTCTAA
ERβ5-ChIP-F CCCTAAGGAGCTGCTCTGCTTG
ERβ5-ChIP-R TATAAACCCCAGCAATTGAAA
105
Chapter 4: Estrogen-receptor Beta Isoform 5 (ERβ5) confers sensitivity of breast cancer cells to
chemotherapeutic agent–induced apoptosis through interaction with Bcl2L12
Abstract
Alternative splicing of estrogen-receptor beta (ERβ) yields five isoforms but their functions
remain elusive. ERβ isoform 5 (ERβ5) has been positively correlated with better prognosis and longer
survival of patients with breast cancer (BCa) in various clinical studies. In this study, we investigated the
inhibitory role of ERβ5 in BCa cells. Although ERβ5 does not reduce proliferation of BCa cell lines
MCF-7 and MDA-MB-231, its ectopic expression significantly decreases their survival by sensitizing
them to doxorubicin- or cisplatin-induced apoptosis through the intrinsic apoptotic pathway. Moreover,
we discovered Bcl2L12, which belongs to the Bcl-2 family regulating apoptosis, to be a specific
interacting partner of ERβ5, but not ERβ1 or ERα, in an estradiol (E2)-independent manner.
Knockdown of Bcl2L12 enhanced doxorubicin- or cisplatin-induced apoptosis, and this process was
further promoted by ectopic expression of ERβ5. Whereas Bcl2L12 was previously shown to inhibit
apoptosis through binding to caspase 7, such interaction is reduced in the presence of ERβ5, suggesting a mechanism by which ERβ5 sensitizes cells to apoptosis. In conclusion, ERβ5 interacts with Bcl2L12 and functions in a novel estrogen-independent molecular pathway that promotes chemotherapeutic-agent
induced apoptosis of BCa cells.
106
Introduction
Breast cancer (BCa) is the leading cause of cancer-related death in women worldwide.
Estrogen receptors (ERs) are one of the most important biomarkers for the prediction of prognosis and response to therapy among patients with BCa (324). Hormonal therapy via estrogen depletion or with selective ER modulators (SERMs) is widely used to block the action of estrogen on its receptors and to induce cell death. Nonetheless, this therapy can be applied only in patients with estrogen-sensitive BCa
(325). Even worse, some patients with advanced BCa eventually are unresponsive to SERMs (326,327) and require chemotherapy as second-line treatment, with its severe adverse effects, especially at high dosage (328,329).
In contrast to ERα, which has a proliferative action in BCa, ERβ has been found during the last few years to be protective. Although ERα is generally known to promote BCa tumorigenesis
(330,331), ERβ was found to antagonize ERα by negating ERα activity (235). A decrease in ERβ expression during the progression of BCa suggests that ERβ is antiproliferative and suppresses carcinogenesis (239,240,245). ERβ also can inhibit the survival of BCa cells by promoting apoptosis and enhancing the efficacy of apoptotic chemotherapeutic agents (241-244). For example, ERβ expression triggers the activation of p53 through phosphorylation and enhances apoptosis (332,333). A genome- wide study showed that ERβ downregulates antiapoptotic factors in either the absence or presence of estradiol (E2) (217). Its expression also sensitizes BCa cells to doxorubicin and cisplatin (334,335), an effect independent of ligand. Moreover, various studies showed that ERβ agonists confer resistance of
BCa cells to chemotherapeutic agents (336-338), suggesting that ERβ may enhance the chemosensitivity of cells in a ligand-independent manner.
Alternative splicing of ESR2 gene produces ERβ1 (or wild-type ERβ) and its four isoforms, including ERβ2 to ERβ5, which possess unique amino acid sequences at their carboxyl (C)-terminus
107
(235). Although ~90% of their sequences are identical with that of ERβ1, their binding to estrogen is
either weak (ERβ4 and 5) or absent (ERβ2) (130). Our previous study demonstrated that the AF-2
(activation function 2) domain at C-termini is responsible for their estrogen independence (130).
Therefore, these isoforms are considered to be transcriptionally inactive but capable of modulating
ERβ1- or ERα-mediated transcription when heterodimerized with them (339,340). ERβ5 expression, similar to that of ERβ1, was shown to be protective in patients with BCa (253,255) and may inhibit tumor growth (256). Other studies reported a positively association of ERβ5 expression with a longer relapse-free survival (RFS) (254) and a significant correlation of its nuclear expression with overall survival (OS) (253), suggesting that ERβ5 expression may be a powerful prognostic marker for BCa.
Thus, we are interested in clarifying its functions in BCa.
Our current study revealed the role and molecular mechanism of ERβ5 in apoptosis of BCa cells. To investigate functions of ERβ5, we performed yeast two-hybrid screening and isolated Bcl2L12, which is a Bcl-2 family member, and found that Bcl2L12 interacts specifically with ERβ5 but not with other ER subtypes. Bcl2L12 has opposing roles in apoptosis in different cancers (341,342). Therefore, we also determined the effect of Bcl2L12 expression on BCa cell lines treated with apoptosis-inducing drugs. Moreover, we investigated the relationship between ERβ5-mediated sensitization of cells to apoptosis and the interaction of ERβ5 with Bcl2L12 and found that ERβ5 confers sensitivity of BCa cells to apoptosis-inducing chemotherapeutic agents through direct interaction with Bcl2L12.
108
Materials and Methods
Cell cultures and reagents
MCF-7, MDA-MB-231, 293T, and 293FT cells were purchased from ATCC (ATCC,
Manassas, VA) and maintained according to the manufacturer's protocols. Stably expressed cell lines
were also supplemented with blasticidin (10 μg/ml) (Life Technologies, Carlsbad, CA).
Plasmids were transfected into 293T or 293FT cells by Lipofectamine 2000 (Life Technologies).
DharmaFECT 1 was used as the siRNA transfection reagent (Thermo Scientific Dharmacon, Florence,
KY) for MCF-7 and MDA-MB-231. Procedures of transfection were those recommended by the
manufacturer . The chemotherapeutic agents doxorubicin hydrochloride and cisplatin (cis-
diamminedichloroplatinum(II), CDDP) were purchased from Sigma Aldrich (St. Louis, MO).
Plasmids and siRNAs
Full-length ERβ1, ERβ5, ERα, and Bcl2L12 were cloned into pcDNA-HisMax (Life
Technologies). The siRNA oligonucleotides specific to Bcl2L12, siL12-1
(AAGCUGGUCCGCCUGUCCU), and siL12-2 (UGGUGGAGCUGUUCUGUAG), were used for the
knockdown of Bcl2L12 (Thermo Scientific Dharmacon). The sequences were based on the published
data of Stegh et al. (343). ONTARGETplus non-targeting siRNA (siNT) was used as the negative
control (Thermo Scientific Dharmacon).
Antibodies
Rabbit polyclonal anti-ERβ (H-150) and goat polyclonal anti-caspase 7 (N-17) were
purchased from Santa Cruz Biotechnology (Dallas, TX). Mouse monoclonal anti-His (THE His) was purchased from Genescript (Piscataway, NJ). Mouse monoclonal anti-ERβ (14C8) was purchased from
109
Abcam (Cambridge, MA). Rabbit anti-cleaved PARP, anti-cleaved caspase 3, anti-cleaved caspase 7,
anti-cleaved caspase 8, anti-caspase 9 were purchased from Cell Signaling Technology (Danvers, MA).
EZview anti-HA affinity gel was purchased from Sigma Aldrich. Two custom rabbit polyclonal anti-
Bcl2L12 (anti-L12-1 and anti-L12-2) were kindly provided by Dr. Alexander H. Stegh at Northwestern
University, Evanston, IL. All control IgGs were purchased from Santa Cruz Biotechnology.
Construction of ERβ5 stably expressed cell lines
Procedures of constructing stably expressed cell lines have been described previously (236).
In brief, full-length ERβ5 or LacZ (negative control), respectively, was subcloned into pLenti6 lentiviral vector by Multisite Gateway Cloning (Life Technologies) and then transfected into 293FT cells for production of lentivirus. The titer of each lentivirus was measured, and the multiplicity of the infection of MCF7 and MDA-MB-231 cells was determined. Lentivirus-infected MCF-7 and MDA-MB-231 cells were selected with blasticidin (10 μg/ml) for 3 weeks. Stable expression of ERβ5 or LacZ was determined by quantitative reverse transcription (RT)-PCR, western blot, and β-galactosidase assay.
RNA extraction and quantitative reverse transcription (RT)-PCR
Total RNA was extracted with TRIZOL reagent (Life Technologies) and cDNA was
synthesized with SMART MMLV reverse transcriptase with poly d(T) primer (Promega, Fitchburg,
WI). All the procedures followed the manufacturer’s instructions. Quantitative reverse transcription
PCR reactions were performed with ABI7900 real-time PCR system (Life Technologies). Intron- spanning primers of ERβ5 (forward 5′-CGGAAGCTGGCTCACTTGCT-3′; reverse 5′-
CTTCACCCTCCGTGGAGCAC-3′), Bcl2L12 (forward 5′- CCTGTTCCAACTCCACCTAGAA-3′; reverse 5′-GACTCAGAGGGGGCTGCT-3′) were used. The primers of Bcl2L12 were designed
110
specifically for amplification of the sequence in the wild-type of Bcl2L12 but not in the truncated form,
Bcl2L12A.
MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) cell proliferation assay
MCF-7 and MDA-MB-231 were seeded in 96-well plates at 3 × 103. After 24 h, The MTS
assay was performed to normalize the number of cells in each well. The CellTiter 96 AQueous Non-
radioactive Cell Proliferation Assay (Promega), following the manufacturer's protocol, was used for the
experiment. The reading was taken at 24, 72, and 120 h for cell-proliferation experiments or after 24 h
and 48 h of drug treatments for cell-viability experiments.
Treatment with apoptosis-inducing chemotherapeutic agents
Cells were seeded on six-well plates at 3.3 × 105 (MCF-7) or 1.8 × 105 (MDA-MB-231).
They were stably transfected with expression plasmids and/or transiently transfected with siRNAs as
described. Medium was added with or without doxorubicin or cisplatin at different concentrations after
24 h. The adherent and non-adherent cells were harvested and lysed with M-PER lysis buffer (Thermo
Scientific Pierce, Florence, KY) containing complete EDTA-free protease inhibitor cocktail
(Calbiochem, Billerica, MA). Equal amounts of total protein lysates were used in western-blot analysis.
Different antibodies to apoptotic markers (cleaved PARP, cleaved caspase 3, cleaved caspase 7, cleaved caspase 8, and cleaved caspase 9) and other relevant antibodies were used as stated. Target proteins were detected with IRDye secondary antibody, and signals were obtained with the Odyssey Infrared Imaging
System (LiCor Bioscence, St. Lincoln, NE). Relative band intensities were measured by ImageJ analysis
(NCBI, Bethesda, MD).
111
Staining with annexin V and 7-aminoactinomycin D (7-AAD)
MCF-7 and MDA-MB-231 cells were seeded on 12-well plates at 2 × 105 (MCF-7) or 1 × 105
(MDA-MB-231). The medium was added, with doxorubicin or cisplatin at different concentrations, for
18 h. The adherent and non-adherent cells were collected. Cells were washed with PBS and resuspended in the binding buffer and then incubated with annexin-V-Alexa fluor 488 (Life Technologies) and 7-
AAD (BD Biosciences, San Jose, CA) for 10 min in the dark. Fluorescence-activated cell sorting
(FACS) analysis was performed with FACS Calibur (Becton Dickinson, Franklin Lakes, NJ). Data
analysis was done by CellQuest Pro version 5.2 (BD Biosciences).
Yeast two-hybrid screening
Human prostate MATCHMAKER cDNA library (Clontech, Mountain View, CA) was used as prey library for screening. C-terminal ERβ was cloned into the bait vector pGBKT7 (Clontech). The
screening procedures followed the manufacturer’s protocol. In brief, the bait vector and prey library
were transformed to yeast strain AH109 and Y187, respectively. Yeast mating was performed at 30 C̊ at a low shaking speed. Clones were selected on quadruple nutrient dropout agar (SD/-Ade-His-Leu-Trp).
Positive clones were isolated, and the presence of coding sequences was confirmed by PCR screening.
The interaction was confirmed by co-transforming bait and prey plasmids into yeast strain Y187 using the polyethylene glycol-lithium acetate method of the Yeastmaker yeast transformation system
(Clontech). Full-length ERβ1, ERβ5, and ERα were subcloned into pGBKT7 vector as baits in the co- transformation assay. Transformed cells were grown on QDO agar with X-α-galactosidase for 4 days until blue yeast colonies appeared.
112
In vitro co-immunoprecipitation (co-IP)
The yeast plasmid containing the partial sequence of Bcl2L12 was extracted. T7 promoter and HA tag were added to the N-terminus of the coding sequence by the PCR reaction. Plasmids of full- length ERβ1, ERβ5, and ERα and PCR products containing Bcl2L12 were respectively translated in vitro by the TNT T7-recticulocyte system (Promega) labeled with EasyTag EXPRESS 35S protein labeling mix (Perkin Elmer, Hebron, KY). In vitro–translated bait and prey proteins were incubated together in the absence or presence of E2 at 4 ̊C for 1 h. Lysates were then immunoprecipitated with 20
µl anti-HA affinity gel (Sigma Aldrich) at 4 C̊ overnight. The samples were subjected to SDS-PAGE.
Dried gels were exposed to X-ray films for 72 h with intensifying screen for signal enhancement
(Kodak). The films were scanned with the Odyssey Infrared Imaging System (LiCor Bioscence).
Mammalian co-IP
The 293T cells were seeded on 60-mm plates at 3 × 106 in charcoal-stripped serum (CSS) medium and transfected with different plasmids for 24 h; the culture medium was added with DMSO (as vehicle control) or 10 nM estradiol (E2) as indicated. MCF-7 cells grown in full-serum medium were used in the co-immunoprecipitation experiment. Cells were lysed with IP lysis buffer (Thermo Scientific
Pierce) containing protease inhibitor. One milligram of lysate was immunoprecipitated with 2 µg of the appropriate antibodies at 4 ̊C overnight and then with protein G Dynabeads (Life Technologies). Control
IgG was used as the negative control. The samples were subjected to western-blot analysis. IRDye secondary antibodies were used to detect protein bands and the Odyssey Infrared Imaging System
(LiCor Bioscence) was used to obtain the signals
113
Immunofluorescence staining
The 293T cells were seeded on round coverslips and transfected with ERβ5 and Bcl2L12;
MCF-7-ERβ5 cells were also seeded on coverslips without any transfection. Cells were fixed in 10% formalin at room temperature for 20 min and permeabilized with 1% NP-40. Normal chicken serum
(10%) was used for blocking. Mouse ERβ (14C8) and rabbit Bcl2L12 antibodies (anti-L12-2) were
incubated with the cells at room temperature for 1 h. Different fluorescent secondary antibodies were
then incubated with the cells for 1 h in the dark. Cell nuclei were counterstained with DAPI (Sigma
Aldrich). Prolong R Gold antifade reagent (Life Technologies) was used for enhancing signals. The
fluorescent images were obtained by an Axiovert 200M fluorescent microscope equipped with an
AxioCam MRm camera and Axiovision 4.8 software (Carl Zeiss, Oberkochen, Germany).
Statistical analysis
Student's t-test was used for statistical analysis (GraphPad Software, La Jolla, CA). All P-
values were two-sided, and P<0.05 was considered to be statistically significant.
114
Results
Ectopic expression of ERβ5 in BCa cell lines does not alter cell proliferation
To investigate the underlying mechanisms and functions of ERβ5 in BCa, we constructed
BCa cell lines expressing either ERβ5 or LacZ. Two BCa cell lines, MCF-7 and MDA-MB-231, were chosen because of their different ERα and p53 status; MCF-7 is ERα- and p53-positive, whereas MDA-
MB-231 is ERα-negative and possesses a mutant form of p53 (344,345). The mRNA and protein expression were measured after the construction of ERβ5-stably expressed MCF-7 (Fig. 4.1A) and
MDA-MB-231 (Fig. 4.1B). Unlike the antiproliferative role of ERβ1 in BCa (346), ectopic expression of ERβ5 did not alter cell proliferation of either cell line (Fig. 4.1, C and D), suggesting that ERβ5 has no significant effect on cell proliferation in BCa cells.
ERβ5 functions in the intrinsic apoptotic pathway and sensitizes BCa cell lines to doxorubicin-induced apoptosis
ERβ5 expression significantly correlates with better RFS and OS of patients with BCa
(253,254). Although ERβ5 expression does not alter the proliferation of BCa cells, it may determine cell survival via other molecular pathways, such as apoptosis. Doxorubicin induces apoptosis and is a standard chemotherapy for patients with BCa (347), whereas its high dosage increases the risk of cardiotoxicity and other adverse effects (348). To determine whether the presence of ERβ5 can sensitize cells to doxorubicin treatment, we treated ERβ5 or LacZ stably expressed MCF-7 (MCF-7-ERβ5/-LacZ) with different concentrations of doxorubicin for 12 h (data not shown) or 24 h (Fig. 4.2A). With doxorubicin treatment, MCF-7-ERβ5 showed an increase, as compared with the LacZ control, in the expression of cleaved caspase 9 but not cleaved caspase 8, indicating activation of the intrinsic pathway.
The expression of cleaved PARP and cleaved caspase 7, which are the late apoptotic markers, also
115
increased (Fig. 4.2A). To further determine ERβ5-mediated sensitization, we confirmed the apoptotic status of cells using annexin V/7-AAD FACS analysis. Again, we found an increase in apoptosis of
MCF-7-ERβ5 cells with doxorubicin treatment as compared with the LacZ control (Fig. 4.2B).
Moreover, after doxorubicin treatment, survival of MCF-7-ERβ5 cells was significantly lower than that
of MCF-7-LacZ, as measured by the MTS assay (Fig. 4.2C). Results were similar in ERβ5 or LacZ
stably expressed MDA-MB-231 (MDA-ERβ5/-LacZ) (Fig. 4.3, A to C). Thus, we infer that ERβ5
sensitizes BCa cells to doxorubicin-induced apoptosis through an intrinsic apoptotic pathway.
ERβ5 sensitizes BCa cell lines to cisplatin-induced apoptosis
ERβ5 was shown to confer chemosensitivity of BCa cells to doxorubicin-induced apoptosis.
Because cisplatin induces apoptosis via a mechanism distinct from that with doxorubicin (349,350) and is effective against triple-negative BCa (351-353), we next examined whether ERβ5 can improve the efficacy of cisplatin in BCa cells. Experiments were similar to those done for doxorubicin in BCa cell lines. MCF-7-ERβ5 showed greater sensitivity to cisplatin treatment than the LacZ control, as reflected by enhanced activation of PARP, caspase 9 and caspase 7 (Fig. 4.4A) and a greater percentage of apoptotic cells in FACS analysis (Fig. 4.4B). Cell survival was significantly decreased with cisplatin treatment in MCF-7-ERβ5 as measured by the MTS assay (Fig. 4.4C). Results were similar in MDA-
MB-231 ectopically expressed with ERβ5 (Fig. 4.5, A to C). These findings, taken together, indicate that
ERβ5 enhances the chemosensitivity of MCF-7 and MDA-MB-231 to cisplatin-induced apoptosis.
Bcl2L12 specifically interacts with ERβ5 in an E2-independent manner
To identify novel ERβ5-mediated molecular pathways, we employed yeast two-hybrid screening using ERβ as bait to isolate its interacting partners in a human total cDNA library. We isolated
116
a clone that encodes amino acids 14 to 273 of human Bcl2L12. To eliminate a false-positive interaction
and to determine whether Bcl2L12 interacts with other ERs, we performed yeast co-transformation of
Bcl2L12 with full-length ERβ5, ERβ1 or ERα. Bcl2L12 showed a strong interaction with ERβ5 and a
weak interaction with ERα but did not interact with ERβ1 (Fig. 4.7A). The physical binding between the
proteins was further verified by in vitro co-IP. ERβ5 interacted with Bcl2L12 (Fig. 4.7B, lane 2), whereas ERα (Fig. 4.7B, lanes 6 and 7) and ERβ1 (Fig. 4.7B, lanes 9 and 10) could not be co- immunoprecipitated with Bcl2L12 in the absence or presence of E2. Next, we confirmed the interaction in mammalian cells. Full-length sequence of Bcl2L12 was cloned from MCF-7. Consistent with the
results in two-hybrid assays and in vitro co-IP, Bcl2L12 was co-immunoprecipitated with ERβ5
independent of E2 in 293T cells (Fig. 4.6A, lanes 3 and 5) but not with ERβ1 or ERα (data not shown).
