In the Peptide-Loading Complex Mechanistic Basis for Epitope

Mechanistic Basis for Epitope Proofreading in the Peptide-Loading Complex Gerda Fleischmann, Olivier Fisette, Christoph Thomas, Ralph Wieneke, Franz Tumulka, Clemens Schneeweiss, This information is current as Sebastian Springer, Lars V. Schäfer and Robert Tampé of September 24, 2021. J Immunol 2015; 195:4503-4513; Prepublished online 28 September 2015; doi: 10.4049/jimmunol.1501515

http://www.jimmunol.org/content/195/9/4503 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2015/09/28/jimmunol.150151 Material 5.DCSupplemental http://www.jimmunol.org/ References This article cites 59 articles, 16 of which you can access for free at: http://www.jimmunol.org/content/195/9/4503.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

by guest on September 24, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Mechanistic Basis for Epitope Proofreading in the Peptide-Loading Complex

Gerda Fleischmann,* Olivier Fisette,† Christoph Thomas,* Ralph Wieneke,* Franz Tumulka,* Clemens Schneeweiss,‡ Sebastian Springer,‡ Lars V. Scha¨fer,† and Robert Tampe´*

The peptide-loading complex plays a pivotal role in Ag processing and is thus central to the efﬁcient immune recognition of virally and malignantly transformed cells. The underlying mechanism by which MHC class I (MHC I) molecules sample immunodominant peptide epitopes, however, remains poorly understood. In this article, we delineate the interaction between tapasin (Tsn) and MHC I molecules. We followed the process of peptide editing in real time after ultra-fast photoconversion to pseudoempty MHC I molecules. Tsn discriminates between MHC I loaded with optimal and MHC I bound to suboptimal cargo. This differential interaction is key to understanding the kinetics of epitope proofreading. To elucidate the underlying mechanism at the atomic level, we modeled Downloaded from the Tsn/MHC I complex using all-atom molecular dynamics simulations. We present a catalytic working cycle, in which Tsn binds to MHC I with suboptimal cargo and thereby adjusts the energy landscape in favor of MHC I complexes with immunodominant epitopes. The Journal of Immunology, 2015, 195: 4503–4513.

ytotoxic T lymphocytes recognize virally or malignantly critical role in Ag processing was confirmed in Tsn2/2 mice, transformed cells via antigenic peptide epitopes presented where a drastic reduction in MHC I cell-surface expression was http://www.jimmunol.org/ C onMHCclassI(MHCI)molecules.SelectionofMHCI observed when compared with Tsn-proficient cells (8, 9). Notably, loaded with immunodominant epitopes requires a sophisticated soluble Tsn, which lacks the transmembrane domain and cytosolic interplay of various factors including the transporter associated tail, can partly complement MHC I loading and cell-surface ex- with Ag processing (TAP) and tapasin (Tsn) as key players, as pression (10). Tsn has been shown to play a key role in catalyzing well as auxiliary chaperones such as calreticulin and the thiol- peptide loading of MHC I (11) in a process called peptide opti- dependent oxidoreductase ERp57 that is disulfide-linked to Tsn. mization (12). The Tsn-ERp57 conjugate acts as a scaffold for Together, they comprise the endoplasmic reticulum (ER)-resident other PLC components, especially in recruiting and stabilizing

peptide-loading complex (PLC) centered on the TAP complex (1, peptide-receptive MHC I molecules (13). In addition, Tsn binds to by guest on September 24, 2021 2). The molecular events during MHC I peptide loading are still TAP, thus bridging peptide donor and acceptor (14, 15). The not well defined. In particular, our understanding of MHC I function of ERp57 is mainly a structural one, promoting the Tsn– proofreading through direct contact between Tsn and MHC I still MHC I interaction (3, 13). The Tsn–MHC interaction is thought needs further development. X-ray structures of a range of MHC I to be mediated by two conserved ER-lumenal interfaces (3, 16–19). molecules and the Tsn-ERp57 conjugate have been described MHC I alleles differ in their dependence on Tsn with respect previously (3, 4); the architecture of the Tsn/MHC I complex to the acquisition of peptides (20–22). Notably, the HLA alleles within the PLC, however, remains to be determined. B*44:02 and B*44:05 differ only by a single residue at position The crucial function of Tsn in MHC I loading was first described 116, yet they diverge markedly in their dependence on Tsn: in studies using the Tsn-deficient human cell line 721.220 (5–7). Its B*44:02 carries an aspartate and is Tsn dependent, whereas B*44:05 contains a tyrosine and is Tsn independent. It has been *Institute of Biochemistry, Biocenter, Goethe University Frankfurt, 60438 Frankfurt, suggested that Tsn widens the peptide-binding pocket and gen- † Germany; Lehrstuhl fur€ Theoretische Chemie, Ruhr-University Bochum, 44780 erates an energy barrier, which allows only the binding of high- Bochum, Germany; and ‡Molecular Life Science, Jacobs University Bremen, 28759 Bremen, Germany affinity peptides, thereby disengaging Tsn (23). By analyzing b Received for publication July 29, 2015. Accepted for publication August 31, 2015. peptide loading onto the MHC I allele H-2K using isolated This work was supported by German Research Foundation Project SFB 807 “Mem- microsomes, Tsn was shown to increase dissociation rates of brane Transport and Communication” (to R.T. and L.V.S.), Cluster of Excellence peptides and thus to reduce the concentration of unstable MHC I Ruhr Explores Solvation EXC 1069 (to L.V.S.), Graduate School Complex Scenarios complexes with low-affinity peptides (24). of Light-Control (to R.T.), Emmy Noether Grant SCHA1574/3-1 (to L.V.S.), and a European Molecular Biology Organization short-term fellowship (to C.S.). Because an atomic-level picture of the structure and dynamics Address correspondence and reprint requests to Prof. Robert Tampe´, Institute of of the complex between MHC I and Tsn was lacking so far, Biochemistry, Biocenter, Goethe University Frankfurt, Max-von-Laue-Strasse 9, the mechanistic principle of peptide optimization has remained 60438 Frankfurt am Main, Germany. E-mail address: [email protected] enigmatic (25). We followed peptide editing in real time in the The online version of this article contains supplemental material. presence and absence of Tsn and determined the kinetics as well Abbreviations used in this article: AF633, Alexa Fluor 633; BirA, biotin ligase A; as thermodynamics of the interaction between Tsn and MHC I. dNA, dimeric NeutrAvidin; ER, endoplasmic reticulum; b2-m, b2-microglobulin; MD, molecular dynamics; MHC I, MHC class I; PLC, peptide-loading complex; The process of peptide optimization was synchronized by a pho- SEC-MALLS, size-exclusion chromatography multiangle laser light scattering; toreaction, converting a high-affinity epitope into a low-affinity SPR, surface plasmon resonance; TAP, transporter associated with Ag processing; cargo. We show that Tsn accelerates the dissociation rate of low- Tn6, Tsn variant 6; Tsn, tapasin. and medium-affinity (suboptimal) peptide epitopes. Moreover, the Copyright Ó 2015 by The American Association of Immunologists, Inc. 0022-1767/15/$25.00 differential binding of Tsn to peptide-loaded and peptide-deficient www.jimmunol.org/cgi/doi/10.4049/jimmunol.1501515 4504 MHC I PROOFREADING

