DOCSLIB.ORG

Mouse Il1rapl1 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Il1rapl1 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Il1rapl1 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Il1rapl1 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Il1rapl1 gene (NCBI Reference Sequence: NM_001160403 ; Ensembl: ENSMUSG00000052372 ) is located on Mouse chromosome X. 11 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 11 (Transcript: ENSMUST00000113966). Exon 3 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Il1rapl1 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-458F20 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele exhibit premature giant inhibitory postsynaptic currents and parallel fiber- mediated recruitment of molecular layer interneurons. Exon 3 starts from about 3.98% of the coding region. The knockout of Exon 3 will result in frameshift of the gene. The size of intron 2 for 5'-loxP site insertion: 470851 bp, and the size of intron 3 for 3'-loxP site insertion: 114072 bp. The size of effective cKO region: ~780 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 3 11 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Il1rapl1 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. It may be difficult to construct this targeting vector. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7280bp) | A(31.91% 2323) | C(17.34% 1262) | T(32.57% 2371) | G(18.19% 1324) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN -------------------------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chrX - 87419553 87422552 3000 browser details YourSeq 348 2255 2945 3000 83.8% chr15 - 55337270 55337963 694 browser details YourSeq 331 2245 2917 3000 82.5% chrX + 23180263 23180924 662 browser details YourSeq 330 2378 2944 3000 84.9% chr11 + 59623428 59624127 700 browser details YourSeq 311 2251 2944 3000 82.4% chrX - 82965028 82965697 670 browser details YourSeq 311 2284 2945 3000 77.6% chr16 + 88118605 88119244 640 browser details YourSeq 305 2245 2933 3000 82.6% chr17 - 12088718 12089388 671 browser details YourSeq 303 2248 2936 3000 78.1% chrX - 17529702 17530383 682 browser details YourSeq 301 2371 2922 3000 78.8% chrX - 38851231 38851773 543 browser details YourSeq 298 2259 2944 3000 81.3% chr8 + 33276291 33276954 664 browser details YourSeq 297 2248 2942 3000 75.2% chrX - 95407647 95408326 680 browser details YourSeq 295 2245 2955 3000 85.0% chr16 - 21502618 21503578 961 browser details YourSeq 294 2422 2944 3000 82.2% chr6 - 122288760 122289279 520 browser details YourSeq 294 2349 2945 3000 82.9% chr12 - 81535429 81535991 563 browser details YourSeq 292 2286 2851 3000 81.2% chr18 - 81006897 81007459 563 browser details YourSeq 289 2246 2944 3000 79.8% chr4 - 80831109 80831801 693 browser details YourSeq 289 2349 2945 3000 79.6% chr17 + 72248396 72248976 581 browser details YourSeq 285 2349 2932 3000 83.3% chr9 - 52509422 52510000 579 browser details YourSeq 285 2190 2942 3000 83.8% chrX + 92313191 92314258 1068 browser details YourSeq 281 2386 2944 3000 80.7% chr14 - 104159140 104159683 544 Note: The 3000 bp section upstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chrX - 87415773 87418772 3000 browser details YourSeq 914 1466 2991 3000 89.9% chr2 - 11886626 12571595 684970 browser details YourSeq 900 756 2400 3000 87.0% chr1 - 6129960 6598033 468074 browser details YourSeq 583 517 1546 3000 86.9% chr15 - 89600850 89601858 1009 browser details YourSeq 576 517 1603 3000 85.8% chr19 + 11433477 11434785 1309 browser details YourSeq 567 585 1578 3000 87.2% chr16 - 38022040 38023031 992 browser details YourSeq 557 1357 2400 3000 88.4% chr11 + 16212004 16725575 513572 browser details YourSeq 554 551 1531 3000 86.1% chr18 + 32874211 32875192 982 browser details YourSeq 547 1779 2649 3000 86.2% chr8 + 5585319 5586366 1048 browser details YourSeq 544 550 1429 3000 86.4% chr1 - 166220900 166221778 879 browser details YourSeq 528 517 1578 3000 86.1% chr5 + 20594472 20595564 1093 browser details YourSeq 512 517 1496 3000 86.6% chr1 - 16143708 16144714 1007 browser details YourSeq 509 517 