The interaction was further confirmed in MCF-7-ERβ5 (Fig. 4.6B). Moreover, immunofluorescence staining showed that ERβ5 and Bcl2L12 were localized in the same subcellular compartments. Co- localization was observed in both nucleus and cytoplasm of 293T (Fig. 4.7C) and MCF-7-ERβ5 cells
(Fig. 4.7D). In conclusion, we determined that ERβ5, but not ERα or ERβ1, interacts with Bcl2L12 in an
E2-independent manner.
Knockdown of Bcl2L12 sensitizes BCa cells to doxorubicin and cisplatin
Bcl2L12 acts as a pro- or anti-apoptotic factor in different cancers (342,354). To explore the functions of Bcl2L12 in BCa, we used the gene knockdown approach, since Bcl2L12 is highly expressed in MCF-7 and MDA-MB-231 (Fig. 4.8A). Moreover, ectopic expression of ERβ5 did not alter the expression of Bcl2L12 (Fig. 4.8, B and C). Two Bcl2L12 siRNAs (siL12-1 and siL12-2), validated
by Stegh et al. (343), significantly decreased its mRNA and protein levels in MCF-7 (Fig. 4.8, D and E)
and MDA-MB-231 (Fig. 4.8, F and G). PARP, caspase 9, caspase 7, and caspase 3 were moderately
117
activated in the absence of apoptotic drugs after knockdown of Bcl2L12 by either siL12-1 (Fig. 4.9B, lanes 4 and 10) or siL12-2 (Fig. 4.10B, lanes 3 and 7) in MDA-MB-231.
With doxorubicin treatment, depletion of Bcl2L12 by siL12-1 in MCF-7 increased the activation of PARP, caspase 9, caspase 7 (Fig. 4.9A, lanes 5 and 11). Although activation of caspase 7 and caspase 3 was enhanced with similar treatment in MDA-MB-231 (Fig. 4.9B, lanes 5 and 11), cleavage of PARP and caspase 9 was similar with and without the knockdown by siL12-1 (Fig. 4.9B, lanes 2, 5, 8, and 11). MCF-7 and MDA-MB-231 with ectopic expression of ERβ5 and knockdown of
Bcl2L12 showed the highest expression of apoptotic markers (Fig. 4.9, A and B, lane 11). The inhibitory effect of Bcl2L12 on doxorubicin-induced apoptosis was confirmed by its depletion with the use of its second siRNA, siL12-2 (Fig. 4.10, A and B, lanes 4 and 8). The suppression of cisplatin-induced apoptosis by Bcl2L12 also was determined. Knockdown of Bcl2L12 did not facilitate the activation of apoptotic markers in MCF-7-LacZ/-ERβ5 (Fig. 4.9A, lanes 6 and 12). However, downregulation of
Bcl2L12 expression increased the level of cleaved caspase 9, cleaved caspase 7, and cleaved caspase 3 but not cleaved PARP in MDA-LacZ/-ERβ5 (Fig. 4.9B, lanes 6 and 12). Next, FACS analysis was performed to confirm the inhibitory role of Bcl2L12 in drug-induced apoptosis. The percentage of apoptotic cells in both cell lines significantly increased upon the knockdown of Bcl2L12 followed by treatment with doxorubicin or cisplatin (Fig. 4.9, C and D). Consistent with the results of western-blot analysis, ectopic expression of ERβ5, together with Bcl2L12 depletion, resulted in the highest percentage of apoptotic cells (Fig. 4.9, C and D, lower right panel). Our results not only reveal that
Bcl2L12 confers chemoresistance to doxorubicin- or cisplatin-induced apoptosis in BCa cells but also imply that ERβ5 and Bcl2L12 play opposing roles in the apoptosis of BCa cells.
ERβ5 sequesters Bcl2L12 from interacting with caspase 7
118
In our current study, ERβ5 sensitized BCa cells to apoptosis induced by chemotherapeutic
agents, whereas Bcl2L12 inhibited the response to treatment with different drugs. Since Bcl2L12 has
been shown to repress apoptosis in glioblastoma by preventing the cleavage of caspase 7 through
physical binding (343), we proposed that the interaction between Bcl2L12 and caspase 7 also occurs in
BCa and that it may be inhibited by ERβ5. To understand how ERβ5-Bcl2L12 interaction regulates
apoptosis in BCa cells, we performed co-IP of Bcl2L12 and caspase 7 in MCF-7. Upon
immunoprecipitation with antibody to Bcl2L12, caspase 7 was co-immunoprecipitated in MCF-7-LacZ, whereas the binding of caspase 7 to Bcl2L12 was drastically reduced in MCF-7-ERβ5 (Fig. 4.11). Since
ERβ5 interacted with Bcl2L12 in MCF-7 (Fig. 4.6B), our data suggest that ERβ5 inhibits the physical binding between Bcl2L12 and caspase 7.
119
Discussion
ERβ5 has been shown to be positively correlated with survival outcomes such as RFS and
OS in patients with BCa (253,254), suggesting that ERβ5 is a good prognostic marker in BCa. In our
study, expression of ERβ5, unlike that of ERβ1, had no effect on cell proliferation. Nonetheless, ERβ5
decreased the cell survival by sensitizing the BCa cell lines MCF-7 and MDA-MB-231 to doxorubicin-
or cisplatin-induced apoptosis. In contrast, Bcl2L12, which was isolated as an ERβ5-specific interacting
partner, conferred chemoresistance of BCa cells to drug-induced apoptosis. We also showed that ERβ5 prevented Bcl2L12 from interacting with caspase 7. Thus, ERβ5 is able to sensitize BCa cells to chemotherapeutic agents through Bcl2L12.
Ectopic expression of ERβ5 sensitized the two BCa cell lines to doxorubicin-induced
apoptosis, as shown in western-blot analysis, FACS analysis, and cell viability assays. In addition, upon
treatment with cisplatin, ERβ5 enhanced apoptosis of MDA-MB-231, as well as MCF-7, which is resistant to the drug (355-357). Since MCF-7 and MDA-MB-231 possess wild-type and mutant p53, respectively, our data indicate that the ERβ5-mediated apoptotic pathway is independent of p53.
Moreover, ERα status did not affect the sensitivity of these cell lines to doxorubicin and cisplatin.
Therefore, we suggest that ERβ5-mediated sensitization for chemotherapeutic agent–induced apoptosis is independent of its inhibition of ERα genomic signaling but probably acts via a novel pathway involving the interaction with an apoptotic protein, Bcl2L12.
We performed yeast two-hybrid screening to identify novel binding partners of ERβ5. One of the prey candidates, Bcl2L12, interacted specifically with ERβ5 but not with ERβ1 or ERα in either the absence or presence of E2. ERβ5 has the same N-terminus sequence as ERβ1 but a different C-terminal region
(130). The observation is not uncommon for ERs and their interacting proteins. Physical binding between ERs and p160 coactivators requires synergy between N-terminal AF-1 and C-terminal AF-2
120
domains (106,134,157,297,358,359). Moreover, our three-dimensional molecular models showed that the absence of helix 12 and the incomplete helix 11 of ERβ5 constitute a conformation of the C-terminus different from that of ERβ1 (130). Thus, the unique protein conformation of ERβ5 may be responsible for its interaction with Bcl2L12. Collectively; the data reveal that Bcl2L12 interacts specifically with
ERβ5, but not ERα or ERβ1, in an E2-independent manner. In addition, this is the first discovery of an interaction between an ER and a Bcl-2 family member.
To determine the significance of the ERβ5-Bcl2L12 interaction for apoptosis, we first clarified the function of Bcl2L12 in BCa cells. Using two validated siRNAs (343), we showed that
Bcl2L12 confers chemoresistance of BCa cells to doxorubicin or cisplatin. Moreover, ectopic expression of ERβ5 with Bcl2L12 depletion resulted in the highest degree of apoptosis in the two cell lines, as reflected in western-blot and FACS analyses. Although Bcl2L12 depletion followed by cisplatin treatment of MCF-7 dramatically increased apoptosis in FACS analysis, expression of apoptotic markers did not show a change in western-blot analysis. The discrepancy between the results of the two experiments may be due to differences in the apoptotic markers used in FACS (cell-surfaced phosphatidylserine) and western-blot (cleaved form of different caspases and PARP) analyses. Bcl2L12 plays distinct roles in the apoptosis of different cancers. It is anti-apoptotic in glioblastoma
(342,360,361) but promoted cisplatin-induced apoptosis in MDA-MB-231 in one study (362). In our current study, similar to the studies of glioblastoma, we showed that Bcl2L12 inhibits apoptosis. The difference between the findings of our current study and that of a previous study in BCa (362) could be explained in several ways. In our study, the function of Bcl2L12 on doxorubicin- and cisplatin-triggered apoptosis was determined in MCF-7 and MDA-MB-231. Moreover, we do not believe that off-target effects are present since both Stegh et al. (343) and our group (Fig. 4.8, D to G) validated two separate siRNAs. In addition, different passage numbers of cells and the use of different culture conditions may
121
lead to differential cellular responses. Here we conclude that Bcl2L12 confers chemoresistance of BCa cells to doxorubicin or cisplatin, while ectopic expression of ERβ5 with Bcl2L12 depletion further enhances the apoptosis.
In the presence of chemotherapeutic agents, ERβ5 promoted apoptosis, which was augmented when expression of Bcl2L12 was knocked down, implying that Bcl2L12 inhibits the ERβ5- mediated apoptotic pathway. Suppression of apoptotic signaling by Bcl2L12 has been studied extensively in glioblastoma (343,361,363,364) and found to inhibit the activity of caspase 7 through physical binding (343). Our study showed that the interaction between Bcl2L12 and caspase 7 is reduced in the presence of ERβ5. This suggests that Bcl2L12 can no longer repress the cleavage of caspase 7 when ERβ5 is expressed, resulting in a mechanism by which ERβ5 sensitizes cells to apoptosis.
However, we also observed an increase in the activation of caspase 9 in ERβ5-expressing BCa cells as compared with the controls treated with same concentration of drugs (Fig. 4.2-4.5; panel A). Since caspase 9 functions at an early stage of the intrinsic apoptotic pathway (365), ERβ5 may have additional mechanism(s) of enhancing apoptosis.
In conclusion, our study revealed a novel estrogen-independent molecular pathway of ERβ5 in BCa cells. To our knowledge, we are the first to illustrate that ERβ5 confers sensitivity of BCa cells to chemotherapeutic agent–induced apoptosis through the intrinsic pathway. Moreover, we discovered the estrogen-independent ERβ5-Bcl2l12 interaction and uncovered the ERβ5-mediated sensitization stem from its inhibition of Bcl2L12-caspase 7 interaction. Our further research will focus on the functions of ERβ5 and Bcl2L12 in vivo and their prognostic values in BCa. Since the ERβ5-mediated sensitization occurred in BCa cell lines with different statuses of ERα and p53, ERβ5 may be a new therapeutic target for various types of BCa. Moreover, our study yields valuable information concerning
122
the development of small molecules or peptide mimics targeting the ERβ5-Bcl2L12 interaction to enhance the efficacy of chemotherapeutic agents for patients with advanced BCa.
123
Fig. 4.1 Ectopic expression of ERβ5 in BCa cell lines does not alter the rate of cell proliferation. Panels A and B: The mRNA and protein expression of ERβ5 were determined in ERβ5 or LacZ stably expressed MCF-7 (panel A) and MDA-MB-231 (panel B) cell lines by quantitative reverse transcription (RT)-PCR and western blotting, respectively. GAPDH was used as the housekeeping gene in quantitative RT-PCR, while α-tubulin served as the loading control in western blotting. The cell lines were stably transfected with either an ERβ5 or LacZ expression plasmid. Results are the average of two independent experiments. Data are represented as mean ± SD. Panels C and D: Ectopic expression of ERβ5 does not alter the proliferation rate of BCa cells. The proliferation rates of MCF-7 (panel C) and MDA-MB-231 (panel D) were measured by MTS assay. Equal numbers of cells (3 × 103) were seeded on 96-well plates. The data were recorded after days 1, 3, and 5 and represented as the percentage of cell proliferation relative to LacZ stably expressed cells on day 1. The results are the average of three independent experiments; each was performed in triplicate. Data are represented as mean ± SD.
124
Fig. 4.2 Ectopic ERβ5 sensitizes MCF-7 to doxorubicin-induced apoptosis. Panel A: ERβ5 and LacZ stably expressed MCF-7 (MCF-7-ERβ5 and MCF-7-LacZ) were treated with different concentrations of doxorubicin (0, 0.4, 2, and 10 μM) for 24 h. Whole-cell lysates were extracted for western-blot analysis with antibodies as indicated. Band intensities were measured and normalized to the intensity of α-tubulin. The relative band intensities were compared with that of LacZ stably expressed cells without the treatment. Results of densitometric analysis are the average of three measurements in a representative experiment. Data are presented as mean ± SD. Panel B: Annexin V/7-aminoactinomycin D (7-AAD) staining assays were performed in ERβ5 (green) and LacZ (red) stably expressed MCF-7 cells. Cells were incubated with different concentrations of doxorubicin (0, 2, and 10 µM) for 18 h. The percentage of annexin V–positive (apoptotic) cells was determined by FACS. Three independent experiments were performed. The results shown are from a representative experiment. Panel C: Cell viability of MCF-7 stably expressed cell lines was measured by MTS assay. Equal numbers of cells (3 × 103) were seeded on 96-well plates. Cells were incubated with 2 μM doxorubicin after 24 h. The data were recorded on the first and second day after drug treatment and represented as the percentage of cell viability relative to that of untreated cells. Results are the average of three independent experiments; each was performed in triplicate. Data are represented as mean ± SD. The statistical significance of the difference in cell viability between ERβ5- and LacZ stably expressed cells is shown as *P<0.05, ***P<0.001.
125
126
Fig. 4.3 Ectopic ERβ5 sensitizes MDA-MB-231 to doxorubicin-induced apoptosis. Panel A: ERβ5 and LacZ stably expressed MDA-MB-231 (MDA-ERβ5 and MDA-LacZ) were treated with different concentrations of doxorubicin (0, 5, and 10 μM) for 24 h. Whole-cell lysates were extracted for western-blot analysis with antibodies as indicated. Band intensities were measured and normalized to the intensity of α-tubulin. The relative band intensities were compared with that of untreated LacZ stably expressed cells. Results are the average of three measurements in a representative experiment. Data are presented as mean ± SD. Similar results were obtained in cells incubated with doxorubicin for 12 h. Panel B: Annexin V/7-aminoactinomycin D (7-AAD) staining assays were performed in ERβ5 (green) and LacZ (red) stably expressed MDA-MB-231 cells. Cells were incubated with different concentrations of doxorubicin (0, 5 , and 10 µM) for 18 h. The percentage of annexin V–positive (apoptotic) cells was determined by FACS. Three independent experiments were performed. The results shown are from a representative experiment. Panel C: The cell viability of MDA-MB-231 stably expressed cell lines was measured by MTS assay. Equal numbers of cells (3 × 103) were seeded on 96-well plates. Cells were incubated with 5 μM doxorubicin after 24 h. The data were recorded on the first and second day after drug treatment and represented as the percentage of cell viability relative to that of untreated cells. The results are the average of three independent experiments; each was performed in triplicate. Data are represented as mean ± SD. The statistical significance of the difference in cell viability between ERβ5- and LacZ stably expressed cells is shown as *P<0.05.
127
Fig. 4.4 Ectopic ERβ5 sensitizes MCF-7 to cisplatin-induced apoptosis. Panel A: ERβ5 and LacZ stably expressed MCF-7 were treated with different concentrations of cisplatin (0, 25, and 50 μM) for 24 h. Whole-cell lysates were extracted for western-blot analysis with antibodies as indicated. The measurement of relative band intensities and analysis of data were similar to that in Figure 4.2A. Panel B: Annexin V/7-AAD staining assays were performed in ERβ5 (green) and LacZ (red) stably expressed MCF-7 cells. Cells were incubated with different concentrations of cisplatin (0, 25, and 50 µM) for 18 h. Other experimental details and analysis of data were similar to those in Figure 4.2B. Panel C: The cell viability of MCF-7 stably expressed cell lines was measured by MTS assay. Cells were incubated with 50 μM cisplatin. The procedures of experiment and analysis of data were similar to those described in Figure 4.2C. The statistical significance of the difference in cell viability between ERβ5 and LacZ stably expressed cells is shown as **P<0.01.
128
Fig. 4.5 Ectopic ERβ5 sensitizes MDA-MB-231 to cisplatin-induced apoptosis. Panel A: ERβ5 and LacZ stably expressed MDA-MB-231 were treated with different concentrations of cisplatin (0, 25, and 50 μM) for 24 h. Whole-cell lysates were extracted for western-blot analysis with antibodies as indicated. The measurement of relative band intensities and analysis of data were similar to those in Figure 4.3A. Panel B: Annexin V/7-AAD staining assays were performed in ERβ5 (green) and LacZ (red) stably expressed MDA-MB-231 cells. Cells were incubated with different concentrations of cisplatin (0, 25, and 50 µM) for 18 h. Other experimental details and analysis of data were similar to those in Figure 4.3B. Panel C: The cell viability of MDA-MB-231 stably expressed cell lines was measured by MTS assay. Cells were incubated with 50 μM cisplatin. The procedures of experiment and analysis of data were similar to those described in Figure 4.3C. The statistical significance of the difference in cell viability between ERβ5 and LacZ stably expressed cells is shown as **P<0.01.
129
Fig. 4.6 Bcl2L12 specifically interacts with ERβ5 in an estradiol (E2)-independent manner. Panel A: ERβ5 interacts with Bcl2L12 in vivo in an E2-independent manner. The 293T cells were grown in charcoal-stripped serum (CSS) medium and transfected with ERβ5 and His-tagged Bcl2L12. After 24-h transfection, DMSO or 10 nM E2 was added. Lysates were immunoprecipitated with ERβ antibody and then immunoblotted with His (Bcl2L12) or ERβ antibody. Immunoglobulin IgG was used as negative control. Panel B: ERβ5 interacts with Bcl2L12 in MCF-7. MCF-7-ERβ5 was grown in full-serum medium. Lysates were immunoprecipitated with ERβ antibody and then immunoblotted with Bcl2L12 (L12-1) or ERβ antibody.
130
Fig. 4.7 Bcl2L12 specifically interacts with ERβ5 but not ERβ1 or ERα. Panel A: Full-length ERβ5 and ERα, but not ERβ1, interact with Bcl2L12 in yeast. ERβ1, ERβ5, ERα, or empty vector (pGBKT7) was transformed with Bcl2L12 into yeast cells. Transformed cells were seeded on quadruple dropout agar (QDO) containing X-α-galactosidase until growth of blue colonies. Panel B: Bcl2L12 interacts with ERβ5 but not ERβ1 or ERα in vitro. ERβ5, ERβ1, ERα, and HA-tagged Bcl2L12, respectively, were translated in vitro and labeled with [35S] methionine. Lysates were mixed and incubated in the absence or presence of estradiol (E2) as indicated, followed by immunoprecipitation with anti-HA affinity gel. The immunoprecipitates were resolved by SDS-PAGE and analyzed by X-ray autoradiography. The asterisk (*), number sign (#) and plus sign (+) respectively indicate the positions of ERβ5, ERα and ERβ1. Panels C and D: ERβ5 co-localized with Bcl2L12 in 293T and MCF-7-ERβ5 cells. The two cell lines were grown in full-serum medium. 293T cells were transfected with ERβ5 and Bcl2L12. Antibodies to ERβ and Bcl2L12 were used for immunostaining. DAPI was used as a nuclear marker. Images in panel C and D were captured by fluorescence microscopy. Bar = 20 µm.