MHC I was observed, which is crucial for peptide editing and se- gel filtration using a Superdex 200 (GE Healthcare) in HEPES-E buffer. lection of immunodominant epitopes. To unravel the underlying The Tsn-ERp57 conjugate was concentrated using Amicon Ultra-15 mechanism at the atomic level, we obtained the structure of the Tsn/ devices (Millipore). MHC I complex from multimicrosecond all-atom molecular dy- Assembly of MHC I/Tsn-ERp57/dimeric NeutrAvidin namics (MD) simulations. Tsn and the Ag peptide compete for complexes opening/closing the MHC I binding groove, thereby modulating the Biotin ligase A (BirA) (pET21-BirA; Addgene) was expressed in E. coli affinity of the Tsn/MHC I complex. and purified as described previously (28). B*44:02 (30 mM) and Tsn- ERp57 (30 mM) were incubated with BirA (1 mM) in BirA reaction Materials and Methods buffer (50 mM bicine, pH 8.3, 10 mM biotin, 1 mM MgATP). After 2 h at Retrovirus and stable cell line expressing single-chain HLA- 30˚C, free biotin was removed by rapid gel filtration (MicroSpin G25; Bio- B*44:02 Rad). The biotinylation of the two components was compared by immunoblotting using streptactin-conjugated HRP. Biotinylated B*44:02 (10 The DNA sequence coding for HLA-B*44:02 (aa 25-298) was PCR- mM) was first titrated to equimolar amounts of dimeric NeutrAvidin (dNA, amplified from pCSB53 using the forward primer (59-CCTTAAT- Thermo Scientific). Subsequently, twice the amount of Tsn-ERp57 (20 TAACGGCTCCCACTCCATGAGGTATTT-39) and the reverse primer (59- mM, biotinylation efficiency was lower in comparison with B*44:02) was CTGCACCGGTCCATCTCAGGGTGAGGGGCTTC-39). The resulting added and incubated at 4˚C for 30 min in HEPES-E buffer to yield construct was cloned into a plasmid containing a GFP gene after an in- a stoichiometric B*44:02/Tsn-ERp57/dNA complex. The monodispersity ternal ribosomal entry site for selection, kindly provided by A. Townsend of the complexes was analyzed in HEPES-E buffer pH 7.0 using size- (Oxford University). The complete method is described elsewhere (26). exclusion chromatography multiangle laser light scattering (SEC- The final plasmid pCSM71 codes for b2-microglobulin (b2m; bearing its MALLS). native signal peptide), a linker sequence (GS)6LIN, and the ER-lumenal Downloaded from domain of the HLA-B*44:02 H chain, followed by a myc-tag, a bio- SEC-MALLS tinylation recognition sequence, and a His -tag. For the generation of 6 Gel filtration (TSK-GEL G3000 SWXL column; Tosoh) was performed with the retrovirus, the packaging cell line GP2-293 (BD Biosciences) was an in-line laser light scattering detector (TREOS), refractometer (Opti- cotransfected with pVSV-G (27) and pCSM71 using the Effectine trans- labrEX; Wyatt Technology), and UV detector (Jasco). The system was fection kit (Qiagen). Cell culture supernatants were collected after 2–3 d, equilibrated with HEPES-E buffer pH 7.0 filtered through a 0.1-mm pore 3 centrifuged at 500 g for 5 min, and used directly for transduction of the size VVLP filter (Millipore), followed by a recirculation through the production cell line or stored at 4˚C. HeLa cells were infected with the