1547 3000 87.6% chr8 + 98228163 98229211 1049 browser details YourSeq 506 556 1578 3000 85.9% chr17 - 82358818 82359840 1023 browser details YourSeq 474 1777 2410 3000 88.5% chr8 + 22153308 22153939 632 browser details YourSeq 472 1777 2400 3000 88.1% chrX - 139139267 139139888 622 browser details YourSeq 472 1777 2410 3000 89.3% chrX - 129266386 129267021 636 browser details YourSeq 470 1777 2400 3000 88.5% chr3 - 41147713 41148333 621 browser details YourSeq 469 1777 2400 3000 88.6% chr18 - 63562591 63563213 623 browser details YourSeq 469 1779 2410 3000 88.2% chr18 - 45055957 45259142 203186 Note: The 3000 bp section downstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Il1rapl1 interleukin 1 receptor accessory protein-like 1 [ Mus musculus (house mouse) ] Gene ID: 331461, updated on 12-Aug-2019 Gene summary Official Symbol Il1rapl1 provided by MGI Official Full Name interleukin 1 receptor accessory protein-like 1 provided by MGI Primary source MGI:MGI:2687319 See related Ensembl:ENSMUSG00000052372 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as IL1R8; MRX34; OPHN4; IL1RAPL; TIGIRR-2; IL1RAPL-1; C030039N24; 6330532G10Rik Expression Biased expression in frontal lobe adult (RPKM 1.3), cortex adult (RPKM 1.1) and 5 other tissues See more Orthologs human all Genomic context Location: X; X C1 See Il1rapl1 in Genome Data Viewer Exon count: 11 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) X NC_000086.7 (86740937..88115948, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) X NC_000086.6 (83992581..85360962, complement) Chromosome X - NC_000086.7 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 3 transcripts Gene: Il1rapl1 ENSMUSG00000052372 Description interleukin 1 receptor accessory protein-like 1 [Source:MGI Symbol;Acc:MGI:2687319] Gene Synonyms 6330532G10Rik, IL1R8, IL1RAPL, MRX34, OPHN4, TIGIRR-2 Location Chromosome X: 86,740,870-88,115,645 reverse strand. GRCm38:CM001013.2 About this gene This gene has 3 transcripts (splice variants), 139 orthologues, 10 paralogues, is a member of 1 Ensembl protein family and is associated with 3 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Il1rapl1-203 ENSMUST00000113966.7 9133 696aa ENSMUSP00000109599.1 Protein coding CCDS53128 B1ASU0 TSL:5 GENCODE basic APPRIS P1 Il1rapl1-201 ENSMUST00000078875.7 2091 696aa ENSMUSP00000077915.1 Protein coding CCDS53128 B1ASU0 TSL:5 GENCODE basic APPRIS P1 Il1rapl1-202 ENSMUST00000113964.1 1936 383aa ENSMUSP00000109597.1 Protein coding - Q0VDP7 TSL:1 GENCODE basic 1.39 Mb Forward strand 87.0Mb 87.5Mb 88.0Mb Genes Gm14775-201 >processed pseudogene (Comprehensive set... Contigs AL627409.9 > AL844869.5 > Genes (Comprehensive set... < Il1rapl1-203protein coding < Il1rapl1-201protein coding < Gm24812-201misc RNA < Il1rapl1-202protein coding < Gm8855-201processed pseudogene < Gm14776-201processed pseudogene < Gm14774-201processed pseudogene Regulatory Build 87.0Mb 87.5Mb 88.0Mb Reverse strand 1.39 Mb Regulation Legend CTCF Open Chromatin Promoter Promoter Flank Gene Legend Protein Coding Ensembl protein coding Non-Protein Coding pseudogene RNA gene Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000113966 < Il1rapl1-203protein coding Reverse strand 1.37 Mb ENSMUSP00000109... Transmembrane heli... MobiDB lite Low complexity (Seg) Cleavage site (Sign... Superfamily Immunoglobulin-like domain superfamily Toll/interleukin-1 receptor homology (TIR) domain superfamily SMART Immunoglobulin subtype Toll/interleukin-1 receptor homology (TIR) domain Immunoglobulin subtype 2 Prints PR01537 Pfam IL-18Ra-like, immunoglobulin domain Toll/interleukin-1 receptor homology (TIR) domain Immunoglobulin PROSITE profiles Immunoglobulin-like domain Toll/interleukin-1 receptor homology (TIR) domain PANTHER PTHR11890:SF22 Interleukin-1 receptor family Gene3D Immunoglobulin-like fold Toll/interleukin-1 receptor homology (TIR) domain superfamily CDD cd05896 cd00096 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend synonymous variant Scale bar 0 60 120 180 240 300 360 420 480 540 600 696 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 7 of 7.
