Identification of Telomere Length Regulators By
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
(LRV1) Pathogenicity Factor
Antiviral screening identifies adenosine analogs PNAS PLUS targeting the endogenous dsRNA Leishmania RNA virus 1 (LRV1) pathogenicity factor F. Matthew Kuhlmanna,b, John I. Robinsona, Gregory R. Bluemlingc, Catherine Ronetd, Nicolas Faseld, and Stephen M. Beverleya,1 aDepartment of Molecular Microbiology, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; bDepartment of Medicine, Division of Infectious Diseases, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; cEmory Institute for Drug Development, Emory University, Atlanta, GA 30329; and dDepartment of Biochemistry, University of Lausanne, 1066 Lausanne, Switzerland Contributed by Stephen M. Beverley, December 19, 2016 (sent for review November 21, 2016; reviewed by Buddy Ullman and C. C. Wang) + + The endogenous double-stranded RNA (dsRNA) virus Leishmaniavirus macrophages infected in vitro with LRV1 L. guyanensis or LRV2 (LRV1) has been implicated as a pathogenicity factor for leishmaniasis Leishmania aethiopica release higher levels of cytokines, which are in rodent models and human disease, and associated with drug-treat- dependent on Toll-like receptor 3 (7, 10). Recently, methods for ment failures in Leishmania braziliensis and Leishmania guyanensis systematically eliminating LRV1 by RNA interference have been − infections. Thus, methods targeting LRV1 could have therapeutic ben- developed, enabling the generation of isogenic LRV1 lines and efit. Here we screened a panel of antivirals for parasite and LRV1 allowing the extension of the LRV1-dependent virulence paradigm inhibition, focusing on nucleoside analogs to capitalize on the highly to L. braziliensis (12). active salvage pathways of Leishmania, which are purine auxo- A key question is the relevancy of the studies carried out in trophs. -
4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4). -
Transposon Insertion Mutagenesis in Mice for Modeling Human Cancers: Critical Insights Gained and New Opportunities
International Journal of Molecular Sciences Review Transposon Insertion Mutagenesis in Mice for Modeling Human Cancers: Critical Insights Gained and New Opportunities Pauline J. Beckmann 1 and David A. Largaespada 1,2,3,4,* 1 Department of Pediatrics, University of Minnesota, Minneapolis, MN 55455, USA; [email protected] 2 Masonic Cancer Center, University of Minnesota, Minneapolis, MN 55455, USA 3 Department of Genetics, Cell Biology and Development, University of Minnesota, Minneapolis, MN 55455, USA 4 Center for Genome Engineering, University of Minnesota, Minneapolis, MN 55455, USA * Correspondence: [email protected]; Tel.: +1-612-626-4979; Fax: +1-612-624-3869 Received: 3 January 2020; Accepted: 3 February 2020; Published: 10 February 2020 Abstract: Transposon mutagenesis has been used to model many types of human cancer in mice, leading to the discovery of novel cancer genes and insights into the mechanism of tumorigenesis. For this review, we identified over twenty types of human cancer that have been modeled in the mouse using Sleeping Beauty and piggyBac transposon insertion mutagenesis. We examine several specific biological insights that have been gained and describe opportunities for continued research. Specifically, we review studies with a focus on understanding metastasis, therapy resistance, and tumor cell of origin. Additionally, we propose further uses of transposon-based models to identify rarely mutated driver genes across many cancers, understand additional mechanisms of drug resistance and metastasis, and define personalized therapies for cancer patients with obesity as a comorbidity. Keywords: animal modeling; cancer; transposon screen 1. Transposon Basics Until the mid of 1900’s, DNA was widely considered to be a highly stable, orderly macromolecule neatly organized into chromosomes. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Balance Between Senescence and Apoptosis Is Regulated by Telomere Damage–Induced Association Between P16 and Caspase-3