131
Fig. 4.8 Expression of Bcl2L12 was significantly reduced by gene-specific siRNAs in MCF-7 and MDA-MB-231. Panel A: Expression level of Bcl2L12 in different mammary cell lines was determined. The cDNAs of BCa cell lines (MDA-MB-231, MCF-7, T47D, and SKBR-3) and mammary epithelial cells (MCF-10A) were used in quantitative RT-PCR. The results are the average of two independent experiments. Panels B and C: Expression of Bcl2L12 is not altered by the ectopic expression of ERβ5 in BCa cells. The cDNAs of MCF-7-ERβ5/-LacZ (panel B) and MDA-ERβ5/-LacZ (panel C) were used in quantitative RT-PCR. The results are the average of two independent experiments. Panels D to G: Bcl2L12 siRNAs efficiently reduced its expression in MCF-7 and MDA-MB- 231. Two Bcl2L12-specific siRNAs (siL12-1 and siL12-2) were transfected into MCF-7 (panels D and E) and MDA-MB-231 (panels F and G). After 24-h transfection, cells were transfected for the second time. Non-targeting siRNA (siNT) was used as negative control. The relative expression of Bcl2L12 was measured by quantitative RT-PCR and western-blot analysis. β-actin was used as loading control in western blotting. The results of quantitative RT-PCR were the average of three independent experiments. All data are represented as mean ± SD.
132
e
133
Fig. 4.9 Knockdown of Bcl2L12 sensitizes MCF-7 and MDA-MB-231 to doxorubicin- and cisplatin-induced apoptosis. Panels A and B: ERβ5 and LacZ stably expressed MCF-7 (panel A) or MDA-MB-231 (panel B) were transfected with non-targeting control siRNA (siNT) or Bcl2l12 siRNA (siL12-1) twice. The cells were then treated with doxorubicin (2 μM) or cisplatin (50 μM) for 24 h. Whole-cell lysates were extracted for western-blot analysis with antibodies as indicated. The measurement of relative band intensities and analysis of data were similar to that in Figure 4.2A. Panels C and D: Annexin V/7-AAD staining assays were performed. MCF-7-LacZ (panel C) or MDA-LacZ (panel D) transfected with siNT (red) and siL12-1 (purple), as well as MCF-7-ERβ5 (panel C) or MDA-ERβ5 (panel D) transfected with siNT (green) or siL12-1 (blue) were used in the assays. Cells were incubated with doxorubicin (2 µM) and cisplatin (50 μM) for 18 h. Other experimental details and analysis of data were similar to those in Figure 4.2B.
134
Fig. 4.10 Knockdown of Bcl2L12 by siL12-2 sensitizes doxorubicin-induced apoptosis in MCF- 7 and MDA-MB-231. Panels A and B: siNT or siL12-2 was transfected twice into MCF-7-ERβ5/-LacZ (panel A) and MDA-ERβ5/-LacZ (panel B). MCF-7 cells were incubated with 2 μM doxorubicin, and MDA- MB-231 cells were incubated with 5 μM doxorubicin. Whole-cell lysates were extracted for western-blot analysis with antibodies as indicated. The measurement of relative band intensities and analysis of data were similar to that in Figure 4.3A.
135
Fig. 4.11 ERβ5 inhibits the interaction between Bcl2L12 and caspase 7. ERβ5 and LacZ stably expressed MCF-7 cells were grown in full-serum medium. Lysates were immunoprecipitated with Bcl2L12 (L12-2) antibody and then immunoblotted with caspase 7 or Bcl2L12 (L12-1) antibody. Immunoglobulin IgG was used as negative control.
136
Fig. 4.12 Schematic diagram shows the role of ERβ5 in the apoptosis of breast cancer (BCa) cells. Although ERβ5 does not reduce proliferation of different BCa cell lines, its ectopic expression decreases their survival by sensitizing them to doxorubicin- or cisplatin-induced apoptosis through the intrinsic apoptotic pathway as reflected by the increase in the activation of caspase 9 but not caspase 8. To investigate the ERβ5-mediated molecular pathway, we performed yeast two-hybrid screening and discovered Bcl2L12, which belongs to the Bcl-2 family regulating apoptosis, to interact specifically with ERβ5 in an E2-independent manner. Doxorubicin- or cisplatin-induced apoptosis was enhanced by the knockdown of Bcl2L12 and further promoted by ectopic expression of ERβ5. ERβ5 sensitizes BCa cells to chemotherapeutic agents via reduction of Bcl2L12-caspase 7 interaction, which was previously shown to inhibit apoptosis.
137
Chapter 5: General Discussion
Summary of Data
The three research projects of this thesis seek to understand the molecular mechanisms which
control the expression of ERβ isoforms during PCa progression and also their distinct functions via
different signaling pathways in PCa and BCa. In the chapter 2 of the thesis, I showed that the expression
of ERβ1, 2 and 5 is differentially regulated at either or both transcriptional and post-transcriptional levels in normal and cancerous prostatic tissues. In the chapter 3 and 4, my data reveal that the functions of ERβ1 and ERβ5 are regulated by the interactions with their binding partners. The transcriptional activity of ERβ1 at different cis-regulatory elements is determined by its interaction with Tip60. In addition, ERβ5 sensitizes BCa cells to chemotherapeutic agent-induced apoptosis through its interaction with Bcl2L12. The major findings of my thesis are summarized as follows:
In the chapter 2, promoter 0K and 0N of ERβ were found to be actively involved in the transcription of ERβ isoforms during PCa progression. ERβ1 and 2 are transcribed from both promoter
0K and 0N, whereas ERβ5 is preferentially controlled by promoter 0K. In the 5' RACE analysis of a
PCa cell line PC-3 and PCR amplification of 5' UTRs of ERβ transcripts in prostatic clinical specimens, different combinations of 5' untranslated exons, termed exon 0Xs, are present exclusively in the promoter 0K-initiated transcripts. Exon 0Xs accommodate different number of uORFs which are responsible for the reduction of protein expression of downstream coding sequence post- transcriptionally. However, only ERβ2 and 5 possess various combinations of exon 0Xs in their promoter 0K-initiated transcripts. Collectively, our data reveal that expression of ERβ1 is primarily controlled by alternative promoter usage, whereas that of ERβ2 and 5 are regulated at both transcriptional and post-transcriptional levels.
138
Next, the differential modulation of ERβ1 transcriptional activity at different cis-regulatory elements was investigated. Tip60, which is a coregulator of many transcription factors, interacts with the hinge domain of ERβ1 in an E2-independent manner. It reduced ERβ1 transactivation at ERE sites and enhanced its transactivation at AP-1 site in HEK293 and different PCa cell lines, whereas its coregulatory action is independent of its acetyltransferase activity. In addition, different estrogenic compounds could alter the dual actions of Tip60. Diarylpropionitrile, genistein, equol, and bisphenol A
abolished the corepressor activity, whereas its coactivator activity was enhanced by ICI182,780. Tip60
was also found to cooperate with another coactivator GRIP1 to synergistically increase ERβ1 activity at
AP-1 site. Moreover, CXCL12 and cyclin D2 possessing ERE and AP-1 sites respectively were
identified to be regulated by both ERβ1 and Tip60 in PC-3 cells. The co-occupancy of ERβ1 and Tip60 at the ERE or AP-1 region of the target genes were also confirmed. Our data indicate Tip60 is the dual- function coregulator of ERβ1.
In the chapter 4, the function of ERβ5, which correlate with better survival of patients with
BCa, was investigated. Unlike ERβ1, ERβ5 did not alter the proliferation of BCa cell lines MCF-7 and
MDA-MB-231, however, it sensitized the cell lines to doxorubicin- and cisplatin-induced apoptosis.
Yeast two-hybrid screening was performed to isolate Bcl2L12, a Bcl-2 family member, to be an ERβ5- specific interacting partner. Nonetheless, ERβ5 and Bcl2L12 possess opposing roles in apoptosis.
Bcl2L12 confer chemoresistance of BCa cells to drug-induced apoptosis. ERβ5 was shown to inhibit the suppression of caspase 7 cleavage by Bcl2L12, suggesting a mechanism by which ERβ5 sensitizes cells to apoptosis. In conclusion, ERβ5 functions in a novel estrogen-independent non-genomic signaling pathway which promotes chemotherapeutic-agent induced apoptosis of BCa cells through interaction with Bcl2L12.
139
Experimental Limitations and Future Directions
There were different experimental limitations in these projects and our group will pay more
attention to them in the future studies. In the study of chapter 2, different 5’ untranslated exons of ERβ
were proved to reduce protein expression by cloning different combinations of exon 0Xs to the upstream
of luciferase coding sequence, however, we did not show whether the endogenous expression of ERβ
isoforms is modulated by these untranslated exons in prostatic cells. Although PCR amplification of 5'
untranslated regions of ERβ in clinical specimens revealed that exon 0Xs appeared more frequently in
cancerous tissues, 14 paired samples were not enough for drawing a firm conclusion. Larger size of
samples is essential for statistically significant results. Future studies will focus on the mechanisms
controlling the usage of alternative promoters and also specific splicing patterns of 5’ untranslated
exons. For example, cis-regulatory elements and trans-acting factors were shown to determine promoter
usage (366,367). In our study, only ERβ2 and 5 but not ERβ1 possess different exon 0Xs in their 5’
UTRs. Since alternative splicing at the last coding exon (exon 8) lead to the difference in a.a. sequences
of ERβ isoforms, it is tempting to speculate that different factors, such as cis-regulatory sequences,
exonic and intronic transcriptional enhancers and silencers, are involved in specific splicing patterns of
5’ UTRs and also 3’ coding sequences during ERβ-isoform transcription (368). In addition, our study showed that various uORFs in exon 0Xs differentially reduce the translational efficiency. One possible regulatory mechanism is that cellular factors, e.g. eIF4E, affects the influence of uORFs on the mRNA
translation as illustrated by Smith et al. (230,369); thus, the study of co-factors, e.g. miRNA or other
RNA-interacting proteins (272,273), will help us determine the whole picture of the post-transcriptional
mechanisms controlling the ERβ-isoform expression.
Except the study about the differential regulation of ERβ-isoform expression in the chapter 2,
the experiments in the other two studies were all conducted in different cell lines. The lack of in vivo
140
studies using animal models and clinical studies using human tissues may lead to the weak correlation
between my findings and clinical relevance. In PCa cell line PC-3, Tip60 was shown to differentially regulate ERβ1-target genes, CXCL12 and cyclin D2, which possess ERE and AP-1 sites in their cis- regulatory regions respectively. To thoroughly determine the coregulatory effect of Tip60 on ERβ1- mediated transcription, genome-wide studies such as RNA sequencing and ChIP-on-chip will be performed. Since CXCL12 and cyclin D2 were well-documented to function in metastasis and proliferation, different cell-based assays, such as invasion, migration and proliferation assays will be used to determine the physiological effects of ERβ1-Tip60 interaction in PCa cells. In addition, xenograft studies or tissue-specific knockout of Tip60 in animal models will be necessary for confirmation of the dual regulations of ERβ1 transcriptional activity by Tip60 in vivo. In this project, the regulatory mechanisms of Tip60 were studied extensively using plasmid constructs. However, besides being a coregulator, Tip60 functions as a histone acetyltransferase which acetylates histones at the intact chromatin and thus regulates transcription. Further studies will focus on the relationship between the coregulatory activities of Tip60 and its effect on chromatin remodeling.
Similar to the project about Tip60-mediated regulation of ERβ1, most experiments of ERβ5- mediated sensitization of BCa cells to chemotherapeutic agent-induced apoptosis were conducted in two
BCa cell lines. Xenograft of ERβ5-stably expressed and/or Bcl2L12 stably-knockdown BCa cells followed by different drug treatments can provide more information about their functional roles in vivo.
Since ERβ5 and Bcl2L12 possess opposing roles in apoptosis, their expression patterns may serve as prognostic markers of BCa. We have had a collaboration with Dr. Leigh Murphy at the University of
Manitoba, CA and have already performed immunohistochemical staining (IHC) on a panel of tissue microarray containing around 1000 samples of BCa patients. The data are being analyzed by pathologists at the University of Manitoba. In our present study, we used BCa cell lines with constitutive
141
expression of ERβ5. However, cells with high expression of ERβ5 may die during selection of stably expressed cell lines. Its expression may also reduce gradually at the later passages. Moreover, Bcl2L12 expression was transiently depleted by siRNAs. To confirm and further determine their roles in apoptosis, inducible expression of ERβ5 and knockdown of Bcl2L12 in BCa cells will be good alternatives for future studies. In addition, our current study has not fully understood the functional roles of ERβ5 in apoptosis of BCa cells yet. Although it sensitizes BCa cells to drug-induced apoptosis via intrinsic apoptotic pathway, we showed that its interaction with Bcl2L12 eventually promotes the cleavage of caspase 7 which is a common effector caspase for both intrinsic and extrinsic pathways.
Thus, its effect on the extrinsic apoptotic pathway followed by death receptor activation will be investigated. Moreover, ERβ5 was shown to enhance the activation of caspase 9, an early apoptotic marker, revealing that it has multiple mechanisms sensitizing cells to apoptosis and that will also be our future direction. In addition, ERβ5 was localized in both cytoplasmic and nuclear compartments of BCa cells. Since only the nuclear expression of ERβ5 correlated with better survival of BCa patients (253), it will be interesting to dissect the functions of ERβ5 in different compartments.
Significance and Perspective of the Studies
ERβ1 was discovered more than a decade ago. Most of its earlier studies focus on its heterodimerization with ERα and also its antagonizing effect on the transcriptional activity of ERα
(212,213). ERα has been studied extensively about its proliferative role during BCa and PCa progression. Moreover, different animal model and cell culture studies showed that ERβ1 inhibits the proliferation and also promotes the death of cancer cells (257,346). Thus, ERβ1 is suggested to be a possible tumor suppressor in these endocrine-related cancers. However, the research about ERβ1 became much more complicated and the previous findings needed to be re-evaluated with the discovery
142
of its 4 other splice variants, ERβ2 to 5, which have unique a.a. sequences at the C-terminal LBD and
AF-2 domain (130). Although ERβ2 to 5 are transcriptionally inactive, they are able to modulate the transcriptional activity of ERβ1 and ERα. In addition, they have different functions in cellular processes, such as invasion and migration of PCa cells, and also differential expression patterns in PCa and BCa when compared with ERβ1 (257,346). While the prognostic value of ERβ1 in PCa and BCa was determined by differential expression during cancer progression through immunohistochemical analyses, most of the previous studies used pan-ERβ antibodies targeting at the common N-terminal region among different isoforms. Thus, the roles of ERβ1 and its isoforms in these cancers remain elusive and require extensive studies.
Based on these previous findings, we focused on exploring the mechanisms governing the expression of different ERβ isoforms during PCa progression as mentioned in the chapter 2 of my thesis.
We have found that ERβ1, 2 and 5 have different usage of the two promoters, 0K and 0N. Moreover, the
5’ untranslated exons, exon 0Xs, were found exclusively in the transcripts of ERβ2 and 5. These findings are extremely important for the development of ERβ-isoform targeted therapy for PCa. Our previous study showed that the prognostic value of ERβ2 and 5 is distinct from that of ERβ1 in PCa
(236). Besides the correlation between their expressions and shorter postoperative survival (POM) of
PCa patients, they may also possess metastasis-promoting role in PCa cells (236). It is tempting to devise ERβ2 and/or β5-targeted therapies. Since ERβ5 is only transcribed from promoter 0K (367), a gene therapy can be designed to modulate the promoter usage and terminate the transcription from promoter 0K. Moreover, once we dissect the mechanisms of incorporating exon 0Xs into the transcripts of ERβ2 and 5, a customized therapy can be developed for facilitating the alternative splicing at exon
0Xs so as to abolish the expression of ERβ2 and 5, especially at the advanced PCa.
143
Analysis of the correlation between expression patterns of ERβ isoforms and cancer
progression is essential for evaluation of their prognostic values. However, their native functions ought to be well-defined before the development of any ERβ-isoform related therapy. The functions of ERβ1
and its isoforms in particular cell types largely depends on several factors, including the cellular level of
estrogen or estrogenic compounds, post-translational modifications and the presence of their interacting
proteins. Of these, we were particularly interested in the functional significance of the interaction
between ERβ isoforms and their interacting proteins because the interacting proteins are responsible for
increasing the diversity of ERβ isoforms’ functions.
In the chapter 3 of my thesis, Tip60 was shown to be a dual-function coregulator of ERβ1.
Since Tip60 either enhances or inhibits the transcriptional activity of ERβ1 at ERE or AP-1 site
respectively, it is expected to differentially regulate at least two groups of ERβ1 target genes. We found
that the expression of CXCL12 possessing ERE sites was inhibited by Tip60, whereas that of cyclin D2
possessing AP-1 sites was increased by Tip60. Although the studies about CXCL12 are limited, its
expression was positively associated with a decrease in metastatic potential of BCa cells and better
survival of BCa patients (370,371). Cyclin D2, which is epigenetically silenced in PCa, was shown to be
a biomarker of PCa and inhibit the proliferation of PCa cells (372-375). Thus, a treatment targeting
ERβ1-Tip60 interaction would be innovative for patients with PCa. For example, small molecules or
monoclonal antibodies can be used as targeted therapies to either block or augment their interaction at
ERE or AP-1 site respectively. As a result, the growth of cancer cells will be suppressed by promoting the expression of genes for inhibiting proliferation, but interfering with genes for carcinogenesis.
Moreover, our study reveals that certain ERβ1 agonists and antagonists modulate the coregulatory
effects of Tip60. Therefore, these estrogenic compounds may be used as diet supplements or adjuvant
therapy along with the therapy targeting ERβ1-Tip60 interaction.
144
Our study about the apoptotic role of ERβ5 in BCa cells is consistent with the findings that
its expression was positively associated with better survival of patients with BCa (253). However, we
showed that its interacting partner, Bcl2L12, inhibits chemotherapeutic agent-induced apoptosis,
implying that their expression patterns can serve as different prognostic markers in BCa. Since similar
results about the apoptotic role of ERβ5 were observed in BCa cell lines with different statuses of ERα
and p53, we believe that ERβ5 will be a promising therapeutic target for various types of BCa.
Moreover, ERβ5-mediated sensitization of BCa cells to apoptosis stems from its inhibition of the
interaction between Bcl2L12 and caspase 7. Therefore, ERβ5-targeted drugs or small peptide mimics
which promote ERβ5-Bcl2L12 interaction could be designed to enhance the efficacy of
chemotherapeutic drugs, such as doxorubicin and cisplatin, for patients with advanced BCa.
In conclusion, the results of my thesis yield valuable information about the regulatory
mechanisms of ERβ-isoform expression in PCa and also their functional diversity in PCa and BCa due
to the interaction with different interacting partners. We identified the expression of ERβ1 and its
isoforms, ERβ2 and 5 are regulated by different transcriptional and post-transcriptional mechanisms.
This finding may serve as supporting evidence for their distinct functional roles during PCa progression.
Moreover, it is the first time to identify a dual-function coregulator of ERβ1, Tip60, which was shown to
be important for regulation of ERβ1 transcriptional activity in a cis-regulatory element-dependent
manner. Although some clinical studies and translational research reveal that ERβ1 and its isoforms
have distinct functional roles, the corresponding studies are extremely limited. In my thesis, a novel estrogen-independent non-genomic signaling pathway of ERβ5 in the apoptosis of BCa cells was discovered. Moreover, Bc2L12 specifically interacts with ERβ5 but not with ERβ1, suggesting that ERβ isoforms possess unique signaling pathways. Collectively, this thesis raises a concern about ERβ isoforms as promising therapeutic targets for PCa and BCa.