Load more

Recommended publications
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]
  • The X-Linked Intellectual Disability Protein IL1RAPL1 Regulates Dendrite Complexity
    6606 • The Journal of Neuroscience, July 12, 2017 • 37(28):6606–6627 Cellular/Molecular The X-Linked Intellectual Disability Protein IL1RAPL1 Regulates Dendrite Complexity X Caterina Montani,1,2 XMariana Ramos-Brossier,3 Luisa Ponzoni,2,4 XLaura Gritti,1,2 XAndrzej W. Cwetsch,5 X Daniela Braida,2 Yoann Saillour,3 Benedetta Terragni,6 XMassimo Mantegazza,7,8 XMariaelvina Sala,1,2 X Chiara Verpelli,1,2 XPierre Billuart,3 and XCarlo Sala1,2 1National Research Council Neuroscience Institute, 20129 Milan, Italy, 2Department of Medical Biotechnology and Translational Medicine, Universita` degli Studi di Milano, 20129 Milan, Italy, 3Institut Cochin, Institut national de la sante´ et de la recherche me´dicale U1016, Centre National de la Recherche Scientifique UMR8104, Universite´ Paris Descartes, Paris 75014, France, 4Fondazione Umberto Veronesi, 20122 Milan, Italy, 5Department of Neuroscience and Brain Technologies, Istituto Italiano di Tecnologia, 16163 Genoa, Italy, 6Operating Unit of Neurophysiopathology and Diagnostic Epileptology, Foundation Istituto di Ricerca e Cura a Carattere Scientifico Neurological Institute Carlo Besta, 20133 Milan, Italy, 7Institute of Molecular and Cellular Pharmacology, Laboratory of Excellence in Ion Channel Science and Therapeutics, Centre National de la Recherche Scientifique UMR7275, 06560 Valbonne, France, and 8Université Côte d’Azur, 06560 Valbonne, France Mutationsanddeletionsoftheinterleukin-1receptoraccessoryproteinlike1(IL1RAPL1)gene,locatedontheXchromosome,areassociatedwith intellectual disability (ID)
    [Show full text]
  • Insertion of the IL1RAPL1 Gene Into the Duplication Junction of the Dystrophin Gene
    Journal of Human Genetics (2009) 54, 466–473 & 2009 The Japan Society of Human Genetics All rights reserved 1434-5161/09 $32.00 www.nature.com/jhg ORIGINAL ARTICLE Insertion of the IL1RAPL1 gene into the duplication junction of the dystrophin gene Zhujun Zhang, Mariko Yagi, Yo Okizuka, Hiroyuki Awano, Yasuhiro Takeshima and Masafumi Matsuo Duplications of one or more exons of the dystrophin gene are the second most common mutation in dystrophinopathies. Even though duplications are suggested to occur with greater complexity than thought earlier, they have been considered an intragenic event. Here, we report the insertion of a part of the IL1RAPL1 (interleukin-1 receptor accessory protein-like 1) gene into the duplication junction site. When the actual exon junction was examined in 15 duplication mutations in the dystrophin gene by analyzing dystrophin mRNA, one patient was found to have an unknown 621 bp insertion at the junction of duplication of exons from 56 to 62. Unexpectedly, the inserted sequence was found completely identical to sequences of exons 3–5 of the IL1RAPL1 gene that is nearly 100 kb distal from the dystrophin gene. Accordingly, the insertion of IL1RAPL1 exons 3–5 between dystrophin exons 62 and 56 was confirmed at the genomic sequence level. One junction between the IL1RAPL1 intron 5 and dystrophin intron 55 was localized within an Alu sequence. These results showed that a fragment of the IL1RAPL1 gene was inserted into the duplication junction of the dystrophin gene in the same direction as the dystrophin gene. This suggests the novel possibility of co-occurrence of complex genomic rearrangements in dystrophinopathy.