JBC Papers in Press. Published on May 10, 2018 as Manuscript RA118.003506 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.RA118.003506 Balance between senescence and apoptosis is regulated by telomere damage–induced association between p16 and caspase-3 Shanmugam Panneer Selvam1,2, Braden M. Roth1,2, Rose Nganga1,2, Jisun Kim1,2, Marion A. Cooley3,#, Kristi Helke4, Charles D. Smith5, and Besim Ogretmen1,2* 1Department of Biochemistry and Molecular Biology, 2Hollings Cancer Center, 3Department of Regenerative Medicine, 4Department of Comparative Medicine, Medical University of South Carolina, 86 Jonathan Lucas Street, Charleston, SC 29425; 5Department of Pharmacology, Pennsylvania State University, 500 University Drive, Hershey, PA 17033. #Current Address: Department of Oral Biology, Augusta University, Augusta, GA 30912. *Address correspondence to: [email protected] Running title: p16-caspase-3 complex and senescence Key words: apoptosis; senescence; sphingolipid; sphingosine 1-phosphate; telomere damage Downloaded from Abstract damage–induced apoptosis, indicating that an Telomerase activation protects cells from telomere association between p16 and caspase-3 damage by delaying senescence and inducing cell proteinsforces senescence induction by inhibiting immortalization, whereas telomerase inhibition caspase- 3 activation and apoptosis. These results http://www.jbc.org/ mediates rapid senescence or apoptosis. However, suggest that p16 plays a direct role in telomere the cellular mechanisms that determine telomere damage–dependent senescence by limiting damage–dependent senescence versus apoptosis apoptosis via binding to caspase-3, revealing a induction are largely unknown. Here, we direct link between telomere damage–dependent demonstrate that telomerase instability mediated senescence and apoptosis with regards to aging by guest on May 31, 2018 by silencing of sphingosine kinase 2 (SPHK2) and and cancer. -
Recombinant Human Adenosine Kinase/ADK
Recombinant Human Adenosine Kinase/ADK Catalog Number: 8024-AK DESCRIPTION Source E. coliderived Ala2His362 with a Cterminal 6His tag Accession # P55263 Nterminal Sequence Ala2 Analysis Predicted Molecular 41 kDa Mass SPECIFICATIONS SDSPAGE 4345 kDa, reducing conditions Activity Measured by its ability to phosphorylate Adenosine. The specific activity is >7 pmol/min/μg, as measured under the described conditions. Endotoxin Level <1.0 EU per 1 μg of the protein by the LAL method. Purity >95%, by SDSPAGE under reducing conditions and visualized by Colloidal Coomassie® Blue stain at 5 μg per lane. Formulation Supplied as a 0.2 μm filtered solution in Tris and NaCl. See Certificate of Analysis for details. Activity Assay Protocol Materials l Assay Buffer: (10X) 250 mM HEPES, 1.5 M NaCl, 100 mM MgCl2, 100 mM CaCl2 pH 7.0 (supplied in kit) l Recombinant Human Adenosine Kinase/ADK (Catalog # 8024AK) l Adenosine (Sigma, Catalog # A9251), 10 mM stock in deionized water l Adenosine triphosphate (ATP) (Sigma, Catalog # A7699), 10 mM stock in deionized water l Universal Kinase Activity Kit (Catalog # EA004) l 96well Clear Plate (Costar, Catalog # 92592) l Plate Reader (Model: SpectraMax Plus by Molecular Devices) or equivalent Assay 1. Prepare 1X Assay Buffer by diluting 10X Assay Buffer in deionized water. 2. Dilute 1 mM Phosphate Standard provided by the Universal Kinase Activity Kit by adding 40 µL of the 1 mM Phosphate Standard to 360 µL of 1X Assay Buffer for a 100 µM stock. 3. Prepare standard curve by performing seven onehalf serial dilutions of the 100 µM Phosphate stock in 1X Assay Buffer. -