145
References
1. American Cancer Society (2012) Cancer Facts & Figures 2012. American Cancer Society, Atlanta
2. Carter, H. B., Piantadosi, S., and Isaacs, J. T. (1990) Clinical evidence for and implications of the multistep development of prostate cancer. J. Urol. 143, 742-746
3. Abate-Shen, C. and Shen, M. M. (2000) Molecular genetics of prostate cancer. Genes Dev. 14, 2410-2434
4. Montironi, R., Mazzucchelli, R., Lopez-Beltran, A., Cheng, L., and Scarpelli, M. (2007) Mechanisms of disease: high-grade prostatic intraepithelial neoplasia and other proposed preneoplastic lesions in the prostate. Nat. Clin. Pract. Urol. 4, 321-332
5. Bostwick, D. G., Pacelli, A., and Lopez-Beltran, A. (1996) Molecular biology of prostatic intraepithelial neoplasia. Prostate 29, 117-134
6. Qian, J., Wollan, P., and Bostwick, D. G. (1997) The extent and multicentricity of high- grade prostatic intraepithelial neoplasia in clinically localized prostatic adenocarcinoma. Hum. Pathol. 28, 143-148
7. Sakr, W. A., Grignon, D. J., Haas, G. P., Heilbrun, L. K., Pontes, J. E., and Crissman, J. D. (1996) Age and racial distribution of prostatic intraepithelial neoplasia. Eur. Urol. 30, 138-144
8. Bostwick, D. G. and Brawer, M. K. (1987) Prostatic intra-epithelial neoplasia and early invasion in prostate cancer. Cancer 59, 788-794
9. Bostwick, D. G. and Qian, J. (2004) High-grade prostatic intraepithelial neoplasia. Mod. Pathol. 17, 360-379
10. Montironi, R., Mazzucchelli, R., Algaba, F., and Lopez-Beltran, A. (2000) Morphological identification of the patterns of prostatic intraepithelial neoplasia and their importance. J. Clin. Pathol. 53, 655-665
11. Sinha, A. A., Gleason, D. F., Staley, N. A., Wilson, M. J., Sameni, M., and Sloane, B. F. (1995) Cathepsin B in angiogenesis of human prostate: an immunohistochemical and immunoelectron microscopic analysis. Anat. Rec. 241, 353-362
12. Bigler, S. A., Deering, R. E., and Brawer, M. K. (1993) Comparison of microscopic vascularity in benign and malignant prostate tissue. Hum. Pathol. 24, 220-226
13. McNeal, J. E., Villers, A., Redwine, E. A., Freiha, F. S., and Stamey, T. A. (1991) Microcarcinoma in the prostate: its association with duct-acinar dysplasia. Hum. Pathol. 22, 644-652
146
14. Leav, I., Merk, F. B., Kwan, P. W., and Ho, S. M. (1989) Androgen-supported estrogen- enhanced epithelial proliferation in the prostates of intact Noble rats. Prostate 15, 23-40
15. Ho, S. M. and Roy, D. (1994) Sex hormone-induced nuclear DNA damage and lipid peroxidation in the dorsolateral prostates of Noble rats. Cancer Lett. 84, 155-162
16. Shah, R. B. (2009) Current perspectives on the Gleason grading of prostate cancer. Arch. Pathol. Lab Med. 133, 1810-1816
17. Li, H. and Tang, D. G. (2011) Prostate cancer stem cells and their potential roles in metastasis. J. Surg. Oncol. 103, 558-562
18. Feldman, B. J. and Feldman, D. (2001) The development of androgen-independent prostate cancer. Nat. Rev. Cancer 1, 34-45
19. Kimura, T. (2012) East meets West: ethnic differences in prostate cancer epidemiology between East Asians and Caucasians. Chin J. Cancer 31, 421-429
20. de Jong, F. H., Oishi, K., Hayes, R. B., Bogdanowicz, J. F., Raatgever, J. W., van der Maas, P. J., Yoshida, O., and Schroeder, F. H. (1991) Peripheral hormone levels in controls and patients with prostatic cancer or benign prostatic hyperplasia: results from the Dutch-Japanese case-control study. Cancer Res. 51, 3445-3450
21. Richards, R. J., Svec, F., Bao, W., Srinivasan, S. R., and Berenson, G. S. (1992) Steroid hormones during puberty: racial (black-white) differences in androstenedione and estradiol--the Bogalusa Heart Study. J. Clin. Endocrinol. Metab 75, 624-631
22. Rohrmann, S., Nelson, W. G., Rifai, N., Brown, T. R., Dobs, A., Kanarek, N., Yager, J. D., and Platz, E. A. (2007) Serum estrogen, but not testosterone, levels differ between black and white men in a nationally representative sample of Americans. J. Clin. Endocrinol. Metab 92, 2519-2525
23. Orwoll, E. S., Nielson, C. M., Labrie, F., Barrett-Connor, E., Cauley, J. A., Cummings, S. R., Ensrud, K., Karlsson, M., Lau, E., Leung, P. C., Lunggren, O., Mellstrom, D., Patrick, A. L., Stefanick, M. L., Nakamura, K., Yoshimura, N., Zmuda, J., Vandenput, L., and Ohlsson, C. (2010) Evidence for Geographical and Racial Variation in Serum Sex Steroid Levels in Older Men. J. Clin. Endocrinol. Metab
24. Daniels, N. A., Nielson, C. M., Hoffman, A. R., and Bauer, D. C. (2010) Sex hormones and the risk of incident prostate cancer. Urology 76, 1034-1040
25. Tam, N. N., Ghatak, S., and Ho, S. M. (2003) Sex hormone-induced alterations in the activities of antioxidant enzymes and lipid peroxidation status in the prostate of Noble rats. Prostate 55, 1-8
26. Jefcoate, C. R., Liehr, J. G., Santen, R. J., Sutter, T. R., Yager, J. D., Yue, W., Santner, S. J., Tekmal, R., Demers, L., Pauley, R., Naftolin, F., Mor, G., and Berstein, L. (2000)
147
Tissue-specific synthesis and oxidative metabolism of estrogens. J. Natl. Cancer Inst. Monogr 95-112
27. Singh, P. B., Matanhelia, S. S., and Martin, F. L. (2008) A potential paradox in prostate adenocarcinoma progression: oestrogen as the initiating driver. Eur. J. Cancer 44, 928- 936
28. Ellem, S. J. and Risbridger, G. P. (2006) Aromatase and prostate cancer. Minerva Endocrinol. 31, 1-12
29. Brodie, A., Njar, V., Macedo, L. F., Vasaitis, T. S., and Sabnis, G. (2009) The Coffey Lecture: steroidogenic enzyme inhibitors and hormone dependent cancer. Urol. Oncol. 27, 53-63
30. Purohit, A. and Foster, P. A. (2012) Steroid sulfatase inhibitors for estrogen- and androgen-dependent cancers. J. Endocrinol. 212, 99-110
31. Yager, J. D. (2000) Endogenous estrogens as carcinogens through metabolic activation. J. Natl. Cancer Inst. Monogr 67-73
32. Cavalieri, E., Frenkel, K., Liehr, J. G., Rogan, E., and Roy, D. (2000) Estrogens as endogenous genotoxic agents--DNA adducts and mutations. J. Natl. Cancer Inst. Monogr 75-93
33. Yager, J. D. and Liehr, J. G. (1996) Molecular mechanisms of estrogen carcinogenesis. Annu. Rev. Pharmacol. Toxicol. 36, 203-232
34. Lakhani, N. J., Sarkar, M. A., Venitz, J., and Figg, W. D. (2003) 2-Methoxyestradiol, a promising anticancer agent. Pharmacotherapy 23, 165-172
35. Prins, G. S., Birch, L., Couse, J. F., Choi, I., Katzenellenbogen, B., and Korach, K. S. (2001) Estrogen imprinting of the developing prostate gland is mediated through stromal estrogen receptor alpha: studies with alphaERKO and betaERKO mice. Cancer Res. 61, 6089-6097
36. Prins, G. S. (1992) Neonatal estrogen exposure induces lobe-specific alterations in adult rat prostate androgen receptor expression. Endocrinology 130, 3703-3714
37. vom Saal, F. S., Timms, B. G., Montano, M. M., Palanza, P., Thayer, K. A., Nagel, S. C., Dhar, M. D., Ganjam, V. K., Parmigiani, S., and Welshons, W. V. (1997) Prostate enlargement in mice due to fetal exposure to low doses of estradiol or diethylstilbestrol and opposite effects at high doses. Proc. Natl. Acad. Sci. U. S. A 94, 2056-2061
38. Ho, S. M., Tang, W. Y., Belmonte de, F. J., and Prins, G. S. (2006) Developmental exposure to estradiol and bisphenol A increases susceptibility to prostate carcinogenesis and epigenetically regulates phosphodiesterase type 4 variant 4. Cancer Res. 66, 5624- 5632
148
39. Potischman, N., Troisi, R., Thadhani, R., Hoover, R. N., Dodd, K., Davis, W. W., Sluss, P. M., Hsieh, C. C., and Ballard-Barbash, R. (2005) Pregnancy hormone concentrations across ethnic groups: implications for later cancer risk. Cancer Epidemiol. Biomarkers Prev. 14, 1514-1520
40. Ekbom, A., Wuu, J., Adami, H. O., Lu, C. M., Lagiou, P., Trichopoulos, D., and Hsieh, C. (2000) Duration of gestation and prostate cancer risk in offspring. Cancer Epidemiol. Biomarkers Prev. 9, 221-223
41. Ekbom, A., Hsieh, C. C., Lipworth, L., Wolk, A., Ponten, J., Adami, H. O., and Trichopoulos, D. (1996) Perinatal characteristics in relation to incidence of and mortality from prostate cancer. BMJ 313, 337-341
42. Yu, K. D. and Shao, Z. M. (2011) The two faces of autophagy and the pathological underestimation of DCIS. Nat. Rev. Cancer 11, 618
43. Bleicher, R. J. (2013) Ductal carcinoma in situ. Surg. Clin. North Am. 93, 393-410
44. Vargo-Gogola, T. and Rosen, J. M. (2007) Modelling breast cancer: one size does not fit all. Nat. Rev. Cancer 7, 659-672
45. Stewart, J. F., King, R. J., Winter, P. J., Tong, D., Hayward, J. L., and Rubens, R. D. (1982) Oestrogen receptors, clinical features and prognosis in stage III breast cancer. Eur. J. Cancer Clin. Oncol. 18, 1315-1320
46. Honkoop, A. H., Wagstaff, J., and Pinedo, H. M. (1998) Management of stage III breast cancer. Oncology 55, 218-227
47. Hortobagyi, G. N., Ames, F. C., Buzdar, A. U., Kau, S. W., McNeese, M. D., Paulus, D., Hug, V., Holmes, F. A., Romsdahl, M. M., Fraschini, G., and . (1988) Management of stage III primary breast cancer with primary chemotherapy, surgery, and radiation therapy. Cancer 62, 2507-2516
48. Weigelt, B., Peterse, J. L., and van 't Veer, L. J. (2005) Breast cancer metastasis: markers and models. Nat. Rev. Cancer 5, 591-602
49. Russo, I. H. and Russo, J. (1998) Role of hormones in mammary cancer initiation and progression. J. Mammary. Gland. Biol. Neoplasia. 3, 49-61
50. Clemons, M. and Goss, P. (2001) Estrogen and the risk of breast cancer. N. Engl. J. Med. 344, 276-285
51. Yue, W., Santen, R. J., Wang, J. P., Li, Y., Verderame, M. F., Bocchinfuso, W. P., Korach, K. S., Devanesan, P., Todorovic, R., Rogan, E. G., and Cavalieri, E. L. (2003) Genotoxic metabolites of estradiol in breast: potential mechanism of estradiol induced carcinogenesis. J. Steroid Biochem. Mol. Biol. 86, 477-486
149
52. van Landeghem, A. A., Poortman, J., Nabuurs, M., and Thijssen, J. H. (1985) Endogenous concentration and subcellular distribution of estrogens in normal and malignant human breast tissue. Cancer Res. 45, 2900-2906
53. Key, T. J., Appleby, P. N., Reeves, G. K., Roddam, A., Dorgan, J. F., Longcope, C., Stanczyk, F. Z., Stephenson, H. E., Jr., Falk, R. T., Miller, R., Schatzkin, A., Allen, D. S., Fentiman, I. S., Key, T. J., Wang, D. Y., Dowsett, M., Thomas, H. V., Hankinson, S. E., Toniolo, P., Akhmedkhanov, A., Koenig, K., Shore, R. E., Zeleniuch-Jacquotte, A., Berrino, F., Muti, P., Micheli, A., Krogh, V., Sieri, S., Pala, V., Venturelli, E., Secreto, G., Barrett-Connor, E., Laughlin, G. A., Kabuto, M., Akiba, S., Stevens, R. G., Neriishi, K., Land, C. E., Cauley, J. A., Kuller, L. H., Cummings, S. R., Helzlsouer, K. J., Alberg, A. J., Bush, T. L., Comstock, G. W., Gordon, G. B., Miller, S. R., and Longcope, C. (2003) Body mass index, serum sex hormones, and breast cancer risk in postmenopausal women. J. Natl. Cancer Inst. 95, 1218-1226
54. Cleary, M. P., Grossmann, M. E., and Ray, A. (2010) Effect of obesity on breast cancer development. Vet. Pathol. 47, 202-213
55. Nicolas Diaz-Chico, B., German, R. F., Gonzalez, A., Ramirez, R., Bilbao, C., Cabrera de, L. A., Aguirre, J. A., Chirino, R., Navarro, D., and Diaz-Chico, J. C. (2007) Androgens and androgen receptors in breast cancer. J. Steroid Biochem. Mol. Biol. 105, 1-15
56. Yager, J. D. and Davidson, N. E. (2006) Estrogen carcinogenesis in breast cancer. N. Engl. J. Med. 354, 270-282
57. Chang, M. (2011) Dual roles of estrogen metabolism in mammary carcinogenesis. BMB. Rep. 44, 423-434
58. Shoker, B. S., Jarvis, C., Sibson, D. R., Walker, C., and Sloane, J. P. (1999) Oestrogen receptor expression in the normal and pre-cancerous breast. J. Pathol. 188, 237-244
59. Sanchez, R., Nguyen, D., Rocha, W., White, J. H., and Mader, S. (2002) Diversity in the mechanisms of gene regulation by estrogen receptors. Bioessays 24, 244-254
60. Bjornstrom, L. and Sjoberg, M. (2005) Mechanisms of estrogen receptor signaling: convergence of genomic and nongenomic actions on target genes. Mol. Endocrinol. 19, 833-842
61. Levin, E. R. (2002) Cellular functions of plasma membrane estrogen receptors. Steroids 67, 471-475
62. Liao, J. K. (2003) Cross-coupling between the oestrogen receptor and phosphoinositide 3-kinase. Biochem. Soc. Trans. 31, 66-70
63. Levin, E. R. (2003) Bidirectional signaling between the estrogen receptor and the epidermal growth factor receptor. Mol. Endocrinol. 17, 309-317
150
64. Speirs, V., Skliris, G. P., Burdall, S. E., and Carder, P. J. (2002) Distinct expression patterns of ER alpha and ER beta in normal human mammary gland. J. Clin. Pathol. 55, 371-374
65. Shaw, J. A., Udokang, K., Mosquera, J. M., Chauhan, H., Jones, J. L., and Walker, R. A. (2002) Oestrogen receptors alpha and beta differ in normal human breast and breast carcinomas. J. Pathol. 198, 450-457
66. Ignatius, R., Wei, Y., Beaulieu, S., Gettie, A., Steinman, R. M., Pope, M., and Mojsov, S. (2000) The immunodeficiency virus coreceptor, Bonzo/STRL33/TYMSTR, is expressed by macaque and human skin- and blood-derived dendritic cells. AIDS Res. Hum. Retroviruses 16, 1055-1059
67. Turan, V. K., Sanchez, R. I., Li, J. J., Li, S. A., Reuhl, K. R., Thomas, P. E., Conney, A. H., Gallo, M. A., Kauffman, F. C., and Mesia-Vela, S. (2004) The effects of steroidal estrogens in ACI rat mammary carcinogenesis: 17beta-estradiol, 2-hydroxyestradiol, 4- hydroxyestradiol, 16alpha-hydroxyestradiol, and 4-hydroxyestrone. J. Endocrinol. 183, 91-99
68. Russo, J., Hasan, L. M., Balogh, G., Guo, S., and Russo, I. H. (2003) Estrogen and its metabolites are carcinogenic agents in human breast epithelial cells. J. Steroid Biochem. Mol. Biol. 87, 1-25
69. Lavigne, J. A., Goodman, J. E., Fonong, T., Odwin, S., He, P., Roberts, D. W., and Yager, J. D. (2001) The effects of catechol-O-methyltransferase inhibition on estrogen metabolite and oxidative DNA damage levels in estradiol-treated MCF-7 cells. Cancer Res. 61, 7488-7494
70. Nutter, L. M., Ngo, E. O., and Abul-Hajj, Y. J. (1991) Characterization of DNA damage induced by 3,4-estrone-o-quinone in human cells. J. Biol. Chem. 266, 16380-16386
71. Shull, J. D., Spady, T. J., Snyder, M. C., Johansson, S. L., and Pennington, K. L. (1997) Ovary-intact, but not ovariectomized female ACI rats treated with 17beta-estradiol rapidly develop mammary carcinoma. Carcinogenesis 18, 1595-1601
72. Ritchie, M. D., Hahn, L. W., Roodi, N., Bailey, L. R., Dupont, W. D., Parl, F. F., and Moore, J. H. (2001) Multifactor-dimensionality reduction reveals high-order interactions among estrogen-metabolism genes in sporadic breast cancer. Am. J. Hum. Genet. 69, 138- 147
73. Mitrunen, K. and Hirvonen, A. (2003) Molecular epidemiology of sporadic breast cancer. The role of polymorphic genes involved in oestrogen biosynthesis and metabolism. Mutat. Res. 544, 9-41
74. Miyoshi, Y. and Noguchi, S. (2003) Polymorphisms of estrogen synthesizing and metabolizing genes and breast cancer risk in Japanese women. Biomed. Pharmacother. 57, 471-481
151
75. Zhang, L., Gu, L., Qian, B., Hao, X., Zhang, W., Wei, Q., and Chen, K. (2009) Association of genetic polymorphisms of ER-alpha and the estradiol-synthesizing enzyme genes CYP17 and CYP19 with breast cancer risk in Chinese women. Breast Cancer Res. Treat. 114, 327-338
76. Sobczuk, A., Romanowicz, H., Fiks, T., Polac, I., and Smolarz, B. (2009) The CYP17 and CYP19 gene single nucleotide polymorphism in women with sporadic breast cancer. Pol. J. Pathol. 60, 163-167
77. Bancroft, L. W., Berquist, T. H., Morin, R. L., Pietan, J. H., Knudsen, J. M., and Williams, H. J., Jr. (2000) Fracture interpretation using electronic presentation: a comparison. J. Digit. Imaging 13, 13-18
78. Sillanpaa, P., Heikinheimo, L., Kataja, V., Eskelinen, M., Kosma, V. M., Uusitupa, M., Vainio, H., Metsola, K., and Hirvonen, A. (2007) CYP1A1 and CYP1B1 genetic polymorphisms, smoking and breast cancer risk in a Finnish Caucasian population. Breast Cancer Res. Treat. 104, 287-297
79. Mitrunen, K., Kataja, V., Eskelinen, M., Kosma, V. M., Kang, D., Benhamou, S., Vainio, H., Uusitupa, M., and Hirvonen, A. (2002) Combined COMT and GST genotypes and hormone replacement therapy associated breast cancer risk. Pharmacogenetics 12, 67-72
80. Park, S. K., Yim, D. S., Yoon, K. S., Choi, I. M., Choi, J. Y., Yoo, K. Y., Noh, D. Y., Choe, K. J., Ahn, S. H., Hirvonen, A., and Kang, D. (2004) Combined effect of GSTM1, GSTT1, and COMT genotypes in individual breast cancer risk. Breast Cancer Res. Treat. 88, 55-62
81. Barone, I., Brusco, L., and Fuqua, S. A. (2010) Estrogen receptor mutations and changes in downstream gene expression and signaling. Clin. Cancer Res. 16, 2702-2708
82. Warner, M. and Gustafsson, J. A. (2010) The role of estrogen receptor beta (ERbeta) in malignant diseases--a new potential target for antiproliferative drugs in prevention and treatment of cancer. Biochem. Biophys. Res. Commun. 396, 63-66
83. Prins, G. S. and Korach, K. S. (2008) The role of estrogens and estrogen receptors in normal prostate growth and disease. Steroids 73, 233-244
84. Ricke, W. A., Wang, Y., and Cunha, G. R. (2007) Steroid hormones and carcinogenesis of the prostate: the role of estrogens. Differentiation 75, 871-882
85. Risbridger, G. P., Ellem, S. J., and McPherson, S. J. (2007) Estrogen action on the prostate gland: a critical mix of endocrine and paracrine signaling. J. Mol. Endocrinol. 39, 183-188
86. Evans, R. M. (1988) The steroid and thyroid hormone receptor superfamily. Science 240, 889-895
152
87. Hyder, S. M., Chiappetta, C., and Stancel, G. M. (1999) Interaction of human estrogen receptors alpha and beta with the same naturally occurring estrogen response elements. Biochem. Pharmacol. 57, 597-601
88. Hall, J. M., McDonnell, D. P., and Korach, K. S. (2002) Allosteric regulation of estrogen receptor structure, function, and coactivator recruitment by different estrogen response elements. Mol. Endocrinol. 16, 469-486
89. Hall, J. M. and Korach, K. S. (2002) Analysis of the molecular mechanisms of human estrogen receptors alpha and beta reveals differential specificity in target promoter regulation by xenoestrogens. J. Biol. Chem. 277, 44455-44461