    [Show full text]
  • Interleukin-1 Receptor Accessory Protein Organizes Neuronal Synaptogenesis As a Cell Adhesion Molecule
    2588 • The Journal of Neuroscience, February 22, 2012 • 32(8):2588–2600 Cellular/Molecular Interleukin-1 Receptor Accessory Protein Organizes Neuronal Synaptogenesis as a Cell Adhesion Molecule Tomoyuki Yoshida,1,3 Tomoko Shiroshima,1 Sung-Jin Lee,1 Misato Yasumura,1 Takeshi Uemura,1 Xigui Chen,1 Yoichiro Iwakura,2 and Masayoshi Mishina1 1Department of Molecular Neurobiology and Pharmacology, Graduate School of Medicine, University of Tokyo, Tokyo 113-0033, Japan, 2Center for Experimental Medicine and Systems Biology, Institute of Medical Science, University of Tokyo, Tokyo 108-8639, Japan, and 3PRESTO (Precursory Research for Embryonic Science and Technology), Japan Science and Technology Agency, Saitama 332-0012, Japan Interleukin-1 receptor accessory protein (IL-1RAcP) is the essential component of receptor complexes mediating immune responses to interleukin-1 family cytokines. IL-1RAcP in the brain exists in two isoforms, IL-1RAcP and IL-1RAcPb, differing only in the C-terminal region. Here, we found robust synaptogenic activities of IL-1RAcP in cultured cortical neurons. Knockdown of IL-1RAcP isoforms in cultured cortical neurons suppressed synapse formation as indicated by decreases of active zone protein Bassoon puncta and dendritic protrusions. IL-1RAcP recovered the accumulation of presynaptic Bassoon puncta, while IL-1RAcPb rescued both Bassoon puncta and dendritic protrusions. Consistently, the expression of IL-1RAcP in cortical neurons enhances the accumulation of Bassoon puncta and that of IL-1RAcPb stimulated both Bassoon puncta accumulation and spinogenesis. IL-1RAcP interacted with protein tyrosine phospha- tase (PTP) ␦ through the extracellular domain. Mini-exon peptides in the Ig-like domains of PTP␦ splice variants were critical for their efficient binding to IL-1RAcP.
    [Show full text]
  • IL1RAPL1 Antibody
    Efficient Professional Protein and Antibody Platforms IL1RAPL1 Antibody Basic information: Catalog No.: UMA21124 Source: Mouse Size: 50ul/100ul Clonality: Monoclonal 2H3C12 Concentration: 1mg/ml Isotype: Mouse IgG1 Purification: The antibody was purified by immunogen affinity chromatography. Useful Information: WB:1:500 - 1:2000 Applications: ELISA:1:10000 Reactivity: Human Specificity: This antibody recognizes IL1RAPL1 protein. Purified recombinant fragment of human IL1RAPL1 (AA: 541-694) expressed Immunogen: in E. Coli. The protein encoded by this gene is a member of the interleukin 1 receptor family and is similar to the interleukin 1 accessory proteins. It is most closely related to interleukin 1 receptor accessory protein-like 2 (IL1RAPL2). This gene and IL1RAPL2 are located at a region on chromosome X that is associ- Description: ated with X-linked non-syndromic mental retardation. Deletions and muta- tions in this gene were found in patients with mental retardation. This gene is expressed at a high level in post-natal brain structures involved in the hippocampal memory system, which suggests a specialized role in the physiological processes underlying memory and learning abilities. Uniprot: Q9NZN1 BiowMW: 80kDa Buffer: Purified antibody in PBS with 0.05% sodium azide Storage: Store at 4°C short term and -20°C long term. Avoid freeze-thaw cycles. Note: For research use only, not for use in diagnostic procedure. Data: Figure 1:Black line: Control Antigen (100 ng);Purple line: Antigen (10ng); Blue line: Antigen (50 ng); Red line:Antigen (100 ng) Gene Universal Technology Co. Ltd www.universalbiol.com Tel: 0550-3121009 E-mail: [email protected] Efficient Professional Protein and Antibody Platforms Figure 2:Western blot analysis using IL1RAPL1 mAb against human IL1RAPL1 (AA: 541-694) re- combinant protein.