Supplementary Table 1. in Vitro Side Effect Profiling Study for LDN/OSU-0212320. Neurotransmitter Related Steroids
Supplementary Table 1. In vitro side effect profiling study for LDN/OSU-0212320. Percent Inhibition Receptor 10 µM Neurotransmitter Related Adenosine, Non-selective 7.29% Adrenergic, Alpha 1, Non-selective 24.98% Adrenergic, Alpha 2, Non-selective 27.18% Adrenergic, Beta, Non-selective -20.94% Dopamine Transporter 8.69% Dopamine, D1 (h) 8.48% Dopamine, D2s (h) 4.06% GABA A, Agonist Site -16.15% GABA A, BDZ, alpha 1 site 12.73% GABA-B 13.60% Glutamate, AMPA Site (Ionotropic) 12.06% Glutamate, Kainate Site (Ionotropic) -1.03% Glutamate, NMDA Agonist Site (Ionotropic) 0.12% Glutamate, NMDA, Glycine (Stry-insens Site) 9.84% (Ionotropic) Glycine, Strychnine-sensitive 0.99% Histamine, H1 -5.54% Histamine, H2 16.54% Histamine, H3 4.80% Melatonin, Non-selective -5.54% Muscarinic, M1 (hr) -1.88% Muscarinic, M2 (h) 0.82% Muscarinic, Non-selective, Central 29.04% Muscarinic, Non-selective, Peripheral 0.29% Nicotinic, Neuronal (-BnTx insensitive) 7.85% Norepinephrine Transporter 2.87% Opioid, Non-selective -0.09% Opioid, Orphanin, ORL1 (h) 11.55% Serotonin Transporter -3.02% Serotonin, Non-selective 26.33% Sigma, Non-Selective 10.19% Steroids Estrogen 11.16% 1 Percent Inhibition Receptor 10 µM Testosterone (cytosolic) (h) 12.50% Ion Channels Calcium Channel, Type L (Dihydropyridine Site) 43.18% Calcium Channel, Type N 4.15% Potassium Channel, ATP-Sensitive -4.05% Potassium Channel, Ca2+ Act., VI 17.80% Potassium Channel, I(Kr) (hERG) (h) -6.44% Sodium, Site 2 -0.39% Second Messengers Nitric Oxide, NOS (Neuronal-Binding) -17.09% Prostaglandins Leukotriene, -
Prognostic Roles of the Expression of Sphingosine-1-Phosphate Metabolism Enzymes in Non-Small Cell Lung Cancer
681 Original Article Prognostic roles of the expression of sphingosine-1-phosphate metabolism enzymes in non-small cell lung cancer Yingqin Wang1#, Yaxing Shen2#, Xia Sun3,4, Tinah L. Hong5, Long Shuang Huang6, Ming Zhong1 1Department of Critical Care Medicine, 2Department of Thoracic Surgery, Zhongshan Hospital, Fudan University, Shanghai 200032, China; 3Department of Nephrology, Xuzhou Municipal Hospital Affiliated to Xuzhou Medical University, Xuzhou 221000, China; 4Cancer Institute, Xuzhou Medical University, Xuzhou 221002, China; 5New Trier High School, Winnetka, IL, USA; 6Department of Pharmacology, Shanghai Hospital of Traditional Chinese Medicine, Shanghai 200032, China Contributions: (I) Conception and design: M Zhong, LS Huang; (II) Administrative support: M Zhong; (III) Provision of study materials or patients: LS Huang, Y Wang; (IV) Collection and assembly of data: Y Wang, Y Shen, X Sun; (V) Data analysis and interpretation: Y Wang, Y Shen, TL Hong, X Sun; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Ming Zhong, MD, PhD. Department of Critical Care Medicine, Zhongshan Hospital, Fudan University, 180 Fenglin Road, Shanghai 200032, China. Email: [email protected]; Long Shuang Huang, PhD. Department of Pharmacology, Shanghai Hospital of Traditional Chinese Medicine, 274 Zhijiang Middle Rd, Zhabei Qu, Shanghai 200072, China. Email: [email protected]. Background: Sphingosine-1-phosphate (S1P), a bioactive lipid, is generally increased in human non- small cell lung cancer (NSCLC). Evidence has shown that the levels of enzymes in S1P metabolism were associated with clinical outcomes in patients with NSCLC. Nevertheless, the roles of mRNA expression of major enzymes (SPHK1, SPHK2 and SGPL1) in S1P metabolism for predicting outcomes in NSCLC patients have not been determined. -