system for at least 24 h at 0.1 ml/min to improve the baseline by remov- http://www.jimmunol.org/ recombinant retrovirus in the presence of polybrene. The supernatant was ing air bubbles, as well as particles, via degasser and preinjection filter replaced with fresh medium after 24 h, and cells were subjected to one (0.1 mm), respectively. A total of 250 mg B*44:02/Tsn-ERp57/dNA or additional cycle of retroviral infection after another 24 h. Transduced cells B*44:02/dNA in 200 ml was injected and analyzed at a flow rate of 0.5 were sorted via their intrinsic GFP using FACS. The cell line was named ml/min. The obtained signals were processed with the ASTRA software HeLa-B4402 SPM148 and yielded high expression levels of HLA- (Wyatt Technology) to calculate the molecular mass. B*44:02. Refolding of MHC I molecules Expression and purification of soluble, single-chain HLA- B*44:02 Single-chain HLA-B*44:02 was purified as described earlier. A total of 147 ml B*44:02 (17 mM stock) was diluted into 1 ml 8 M urea, 20 mM HeLa-B4402 SPM148 cells were grown at 37˚C, 5% (v/v) CO2, in DMEM, HEPES pH 8.0 for denaturation (29). The protein was concentrated to 50 by guest on September 24, 2021 10% (v/v) FCS supplemented with penicillin/streptomycin in a four-tray ml using Amicon Ultra-3 devices (Millipore), thereby removing endoge- cell factory (Nunc) until 90% confluence, washed three times with PBS nously bound peptides. Refolding and subsequent complex formation were buffer, pH 7.3, and incubated in DMEM with penicillin/streptomycin. The induced by dilution of the denatured protein (final concentration, 1 mM) medium was replaced twice every 3 d. The supernatant was collected, into 2.5 ml ice-cold refolding buffer (20 mM HEPES pH 8.0, 400 mM L- centrifuged for 10 min at 5000 3 g, and stored at 4˚C until use. Ni-NTA arginine/HCL, 2 mM EDTA, 5 mM reduced glutathione, 0.5 mM oxidized agarose (Qiagen) was equilibrated with HEPES buffer and incubated with glutathione, 0.5 mM PMSF), and 20 mM EEFGRA(Anp)SF. Refolding supernatant containing single-chain HLA-B*44:02 overnight at 4˚C in an mixture was kept in the dark and mixed using an overhead rotor for 72 h overhead shaker. Subsequently, Ni-NTA agarose was collected using an at 4˚C. The protein was concentrated to 200 ml using Amicon Ultra-3 Econo-Pac column (Bio-Rad) and washed. Protein was then eluted with devices (Millipore) and subjected to gel filtration using a Superdex 200 200 mM histidine in HEPES buffer and finally purified via gel filtration (GE Healthcare) in HEPES-E buffer. using a Superdex 200 (GE Healthcare) in HEPES-E buffer (20 mM HEPES pH 7.4, 150 mM NaCl, 3 mM EDTA). Purified proteins were concentrated Fluorescence anisotropy using Amicon Ultra-15 devices (Millipore). The dissociation and exchange kinetics of low- and medium-affinity peptides labeled with Alexa Fluor 633 [AF633; ADIA(CAF633)VAKY and Expression and purification of Tsn-ERp57 AF633 AAIA(C )VAKY, respectively] were measured at lem/ex 632/647 nm. The cDNA encoding for Tsn and ERp57 was a kind gift of Peter Cresswell Association and exchange kinetics were analyzed using EEFG(CFL488) C60A (Yale University). The ERp57 mutant was used throughout the study to AFSF at lem/ex 480/520 nm. Peptides were synthesized using standard preserve the disulfide bond with Tsn (13). The DNA was amplified via Fmoc solid-phase chemistry and purified by C18 reverse-phase HPLC. The PCR using as forward primer (59-TATGGATCCATGAAGTCCCTGTCT identity of the peptides was verified by electrospray ionization–mass spec- CTGCTCC-39) and reverse primer (59-TAGAAG CTTTTAGTGATGGT- trometry. Data were collected by the FluorEssence software and processed GATGGTGATGGTGATGGTGATGAGACTGGAAGTACAGGTTCTCC with GraphPad Prism. CACTCAATCTTCTGGGCCTCGAAAATGTCGTTCAGACCGTCCTCA AGGGAGGGCC-39), resulting in Tsn bearing the native signal sequence Peptide dissociation and the ER-lumenal domain (1–392), followed by a biotinylation recog- Peptide-deficient B*44:02 (170 nM) was loaded with a 10-fold molar nition sequence, a TEV-cleavage site, and a His10-tag. A recombinant AF633 C60A excess of the medium-affinity peptide ADIA(C )VAKY or the low- baculovirus (pFastBac Dual) harboring Tsn and ERp57 was generated AF633 m according to the manufacturer’s protocol. Sf9 insect cells were cultured in affinity peptide AAIA(C )VAKY for 48 h at 16˚C in 65 l HEPES- SF900 II medium complemented with 10% FCS (v/v) (Invitrogen) and E buffer. Free peptides were removed within 1 min by rapid gel filtration infected with baculovirus (10% of the total expression volume). Seventy- (MicroSpin G25; Bio-Rad). Dissociation kinetics were monitored after adding a 1000-fold excess of unlabeled peptide at 25˚C. The dissociation was two hours postinfection, cells were harvested and lysed at 4˚C for 1 h in l HEPES buffer (20 mM HEPES pH 7.4, 150 mM NaCl) supplemented followed in real time ( ex/em 632/647 nm) in the absence and presence of with 1% (v/v) Triton X-100, 1.0 mM benzamidine, and 2.5 mM PMSF. Tsn-ERp57. Data were fitted to a monoexponential dissociation kinetics The cell lysate was centrifuged at 120,000 3 g for 30 min at 4˚C. The using GraphPad Prism. Tsn-ERp57 conjugate was purified via Ni-NTA agarose (Qiagen) and Peptide exchange eluted with 200 mM histidine in HEPES buffer. Subsequently, the conjugate was purified via HiTrap Q HP (GE Healthcare) with a NaCl A pH shock was used to dissociate endogenously bound peptides from gradient (0–500 mM) in 20 mM HEPES, pH 8.0, and finally polished by B*44:02 (30). In brief, purified B*44:02 was titrated with 0.1 M citric acid The Journal of Immunology 4505 to a pH of 2.5. The reaction was kept on ice for 2 min and subsequently R ¼ R pC=ðC þ KDÞð1Þ neutralized with 1 M Tris/HCl, pH 9.0. Released peptides were removed via eq max rapid gel filtration (MicroSpin G25; Bio-Rad). Peptide exchange was initi- R represents the response units at equilibrium, R is the maximum ated by the addition of 170 nM high-affinity peptide EEFG(CFL488)AFSF to eq max analyte binding capacity of the surface, KD is the equilibrium dissociation B*44:02/dNA (170 nM) or B*44:02/Tsn-ERp57/dNA (170 nM). Association constant, and C is the analyte concentration. The binding isotherms were of EEFG(CFL488)AFSF and dissociation of ADIA(CAF633)VAKY or AAIA AF633 normalized by the Rmax values. (C )VAKY were monitored at lem/ex 480/520 (fluorescein) and 632/ 647 nm (AF633), then fitted by monoexponential association or dissociation Abs kinetics using GraphPad Prism. The error of the rate constants (6)isanSD. The Abs used were 7F6 against Tsn (31), HC10 for HLA B*44:02 (32), Peptide editing triggered by photocleavage a-ERp57 (ERp57; Abcam), a-avidin (NeutrAvidin; Abs-online GmbH), streptactin-HRP (biotin; IBA). All secondary Abs (anti-rat, anti-mouse, Peptide-deficient B*44:02 molecules (170 nM) were loaded with a 10-fold anti-rabbit) were purchased from Sigma-Aldrich. excess of the photocleavable, high-affinity peptide EEFGRA(Anp)SF [Anp, 3- amino-3-(2-nitro) phenyl-propionic acid] for 48 h at 16˚C in 65 ml HEPES-E MD simulations buffer. Free peptides were removed within 1 min by rapid gel filtration MD simulations were performed with GROMACS 4.6.5 (33), using the (MicroSpin G25; Bio-Rad). HLA-B*44:02 preloaded with EEFGRA(Anp)SF (FL488) Amber99SB-ILDN protein force field (34, 35) and TIP3P water model (170 nM) was incubated with the high-affinity peptide EEFGC AFSF (36). The SETTLE (37) and LINCS (38) constraint algorithms were ap- (170 nM). The anisotropy was monitored at l 480/520 nm and 25˚C for em/ex plied to water and other molecules, respectively; LINCS expansion order 60 min. Photocleavage was performed for 10 min on ice using a 366-nm UV 2 was 2 with three iterations. In combination with virtual hydrogens (39), lamp (185 mW/cm ; ThorLabs). After photocleavage, the association kinetics (FL488) this allowed for a 4-fs integration time step. Short-range nonbonded of EEFGC AFSF to B*4402 was monitored for 60 min at 25˚C in Coulomb and Lennard-Jones 6-12 interactions were treated with a Verlet HEPES-E buffer in the absence and presence of Tsn-ERp57. buffered pair list (40) with potentials smoothly shifted to zero at a 10 A˚ Downloaded from Surface plasmon resonance cutoff. Long-range Coulomb interactions were treated with the PME method (41) with a grid spacing of 1.2 A˚ and cubic spline interpolation. A total of 25 mg/ml NeutrAvidin was coupled to the surface via standard Analytical dispersion corrections were applied for energy and pressure to amine coupling to a density of ∼4000 response units. Biotinylated Tsn- compensate for the truncation of the Lennard-Jones interactions. A peri- ERp57 was immobilized on the functionalized surface at a flow rate of odic rhombic dodecahedron cell was used. The thermodynamic ensemble 5 ml/min to an average of ∼700 response units. B*44:02 binding to and was NpT. Temperature was kept constant at 300 K by a velocity-rescaling dissociation from Tsn-ERp57 was monitored for 900 and 5000 s, respec- thermostat (42) with coupling time constant 0.1 ps. For constant 1.0 bar http://www.jimmunol.org/ tively. Regeneration of the chip was performed with 1 M NaCl for 180 s at pressure, an isotropic Berendsen barostat (43) was used with coupling time 30 ml/min. Using a reference flow cell, we corrected sensorgrams for bulk constant 0.5 ps and compressibility of 4.5 3 1025 bar–1. refractive index changes and unspecific binding. All data were double- B*44:02pep (with EEFGRAFSF peptide) and Tsn coordinates were taken referenced using responses from blank injections with running buffer. from crystal structures [PDB ID: 1M6O (44) and 3F8U (3), respectively] to Data were processed using the BIAevaluation software (GE Healthcare) generate starting structures. Missing Tsn loops were filled in with MOD- and fitted to a standard 1:1 interaction model using Eq. 1. ELER 9.12 (45). The two components were first aligned along their longi- by guest on September 24, 2021

FIGURE 1. Tsn catalyzes the dissociation of suboptimal peptides. (A) Schematic of the MHC I/Tsn-ERp57 complex consisting of single-chain B*44:02 and the Tsn-ERp57 conjugate, tethered to dNA. (B) Assembly of B*44:02/dNA and B*44:02/Tsn-ERp57/dNA complexes were analyzed by SDS-PAGE and immunoblotting. (C) SEC-MALLS analyses confirmed the stoichiometry of the two complexes. The m.w. of the B*44:02/Tsn-ERp57/dNA (red) and the B*44:02/dNA complex (green) were calculated to be 184 and 83 kDa. The dissociation kinetics of B*44:02 (170 nM), loaded with the medium-affinity peptide (D) or low-affinity peptide (E) and incubated with a 1000-fold molar excess of unlabeled peptide, was followed in real time by fluorescence anisotropy in the absence (light violet) and presence of Tsn-ERp57 (dark violet). Dissociation rates of 1.78 6 0.10 3 1023 s21 and 7.25 6 0.43 3 1023 s21 were determined for the low-affinity peptide in the absence and presence of Tsn-ERp57, respectively, whereas dissociation rates of 0.34 6 0.04 3 1023 s21 and 1.58 6 0.01 3 1023 s21 were calculated for the medium-affinity peptide in the absence and presence of Tsn-ERp57, respectively. Data are representative of three independent experiments. 4506 MHC I PROOFREADING