    [Show full text]
  • Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands That Promote Axonal Growth
    Research Article: New Research Development Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands that Promote Axonal Growth Jeremy S. Toma,1 Konstantina Karamboulas,1,ª Matthew J. Carr,1,2,ª Adelaida Kolaj,1,3 Scott A. Yuzwa,1 Neemat Mahmud,1,3 Mekayla A. Storer,1 David R. Kaplan,1,2,4 and Freda D. Miller1,2,3,4 https://doi.org/10.1523/ENEURO.0066-20.2020 1Program in Neurosciences and Mental Health, Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada, 2Institute of Medical Sciences University of Toronto, Toronto, Ontario M5G 1A8, Canada, 3Department of Physiology, University of Toronto, Toronto, Ontario M5G 1A8, Canada, and 4Department of Molecular Genetics, University of Toronto, Toronto, Ontario M5G 1A8, Canada Abstract Peripheral nerves provide a supportive growth environment for developing and regenerating axons and are es- sential for maintenance and repair of many non-neural tissues. This capacity has largely been ascribed to paracrine factors secreted by nerve-resident Schwann cells. Here, we used single-cell transcriptional profiling to identify ligands made by different injured rodent nerve cell types and have combined this with cell-surface mass spectrometry to computationally model potential paracrine interactions with peripheral neurons. These analyses show that peripheral nerves make many ligands predicted to act on peripheral and CNS neurons, in- cluding known and previously uncharacterized ligands. While Schwann cells are an important ligand source within injured nerves, more than half of the predicted ligands are made by nerve-resident mesenchymal cells, including the endoneurial cells most closely associated with peripheral axons. At least three of these mesen- chymal ligands, ANGPT1, CCL11, and VEGFC, promote growth when locally applied on sympathetic axons.
    [Show full text]
  • IL1RAPL2 (NM 017416) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC304458 IL1RAPL2 (NM_017416) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: IL1RAPL2 (NM_017416) Human Untagged Clone Tag: Tag Free Symbol: IL1RAPL2 Synonyms: IL-1R9; IL1R9; IL1RAPL-2; TIGIRR-1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 IL1RAPL2 (NM_017416) Human Untagged Clone – SC304458 Fully Sequenced ORF: >NCBI ORF sequence for NM_017416, the custom clone sequence may differ by one or more nucleotides ATGAAGCCACCATTTCTTTTGGCCCTTGTGGTCTGTTCTGTAGTCAGCACAAATCTGAAGATGGTGTCAA AGAGAAATTCTGTGGATGGCTGCATTGACTGGTCAGTGGATCTCAAGACATACATGGCTTTGGCAGGTGA ACCAGTCCGAGTGAAATGTGCCCTTTTCTACAGTTATATTCGTACCAACTATAGCACGGCCCAGAGCACT GGGCTCAGGCTTATGTGGTACAAAAACAAAGGTGATTTGGAAGAGCCCATCATCTTTTCAGAGGTCAGGA TGAGCAAAGAGGAAGATTCAATATGGTTTCACTCAGCTGAGGCACAAGACAGTGGATTCTACACTTGTGT TTTAAGAAACTCAACATATTGCATGAAGGTGTCAATGTCCTTGACTGTTGCAGAGAATGAATCAGGCCTG TGCTACAACAGCAGGATCCGCTATTTAGAAAAATCTGAAGTCACTAAAAGAAAGGAGATCTCCTGTCCAG ACATGGATGACTTTAAAAAGTCCGATCAGGAGCCTGATGTTGTGTGGTATAAGGAATGCAAGCCAAAAAT GTGGAGAAGCATAATAATACAGAAAGGAAATGCTCTTCTGATCCAAGAAGTTCAAGAAGAAGATGGAGGA AATTACACATGTGAACTTAAATATGAAGGAAAACTTGTAAGACGAACAACTGAATTGAAAGTTACAGCTT
    [Show full text]
  • Understanding LAG-3 Signaling
    International Journal of Molecular Sciences Review Understanding LAG-3 Signaling Luisa Chocarro 1 , Ester Blanco 1 , Miren Zuazo 1, Hugo Arasanz 1,2 , Ana Bocanegra 1, Leticia Fernández-Rubio 1, Pilar Morente 1, Gonzalo Fernández-Hinojal 1,2, Miriam Echaide 1, Maider Garnica 1, Pablo Ramos 1, Ruth Vera 2, Grazyna Kochan 1,* and David Escors 1,* 1 Oncoimmunology Group, Navarrabiomed-Public University of Navarre, IdISNA, 31008 Pamplona, Navarra, Spain; [email protected] (L.C.); [email protected] (E.B.); [email protected] (M.Z.); [email protected] (H.A.); [email protected] (A.B.); [email protected] (L.F.-R.); [email protected] (P.M.); [email protected] (G.F.-H.); [email protected] (M.E.); [email protected] (M.G.); [email protected] (P.R.) 2 Department of Medical Oncology, Complejo Hospitalario de Navarra CHN-IdISNA, 31008 Pamplona, Navarra, Spain; [email protected] * Correspondence: [email protected] (G.K.); [email protected] (D.E.) Abstract: Lymphocyte activation gene 3 (LAG-3) is a cell surface inhibitory receptor with multiple biological activities over T cell activation and effector functions. LAG-3 plays a regulatory role in immunity and emerged some time ago as an inhibitory immune checkpoint molecule comparable to PD-1 and CTLA-4 and a potential target for enhancing anti-cancer immune responses. LAG-3 is the third inhibitory receptor to be exploited in human anti-cancer immunotherapies, and it is considered a potential next-generation cancer immunotherapy target in human therapy, right next to PD-1 and CTLA-4.