90. Carroll, J. S. and Brown, M. (2006) Estrogen receptor target gene: an evolving concept. Mol. Endocrinol. 20, 1707-1714
91. Picard, D., Kumar, V., Chambon, P., and Yamamoto, K. R. (1990) Signal transduction by steroid hormones: nuclear localization is differentially regulated in estrogen and glucocorticoid receptors. Cell Regul. 1, 291-299
92. Zwart, W., de, L. R., Rondaij, M., Neefjes, J., Mancini, M. A., and Michalides, R. (2010) The hinge region of the human estrogen receptor determines functional synergy between AF-1 and AF-2 in the quantitative response to estradiol and tamoxifen. J. Cell Sci. 123, 1253-1261
93. Danielian, P. S., White, R., Lees, J. A., and Parker, M. G. (1992) Identification of a conserved region required for hormone dependent transcriptional activation by steroid hormone receptors. EMBO J. 11, 1025-1033
94. Koehler, K. F., Helguero, L. A., Haldosen, L. A., Warner, M., and Gustafsson, J. A. (2005) Reflections on the discovery and significance of estrogen receptor beta. Endocr. Rev. 26, 465-478
95. Mosselman, S., Polman, J., and Dijkema, R. (1996) ER beta: identification and characterization of a novel human estrogen receptor. FEBS Lett. 392, 49-53
96. Kuiper, G. G., Carlsson, B., Grandien, K., Enmark, E., Haggblad, J., Nilsson, S., and Gustafsson, J. A. (1997) Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology 138, 863-870
97. Kuiper, G. G., Lemmen, J. G., Carlsson, B., Corton, J. C., Safe, S. H., van der Saag, P. T., van der Burg, B., and Gustafsson, J. A. (1998) Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor beta. Endocrinology 139, 4252-4263
98. Tora, L., White, J., Brou, C., Tasset, D., Webster, N., Scheer, E., and Chambon, P. (1989) The human estrogen receptor has two independent nonacidic transcriptional activation functions. Cell 59, 477-487
153
99. Katzenellenbogen, B. S., Sun, J., Harrington, W. R., Kraichely, D. M., Ganessunker, D., and Katzenellenbogen, J. A. (2001) Structure-function relationships in estrogen receptors and the characterization of novel selective estrogen receptor modulators with unique pharmacological profiles. Ann. N. Y. Acad. Sci. 949, 6-15
100. Tremblay, G. B. and Giguere, V. (2002) Coregulators of estrogen receptor action. Crit Rev. Eukaryot. Gene Expr. 12, 1-22
101. Dondi, D., Piccolella, M., Biserni, A., Della, T. S., Ramachandran, B., Locatelli, A., Rusmini, P., Sau, D., Caruso, D., Maggi, A., Ciana, P., and Poletti, A. (2010) Estrogen receptor beta and the progression of prostate cancer: role of 5alpha-androstane- 3beta,17beta-diol. Endocr. Relat Cancer 17, 731-742
102. Hall, J. M., Couse, J. F., and Korach, K. S. (2001) The multifaceted mechanisms of estradiol and estrogen receptor signaling. J. Biol. Chem. 276, 36869-36872
103. Menendez, D., Inga, A., and Resnick, M. A. (2010) Estrogen receptor acting in cis enhances WT and mutant p53 transactivation at canonical and noncanonical p53 target sequences. Proc. Natl. Acad. Sci. U. S. A 107, 1500-1505
104. Porter, W., Saville, B., Hoivik, D., and Safe, S. (1997) Functional synergy between the transcription factor Sp1 and the estrogen receptor. Mol. Endocrinol. 11, 1569-1580
105. Saville, B., Wormke, M., Wang, F., Nguyen, T., Enmark, E., Kuiper, G., Gustafsson, J. A., and Safe, S. (2000) Ligand-, cell-, and estrogen receptor subtype (alpha/beta)- dependent activation at GC-rich (Sp1) promoter elements. J. Biol. Chem. 275, 5379-5387
106. Kushner, P. J., Agard, D. A., Greene, G. L., Scanlan, T. S., Shiau, A. K., Uht, R. M., and Webb, P. (2000) Estrogen receptor pathways to AP-1. J. Steroid Biochem. Mol. Biol. 74, 311-317
107. Maruyama, S., Fujimoto, N., Asano, K., and Ito, A. (2001) Suppression by estrogen receptor beta of AP-1 mediated transactivation through estrogen receptor alpha. J. Steroid Biochem. Mol. Biol. 78, 177-184
108. Paech, K., Webb, P., Kuiper, G. G., Nilsson, S., Gustafsson, J., Kushner, P. J., and Scanlan, T. S. (1997) Differential ligand activation of estrogen receptors ERalpha and ERbeta at AP1 sites. Science 277, 1508-1510
109. Kim, K., Thu, N., Saville, B., and Safe, S. (2003) Domains of estrogen receptor alpha (ERalpha) required for ERalpha/Sp1-mediated activation of GC-rich promoters by estrogens and antiestrogens in breast cancer cells. Mol. Endocrinol. 17, 804-817
110. Lonard, D. M. and O'Malley, B. W. (2007) Nuclear receptor coregulators: judges, juries, and executioners of cellular regulation. Mol. Cell 27, 691-700
111. Klinge, C. M., Jernigan, S. C., Mattingly, K. A., Risinger, K. E., and Zhang, J. (2004) Estrogen response element-dependent regulation of transcriptional activation of estrogen
154
receptors alpha and beta by coactivators and corepressors. J. Mol. Endocrinol. 33, 387- 410
112. Nakajima, A., Maruyama, S., Bohgaki, M., Miyajima, N., Tsukiyama, T., Sakuragi, N., and Hatakeyama, S. (2007) Ligand-dependent transcription of estrogen receptor alpha is mediated by the ubiquitin ligase EFP. Biochem. Biophys. Res. Commun. 357, 245-251
113. Jeong, K. W., Kim, K., Situ, A. J., Ulmer, T. S., An, W., and Stallcup, M. R. (2011) Recognition of enhancer element-specific histone methylation by TIP60 in transcriptional activation. Nat. Struct. Mol. Biol. 18, 1358-1365
114. Won, J. K., Chodankar, R., Purcell, D. J., Bittencourt, D., and Stallcup, M. R. (2012) Gene-specific patterns of coregulator requirements by estrogen receptor-alpha in breast cancer cells. Mol. Endocrinol. 26, 955-966
115. Kato, S., Endoh, H., Masuhiro, Y., Kitamoto, T., Uchiyama, S., Sasaki, H., Masushige, S., Gotoh, Y., Nishida, E., Kawashima, H., Metzger, D., and Chambon, P. (1995) Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase. Science 270, 1491-1494
116. Tremblay, A., Tremblay, G. B., Labrie, F., and Giguere, V. (1999) Ligand-independent recruitment of SRC-1 to estrogen receptor beta through phosphorylation of activation function AF-1. Mol. Cell 3, 513-519
117. Meriin, A. B., Yaglom, J. A., Gabai, V. L., Zon, L., Ganiatsas, S., Mosser, D. D., Zon, L., and Sherman, M. Y. (1999) Protein-damaging stresses activate c-Jun N-terminal kinase via inhibition of its dephosphorylation: a novel pathway controlled by HSP72. Mol. Cell Biol. 19, 2547-2555
118. Lam, H. M., Suresh Babu, C. V., Wang, J., Yuan, Y., Lam, Y. W., Ho, S. M., and Leung, Y. K. (2012) Phosphorylation of human estrogen receptor-beta at serine 105 inhibits breast cancer cell migration and invasion. Mol. Cell Endocrinol. 358, 27-35
119. Razandi, M., Pedram, A., Merchenthaler, I., Greene, G. L., and Levin, E. R. (2004) Plasma membrane estrogen receptors exist and functions as dimers. Mol. Endocrinol. 18, 2854-2865
120. Razandi, M., Pedram, A., Greene, G. L., and Levin, E. R. (1999) Cell membrane and nuclear estrogen receptors (ERs) originate from a single transcript: studies of ERalpha and ERbeta expressed in Chinese hamster ovary cells. Mol. Endocrinol. 13, 307-319
121. Razandi, M., Pedram, A., Jordan, V. C., Fuqua, S., and Levin, E. R. (2012) Tamoxifen regulates cell fate through mitochondrial estrogen receptor beta in breast cancer. Oncogene
122. Zhou, Z., Zhou, J., and Du, Y. (2012) Estrogen receptor beta interacts and colocalizes with HADHB in mitochondria. Biochem. Biophys. Res. Commun. 427, 305-308
155
123. Fraser, S. P., Ozerlat-Gunduz, I., Onkal, R., Diss, J. K., Latchman, D. S., and Djamgoz, M. B. (2010) Estrogen and non-genomic upregulation of voltage-gated Na(+) channel activity in MDA-MB-231 human breast cancer cells: role in adhesion. J. Cell Physiol 224, 527-539
124. Chakravarty, D., Nair, S. S., Santhamma, B., Nair, B. C., Wang, L., Bandyopadhyay, A., Agyin, J. K., Brann, D., Sun, L. Z., Yeh, I. T., Lee, F. Y., Tekmal, R. R., Kumar, R., and Vadlamudi, R. K. (2010) Extranuclear functions of ER impact invasive migration and metastasis by breast cancer cells. Cancer Res. 70, 4092-4101
125. Verma, M. K., Miki, Y., Abe, K., Niikawa, H., and Sasano, H. (2012) Cytoplasmic estrogen receptor beta as a potential marker in human non-small cell lung carcinoma. Expert. Opin. Ther. Targets. 16 Suppl 1, S91-102
126. Grytsyuk, N., Arapis, G., Perepelyatnikova, L., Ivanova, T., and Vynograds'ka, V. (2006) Heavy metals effects on forage crops yields and estimation of elements accumulation in plants as affected by soil. Sci. Total Environ. 354, 224-231
127. Danesh, S. M., Kundu, P., Lu, R., Stefani, E., and Toro, L. (2011) Distinct transcriptional regulation of human large conductance voltage- and calcium-activated K+ channel gene (hSlo1) by activated estrogen receptor alpha and c-Src tyrosine kinase. J. Biol. Chem. 286, 31064-31071
128. Ohshiro, K., Schwartz, A. M., Levine, P. H., and Kumar, R. (2012) Alternate estrogen receptors promote invasion of inflammatory breast cancer cells via non-genomic signaling. PLoS. One. 7, e30725
129. Zhang, X. T., Ding, L., Kang, L. G., and Wang, Z. Y. (2012) Involvement of ER-alpha36, Src, EGFR and STAT5 in the biphasic estrogen signaling of ER-negative breast cancer cells. Oncol. Rep. 27, 2057-2065
130. Leung, Y. K., Mak, P., Hassan, S., and Ho, S. M. (2006) Estrogen receptor (ER)-beta isoforms: a key to understanding ER-beta signaling. Proc. Natl. Acad. Sci. U. S. A 103, 13162-13167
131. Tremblay, G. B., Tremblay, A., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Labrie, F., and Giguere, V. (1997) Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor beta. Mol. Endocrinol. 11, 353-365
132. Tee, M. K., Rogatsky, I., Tzagarakis-Foster, C., Cvoro, A., An, J., Christy, R. J., Yamamoto, K. R., and Leitman, D. C. (2004) Estradiol and selective estrogen receptor modulators differentially regulate target genes with estrogen receptors alpha and beta. Mol. Biol. Cell 15, 1262-1272
133. Levy, N., Tatomer, D., Herber, C. B., Zhao, X., Tang, H., Sargeant, T., Ball, L. J., Summers, J., Speed, T. P., and Leitman, D. C. (2008) Differential regulation of native estrogen receptor-regulatory elements by estradiol, tamoxifen, and raloxifene. Mol. Endocrinol. 22, 287-303
156
134. Webb, P., Nguyen, P., Valentine, C., Lopez, G. N., Kwok, G. R., McInerney, E., Katzenellenbogen, B. S., Enmark, E., Gustafsson, J. A., Nilsson, S., and Kushner, P. J. (1999) The estrogen receptor enhances AP-1 activity by two distinct mechanisms with different requirements for receptor transactivation functions. Mol. Endocrinol. 13, 1672- 1685
135. Zhao, C., Gao, H., Liu, Y., Papoutsi, Z., Jaffrey, S., Gustafsson, J. A., and Dahlman- Wright, K. (2010) Genome-wide mapping of estrogen receptor-beta-binding regions reveals extensive cross-talk with transcription factor activator protein-1. Cancer Res. 70, 5174-5183
136. Vivar, O. I., Zhao, X., Saunier, E. F., Griffin, C., Mayba, O. S., Tagliaferri, M., Cohen, I., Speed, T. P., and Leitman, D. C. (2010) Estrogen receptor beta binds to and regulates three distinct classes of target genes. J. Biol. Chem. 285, 22059-22066
137. Tateishi, Y., Kawabe, Y., Chiba, T., Murata, S., Ichikawa, K., Murayama, A., Tanaka, K., Baba, T., Kato, S., and Yanagisawa, J. (2004) Ligand-dependent switching of ubiquitin- proteasome pathways for estrogen receptor. EMBO J. 23, 4813-4823
138. Cappelletti, V., Miodini, P., Di, F. G., and Daidone, M. G. (2006) Modulation of estrogen receptor-beta isoforms by phytoestrogens in breast cancer cells. Int. J. Oncol. 28, 1185- 1191
139. Shang, Y., Hu, X., DiRenzo, J., Lazar, M. A., and Brown, M. (2000) Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103, 843-852
140. Reid, G., Hubner, M. R., Metivier, R., Brand, H., Denger, S., Manu, D., Beaudouin, J., Ellenberg, J., and Gannon, F. (2003) Cyclic, proteasome-mediated turnover of unliganded and liganded ERalpha on responsive promoters is an integral feature of estrogen signaling. Mol. Cell 11, 695-707
141. Tateishi, Y., Sonoo, R., Sekiya, Y., Sunahara, N., Kawano, M., Wayama, M., Hirota, R., Kawabe, Y., Murayama, A., Kato, S., Kimura, K., and Yanagisawa, J. (2006) Turning off estrogen receptor beta-mediated transcription requires estrogen-dependent receptor proteolysis. Mol. Cell Biol. 26, 7966-7976
142. Masuyama, H. and Hiramatsu, Y. (2004) Involvement of suppressor for Gal 1 in the ubiquitin/proteasome-mediated degradation of estrogen receptors. J. Biol. Chem. 279, 12020-12026
143. Biswas, D. K., Singh, S., Shi, Q., Pardee, A. B., and Iglehart, J. D. (2005) Crossroads of estrogen receptor and NF-kappaB signaling. Sci. STKE. 2005, e27
144. Merot, Y., Metivier, R., Penot, G., Manu, D., Saligaut, C., Gannon, F., Pakdel, F., Kah, O., and Flouriot, G. (2004) The relative contribution exerted by AF-1 and AF-2 transactivation functions in estrogen receptor alpha transcriptional activity depends upon the differentiation stage of the cell. J. Biol. Chem. 279, 26184-26191
157
145. Flototto, T., Niederacher, D., Hohmann, D., Heimerzheim, T., Dall, P., Djahansouzi, S., Bender, H. G., and Hanstein, B. (2004) Molecular mechanism of estrogen receptor (ER)alpha-specific, estradiol-dependent expression of the progesterone receptor (PR) B- isoform. J. Steroid Biochem. Mol. Biol. 88, 131-142
146. Onate, S. A., Tsai, S. Y., Tsai, M. J., and O'Malley, B. W. (1995) Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270, 1354-1357
147. Voegel, J. J., Heine, M. J., Zechel, C., Chambon, P., and Gronemeyer, H. (1996) TIF2, a 160 kDa transcriptional mediator for the ligand-dependent activation function AF-2 of nuclear receptors. EMBO J. 15, 3667-3675
148. Anzick, S. L., Kononen, J., Walker, R. L., Azorsa, D. O., Tanner, M. M., Guan, X. Y., Sauter, G., Kallioniemi, O. P., Trent, J. M., and Meltzer, P. S. (1997) AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277, 965-968
149. Malovannaya, A., Lanz, R. B., Jung, S. Y., Bulynko, Y., Le, N. T., Chan, D. W., Ding, C., Shi, Y., Yucer, N., Krenciute, G., Kim, B. J., Li, C., Chen, R., Li, W., Wang, Y., O'Malley, B. W., and Qin, J. (2011) Analysis of the human endogenous coregulator complexome. Cell 145, 787-799
150. Zwijsen, R. M., Buckle, R. S., Hijmans, E. M., Loomans, C. J., and Bernards, R. (1998) Ligand-independent recruitment of steroid receptor coactivators to estrogen receptor by cyclin D1. Genes Dev. 12, 3488-3498
151. Horlein, A. J., Naar, A. M., Heinzel, T., Torchia, J., Gloss, B., Kurokawa, R., Ryan, A., Kamei, Y., Soderstrom, M., Glass, C. K., and . (1995) Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature 377, 397-404
152. Chen, J. D. and Evans, R. M. (1995) A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature 377, 454-457
153. Karmakar, S., Gao, T., Pace, M. C., Oesterreich, S., and Smith, C. L. (2010) Cooperative activation of cyclin D1 and progesterone receptor gene expression by the SRC-3 coactivator and SMRT corepressor. Mol. Endocrinol. 24, 1187-1202
154. Kojetin, D. J., Burris, T. P., Jensen, E. V., and Khan, S. A. (2008) Implications of the binding of tamoxifen to the coactivator recognition site of the estrogen receptor. Endocr. Relat Cancer 15, 851-870
155. Routledge, E. J., White, R., Parker, M. G., and Sumpter, J. P. (2000) Differential effects of xenoestrogens on coactivator recruitment by estrogen receptor (ER) alpha and ERbeta. J. Biol. Chem. 275, 35986-35993
156. Fleming, F. J., Hill, A. D., McDermott, E. W., O'Higgins, N. J., and Young, L. S. (2004) Differential recruitment of coregulator proteins steroid receptor coactivator-1 and
158
silencing mediator for retinoid and thyroid receptors to the estrogen receptor-estrogen response element by beta-estradiol and 4-hydroxytamoxifen in human breast cancer. J. Clin. Endocrinol. Metab 89, 375-383
157. Smith, C. L., Nawaz, Z., and O'Malley, B. W. (1997) Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4- hydroxytamoxifen. Mol. Endocrinol. 11, 657-666
158. Mc, I. M., Fleming, F. J., Buggy, Y., Hill, A. D., and Young, L. S. (2006) Tamoxifen- induced ER-alpha-SRC-3 interaction in HER2 positive human breast cancer; a possible mechanism for ER isoform specific recurrence. Endocr. Relat Cancer 13, 1135-1145
159. Ramsey, T. L. and Klinge, C. M. (2001) Estrogen response element binding induces alterations in estrogen receptor-alpha conformation as revealed by susceptibility to partial proteolysis. J. Mol. Endocrinol. 27, 275-292
160. Yi, P., Driscoll, M. D., Huang, J., Bhagat, S., Hilf, R., Bambara, R. A., and Muyan, M. (2002) The effects of estrogen-responsive element- and ligand-induced structural changes on the recruitment of cofactors and transcriptional responses by ER alpha and ER beta. Mol. Endocrinol. 16, 674-693
161. Dutertre, M. and Smith, C. L. (2003) Ligand-independent interactions of p160/steroid receptor coactivators and CREB-binding protein (CBP) with estrogen receptor-alpha: regulation by phosphorylation sites in the A/B region depends on other receptor domains. Mol. Endocrinol. 17, 1296-1314
162. Loven, M. A., Likhite, V. S., Choi, I., and Nardulli, A. M. (2001) Estrogen response elements alter coactivator recruitment through allosteric modulation of estrogen receptor beta conformation. J. Biol. Chem. 276, 45282-45288
163. Nassa, G., Tarallo, R., Ambrosino, C., Bamundo, A., Ferraro, L., Paris, O., Ravo, M., Guzzi, P. H., Cannataro, M., Baumann, M., Nyman, T. A., Nola, E., and Weisz, A. (2011) A large set of estrogen receptor beta-interacting proteins identified by tandem affinity purification in hormone-responsive human breast cancer cell nuclei. Proteomics. 11, 159- 165
164. Kasof, G. M., Goyal, L., and White, E. (1999) Btf, a novel death-promoting transcriptional repressor that interacts with Bcl-2-related proteins. Mol. Cell Biol. 19, 4390-4404
165. Sharon-Friling, R., Goodhouse, J., Colberg-Poley, A. M., and Shenk, T. (2006) Human cytomegalovirus pUL37x1 induces the release of endoplasmic reticulum calcium stores. Proc. Natl. Acad. Sci. U. S. A 103, 19117-19122