Table I. Kinetic and thermodynamic data of peptide binding to HLA-B*44:02 as shown in Supplemental Fig. 2

3 21 21 23 21 Peptides Affinity kon (3 10 M s ) koff (3 10 s ) KD (nM) AAIAC(AF633)VAKY Low 2.05 6 0.64 1.78 6 0.10 844 ADIAC(AF633)VAKY Medium 2.25 6 0.35 0.38 6 0.04 160 EEFGC(FL488)AFSF High 11.37 6 0.04 0.065 6 0.030 6 tudinal axes (as enforced by anchoring in the membrane, which was not and incubation with biotinylated Tsn-ERp57 (Fig. 1B). Using SEC included in our present study) and oriented such that B*44:02 T134 contacts with in-line MALLS, we detected a stoichiometric complex with Tsn R187 [because these residues are known to be in proximity in the a molecular mass of 184 kDa (Fig. 1C). complex (3)], then translated away from each other by 10 A˚ . The system was solvated, and randomly picked water molecules were replaced by Na+ and 2 Tsn-ERp57 accelerates the dissociation of suboptimal Cl ions to yield a concentration of 0.15 M and a neutral overall charge. The peptide–MHC I complexes final system contained ∼150,000 atoms. Initial velocities were generated at 65 K, and the system was progressively heated to 300 K over 1.0 ns. The We first characterized a set of peptides with respect to their affinity final coordinates from the complex-forming simulation after 1 ms were used as well as association and dissociation rate constants for HLA- as the starting point for the comparison of peptide-loaded B*44:02pep and pd B*44:02. The well-characterized B*44:02 epitope EEFGRAFSF peptide-deficient B*44:02 . The peptide-deficient form was prepared by a replacing the peptide from the MHC I binding groove by water molecules, derived from HLA-DP *0201 (47) was labeled with fluorescein followed by 500 steps of steepest-descent energy minimization. Finally, five via a cysteine positioned at the center of the peptide. EEFG(CFL488) m AF633 AF633 Downloaded from 1.0- s trajectories were acquired for both peptide-loaded and peptide- AFSF has a KD of 6 nM. ADIA(C )VAKY and AAIA(C ) deficient systems. VAKY labeled with AF633 display a K of 160 and 844 nM for Buried surface was computed as the difference in solvent-accessible D surface between the protein complex and its isolated components, with B*44:02 (Table I, Supplemental Fig. 2A–C) and are, therefore, a probe size of 1.4 A˚ . The mean buried surfaces (for both the peptide- referred to as medium- and low-affinity peptides, respectively. The loaded and -deficient complexes) were averaged over the last 900 ns of the equilibrium dissociation constants determined by fluorescence an- five trajectories started after complex formation and are presented with isotropy are in agreement with previously reported data (48). It is their SD as an error estimate. Residue-residue contact occupancy was noteworthy that binding affinity and kinetics of these model pep- http://www.jimmunol.org/ defined as the fraction of total simulation time that any pair of atoms in two residues is within a 3.5-A˚ cutoff. Occupancy was averaged over the last tides are not affected by the attached fluorophores (Supplemental 900 ns of each simulation; SD between the individual simulations was used Fig. 2D). as an error estimate. F-pocket width was measured from Ca-Ca distances To investigate the impact of Tsn on the peptide dissociation a a a a d1 between I85 ( 1) and T138 ( 2-1), d2 between Y74 ( 1) and A149 ( 2-1). kinetics, we preloaded peptide-deficient B*44:02 with either Distances were averaged over the last 900 ns of each simulation; statistical errors were estimated using block averaging. the low-, medium-, or high-affinity peptide. Free peptides were removed via rapid-spin gel filtration. Peptide–MHC I complexes Results were immediately used to analyze peptide dissociation kinetics in the absence or presence of Tsn via fluorescence anisotropy. Pep- Assembly of stoichiometric MHC I/Tsn-ERp57 complexes by guest on September 24, 2021 tide dissociation was followed in the presence of a 1000-fold Mechanistic analyses of peptide–MHC I association and dissoci- excess of unlabeled peptides to prevent any rebinding of fluores- b ation have been largely hampered by the dissociation of 2m cent peptides. Notably, the Tsn-ERp57 conjugate stimulated the from the H chain, which resulted in irreversible inactivation/ dissociation rate of the medium-affinity complex from 0.34 6 b 23 21 23 21 aggregation of the MHC I molecules. Hence, we linked 2m co- 0.04 3 10 s to 1.58 6 0.01 3 10 s (Fig. 1D). In the case valently to HLA-B*44:02 (residues 25–298). This MHC I allo- of the low-affinity peptide, the off-rate was found to be 1.78 6 morph displays the strongest Tsn dependence known so far and is 0.10 3 1023 s21 in the absence and 7.25 6 0.43 3 1023 s21 in therefore ideal to study the mechanistic basis of peptide editing the presence of Tsn (Fig. 1E, Table II). The dissociation of the by Tsn (20, 46). Single-chain B*44:02 with a C-terminal bio- high-affinity epitope was extremely slow and difficult to follow tinylation tag, purified from stably transduced HeLa cells, eluted over 40 h, changing only gradually from 0.06 6 0.03 3 1023 s21 as a monodisperse peak at 50 kDa during SEC (Supplemental Fig. to 0.10 6 0.02 3 1023 s21 when Tsn-ERp57 was added. The Tsn 1). The Tsn construct, also containing a C-terminal biotinylation variant 6 (Tn6) with mutations at the predicted MHC I interaction tag, comprises the ER-lumenal domain of Tsn (residues 21–412). interface (E185K, R187E, Q189S, and Q261S), which is unable to Tsn and ERp57, coexpressed in Sf9 cells, were purified as mono- restore B*44:02 surface expression (3), did not alter the off-rate of disperse Tsn-ERp57 conjugate of 102 kDa (Supplemental Fig. 1). low- and medium-affinity complexes (Table II, Supplemental Fig. 3). To mimic the lateral organization and interaction within the PLC, These results demonstrate that a direct interaction between Tsn and we tethered BirA-biotinylated MHC I and Tsn-ERp57 to dNA (Fig. MHC I accelerates the dissociation of suboptimal peptides. 1A). MHC I/Tsn-ERp57 complexes were assembled by titrating equimolar amounts of B*44:02 to dNA, followed by gel filtration Peptide editing followed in real time To follow peptide editing by Tsn in real time, we loaded B*44:02 molecules with suboptimal epitopes as described earlier. Peptide Table II. Dissociation rates of low- and medium-affinity peptides exchange was initiated by adding an equimolar concentration of from B*44:02 in the absence and presence of Tsn-ERp57 and mutant the high-affinity epitope EEFG(CFL488)AFSF (170 nM). Associ- Tn6-ERp57 (E185K, R187E, Q189S, and Q261S of Tsn) as shown in Supplemental Fig. 3 ation and dissociation kinetics were monitored simultaneously by dual-color fluorescence anisotropy. Notably, in the absence of Tsn, AAIAC(AF633)VAKY ADIAC(AF633)VAKY peptide exchange was very slow, leading to an apparent rate of 23 21 Low-Affinity Medium-Affinity 0.25 6 0.14 3 10 s (kon,app) for the association of the high- 3 23 21 3 23 21 koff ( 10 s ) koff ( 10 s ) affinity peptide with the low-affinity peptide/MHC I complex, 23 21 2Tsn-ERp57 1.78 6 0.10 0.34 6 0.04 whereas an off-rate (koff,app) of 0.38 6 0.18 3 10 s was + Tsn-ERp57 7.25 6 0.43 1.58 6 0.01 measured for the low-affinity peptide (Fig. 2A). These data imply + Tn6-ERp57 1.81 6 0.20 0.40 6 0.08 that the dissociation of the suboptimal peptide is the rate-limiting The Journal of Immunology 4507