Leukocyte Cytoskeleton Polarization Is Initiated by Plasma Membrane Curvature from Cell Attachment
Article Leukocyte Cytoskeleton Polarization Is Initiated by Plasma Membrane Curvature from Cell Attachment Graphical Abstract Authors Chunguang Ren, Qianying Yuan, Martha Braun, ..., Erdem Karatekin, Wenwen Tang, Dianqing Wu Correspondence [email protected] (E.K.), [email protected] (W.T.), [email protected] (D.W.) In Brief The molecular mechanisms controlling cell polarization are incompletely understood. Ren and Yuan et al. show that local increase in plasma membrane (PM) curvature resulting from cell attachment recruits and polarizes an inverse FBAR domain protein SRGAP2 to initiate cell cytoskeleton polarization, which is important for neutrophil adhesion to endothelium. Highlights d Cell attachment is required for chemical-induced cytoskeleton polarization d Cell attachment induces local PM curvature increase to recruit and polarize SRGAP2 d Polarized SRGAP2 induces sequential polarization of PtdIns4P, PIP5K1C90, and pMLC d This SRGAP2 polarization signaling axis regulates neutrophil firm adhesion Ren et al., 2019, Developmental Cell 49, 1–14 April 22, 2019 ª 2019 Elsevier Inc. https://doi.org/10.1016/j.devcel.2019.02.023 Please cite this article in press as: Ren et al., Leukocyte Cytoskeleton Polarization Is Initiated by Plasma Membrane Curvature from Cell Attachment, Developmental Cell (2019), https://doi.org/10.1016/j.devcel.2019.02.023 Developmental Cell Article Leukocyte Cytoskeleton Polarization Is Initiated by Plasma Membrane Curvature from Cell Attachment Chunguang Ren,1,16 Qianying Yuan,1,16 Martha Braun,2,3,14 Xia -
Focus on the A3 Adenosine Receptor
JOURNAL OF CELLULAR PHYSIOLOGY 186:19±23 (2001) Differential Effect of Adenosine on Tumor and Normal Cell Growth: Focus on the A3 Adenosine Receptor GIL OHANA, SARA BAR-YEHUDA, FAINA BARER, AND PNINA FISHMAN* Laboratory of Clinical and Tumor Immunology, The Felsenstein Medical Research Center, Tel-Aviv University, Rabin Medical Center, Petach-Tikva, Israel Adenosine is an ubiquitous nucleoside present in all body cells. It is released from metabolically active or stressed cells and subsequently acts as a regulatory mole- cule through binding to speci®c A1, A2A,A2B and A3 cell surface receptors. The synthesis of agonists and antagonists to the adenosine receptors and their cloning enabled the exploration of their physiological functions. As nearly all cells express speci®c adenosine receptors, adenosine serves as a physiological regulator and acts as a cardioprotector, neuroprotector, chemoprotector, and as an immuno- modulator. At the cellular level, activation of the receptors by adenosine initiates signal transduction mechanisms through G-protein associated receptors. Adeno- sine's unique characteristic is to differentially modulate normal and transformed cell growth, depending upon its extracellular concentration, the expression of adenosine cell surface receptors, and the physiological state of the target cell. Stimulation of cell proliferation following incubation with adenosine has been demonstrated in a variety of normal cells in the range of low micromolar con- centrations, including mesangial and thymocyte cells, Swiss mouse 3T3 ®bro- blasts, and bone marrow cells. Induction of apoptosis in tumor or normal cells was shown at higher adenosine concentrations (>100 mM) such as in leukemia HL-60, lymphoma U-937, A431 epidermoid cells, and GH3 tumor pituitary cell lines.