166. Ivanova, M., Abner, S., Pierce, W., Jr., and Klinge, C. (2011) Ligand-dependent differences in estrogen receptor beta-interacting proteins identified in lung adenocarcinoma cells corresponds to estrogenic responses. Proteome. Sci. 9, 60
159
167. Faus, H. and Haendler, B. (2006) Post-translational modifications of steroid receptors. Biomed. Pharmacother. 60, 520-528
168. Le, R. M., Poulard, C., Cohen, P., Sentis, S., Renoir, J. M., and Corbo, L. (2011) Cracking the estrogen receptor's posttranslational code in breast tumors. Endocr. Rev. 32, 597-622
169. Thomas, C. and Gustafsson, J. A. (2011) The different roles of ER subtypes in cancer biology and therapy. Nat. Rev. Cancer 11, 597-608
170. Lannigan, D. A. (2003) Estrogen receptor phosphorylation. Steroids 68, 1-9
171. Ito, S., Takeyama, K., Yamamoto, A., Sawatsubashi, S., Shirode, Y., Kouzmenko, A., Tabata, T., and Kato, S. (2004) In vivo potentiation of human oestrogen receptor alpha by Cdk7-mediated phosphorylation. Genes Cells 9, 983-992
172. Vilgelm, A., Lian, Z., Wang, H., Beauparlant, S. L., Klein-Szanto, A., Ellenson, L. H., and Di, C. A. (2006) Akt-mediated phosphorylation and activation of estrogen receptor alpha is required for endometrial neoplastic transformation in Pten+/- mice. Cancer Res. 66, 3375-3380
173. Chen, D., Pace, P. E., Coombes, R. C., and Ali, S. (1999) Phosphorylation of human estrogen receptor alpha by protein kinase A regulates dimerization. Mol. Cell Biol. 19, 1002-1015
174. Hamilton-Burke, W., Coleman, L., Cummings, M., Green, C. A., Holliday, D. L., Horgan, K., Maraqa, L., Peter, M. B., Pollock, S., Shaaban, A. M., Smith, L., and Speirs, V. (2010) Phosphorylation of estrogen receptor beta at serine 105 is associated with good prognosis in breast cancer. Am. J. Pathol. 177, 1079-1086
175. Sauve, K., Lepage, J., Sanchez, M., Heveker, N., and Tremblay, A. (2009) Positive feedback activation of estrogen receptors by the CXCL12-CXCR4 pathway. Cancer Res. 69, 5793-5800
176. Tremblay, A. and Giguere, V. (2001) Contribution of steroid receptor coactivator-1 and CREB binding protein in ligand-independent activity of estrogen receptor beta. J. Steroid Biochem. Mol. Biol. 77, 19-27
177. Picard, N., Charbonneau, C., Sanchez, M., Licznar, A., Busson, M., Lazennec, G., and Tremblay, A. (2008) Phosphorylation of activation function-1 regulates proteasome- dependent nuclear mobility and E6-associated protein ubiquitin ligase recruitment to the estrogen receptor beta. Mol. Endocrinol. 22, 317-330
178. Lee, J. W., Ryan, F., Swaffield, J. C., Johnston, S. A., and Moore, D. D. (1995) Interaction of thyroid-hormone receptor with a conserved transcriptional mediator. Nature 374, 91-94
160
179. Nawaz, Z., Lonard, D. M., Smith, C. L., Lev-Lehman, E., Tsai, S. Y., Tsai, M. J., and O'Malley, B. W. (1999) The Angelman syndrome-associated protein, E6-AP, is a coactivator for the nuclear hormone receptor superfamily. Mol. Cell Biol. 19, 1182-1189
180. Luo, M., Koh, M., Feng, J., Wu, Q., and Melamed, P. (2005) Cross talk in hormonally regulated gene transcription through induction of estrogen receptor ubiquitylation. Mol. Cell Biol. 25, 7386-7398
181. Matthews, J., Wihlen, B., Thomsen, J., and Gustafsson, J. A. (2005) Aryl hydrocarbon receptor-mediated transcription: ligand-dependent recruitment of estrogen receptor alpha to 2,3,7,8-tetrachlorodibenzo-p-dioxin-responsive promoters. Mol. Cell Biol. 25, 5317- 5328
182. Chakrabarti, S., Lekontseva, O., Peters, A., and Davidge, S. T. (2010) 17beta-Estradiol induces protein S-nitrosylation in the endothelium. Cardiovasc. Res. 85, 796-805
183. Zhang, H. H., Feng, L., Livnat, I., Hoh, J. K., Shim, J. Y., Liao, W. X., and Chen, D. B. (2010) Estradiol-17beta stimulates specific receptor and endogenous nitric oxide- dependent dynamic endothelial protein S-nitrosylation: analysis of endothelial nitrosyl- proteome. Endocrinology 151, 3874-3887
184. Lin, J., Steenbergen, C., Murphy, E., and Sun, J. (2009) Estrogen receptor-beta activation results in S-nitrosylation of proteins involved in cardioprotection. Circulation 120, 245- 254
185. Zhang, H. H., Feng, L., Wang, W., Magness, R. R., and Chen, D. B. (2012) Estrogen- responsive nitroso-proteome in uterine artery endothelial cells: role of endothelial nitric oxide synthase and estrogen receptor-beta. J. Cell Physiol 227, 146-159
186. Garban, H. J., Marquez-Garban, D. C., Pietras, R. J., and Ignarro, L. J. (2005) Rapid nitric oxide-mediated S-nitrosylation of estrogen receptor: regulation of estrogen- dependent gene transcription. Proc. Natl. Acad. Sci. U. S. A 102, 2632-2636
187. Wang, C., Tian, L., Popov, V. M., and Pestell, R. G. (2011) Acetylation and nuclear receptor action. J. Steroid Biochem. Mol. Biol. 123, 91-100
188. Fu, Y., Hsieh, T. C., Guo, J., Kunicki, J., Lee, M. Y., Darzynkiewicz, Z., and Wu, J. M. (2004) Licochalcone-A, a novel flavonoid isolated from licorice root (Glycyrrhiza glabra), causes G2 and late-G1 arrests in androgen-independent PC-3 prostate cancer cells. Biochem. Biophys. Res. Commun. 322, 263-270
189. Kim, M. Y., Woo, E. M., Chong, Y. T., Homenko, D. R., and Kraus, W. L. (2006) Acetylation of estrogen receptor alpha by p300 at lysines 266 and 268 enhances the deoxyribonucleic acid binding and transactivation activities of the receptor. Mol. Endocrinol. 20, 1479-1493
190. Wang, C., Fu, M., Angeletti, R. H., Siconolfi-Baez, L., Reutens, A. T., Albanese, C., Lisanti, M. P., Katzenellenbogen, B. S., Kato, S., Hopp, T., Fuqua, S. A., Lopez, G. N.,
161
Kushner, P. J., and Pestell, R. G. (2001) Direct acetylation of the estrogen receptor alpha hinge region by p300 regulates transactivation and hormone sensitivity. J. Biol. Chem. 276, 18375-18383
191. Cui, Y., Zhang, M., Pestell, R., Curran, E. M., Welshons, W. V., and Fuqua, S. A. (2004) Phosphorylation of estrogen receptor alpha blocks its acetylation and regulates estrogen sensitivity. Cancer Res. 64, 9199-9208
192. Wong, C. W., Komm, B., and Cheskis, B. J. (2001) Structure-function evaluation of ER alpha and beta interplay with SRC family coactivators. ER selective ligands. Biochemistry 40, 6756-6765
193. Latil, A., Bieche, I., Vidaud, D., Lidereau, R., Berthon, P., Cussenot, O., and Vidaud, M. (2001) Evaluation of androgen, estrogen (ER alpha and ER beta), and progesterone receptor expression in human prostate cancer by real-time quantitative reverse transcription-polymerase chain reaction assays. Cancer Res. 61, 1919-1926
194. Pasquali, D., Rossi, V., Esposito, D., Abbondanza, C., Puca, G. A., Bellastella, A., and Sinisi, A. A. (2001) Loss of estrogen receptor beta expression in malignant human prostate cells in primary cultures and in prostate cancer tissues. J. Clin. Endocrinol. Metab 86, 2051-2055
195. Pasquali, D., Staibano, S., Prezioso, D., Franco, R., Esposito, D., Notaro, A., De, R. G., Bellastella, A., and Sinisi, A. A. (2001) Estrogen receptor beta expression in human prostate tissue. Mol. Cell Endocrinol. 178, 47-50
196. Horvath, L. G., Henshall, S. M., Lee, C. S., Head, D. R., Quinn, D. I., Makela, S., Delprado, W., Golovsky, D., Brenner, P. C., O'Neill, G., Kooner, R., Stricker, P. D., Grygiel, J. J., Gustafsson, J. A., and Sutherland, R. L. (2001) Frequent loss of estrogen receptor-beta expression in prostate cancer. Cancer Res. 61, 5331-5335
197. Leav, I., Lau, K. M., Adams, J. Y., McNeal, J. E., Taplin, M. E., Wang, J., Singh, H., and Ho, S. M. (2001) Comparative studies of the estrogen receptors beta and alpha and the androgen receptor in normal human prostate glands, dysplasia, and in primary and metastatic carcinoma. Am. J. Pathol. 159, 79-92
198. Zhu, X., Leav, I., Leung, Y. K., Wu, M., Liu, Q., Gao, Y., McNeal, J. E., and Ho, S. M. (2004) Dynamic regulation of estrogen receptor-beta expression by DNA methylation during prostate cancer development and metastasis. Am. J. Pathol. 164, 2003-2012
199. Krege, J. H., Hodgin, J. B., Couse, J. F., Enmark, E., Warner, M., Mahler, J. F., Sar, M., Korach, K. S., Gustafsson, J. A., and Smithies, O. (1998) Generation and reproductive phenotypes of mice lacking estrogen receptor beta. Proc. Natl. Acad. Sci. U. S. A 95, 15677-15682
200. McPherson, S. J., Hussain, S., Balanathan, P., Hedwards, S. L., Niranjan, B., Grant, M., Chandrasiri, U. P., Toivanen, R., Wang, Y., Taylor, R. A., and Risbridger, G. P. (2010) Estrogen receptor-beta activated apoptosis in benign hyperplasia and cancer of the
162
prostate is androgen independent and TNFalpha mediated. Proc. Natl. Acad. Sci. U. S. A 107, 3123-3128
201. Hurtado, A., Pinos, T., Barbosa-Desongles, A., Lopez-Aviles, S., Barquinero, J., Petriz, J., Santamaria-Martinez, A., Morote, J., de, T., I, Bellmunt, J., Reventos, J., and Munell, F. (2008) Estrogen receptor beta displays cell cycle-dependent expression and regulates the G1 phase through a non-genomic mechanism in prostate carcinoma cells. Cell Oncol. 30, 349-365
202. Nakajima, Y., Akaogi, K., Suzuki, T., Osakabe, A., Yamaguchi, C., Sunahara, N., Ishida, J., Kako, K., Ogawa, S., Fujimura, T., Homma, Y., Fukamizu, A., Murayama, A., Kimura, K., Inoue, S., and Yanagisawa, J. (2011) Estrogen regulates tumor growth through a nonclassical pathway that includes the transcription factors ERbeta and KLF5. Sci. Signal. 4, ra22
203. Chang, W. Y. and Prins, G. S. (1999) Estrogen receptor-beta: implications for the prostate gland. Prostate 40, 115-124
204. Mak, P., Leav, I., Pursell, B., Bae, D., Yang, X., Taglienti, C. A., Gouvin, L. M., Sharma, V. M., and Mercurio, A. M. (2010) ERbeta impedes prostate cancer EMT by destabilizing HIF-1alpha and inhibiting VEGF-mediated snail nuclear localization: implications for Gleason grading. Cancer Cell 17, 319-332
205. Guerini, V., Sau, D., Scaccianoce, E., Rusmini, P., Ciana, P., Maggi, A., Martini, P. G., Katzenellenbogen, B. S., Martini, L., Motta, M., and Poletti, A. (2005) The androgen derivative 5alpha-androstane-3beta,17beta-diol inhibits prostate cancer cell migration through activation of the estrogen receptor beta subtype. Cancer Res. 65, 5445-5453
206. Markopoulos, C., Berger, U., Wilson, P., Gazet, J. C., and Coombes, R. C. (1988) Oestrogen receptor content of normal breast cells and breast carcinomas throughout the menstrual cycle. Br. Med. J. (Clin. Res. Ed) 296, 1349-1351
207. Iwase, H., Zhang, Z., Omoto, Y., Sugiura, H., Yamashita, H., Toyama, T., Iwata, H., and Kobayashi, S. (2003) Clinical significance of the expression of estrogen receptors alpha and beta for endocrine therapy of breast cancer. Cancer Chemother. Pharmacol. 52 Suppl 1, S34-S38
208. Esslimani-Sahla, M., Simony-Lafontaine, J., Kramar, A., Lavaill, R., Mollevi, C., Warner, M., Gustafsson, J. A., and Rochefort, H. (2004) Estrogen receptor beta (ER beta) level but not its ER beta cx variant helps to predict tamoxifen resistance in breast cancer. Clin. Cancer Res. 10, 5769-5776
209. Honma, N., Horii, R., Iwase, T., Saji, S., Younes, M., Takubo, K., Matsuura, M., Ito, Y., Akiyama, F., and Sakamoto, G. (2008) Clinical importance of estrogen receptor-beta evaluation in breast cancer patients treated with adjuvant tamoxifen therapy. J. Clin. Oncol. 26, 3727-3734
163
210. Speirs, V., Carder, P. J., Lane, S., Dodwell, D., Lansdown, M. R., and Hanby, A. M. (2004) Oestrogen receptor beta: what it means for patients with breast cancer. Lancet Oncol. 5, 174-181
211. Murphy, L. C., Peng, B., Lewis, A., Davie, J. R., Leygue, E., Kemp, A., Ung, K., Vendetti, M., and Shiu, R. (2005) Inducible upregulation of oestrogen receptor-beta1 affects oestrogen and tamoxifen responsiveness in MCF7 human breast cancer cells. J. Mol. Endocrinol. 34, 553-566
212. Hayashi, S. I., Eguchi, H., Tanimoto, K., Yoshida, T., Omoto, Y., Inoue, A., Yoshida, N., and Yamaguchi, Y. (2003) The expression and function of estrogen receptor alpha and beta in human breast cancer and its clinical application. Endocr. Relat Cancer 10, 193- 202
213. Omoto, Y., Eguchi, H., Yamamoto-Yamaguchi, Y., and Hayashi, S. (2003) Estrogen receptor (ER) beta1 and ERbetacx/beta2 inhibit ERalpha function differently in breast cancer cell line MCF7. Oncogene 22, 5011-5020
214. Lazennec, G., Bresson, D., Lucas, A., Chauveau, C., and Vignon, F. (2001) ER beta inhibits proliferation and invasion of breast cancer cells. Endocrinology 142, 4120-4130
215. Paruthiyil, S., Parmar, H., Kerekatte, V., Cunha, G. R., Firestone, G. L., and Leitman, D. C. (2004) Estrogen receptor beta inhibits human breast cancer cell proliferation and tumor formation by causing a G2 cell cycle arrest. Cancer Res. 64, 423-428
216. Strom, A., Hartman, J., Foster, J. S., Kietz, S., Wimalasena, J., and Gustafsson, J. A. (2004) Estrogen receptor beta inhibits 17beta-estradiol-stimulated proliferation of the breast cancer cell line T47D. Proc. Natl. Acad. Sci. U. S. A 101, 1566-1571
217. Chang, E. C., Frasor, J., Komm, B., and Katzenellenbogen, B. S. (2006) Impact of estrogen receptor beta on gene networks regulated by estrogen receptor alpha in breast cancer cells. Endocrinology 147, 4831-4842
218. Williams, C., Edvardsson, K., Lewandowski, S. A., Strom, A., and Gustafsson, J. A. (2008) A genome-wide study of the repressive effects of estrogen receptor beta on estrogen receptor alpha signaling in breast cancer cells. Oncogene 27, 1019-1032
219. Hartman, J., Lindberg, K., Morani, A., Inzunza, J., Strom, A., and Gustafsson, J. A. (2006) Estrogen receptor beta inhibits angiogenesis and growth of T47D breast cancer xenografts. Cancer Res. 66, 11207-11213
220. Platet, N., Cunat, S., Chalbos, D., Rochefort, H., and Garcia, M. (2000) Unliganded and liganded estrogen receptors protect against cancer invasion via different mechanisms. Mol. Endocrinol. 14, 999-1009
221. Hou, Y. F., Yuan, S. T., Li, H. C., Wu, J., Lu, J. S., Liu, G., Lu, L. J., Shen, Z. Z., Ding, J., and Shao, Z. M. (2004) ERbeta exerts multiple stimulative effects on human breast carcinoma cells. Oncogene 23, 5799-5806
164
222. Fasco, M. J., Keyomarsi, K., Arcaro, K. F., and Gierthy, J. F. (2000) Expression of an estrogen receptor alpha variant protein in cell lines and tumors. Mol. Cell Endocrinol. 162, 167-180
223. Ye, Q., Chung, L. W., Cinar, B., Li, S., and Zhau, H. E. (2000) Identification and characterization of estrogen receptor variants in prostate cancer cell lines. J. Steroid Biochem. Mol. Biol. 75, 21-31
224. Al-Bader, M., Al-Saji, S., Ford, C. H., Francis, I., and Al-Ayadhy, B. (2010) Real-time PCR: detection of oestrogen receptor-alpha and -beta isoforms and variants in breast cancer. Anticancer Res. 30, 4147-4156
225. Al-Bader, M., Ford, C., Al-Ayadhy, B., and Francis, I. (2011) Analysis of estrogen receptor isoforms and variants in breast cancer cell lines. Exp. Ther. Med. 2, 537-544
226. Chaudhri, R. A., Olivares-Navarrete, R., Cuenca, N., Hadadi, A., Boyan, B. D., and Schwartz, Z. (2012) Membrane estrogen signaling enhances tumorigenesis and metastatic potential of breast cancer cells via estrogen receptor-alpha36 (ERalpha36). J. Biol. Chem. 287, 7169-7181
227. Klinge, C. M., Riggs, K. A., Wickramasinghe, N. S., Emberts, C. G., McConda, D. B., Barry, P. N., and Magnusen, J. E. (2010) Estrogen receptor alpha 46 is reduced in tamoxifen resistant breast cancer cells and re-expression inhibits cell proliferation and estrogen receptor alpha 66-regulated target gene transcription. Mol. Cell Endocrinol. 323, 268-276
228. Zhao, C., Lam, E. W., Sunters, A., Enmark, E., De Bella, M. T., Coombes, R. C., Gustafsson, J. A., and Dahlman-Wright, K. (2003) Expression of estrogen receptor beta isoforms in normal breast epithelial cells and breast cancer: regulation by methylation. Oncogene 22, 7600-7606
229. Zhang, X., Leung, Y. K., and Ho, S. M. (2007) AP-2 regulates the transcription of estrogen receptor (ER)-beta by acting through a methylation hotspot of the 0N promoter in prostate cancer cells. Oncogene 26, 7346-7354
230. Smith, L., Brannan, R. A., Hanby, A. M., Shaaban, A. M., Verghese, E. T., Peter, M. B., Pollock, S., Satheesha, S., Szynkiewicz, M., Speirs, V., and Hughes, T. A. (2010) Differential regulation of oestrogen receptor beta isoforms by 5' untranslated regions in cancer. J. Cell Mol. Med. 14, 2172-2184
231. Hirata, S., Shoda, T., Kato, J., and Hoshi, K. (2001) The multiple untranslated first exons system of the human estrogen receptor beta (ER beta) gene. J. Steroid Biochem. Mol. Biol. 78, 33-40
232. Morris, D. R. and Geballe, A. P. (2000) Upstream open reading frames as regulators of mRNA translation. Mol. Cell Biol. 20, 8635-8642
165
233. Poola, I., Abraham, J., Baldwin, K., Saunders, A., and Bhatnagar, R. (2005) Estrogen receptors beta4 and beta5 are full length functionally distinct ERbeta isoforms: cloning from human ovary and functional characterization. Endocrine. 27, 227-238
234. Moore, J. T., McKee, D. D., Slentz-Kesler, K., Moore, L. B., Jones, S. A., Horne, E. L., Su, J. L., Kliewer, S. A., Lehmann, J. M., and Willson, T. M. (1998) Cloning and characterization of human estrogen receptor beta isoforms. Biochem. Biophys. Res. Commun. 247, 75-78
235. Matthews, J. and Gustafsson, J. A. (2003) Estrogen signaling: a subtle balance between ER alpha and ER beta. Mol. Interv. 3, 281-292
236. Leung, Y. K., Lam, H. M., Wu, S., Song, D., Levin, L., Cheng, L., Wu, C. L., and Ho, S. M. (2010) Estrogen receptor beta2 and beta5 are associated with poor prognosis in prostate cancer, and promote cancer cell migration and invasion. Endocr. Relat Cancer 17, 675-689
237. Fujimura, T., Takahashi, S., Urano, T., Ogawa, S., Ouchi, Y., Kitamura, T., Muramatsu, M., and Inoue, S. (2001) Differential expression of estrogen receptor beta (ERbeta) and its C-terminal truncated splice variant ERbetacx as prognostic predictors in human prostatic cancer. Biochem. Biophys. Res. Commun. 289, 692-699
238. Dey, P., Jonsson, P., Hartman, J., Williams, C., Strom, A., and Gustafsson, J. A. (2012) Estrogen Receptors beta1 and beta2 Have Opposing Roles in Regulating Proliferation and Bone Metastasis Genes in the Prostate Cancer Cell Line PC3. Mol. Endocrinol.