FIGURE 2. Tsn-catalyzed peptide exchange on B*44:02. Peptide exchange was monitored by dual-color fluorescence anisotropy. B*44:02 (170 nM) was preloaded with low- affinity peptide (A) or medium-affinity peptide (B) as described in Fig. 3. Peptide exchange was initiated by adding high-affinity peptide (170 nM) to equimolar concentrations of either B*44:02/dNA (light color) or B*44:02/ Tsn-ERp57/dNA (dark color). Data shown are representative of three independent experiments. Downloaded from http://www.jimmunol.org/ step in peptide exchange. Remarkably, in the presence of Tsn, the affinity peptide. It is worth mentioning that 90% of the MHC I rate of peptide exchange was significantly increased, yielding molecules loaded with the photocleavable peptide are reloaded 23 21 FL488 a kon,app of 2.65 6 0.07 3 10 s for the high-affinity peptide with the high-affinity peptide EEFG(C )AFSF after the light- and an off-rate of 2.81 6 0.80 3 1023 s21 for the low-affinity triggered peptide editing (Supplemental Fig. 4). In conclusion, peptide, indicating that Tsn catalyzes peptide exchange by in- creasing the dissociation rate of low-affinity peptides. We also examined whether Tsn stimulates the exchange of by guest on September 24, 2021 medium-affinity peptides by a high-affinity epitope (Fig. 2B). In the absence of Tsn, peptide exchange was not observed within the time period of the measurement. In contrast, in the presence of Tsn, the dissociation of the medium-affinity peptide and the association of the high-affinity peptide were dramatically accelerated, yielding apparent association and dissociation rates of 1.01 6 0.06 3 1023 s21 and 0.97 6 0.17 3 1023 s21, respectively. The real-time analysis of peptide exchange in MHC I/Tsn-ERp57 complexes, reconstituted by isolated components, provides direct proof of the function of Tsn-ERp57 in peptide exchange in favor of high-affinity, immunodominant epitopes. Peptide editing synchronized by light To follow the immediate response when a high-affinity epitope is converted into a low-affinity cargo, we made use of the photocleavable, high-affinity peptide EEFGRA(Anp)SF. The photo- labile amino acid (Anp) was incorporated at a solvent-exposed, nonanchored position, predicted to have no effect on the pep- FIGURE 3. Peptide editing by Tsn synchronized by light. (A, left) tide–MHC I complex (Fig. 3A). Upon illumination at 366 nm for Cartoon representation of peptide-loaded B*44:02 (PDB ID code: 1 min, this high-affinity epitope is converted into two low- 1M6O), with the peptides shown as red sticks, the position of the phe- affinity fragments (Fig. 3A). MHC I molecules loaded with the nylalanine within the peptide that is replaced with a photocleavable res- photocleavable, high-affinity peptide were incubated with equi- idue highlighted in blue. Right, Schematic of the photoconversion of the molar amounts of the high-affinity peptide EEFG(CFL488)AFSF. high-affinity peptide into low-affinity cargos. (B) The displacement of Before photocleavage, no significant peptide exchange of MHC I photocleavable, high-affinity peptide in the absence (green) and presence loaded with the photocleavable, high-affinity peptide was ob- (magenta) of Tsn-ERp57 was followed by fluorescence anisotropy. Pep- tide exchange was followed after adding the high-affinity peptide served either in the absence or presence of Tsn (Fig. 3B). This is EEFG(CFL488)AFSF (170 nM) to B*44:02/dNA (170 nM) or B*44:02/Tsn- in line with the findings described above, demonstrating that the ERp57/dNA (170 nM) preloaded with a photocleavable, high-affinity exchange of high-affinity peptides on B*44:02 is kinetically peptide. After photoconversion, the association kinetics (kon,app) was disfavored even in the presence of Tsn. Upon photoconversion monitored for another 60 min. Apparent association rates of 1.08 6 into a suboptimal cargo, the function of Tsn becomes obvious 0.02 3 1023 s21 and 5.21 6 0.12 3 1023 s21 were determined in the in accelerating the exchange of low-affinity cargo against high- absence and presence of Tsn-ERp57, respectively. 4508 MHC I PROOFREADING

Tsn catalyzes the thermodynamically favored, but kinetically loaded and -deficient B*44:02, as well as the impact of peptide disfavored, exchange of suboptimal cargo against high-affinity loading on the dissociation of B*44:02pd/Tsn-ERp57 complexes. epitopes, and therefore preferentially enables kinetically and Equilibrium dissociation constants KD were derived from the thermodynamically stable peptide–MHC I complexes to travel to equilibrium binding (Req; Fig. 4D). The data are in excellent the cell surface. agreement with a Langmuir-type (1:1) interaction model, reflecting a high-affinity interaction between Tsn and peptide- Tsn discriminates between optimally and suboptimally loaded deficient B*44:02 (KD,1 =0.206 0.01 mM) and transient, low- MHC I affinity interaction with peptide-loaded B*44:02 (KD,2 =4.776 Based on the previous results, Tsn must control the quality of 0.29 mM). These affinities correspondtoafreeenergydifference peptide–MHC I complexes. However, the direct interaction be- of DDG=2RT ln (KD,2/KD,1)=28kJ/molbywhichTsnsta- tweenTsnandpeptide–MHCIhasnot yet been characterized. bilizes B*44:02pd over B*44:02pep. Because the peptide-deficient Using an oriented site-specific immobilization of Tsn-ERp57, we state is traversed during peptide exchange, stabilization of this determined the kinetics and thermodynamics of this transient high-energy intermediate explains the observed accelerated pep- interactionwithMHCIbysurfaceplasmonresonance(SPR).To tide exchange. convert peptide-loaded into peptide-deficient MHC I complexes We also compared the Tsn-binding characteristics of B*44:02 in situ, we preloaded HLA-B*44:02 with the photocleavable, and B*44:05. The two allomorphs, loaded with endogenous pep- high-affinity peptide. As expected, MHC I molecules loaded tide, were probed for interaction with immobilized Tsn-ERp57 pep with the high-affinity peptide (B*44:02 ) displayed a relatively (Fig. 5). The affinities (KD) of the peptide-loaded MHC I mole- slow association and a fast dissociation from Tsn-ERp57, cules to Tsn-ERp57 were determined as 1.8 6 0.2 mMfor Downloaded from reflecting a low-affinity, transient interaction (Fig. 4A). Strik- B*44:02 and 10.3 6 0.6 mM for B*44:05. For the peptide- pd pd ingly, after fast photoconversion of the high-affinity epitope into deficient forms B*44:02 and B*44:05 , KDs of 0.31 6 0.02 a suboptimal cargo, peptide-deficient B*44:02pd now revealed and 1.3 6 0.2 mM, respectively, were determined (Table III). a high-affinity interaction, reflected by the fast association and Taken together, these results demonstrate that the Tsn-dependent slow dissociation kinetics (Fig. 4B). Reloading B*44:02pd/Tsn- MHC I allele, B*44:02, has a significantly higher affinity toward

ERp57 complexes with the high-affinity peptide converts the Tsn-ERp57 than the Tsn-independent B*44:05, which is in line http://www.jimmunol.org/ high-affinity into a transient interaction (Fig. 4C). This proves with the notion that HLA-B*44:05 does not require Tsn for pep- that the affinity and kinetics of the MHC/Tsn-ERp57 interaction tide loading, whereas Tsn is indispensable for loading of B*44:02 are specifically and reversibly altered by the peptide-loading (49). We also checked by SPR whether the Tn6 mutant is able to status of MHC I. The binding profiles at 1.5 mM of B*44:02 discriminate between peptide-loaded and -deficient MHC I. This were overlaid to illustrate the differences between peptide- is not the case; as with immobilized Tn6-ERp57, we were unable by guest on September 24, 2021