    [Show full text]
  • Autism Genes and the Leukocyte Transcriptome in Autistic Toddlers Relate to Pathogen Interactomes, Infection and the Immune System
    Neurochemistry International 126 (2019) 36–58 Contents lists available at ScienceDirect Neurochemistry International journal homepage: www.elsevier.com/locate/neuint Autism genes and the leukocyte transcriptome in autistic toddlers relate to pathogen interactomes, infection and the immune system. A role for excess T neurotrophic sAPPα and reduced antimicrobial Aβ C.J. Carter PolygenicPathways, 41C Marina, Saint Leonard's on Sea, TN38 0BU, East Sussex, UK ARTICLE INFO ABSTRACT Keywords: Prenatal and early childhood infections have been implicated in autism. Many autism susceptibility genes (206 Autism Autworks genes) are localised in the immune system and are related to immune/infection pathways. They are Infection enriched in the host/pathogen interactomes of 18 separate microbes (bacteria/viruses and fungi) and to the Immune genes regulated by bacterial toxins, mycotoxins and Toll-like receptor ligands. This enrichment was also ob- APP processing served for misregulated genes from a microarray study of leukocytes from autistic toddlers. The upregulated Beta-amyloid genes from this leukocyte study also matched the expression profiles in response to numerous infectious agents Sappalpha from the Broad Institute molecular signatures database. They also matched genes related to sudden infant death syndrome and autism comorbid conditions (autoimmune disease, systemic lupus erythematosus, diabetes, epi- lepsy and cardiomyopathy) as well as to estrogen and thyrotropin responses and to those upregulated by dif- ferent types of stressors including oxidative stress, hypoxia, endoplasmic reticulum stress, ultraviolet radiation or 2,4-dinitrofluorobenzene, a hapten used to develop allergic skin reactions in animal models. The oxidative/ integrated stress response is also upregulated in the autism brain and may contribute to myelination problems.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • IL1RAPL1 Antibody
    Efficient Professional Protein and Antibody Platforms IL1RAPL1 Antibody Basic information: Catalog No.: UMA60296 Source: Mouse Size: 50ul/100ul Clonality: Monoclonal Concentration: 1mg/ml Isotype: Mouse IgG1 Purification: Protein A affinity purified Useful Information: WB:1:500-1:2000 Applications: ICC:1:50-1:200 FC:1:100-1:200 Reactivity: Human Specificity: This antibody recognizes IL1RAPL1 protein. Immunogen: Recombinant protein May regulate secretion and presynaptic differentiation through inhibition of the activity of N-type voltage-gated calcium channel. May activate the MAP kinase JNK. The protein encoded by this gene is a member of the interleukin 1 receptor family and is similar to the interleukin 1 accessory proteins. It is most closely related to interleukin 1 receptor accessory protein-like 2 Description: (IL1RAPL2). This gene and IL1RAPL2 are located at a region on chromosome X that is associated with X-linked non-syndromic mental retardation. Dele- tions and mutations in this gene were found in patients with mental retar- dation. This gene is expressed at a high level in post-natal brain structures involved in the hippocampal memory system, which suggests a specialized role in the physiological processes underlying memory and learning abilities. Uniprot: Q9NZN1(Human) BiowMW: 80 kDa Buffer: 1*TBS (pH7.4), 1%BSA, 40%Glycerol. Preservative: 0.05% Sodium Azide. Storage: Store at 4°C short term and -20°C long term. Avoid freeze-thaw cycles. Note: For research use only, not for use in diagnostic procedure. Data: Western blot analysis of IL1RAPL1 on ?human IL1RAPL1 recombinant protein using an- ti-IL1RAPL1 antibody at 1/1,000 dilution.
    [Show full text]