239. Iwao, K., Miyoshi, Y., Egawa, C., Ikeda, N., and Noguchi, S. (2000) Quantitative analysis of estrogen receptor-beta mRNA and its variants in human breast cancers. Int. J. Cancer 88, 733-736
240. Roger, P., Sahla, M. E., Makela, S., Gustafsson, J. A., Baldet, P., and Rochefort, H. (2001) Decreased expression of estrogen receptor beta protein in proliferative preinvasive mammary tumors. Cancer Res. 61, 2537-2541
241. Hodges-Gallagher, L., Valentine, C. D., El, B. S., and Kushner, P. J. (2008) Estrogen receptor beta increases the efficacy of antiestrogens by effects on apoptosis and cell cycling in breast cancer cells. Breast Cancer Res. Treat. 109, 241-250
242. Treeck, O., Juhasz-Boess, I., Lattrich, C., Horn, F., Goerse, R., and Ortmann, O. (2008) Effects of exon-deleted estrogen receptor beta transcript variants on growth, apoptosis and gene expression of human breast cancer cell lines. Breast Cancer Res. Treat. 110, 507-520
243. Wu, X., Subramaniam, M., Grygo, S. B., Sun, Z., Negron, V., Lingle, W. L., Goetz, M. P., Ingle, J. N., Spelsberg, T. C., and Hawse, J. R. (2011) Estrogen receptor-beta sensitizes breast cancer cells to the anti-estrogenic actions of endoxifen. Breast Cancer Res. 13, R27
166
244. Cotrim, C. Z., Fabris, V., Doria, M. L., Lindberg, K., Gustafsson, J. A., Amado, F., Lanari, C., and Helguero, L. A. (2013) Estrogen receptor beta growth-inhibitory effects are repressed through activation of MAPK and PI3K signalling in mammary epithelial and breast cancer cells. Oncogene 32, 2390-2402
245. Leygue, E., Dotzlaw, H., Watson, P. H., and Murphy, L. C. (1998) Altered estrogen receptor alpha and beta messenger RNA expression during human breast tumorigenesis. Cancer Res. 58, 3197-3201
246. Esslimani-Sahla, M., Kramar, A., Simony-Lafontaine, J., Warner, M., Gustafsson, J. A., and Rochefort, H. (2005) Increased estrogen receptor betacx expression during mammary carcinogenesis. Clin. Cancer Res. 11, 3170-3174
247. Yan, M., Rayoo, M., Takano, E. A., and Fox, S. B. (2011) Nuclear and cytoplasmic expressions of ERbeta1 and ERbeta2 are predictive of response to therapy and alters prognosis in familial breast cancers. Breast Cancer Res. Treat. 126, 395-405
248. Vinayagam, R., Sibson, D. R., Holcombe, C., Aachi, V., and Davies, M. P. (2007) Association of oestrogen receptor beta 2 (ER beta 2/ER beta cx) with outcome of adjuvant endocrine treatment for primary breast cancer--a retrospective study. BMC. Cancer 7, 131
249. Sugiura, H., Toyama, T., Hara, Y., Zhang, Z., Kobayashi, S., Fujii, Y., Iwase, H., and Yamashita, H. (2007) Expression of estrogen receptor beta wild-type and its variant ERbetacx/beta2 is correlated with better prognosis in breast cancer. Jpn. J. Clin. Oncol. 37, 820-828
250. Yamashita, H., Nishio, M., Kobayashi, S., Ando, Y., Sugiura, H., Zhang, Z., Hamaguchi, M., Mita, K., Fujii, Y., and Iwase, H. (2005) Phosphorylation of estrogen receptor alpha serine 167 is predictive of response to endocrine therapy and increases postrelapse survival in metastatic breast cancer. Breast Cancer Res. 7, R753-R764
251. Miller, W. R., Anderson, T. J., Dixon, J. M., and Saunders, P. T. (2006) Oestrogen receptor beta and neoadjuvant therapy with tamoxifen: prediction of response and effects of treatment. Br. J. Cancer 94, 1333-1338
252. Honma, N., Saji, S., Kurabayashi, R., Aida, J., Arai, T., Horii, R., Akiyama, F., Iwase, T., Harada, N., Younes, M., Toi, M., Takubo, K., and Sakamoto, G. (2008) Oestrogen receptor-beta1 but not oestrogen receptor-betacx is of prognostic value in apocrine carcinoma of the breast. APMIS 116, 923-930
253. Shaaban, A. M., Green, A. R., Karthik, S., Alizadeh, Y., Hughes, T. A., Harkins, L., Ellis, I. O., Robertson, J. F., Paish, E. C., Saunders, P. T., Groome, N. P., and Speirs, V. (2008) Nuclear and cytoplasmic expression of ERbeta1, ERbeta2, and ERbeta5 identifies distinct prognostic outcome for breast cancer patients. Clin. Cancer Res. 14, 5228-5235
254. Davies, M. P., O'Neill, P. A., Innes, H., Sibson, D. R., Prime, W., Holcombe, C., and Foster, C. S. (2004) Correlation of mRNA for oestrogen receptor beta splice variants
167
ERbeta1, ERbeta2/ERbetacx and ERbeta5 with outcome in endocrine-treated breast cancer. J. Mol. Endocrinol. 33, 773-782
255. Poola, I., Fuqua, S. A., De Witty, R. L., Abraham, J., Marshallack, J. J., and Liu, A. (2005) Estrogen receptor alpha-negative breast cancer tissues express significant levels of estrogen-independent transcription factors, ERbeta1 and ERbeta5: potential molecular targets for chemoprevention. Clin. Cancer Res. 11, 7579-7585
256. Park, B. W., Kim, K. S., Heo, M. K., Yang, W. I., Kim, S. I., Kim, J. H., Kim, G. E., and Lee, K. S. (2006) The changes of estrogen receptor-beta variants expression in breast carcinogenesis: Decrease of estrogen receptor-beta2 expression is the key event in breast cancer development. J. Surg. Oncol. 93, 504-510
257. Ho, S. M., Lee, M. T., Lam, H. M., and Leung, Y. K. (2011) Estrogens and prostate cancer: etiology, mediators, prevention, and management. Endocrinol. Metab Clin. North Am. 40, 591-614, ix
258. Lai, J. S., Brown, L. G., True, L. D., Hawley, S. J., Etzioni, R. B., Higano, C. S., Ho, S. M., Vessella, R. L., and Corey, E. (2004) Metastases of prostate cancer express estrogen receptor-beta. Urology 64, 814-820
259. Waldmann, J., Fendrich, V., Holler, J., Buchholz, M., Heinmoller, E., Langer, P., Ramaswamy, A., Samans, B., Walz, M. K., Rothmund, M., Bartsch, D. K., and Slater, E. P. (2010) Microarray analysis reveals differential expression of benign and malignant pheochromocytoma. Endocr. Relat Cancer 17, 743-756
260. Shoda, T., Hirata, S., Kato, J., and Hoshi, K. (2002) Cloning of the novel isoform of the estrogen receptor beta cDNA (ERbeta isoform M cDNA) from the human testicular cDNA library. J. Steroid Biochem. Mol. Biol. 82, 201-208
261. Calvo, S. E., Pagliarini, D. J., and Mootha, V. K. (2009) Upstream open reading frames cause widespread reduction of protein expression and are polymorphic among humans. Proc. Natl. Acad. Sci. U. S. A 106, 7507-7512
262. Zhang, X., Wu, M., Xiao, H., Lee, M. T., Levin, L., Leung, Y. K., and Ho, S. M. (2010) Methylation of a single intronic CpG mediates expression silencing of the PMP24 gene in prostate cancer. Prostate 70, 765-776
263. Zuker, M. (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406-3415
264. Smith, L., Coleman, L. J., Cummings, M., Satheesha, S., Shaw, S. O., Speirs, V., and Hughes, T. A. (2010) Expression of oestrogen receptor beta isoforms is regulated by transcriptional and post-transcriptional mechanisms. Biochem. J. 429, 283-290
265. Meijer, H. A. and Thomas, A. A. (2002) Control of eukaryotic protein synthesis by upstream open reading frames in the 5'-untranslated region of an mRNA. Biochem. J. 367, 1-11
168
266. Kozak, M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-292
267. Kozak, M. (1987) An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15, 8125-8148
268. Foley, E. F., Jazaeri, A. A., Shupnik, M. A., Jazaeri, O., and Rice, L. W. (2000) Selective loss of estrogen receptor beta in malignant human colon. Cancer Res. 60, 245-248
269. Greenbaum, D., Colangelo, C., Williams, K., and Gerstein, M. (2003) Comparing protein abundance and mRNA expression levels on a genomic scale. Genome Biol. 4, 117
270. Vogel, C. and Marcotte, E. M. (2012) Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat. Rev. Genet. 13, 227-232
271. Gilbert, W. V. (2010) Alternative ways to think about cellular internal ribosome entry. J. Biol. Chem. 285, 29033-29038
272. Farazi, T. A., Spitzer, J. I., Morozov, P., and Tuschl, T. (2011) miRNAs in human cancer. J. Pathol. 223, 102-115
273. Lee, E. K. and Gorospe, M. (2011) Coding region: the neglected post-transcriptional code. RNA. Biol. 8, 44-48
274. Klinge, C. M. (2001) Estrogen receptor interaction with estrogen response elements. Nucleic Acids Res. 29, 2905-2919
275. Heldring, N., Pike, A., Andersson, S., Matthews, J., Cheng, G., Hartman, J., Tujague, M., Strom, A., Treuter, E., Warner, M., and Gustafsson, J. A. (2007) Estrogen receptors: how do they signal and what are their targets. Physiol Rev. 87, 905-931
276. Jeyakumar, M., Carlson, K. E., Gunther, J. R., and Katzenellenbogen, J. A. (2011) Exploration of dimensions of estrogen potency: parsing ligand binding and coactivator binding affinities. J. Biol. Chem. 286, 12971-12982
277. Wu, R. C., Smith, C. L., and O'Malley, B. W. (2005) Transcriptional regulation by steroid receptor coactivator phosphorylation. Endocr. Rev. 26, 393-399
278. Fu, M., Wang, C., Zhang, X., and Pestell, R. G. (2004) Acetylation of nuclear receptors in cellular growth and apoptosis. Biochem. Pharmacol. 68, 1199-1208
279. Ma, Y., Fan, S., Hu, C., Meng, Q., Fuqua, S. A., Pestell, R. G., Tomita, Y. A., and Rosen, E. M. (2010) BRCA1 regulates acetylation and ubiquitination of estrogen receptor-alpha. Mol. Endocrinol. 24, 76-90
280. Utley, R. T. and Cote, J. (2003) The MYST family of histone acetyltransferases. Curr. Top. Microbiol. Immunol. 274, 203-236
169
281. Baek, S. H., Ohgi, K. A., Rose, D. W., Koo, E. H., Glass, C. K., and Rosenfeld, M. G. (2002) Exchange of N-CoR corepressor and Tip60 coactivator complexes links gene expression by NF-kappaB and beta-amyloid precursor protein. Cell 110, 55-67
282. Brady, M. E., Ozanne, D. M., Gaughan, L., Waite, I., Cook, S., Neal, D. E., and Robson, C. N. (1999) Tip60 is a nuclear hormone receptor coactivator. J. Biol. Chem. 274, 17599- 17604
283. Gaughan, L., Logan, I. R., Cook, S., Neal, D. E., and Robson, C. N. (2002) Tip60 and histone deacetylase 1 regulate androgen receptor activity through changes to the acetylation status of the receptor. J. Biol. Chem. 277, 25904-25913
284. Legube, G., Linares, L. K., Tyteca, S., Caron, C., Scheffner, M., Chevillard-Briet, M., and Trouche, D. (2004) Role of the histone acetyl transferase Tip60 in the p53 pathway. J. Biol. Chem. 279, 44825-44833
285. Patel, J. H., Du, Y., Ard, P. G., Phillips, C., Carella, B., Chen, C. J., Rakowski, C., Chatterjee, C., Lieberman, P. M., Lane, W. S., Blobel, G. A., and McMahon, S. B. (2004) The c-MYC oncoprotein is a substrate of the acetyltransferases hGCN5/PCAF and TIP60. Mol. Cell Biol. 24, 10826-10834
286. Gavaravarapu, S. and Kamine, J. (2000) Tip60 inhibits activation of CREB protein by protein kinase A. Biochem. Biophys. Res. Commun. 269, 758-766
287. Xiao, H., Chung, J., Kao, H. Y., and Yang, Y. C. (2003) Tip60 is a co-repressor for STAT3. J. Biol. Chem. 278, 11197-11204
288. Gaughan, L., Brady, M. E., Cook, S., Neal, D. E., and Robson, C. N. (2001) Tip60 is a co-activator specific for class I nuclear hormone receptors. J. Biol. Chem. 276, 46841- 46848
289. Leung, Y. K., Gao, Y., Lau, K. M., Zhang, X., and Ho, S. M. (2006) ICI 182,780- regulated gene expression in DU145 prostate cancer cells is mediated by estrogen receptor-beta/NFkappaB crosstalk. Neoplasia. 8, 242-249
290. Shiota, M., Yokomizo, A., Masubuchi, D., Tada, Y., Inokuchi, J., Eto, M., Uchiumi, T., Fujimoto, N., and Naito, S. (2010) Tip60 promotes prostate cancer cell proliferation by translocation of androgen receptor into the nucleus. Prostate 70, 540-554
291. Fujimoto, N. and Kitamura, S. (2004) Effects of environmental estrogenic chemicals on AP1 mediated transcription with estrogen receptors alpha and beta. J. Steroid Biochem. Mol. Biol. 88, 53-59
292. Sun, Y., Jiang, X., Chen, S., Fernandes, N., and Price, B. D. (2005) A role for the Tip60 histone acetyltransferase in the acetylation and activation of ATM. Proc. Natl. Acad. Sci. U. S. A 102, 13182-13187
170
293. Sun, Y., Jiang, X., Chen, S., and Price, B. D. (2006) Inhibition of histone acetyltransferase activity by anacardic acid sensitizes tumor cells to ionizing radiation. FEBS Lett. 580, 4353-4356
294. Lonard, D. M. and O'Malley, B. W. (2005) Expanding functional diversity of the coactivators. Trends Biochem. Sci. 30, 126-132
295. Puigserver, P., Adelmant, G., Wu, Z., Fan, M., Xu, J., O'Malley, B., and Spiegelman, B. M. (1999) Activation of PPARgamma coactivator-1 through transcription factor docking. Science 286, 1368-1371
296. Xu, J., Wu, R. C., and O'Malley, B. W. (2009) Normal and cancer-related functions of the p160 steroid receptor co-activator (SRC) family. Nat. Rev. Cancer 9, 615-630
297. Webb, P., Nguyen, P., Shinsako, J., Anderson, C., Feng, W., Nguyen, M. P., Chen, D., Huang, S. M., Subramanian, S., McKinerney, E., Katzenellenbogen, B. S., Stallcup, M. R., and Kushner, P. J. (1998) Estrogen receptor activation function 1 works by binding p160 coactivator proteins. Mol. Endocrinol. 12, 1605-1618
298. Holmes, K. A., Song, J. S., Liu, X. S., Brown, M., and Carroll, J. S. (2008) Nkx3-1 and LEF-1 function as transcriptional inhibitors of estrogen receptor activity. Cancer Res. 68, 7380-7385
299. Chang, E. C., Charn, T. H., Park, S. H., Helferich, W. G., Komm, B., Katzenellenbogen, J. A., and Katzenellenbogen, B. S. (2008) Estrogen Receptors alpha and beta as determinants of gene expression: influence of ligand, dose, and chromatin binding. Mol. Endocrinol. 22, 1032-1043
300. Liu, Y., Gao, H., Marstrand, T. T., Strom, A., Valen, E., Sandelin, A., Gustafsson, J. A., and Dahlman-Wright, K. (2008) The genome landscape of ERalpha- and ERbeta-binding DNA regions. Proc. Natl. Acad. Sci. U. S. A 105, 2604-2609
301. Matthews, J., Wihlen, B., Tujague, M., Wan, J., Strom, A., and Gustafsson, J. A. (2006) Estrogen receptor (ER) beta modulates ERalpha-mediated transcriptional activation by altering the recruitment of c-Fos and c-Jun to estrogen-responsive promoters. Mol. Endocrinol. 20, 534-543
302. Zhao, C., Dahlman-Wright, K., and Gustafsson, J. A. (2008) Estrogen receptor beta: an overview and update. Nucl. Recept. Signal. 6, e003
303. Jackson, T. A., Richer, J. K., Bain, D. L., Takimoto, G. S., Tung, L., and Horwitz, K. B. (1997) The partial agonist activity of antagonist-occupied steroid receptors is controlled by a novel hinge domain-binding coactivator L7/SPA and the corepressors N-CoR or SMRT. Mol. Endocrinol. 11, 693-705
304. Tcherepanova, I., Puigserver, P., Norris, J. D., Spiegelman, B. M., and McDonnell, D. P. (2000) Modulation of estrogen receptor-alpha transcriptional activity by the coactivator PGC-1. J. Biol. Chem. 275, 16302-16308
171
305. Sanchez, M., Sauve, K., Picard, N., and Tremblay, A. (2007) The hormonal response of estrogen receptor beta is decreased by the phosphatidylinositol 3-kinase/Akt pathway via a phosphorylation-dependent release of CREB-binding protein. J. Biol. Chem. 282, 4830- 4840
306. Sanchez, M., Picard, N., Sauve, K., and Tremblay, A. (2013) Coordinate regulation of estrogen receptor beta degradation by Mdm2 and CREB-binding protein in response to growth signals. Oncogene 32, 117-126