FIGURE 4. Tsn distinguishes between peptide-loaded and -deficient MHC I. Association and dissociation kinetics as well as equilibrium binding of HLA-B*44:02pep loaded with a high-affinity, photocleavable peptide (A) or photo-cleaved, peptide-deficient B*44:02pd (B) with Tsn-ERp57 were analyzed by SPR. (C) A high-affinity peptide (15 mM) was added during the dissociation phase of the peptide-deficient B*44:02 and compared with the respective pd trace of B*44:02 in the absence of high-affinity peptides. Traces for 1.5 mM B*44:02 illustrate the differences in Rmax as well as the differences of the association and dissociation profiles. Green represents B*44:02pd, orange represents B*44:02 with addition of high-affinity peptide during dissociation pep pd phase (B*44:02 + peptide), and brown represents B*44:02 .(D) Equilibrium dissociation constants KD of peptide-deficient B*44:02 (green) and peptide-loaded B*44:02pep (brown) for Tsn-ERp57 were determined to 0.20 6 0.01 and 4.77 6 0.29 mM, respectively. Data were fitted to a standard 1:1 interaction model and normalized. Data are representative of three independent experiments. The Journal of Immunology 4509 to reach saturation for both peptide-loaded and -deficient B*44:02 R187 and Q189 are mutated (3). For the C-terminal interface even at a concentration of 40 mM (Supplemental Fig. 3F). (Fig. 6C), our MD simulations predict interactions between the CD8 binding site of B*44:02 and a cluster of basic Tsn residues Mechanism of differential binding (R333, H334, H335, H345). To establish these contacts, the To understand at the atomic level the mechanism by which Tsn C-terminal domain of Tsn has to rotate compared with its ini- differentiates between peptide-loaded and -deficient B*44:02, we tial orientation in the X-ray crystal structure. The C-terminal Tsn used multimicrosecond all-atom MD simulations in explicit sol- residues observed in our MD simulations have previously been vent to characterize the formation of the Tsn/B*44:02 complex. suggested to be involved in the interaction and have been shown to Starting from the two solvent-separated proteins, spontaneous influence assembly and surface expression of MHC I molecules formation of the Tsn/B*44:02 complex was observed in an un- (52–55). biased 1.0-ms MD simulation (Fig. 6). Two distinct protein–pro- Our observation that the protein–protein interfaces are tein interfaces were formed (Fig. 6A), one between the Tsn similar, irrespective of the peptide-loading status of B*44:02, N-terminal domain and B*44:02-a2 (Fig. 6B), the other between the raises the intriguing question of how Tsn distinguishes be- pep pd Tsn C-terminal domain and B*44:02-a3 (Fig. 6C). To improve the tween B*44:02 and B*44:02 . Fig. 6E compares the oc- sampling of these identified Tsn/B*44:02 interfaces, we initiated cupancies of the most prevalent contacts between Tsn and five additional 1-ms simulations for both peptide-bound and -free B*44:02 residues. At the N-terminal interface, all contacts B*44:02 from the final complex structure of the first step with .60% occupancy, which are thus likely to play a key role (Fig. 6D). No significant differences were observed between the in the complex, are more prevalent in B*44:02pd than in peptide-loaded and -deficient forms in terms of size of the inter- B*44:02pep. By contrast, at the C-terminal interface, this oc- Downloaded from faces or nature of the individual residue–residue contacts. At the cupancy difference is not observed (inset). In line with these pd N-terminal interface (Fig. 6B), Tsn cradles the B*44:02 a2-1 helix, tighter contacts between Tsn and B*44:02 , the peptide- potentially stabilizing B*44:02 in a peptide-receptive conforma- binding groove F-pocket is widened (Fig. 6B): Upon peptide tion and preventing partial unfolding of a2-1 (50). Tsn contacts removal, the I85-T138 (d1) and Y74-A149 (d2) Ca-Ca dis- B*44:02 a2-1 with K16, L18, and L79, the a2-1/2 hinge with W85, tances increase from 10.8 6 0.7 to 11.8 6 0.4 and from 21.8 6

and the underside of the b-sheet with R187 and Q189. B*44:02 0.4 to 23.8 6 0.8 A˚ , respectively. This small but significant http://www.jimmunol.org/ residues on the Tsn-facing side of a2-1 (mainly I142, R145) are widening by 1–2 A˚ suffices to stretch or even break H-bonds involved in the interface, as are R151 and b-sheet residues (D129, and van der Waals contacts between the F-pocket and the S132, T134). Our results are consistent with previous studies pro- peptide, hence lowering its affinity. At the same time, it allows posing that Tsn acts on the a2-1 helix (16–19, 51); furthermore, they a better match between B*44:02 a2-1 and Tsn, therefore in- support structural data and mutagenesis experiments showing creasing the affinity, as reflected in the occupancy differences loss of peptide-loading activity in the Tsn mutant Tn6, in which and observed experimentally. by guest on September 24, 2021

FIGURE 5. Tsn-ERp57 discriminates between peptide-deficient and endogenous peptide-loaded MHC I molecules. Interaction profiles of B*44:02 loaded with endogenous peptide [B*44:02pep (A)] and peptide-deficient B*44:02 [B*44:02pd (B)] with immobilized Tsn-ERp57 at indicated concentrations. To probe the Tsn-binding characteristics in the peptide-deficient state, we freed the two allomorphs from endogenous peptide by a pH shock, followed by pd pep neutralization and rapid gel filtration. (C) Equilibrium dissociation constants KD for B*44:02 (violet) and B*44:02 (pink) were determined to 0.31 6 0.02 and 1.8 6 0.2 mM, respectively. Interaction profiles of B*44:05 loaded with endogenous peptide [B*44:05pep (D)] and peptide-deficient B*44:05 pd pd [B*44:05 (E)] with immobilized Tsn-ERp57 at indicated concentrations. (F) Equilibrium dissociation constants KD for B*44:05 (light blue) and B*44:05pep (dark blue) were determined to 1.3 6 0.2 and 10.3 6 0.6 mM, respectively. All experiments were carried out at 25˚C with a flow rate of 20 ml/min on a CM5-Chip. A reference cell was used to subtract refractive index changes and nonspecific binding. Data were fitted to a standard 1:1 interaction model and normalized to allow comparison with other data. 4510 MHC I PROOFREADING

Table III. SPR interaction analysis of Tsn-ERp57 and HLA-B*44 alleles

B*44:02pd (mM) B*44:02pep (mM) B*44:05pd (mM) B*44:05pep (mM) Tsn-ERp57 0.31 6 0.02 1.8 6 0.2 1.3 6 0.2 10.3 6 0.6 Tn6-ERp57 .40 .40 ND ND

Discussion editing and proofreading mediated by Tsn within the PLC could Various studies have tried to identify the mechanism by which Tsn not be fully elucidated. By tethering biotinylated components of promotes peptide loading of MHC I molecules (12, 13, 20, 23, 24, the PLC to a NeutrAvidin dimer, we have established a defined 56). These studies have led to different interpretations. Unex- platform to study the transient interaction between Tsn and pectedly, peptides had a lower affinity for HLA-B*08:01 in the B*44:02, thus mimicking the structural organization of the presence of Tsn than in its absence (57). A facilitator function MHC I/Tsn-ERp57 complex at the ER membrane. By using for Tsn was therefore proposed. Intriguingly and in contrast with a set of peptides with affinities ranging from high to medium the previous study, the same affinities were found in Tsn- and low (6–844 nM), we were able to analyze the function of negative cells expressing HLA-B*27:05 or A*02:01 (7, 12). In Tsn in peptide editing. In the absence and presence of Tsn, both systems, the MHC I–peptide complexes expressed at the peptide dissociation followed monoexponential kinetics, which cell surface were much more stable and the peptide repertoire is in contrast with other studies, where dissociation kinetics was evidently altered in the presence of Tsn. were biphasic (23, 58). In these studies, the authors proposed Downloaded from Attempts to elucidate the function of Tsn were hampered by that b2m first dissociates from MHC I followed by the peptide the fact that the direct interaction between MHC and Tsn could (58). Because b2m was covalently linked to the B*44:02 H not be analyzed so far. Thus, the mechanistic basis of peptide chain in this study, its dissociation was prevented. http://www.jimmunol.org/ by guest on September 24, 2021 FIGURE 6. MD simulations of Tsn/B*44:02 complex formation and differential binding of Tsn to B*44:02pep/pd.(A) Structure of the complex. Colors as in Fig. 1; the B*44:02 222–229 stretch and the a2-1 helix fragment are colored in purple. (B) N-terminal interface. Distances d1 and d2 indicate F-pocket width. (C) C-terminal interface. (D)Buried Tsn/B*44:02 surface. Upper panel, 1.0-msMDsimulationofcomplex formation. N- and C-terminal interfaces are shown. Lower panel,Evo- lution of the N- and C-terminal interfaces in Tsn/B*44:02pep/pd.(E) Occupancies of the most prevalent contacts between Tsn and B*44:02pep as well as B*44:02pd residues. Oc- cupancy is the fraction of total simulation time that any pair of atoms in the two residues is within a 3.5-A˚ cutoff. The Journal of Immunology 4511

much stronger than the peptide-loaded complex because of competition of Tsn and peptide for binding to MHC I. Using SPR, we show that Tsn stabilizes peptide-free MHC I relative to the peptide-bound form by DDG=28 kJ/mol (Fig. 7). This explains the observed accelerated exchange kinetics, which are essential for efficient sampling of high-affinity epitopes. Accordingly, in the presence of Tsn, peptide loading is shifted from kinetic control toward the thermodynamically controlled regime, hence increas- ing the probability of binding of a high-affinity peptide against a background of many competing low-affinity peptides during the transit time of typical class I molecules through the ER. The mechanism derived from the kinetic and thermodynamic data of this study agrees with phenomenological kinetic network modeling (59); the kinetic network model, however, could not take the quantitative stabilization of the peptide-free intermediate into account. The mechanism of how Tsn acts on MHC I–peptide binding involves differential binding of Tsn to MHC I depending on its

peptide-loading status. Our MD simulations provide detailed Downloaded from atomic-level insights into this intricate mechanism: Tsn interacts with the a2-1 helix of MHC I and its supporting b-strands (Fig. 6B), which are part of the peptide-binding groove. Tsn and the Ag peptide thus act on the groove as the two players of a molecular tug-of-war mechanism: a high-afﬁnity peptide will

succeed in tightly closing the binding groove, whereas the absence http://www.jimmunol.org/ of peptide or the binding of a low-affinity peptide widens the FIGURE 7. Working cycle of epitope proofreading. Suboptimally groove. This facilitates the release of suboptimal peptides, thus loaded MHC I binds to Tsn with high affinity (step 1). In the absence of generating peptide-deficient MHC I with high affinity for Tsn Tsn, peptide dissociation can lead to partial unfolding of the binding (Fig. 7). In contrast, MHC I molecules loaded with high-affinity groove (step 2). Tsn accelerates peptide exchange by widening the peptides display a very tight peptide binding groove, thereby binding groove, while also stabilizing peptide-free MHC I (step 3). Upon binding of a high-affinity peptide (step 4), forces exerted by the peptide interacting with Tsn at low affinity and priming the PLC for to tighten the binding groove dominate over the outward pulling by Tsn dissociation. to widen the groove. Thus, MHC I affinity for Tsn is lowered, priming In this study, we investigated the peptide loading of B*44:02, the PLC for dissociation (step 5). which shows the strongest dependency on Tsn. However, care by guest on September 24, 2021 must be taken when extrapolating results to other MHC I molecules, which are less affected by Tsn. Taking published data (50, Tsn increased the dissociation rate of low- and medium-affinity 60, 61) into account, we propose a model for the working cycle of peptides up to 10-fold, whereas the Tn6 mutant, which has a mu- Tsn (Fig. 7). Tsn monitors the quality of bound peptides (subop- tated Tsn/MHC I interface and is therefore inactive in peptide timal versus optimal epitopes) by acting on the MHC I binding loading (3), has no impact on the dissociation rate of subopti- groove. Upon engagement of MHC I with Tsn, suboptimal pep- mal peptides, proving the accuracy of the interaction analysis tides are displaced, and the peptide repertoire of MHC I is edited (Supplemental Fig. 3). We further demonstrate that Tsn-ERp57 in favor of high-affinity peptides. Based on this working cycle, significantly accelerates peptide exchange of suboptimal for op- only kinetically stable peptide–MHC complexes reach the cell timal, high-affinity peptides. In the absence of Tsn-ERp57, ex- surface, which is crucial for a prolonged CD8+ T cell–mediated change of suboptimal peptides by high-affinity ones is extremely immune response against tumors and intracellular pathogens. slow, although thermodynamically favored. However, in the presence of Tsn-ERp57, the peptide exchange rate was drastically Acknowledgments increased in favor of the high-affinity peptide. To demonstrate We thank Tim Elliott (University of Southampton) for the B*44:02 cDNA, peptide editing in real time, we made use of MHC I complexes Ute Claus for technical support, and Alain Townsend (University of Ox- preloaded with a photocleavable, high-affinity peptide. This epi- ford) for help in generating the cell line expressing the soluble, single- tope bound to B*44:02 cannot be displaced by another high- chain HLA-B*4402. affinity peptide, neither in the absence nor in the presence of Tsn. Upon photoconversion of the high-affinity into the low- Disclosures affinity cargo, peptide exchange is synchronized and signifi- The authors have no financial conflicts of interest. cantly accelerated by Tsn. To the best of our knowledge, our study determines for the first time in atomic detail the interaction between MHC I and Tsn and References provides direct evidence for a differential binding of Tsn to peptide- 1. Blum, J. S., P. A. Wearsch, and P. Cresswell. 2013. Pathways of antigen pro- loaded and -deficient MHC I, which is key for understanding the cessing. Annu. Rev. Immunol. 31: 443–473. observed acceleration of the peptide exchange reaction. Peptide 2. Hulpke, S., and R. Tampe´. 2013. The MHC I loading complex: a multitasking machinery in adaptive immunity. Trends Biochem. Sci. 38: 412–420. exchange proceeds via the peptide-free form of MHC I as a high- 3. Dong, G., P. A. Wearsch, D. R. Peaper, P. Cresswell, and K. M. Reinisch. 2009. energy intermediate that crucially determines the energy barrier Insights into MHC class I peptide loading from the structure of the tapasin- ERp57 thiol oxidoreductase heterodimer. Immunity 30: 21–32. (and thus the rate) of the process (Fig. 7). Tsn monitors the quality 4. Madden, D. R. 1995. The three-dimensional structure of peptide-MHC com- of peptide–MHC I complexes and binds peptide-deficient MHC I plexes. Annu. Rev. Immunol. 13: 587–622. 4512 MHC I PROOFREADING