307. Burns, K. A., Li, Y., Arao, Y., Petrovich, R. M., and Korach, K. S. (2011) Selective mutations in estrogen receptor alpha D-domain alters nuclear translocation and non- estrogen response element gene regulatory mechanisms. J. Biol. Chem. 286, 12640- 12649
308. Sapountzi, V., Logan, I. R., and Robson, C. N. (2006) Cellular functions of TIP60. Int. J. Biochem. Cell Biol. 38, 1496-1509
309. Cvoro, A., Tzagarakis-Foster, C., Tatomer, D., Paruthiyil, S., Fox, M. S., and Leitman, D. C. (2006) Distinct roles of unliganded and liganded estrogen receptors in transcriptional repression. Mol. Cell 21, 555-564
310. Rogatsky, I., Luecke, H. F., Leitman, D. C., and Yamamoto, K. R. (2002) Alternate surfaces of transcriptional coregulator GRIP1 function in different glucocorticoid receptor activation and repression contexts. Proc. Natl. Acad. Sci. U. S. A 99, 16701- 16706
311. Harris, D. M., Besselink, E., Henning, S. M., Go, V. L., and Heber, D. (2005) Phytoestrogens induce differential estrogen receptor alpha- or Beta-mediated responses in transfected breast cancer cells. Exp. Biol. Med. (Maywood. ) 230, 558-568
312. Nikov, G. N., Hopkins, N. E., Boue, S., and Alworth, W. L. (2000) Interactions of dietary estrogens with human estrogen receptors and the effect on estrogen receptor-estrogen response element complex formation. Environ. Health Perspect. 108, 867-872
313. Paige, L. A., Christensen, D. J., Gron, H., Norris, J. D., Gottlin, E. B., Padilla, K. M., Chang, C. Y., Ballas, L. M., Hamilton, P. T., McDonnell, D. P., and Fowlkes, D. M. (1999) Estrogen receptor (ER) modulators each induce distinct conformational changes in ER alpha and ER beta. Proc. Natl. Acad. Sci. U. S. A 96, 3999-4004
314. Mueller, S. O., Simon, S., Chae, K., Metzler, M., and Korach, K. S. (2004) Phytoestrogens and their human metabolites show distinct agonistic and antagonistic properties on estrogen receptor alpha (ERalpha) and ERbeta in human cells. Toxicol. Sci. 80, 14-25
315. Bjornstrom, L. and Sjoberg, M. (2004) Estrogen receptor-dependent activation of AP-1 via non-genomic signalling. Nucl. Recept. 2, 3
172
316. Pike, A. C., Brzozowski, A. M., Hubbard, R. E., Bonn, T., Thorsell, A. G., Engstrom, O., Ljunggren, J., Gustafsson, J. A., and Carlquist, M. (1999) Structure of the ligand-binding domain of oestrogen receptor beta in the presence of a partial agonist and a full antagonist. EMBO J. 18, 4608-4618
317. Pike, A. C., Brzozowski, A. M., Walton, J., Hubbard, R. E., Thorsell, A. G., Li, Y. L., Gustafsson, J. A., and Carlquist, M. (2001) Structural insights into the mode of action of a pure antiestrogen. Structure. 9, 145-153
318. Wang, Y., Chirgadze, N. Y., Briggs, S. L., Khan, S., Jensen, E. V., and Burris, T. P. (2006) A second binding site for hydroxytamoxifen within the coactivator-binding groove of estrogen receptor beta. Proc. Natl. Acad. Sci. U. S. A 103, 9908-9911
319. Wang, J. and Chen, J. (2010) SIRT1 regulates autoacetylation and histone acetyltransferase activity of TIP60. J. Biol. Chem. 285, 11458-11464
320. Yang, C., Wu, J., and Zheng, Y. G. (2012) Function of the active site lysine autoacetylation in Tip60 catalysis. PLoS. One. 7, e32886
321. Lerin, C., Rodgers, J. T., Kalume, D. E., Kim, S. H., Pandey, A., and Puigserver, P. (2006) GCN5 acetyltransferase complex controls glucose metabolism through transcriptional repression of PGC-1alpha. Cell Metab 3, 429-438
322. Kamei, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., Lin, S. C., Heyman, R. A., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (1996) A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85, 403-414
323. Lee, S. K., Kim, H. J., Na, S. Y., Kim, T. S., Choi, H. S., Im, S. Y., and Lee, J. W. (1998) Steroid receptor coactivator-1 coactivates activating protein-1-mediated transactivations through interaction with the c-Jun and c-Fos subunits. J. Biol. Chem. 273, 16651-16654
324. Shao, W. and Brown, M. (2004) Advances in estrogen receptor biology: prospects for improvements in targeted breast cancer therapy. Breast Cancer Res. 6, 39-52
325. Schiff, R. and Osborne, C. K. (2005) Endocrinology and hormone therapy in breast cancer: new insight into estrogen receptor-alpha function and its implication for endocrine therapy resistance in breast cancer. Breast Cancer Res. 7, 205-211
326. Dorssers, L. C., Van der Flier, S., Brinkman, A., van, A. T., Veldscholte, J., Berns, E. M., Klijn, J. G., Beex, L. V., and Foekens, J. A. (2001) Tamoxifen resistance in breast cancer: elucidating mechanisms. Drugs 61, 1721-1733
327. Droog, M., Beelen, K., Linn, S., and Zwart, W. (2013) Tamoxifen resistance: From bench to bedside. Eur. J. Pharmacol.
328. Hernandez-Aya, L. F. and Gonzalez-Angulo, A. M. (2013) Adjuvant systemic therapies in breast cancer. Surg. Clin. North Am. 93, 473-491
173
329. Iwamoto, T. (2013) Clinical application of drug delivery systems in cancer chemotherapy: review of the efficacy and side effects of approved drugs. Biol. Pharm. Bull. 36, 715-718
330. Welboren, W. J., Sweep, F. C., Span, P. N., and Stunnenberg, H. G. (2009) Genomic actions of estrogen receptor alpha: what are the targets and how are they regulated? Endocr. Relat Cancer 16, 1073-1089
331. Beelen, K., Zwart, W., and Linn, S. C. (2012) Can predictive biomarkers in breast cancer guide adjuvant endocrine therapy? Nat. Rev. Clin. Oncol. 9, 529-541
332. Mendoza, R. A., Moody, E. E., Enriquez, M. I., Mejia, S. M., and Thordarson, G. (2011) Tumorigenicity of MCF-7 human breast cancer cells lacking the p38alpha mitogen- activated protein kinase. J. Endocrinol. 208, 11-19
333. Mendoza, R. A., Enriquez, M. I., Mejia, S. M., Moody, E. E., and Thordarson, G. (2011) Interactions between IGF-I, estrogen receptor-alpha (ERalpha), and ERbeta in regulating growth/apoptosis of MCF-7 human breast cancer cells. J. Endocrinol. 208, 1-9
334. Zampieri, L., Bianchi, P., Ruff, P., and Arbuthnot, P. (2002) Differential modulation by estradiol of P-glycoprotein drug resistance protein expression in cultured MCF7 and T47D breast cancer cells. Anticancer Res. 22, 2253-2259
335. Thomas, C. G., Strom, A., Lindberg, K., and Gustafsson, J. A. (2011) Estrogen receptor beta decreases survival of p53-defective cancer cells after DNA damage by impairing G(2)/M checkpoint signaling. Breast Cancer Res. Treat. 127, 417-427
336. LaPensee, E. W., Tuttle, T. R., Fox, S. R., and Ben-Jonathan, N. (2009) Bisphenol A at low nanomolar doses confers chemoresistance in estrogen receptor-alpha-positive and - negative breast cancer cells. Environ. Health Perspect. 117, 175-180
337. Teixeira, C., Reed, J. C., and Pratt, M. A. (1995) Estrogen promotes chemotherapeutic drug resistance by a mechanism involving Bcl-2 proto-oncogene expression in human breast cancer cells. Cancer Res. 55, 3902-3907
338. Huang, Y., Ray, S., Reed, J. C., Ibrado, A. M., Tang, C., Nawabi, A., and Bhalla, K. (1997) Estrogen increases intracellular p26Bcl-2 to p21Bax ratios and inhibits taxol- induced apoptosis of human breast cancer MCF-7 cells. Breast Cancer Res. Treat. 42, 73-81
339. Hall, J. M. and McDonnell, D. P. (1999) The estrogen receptor beta-isoform (ERbeta) of the human estrogen receptor modulates ERalpha transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 140, 5566-5578
340. Peng, B., Lu, B., Leygue, E., and Murphy, L. C. (2003) Putative functional characteristics of human estrogen receptor-beta isoforms. J. Mol. Endocrinol. 30, 13-29
174
341. Stegh, A. H., Chin, L., Louis, D. N., and DePinho, R. A. (2008) What drives intense apoptosis resistance and propensity for necrosis in glioblastoma? A role for Bcl2L12 as a multifunctional cell death regulator. Cell Cycle 7, 2833-2839
342. Kouri, F. M., Jensen, S. A., and Stegh, A. H. (2012) The role of Bcl-2 family proteins in therapy responses of malignant astrocytic gliomas: Bcl2L12 and beyond. ScientificWorldJournal. 2012, 838916
343. Stegh, A. H., Kim, H., Bachoo, R. M., Forloney, K. L., Zhang, J., Schulze, H., Park, K., Hannon, G. J., Yuan, J., Louis, D. N., DePinho, R. A., and Chin, L. (2007) Bcl2L12 inhibits post-mitochondrial apoptosis signaling in glioblastoma. Genes Dev. 21, 98-111
344. Lacroix, M. and Leclercq, G. (2004) Relevance of breast cancer cell lines as models for breast tumours: an update. Breast Cancer Res. Treat. 83, 249-289
345. Berglind, H., Pawitan, Y., Kato, S., Ishioka, C., and Soussi, T. (2008) Analysis of p53 mutation status in human cancer cell lines: a paradigm for cell line cross-contamination. Cancer Biol. Ther. 7, 699-708
346. Leung, Y. K., Lee, M. T., Lam, H. M., Tarapore, P., and Ho, S. M. (2012) Estrogen receptor-beta and breast cancer: translating biology into clinical practice. Steroids 77, 727-737
347. LaPensee, E. W. and Ben-Jonathan, N. (2010) Novel roles of prolactin and estrogens in breast cancer: resistance to chemotherapy. Endocr. Relat Cancer 17, R91-107
348. Gianni, L., Salvatorelli, E., and Minotti, G. (2007) Anthracycline cardiotoxicity in breast cancer patients: synergism with trastuzumab and taxanes. Cardiovasc. Toxicol. 7, 67-71
349. Rabbani, A., Finn, R. M., and Ausio, J. (2005) The anthracycline antibiotics: antitumor drugs that alter chromatin structure. Bioessays 27, 50-56
350. Fulda, S. and Debatin, K. M. (2006) Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene 25, 4798-4811
351. Leong, C. O., Vidnovic, N., DeYoung, M. P., Sgroi, D., and Ellisen, L. W. (2007) The p63/p73 network mediates chemosensitivity to cisplatin in a biologically defined subset of primary breast cancers. J. Clin. Invest 117, 1370-1380
352. Silver, D. P., Richardson, A. L., Eklund, A. C., Wang, Z. C., Szallasi, Z., Li, Q., Juul, N., Leong, C. O., Calogrias, D., Buraimoh, A., Fatima, A., Gelman, R. S., Ryan, P. D., Tung, N. M., De, N. A., Ganesan, S., Miron, A., Colin, C., Sgroi, D. C., Ellisen, L. W., Winer, E. P., and Garber, J. E. (2010) Efficacy of neoadjuvant Cisplatin in triple-negative breast cancer. J. Clin. Oncol. 28, 1145-1153
353. Berrada, N., Delaloge, S., and Andre, F. (2010) Treatment of triple-negative metastatic breast cancer: toward individualized targeted treatments or chemosensitization? Ann. Oncol. 21 Suppl 7, vii30-vii35
175
354. Thomadaki, H. and Scorilas, A. (2006) BCL2 family of apoptosis-related genes: functions and clinical implications in cancer. Crit Rev. Clin. Lab Sci. 43, 1-67
355. Keen, J. C. and Davidson, N. E. (2003) The biology of breast carcinoma. Cancer 97, 825- 833
356. Yde, C. W. and Issinger, O. G. (2006) Enhancing cisplatin sensitivity in MCF-7 human breast cancer cells by down-regulation of Bcl-2 and cyclin D1. Int. J. Oncol. 29, 1397- 1404
357. Lukyanova, N. Y., Rusetskya, N. V., Tregubova, N. A., and Chekhun, V. F. (2009) Molecular profile and cell cycle in MCF-7 cells resistant to cisplatin and doxorubicin. Exp. Oncol. 31, 87-91
358. Shang, Y. and Brown, M. (2002) Molecular determinants for the tissue specificity of SERMs. Science 295, 2465-2468
359. Osborne, C. K., Bardou, V., Hopp, T. A., Chamness, G. C., Hilsenbeck, S. G., Fuqua, S. A., Wong, J., Allred, D. C., Clark, G. M., and Schiff, R. (2003) Role of the estrogen receptor coactivator AIB1 (SRC-3) and HER-2/neu in tamoxifen resistance in breast cancer. J. Natl. Cancer Inst. 95, 353-361
360. Stegh, A. H. and DePinho, R. A. (2011) Beyond effector caspase inhibition: Bcl2L12 neutralizes p53 signaling in glioblastoma. Cell Cycle 10, 33-38
361. Chou, C. H., Chou, A. K., Lin, C. C., Chen, W. J., Wei, C. C., Yang, M. C., Hsu, C. M., Lung, F. W., Loh, J. K., Howng, S. L., and Hong, Y. R. (2012) GSK3beta regulates Bcl2L12 and Bcl2L12A anti-apoptosis signaling in glioblastoma and is inhibited by LiCl. Cell Cycle 11, 532-542
362. Hong, Y., Yang, J., Wu, W., Wang, W., Kong, X., Wang, Y., Yun, X., Zong, H., Wei, Y., Zhang, S., and Gu, J. (2008) Knockdown of BCL2L12 leads to cisplatin resistance in MDA-MB-231 breast cancer cells. Biochim. Biophys. Acta 1782, 649-657
363. Stegh, A. H., Kesari, S., Mahoney, J. E., Jenq, H. T., Forloney, K. L., Protopopov, A., Louis, D. N., Chin, L., and DePinho, R. A. (2008) Bcl2L12-mediated inhibition of effector caspase-3 and caspase-7 via distinct mechanisms in glioblastoma. Proc. Natl. Acad. Sci. U. S. A 105, 10703-10708
364. Stegh, A. H., Brennan, C., Mahoney, J. A., Forloney, K. L., Jenq, H. T., Luciano, J. P., Protopopov, A., Chin, L., and DePinho, R. A. (2010) Glioma oncoprotein Bcl2L12 inhibits the p53 tumor suppressor. Genes Dev. 24, 2194-2204
365. Fuchs, Y. and Steller, H. (2011) Programmed cell death in animal development and disease. Cell 147, 742-758
176
366. Sandelin, A., Carninci, P., Lenhard, B., Ponjavic, J., Hayashizaki, Y., and Hume, D. A. (2007) Mammalian RNA polymerase II core promoters: insights from genome-wide studies. Nat. Rev. Genet. 8, 424-436
367. Ayoubi, T. A. and Van De Ven, W. J. (1996) Regulation of gene expression by alternative promoters. FASEB J. 10, 453-460
368. Kornblihtt, A. R., Schor, I. E., Allo, M., Dujardin, G., Petrillo, E., and Munoz, M. J. (2013) Alternative splicing: a pivotal step between eukaryotic transcription and translation. Nat. Rev. Mol. Cell Biol. 14, 153-165
369. Koromilas, A. E., Lazaris-Karatzas, A., and Sonenberg, N. (1992) mRNAs containing extensive secondary structure in their 5' non-coding region translate efficiently in cells overexpressing initiation factor eIF-4E. EMBO J. 11, 4153-4158
370. Wendt, M. K., Cooper, A. N., and Dwinell, M. B. (2008) Epigenetic silencing of CXCL12 increases the metastatic potential of mammary carcinoma cells. Oncogene 27, 1461-1471
371. Mirisola, V., Zuccarino, A., Bachmeier, B. E., Sormani, M. P., Falter, J., Nerlich, A., and Pfeffer, U. (2009) CXCL12/SDF1 expression by breast cancers is an independent prognostic marker of disease-free and overall survival. Eur. J. Cancer 45, 2579-2587
372. Costa, V. L., Henrique, R., and Jeronimo, C. (2007) Epigenetic markers for molecular detection of prostate cancer. Dis. Markers 23, 31-41
373. Witt, D., Burfeind, P., von, H. S., Opitz, L., Salinas-Riester, G., Bremmer, F., Schweyer, S., Thelen, P., Neesen, J., and Kaulfuss, S. (2013) Valproic acid inhibits the proliferation of cancer cells by re-expressing cyclin D2. Carcinogenesis 34, 1115-1124
374. Kobayashi, T., Nakamura, E., Shimizu, Y., Terada, N., Maeno, A., Kobori, G., Kamba, T., Kamoto, T., Ogawa, O., and Inoue, T. (2009) Restoration of cyclin D2 has an inhibitory potential on the proliferation of LNCaP cells. Biochem. Biophys. Res. Commun. 387, 196-201
375. Padar, A., Sathyanarayana, U. G., Suzuki, M., Maruyama, R., Hsieh, J. T., Frenkel, E. P., Minna, J. D., and Gazdar, A. F. (2003) Inactivation of cyclin D2 gene in prostate cancers by aberrant promoter methylation. Clin. Cancer Res. 9, 4730-4734
177