5. Sadasivan, B., P. J. Lehner, B. Ortmann, T. Spies, and P. Cresswell. 1996. Roles 31. Hulpke, S., M. Tomioka, E. Kremmer, K. Ueda, R. Abele, and R. Tampe´. 2012. for calreticulin and a novel glycoprotein, tapasin, in the interaction of MHC class Direct evidence that the N-terminal extensions of the TAP complex act as au- I molecules with TAP. Immunity 5: 103–114. tonomous interaction scaffolds for the assembly of the MHC I peptide-loading 6.Myers,N.B.,M.R.Harris,J.M.Connolly,L.Lybarger,Y.Y.Yu,and complex. Cell. Mol. Life Sci. 69: 3317–3327. T. H. Hansen. 2000. Kb,Kd,andLd molecules share common tapasin de- 32. Stam, N. J., T. M. Vroom, P. J. Peters, E. B. Pastoors, and H. L. Ploegh. 1990. pendencies as determined using a novel epitope tag. J. Immunol. 165: 5656– HLA-A- and HLA-B-specific monoclonal antibodies reactive with free heavy 5663. chains in western blots, in formalin-fixed, paraffin-embedded tissue sections and 7. Purcell, A. W., J. J. Gorman, M. Garcia-Peydro´, A. Paradela, S. R. Burrows, in cryo-immuno-electron microscopy. Int. Immunol. 2: 113–125. G. H. Talbo, N. Laham, C. A. Peh, E. C. Reynolds, J. A. Lo´pez De Castro, and 33. Pronk, S., S. Pa´ll, R. Schulz, P. Larsson, P. Bjelkmar, R. Apostolov, M. R. Shirts, J. McCluskey. 2001. Quantitative and qualitative influences of tapasin on the J. C. Smith, P. M. Kasson, D. van der Spoel, et al. 2013. GROMACS 4.5: a high- class I peptide repertoire. J. Immunol. 166: 1016–1027. throughput and highly parallel open source molecular simulation toolkit. Bio- 8. Grandea, A. G., III, T. N. Golovina, S. E. Hamilton, V. Sriram, T. Spies, informatics 29: 845–854. R. R. Brutkiewicz, J. T. Harty, L. C. Eisenlohr, and L. Van Kaer. 2000. Impaired 34. Lindorff-Larsen, K., S. Piana, K. Palmo, P. Maragakis, J. L. Klepeis, R. O. Dror, assembly yet normal trafficking of MHC class I molecules in Tapasin mutant and D. E. Shaw. 2010. Improved side-chain torsion potentials for the Amber mice. Immunity 13: 213–222. ff99SB protein force field. Proteins 78: 1950–1958. 9. Garbi, N., P. Tan, A. D. Diehl, B. J. Chambers, H. G. Ljunggren, F. Momburg, 35. Hornak, V., R. Abel, A. Okur, B. Strockbine, A. Roitberg, and C. Simmerling. and G. J. Ha¨mmerling. 2000. Impaired immune responses and altered peptide 2006. Comparison of multiple Amber force fields and development of improved repertoire in tapasin-deficient mice. Nat. Immunol. 1: 234–238. protein backbone parameters. Proteins 65: 712–725. 10. Lehner, P. J., M. J. Surman, and P. Cresswell. 1998. Soluble tapasin restores 36. Jorgensen, W. L., J. Chandrasekhar, J. D. Madura, R. W. Impey, and M. L. Klein. MHC class I expression and function in the tapasin-negative cell line .220. 1983. Comparison of simple potential functions for simulating liquid water. J. Immunity 8: 221–231. Chem. Phys. 79: 926–935. 11. Peaper, D. R., P. A. Wearsch, and P. Cresswell. 2005. Tapasin and ERp57 form 37. Miyamoto, S., and P. A. Kollman. 1992. Settle - an Analytical Version of the a stable disulfide-linked dimer within the MHC class I peptide-loading complex. Shake and Rattle Algorithm for Rigid Water Models. J. Comput. Chem. 13: 952– EMBO J. 24: 3613–3623. 962. 12. Williams, A. P., C. A. Peh, A. W. Purcell, J. McCluskey, and T. Elliott. 2002. 38. Hess, B. 2008. P-LINCS: a parallel linear constraint solver for molecular sim- Optimization of the MHC class I peptide cargo is dependent on tapasin. Im- ulation. J. Chem. Theory Comput. 4: 116–122. Downloaded from munity 16: 509–520. 39. Feenstra, K. A., B. Hess, and H. J. C. Berendsen. 1999. Improving efficiency of 13. Wearsch, P. A., and P. Cresswell. 2007. Selective loading of high-affinity pep- large time-scale molecular dynamics simulations of hydrogen-rich systems. J. tides onto major histocompatibility complex class I molecules by the tapasin- Comput. Chem. 20: 786–798. ERp57 heterodimer. Nat. Immunol. 8: 873–881. 40. Pa´ll, S., and B. Hess. 2013. A flexible algorithm for calculating pair interactions 14. Ortmann, B., J. Copeman, P. J. Lehner, B. Sadasivan, J. A. Herberg, on SIMD architectures. Comput. Phys. Commun. 184: 2641–2650. A. G. Grandea, S. R. Riddell, R. Tampe´, T. Spies, J. Trowsdale, and P. Cresswell. 41. Essmann, U., L. Perera, M. L. Berkowitz, T. Darden, H. Lee, and 1997. A critical role for tapasin in the assembly and function of multimeric MHC L. G. Pedersen. 1995. A Smooth Particle Mesh Ewald Method. J. Chem. Phys.

class I-TAP complexes. Science 277: 1306–1309. 103: 8577–8593. http://www.jimmunol.org/ 15. Li, S., H. O. Sjo¨gren, U. Hellman, R. F. Pettersson, and P. Wang. 1997. Cloning 42. Bussi, G., D. Donadio, and M. Parrinello. 2007. Canonical sampling through and functional characterization of a subunit of the transporter associated with velocity rescaling. J. Chem. Phys. 126: 014101. antigen processing. Proc. Natl. Acad. Sci. USA 94: 8708–8713. 43. Berendsen, H. J. C., J. P. M. Postma, W. F. Vangunsteren, A. Dinola, and 16.Yu,Y.Y.,H.R.Turnquist,N.B.Myers,G.K.Balendiran,T.H.Hansen,and J. R. Haak. 1984. Molecular-dynamics with coupling to an external bath. J. J. C. Solheim. 1999. An extensive region of an MHC class I alpha 2 domain Chem. Phys. 81: 3684–3690. loop influences interaction with the assembly complex. J. Immunol. 163: 44. Macdonald, W., D. S. Williams, C. S. Clements, J. J. Gorman, L. Kjer-Nielsen, 4427–4433. A. G. Brooks, J. McCluskey, J. Rossjohn, and A. W. Purcell. 2002. Identification 17. Lewis, J. W., A. Neisig, J. Neefjes, and T. Elliott. 1996. Point mutations in the of a dominant self-ligand bound to three HLA B44 alleles and the preliminary alpha 2 domain of HLA-A2.1 define a functionally relevant interaction with TAP. crystallographic analysis of recombinant forms of each complex. FEBS Lett. Curr. Biol. 6: 873–883. 527: 27–32. 18. Peace-Brewer, A. L., L. G. Tussey, M. Matsui, G. Li, D. G. Quinn, and 45. Eswar, N., B. Webb, M. A. Marti-Renom, M. S. Madhusudhan, D. Eramian, M.-

J. A. Frelinger. 1996. A point mutation in HLA-A*0201 results in failure to bind Y. Shen, U. Pieper, and A. Sali. 2006. Comparative protein structure modeling by guest on September 24, 2021 the TAP complex and to present virus-derived peptides to CTL. Immunity 4: using Modeller. Curr. Protoc. Bioinformatics. 5: Unit 5.6. doi:10.1002/ 505–514. 0471250953.bi0506s15 19. Paquet, M. E., and D. B. Williams. 2002. Mutant MHC class I molecules define 46. Geironson, L., C. Thuring, M. Harndahl, M. Rasmussen, S. Buus, G. Røder, and interactions between components of the peptide-loading complex. Int. Immunol. K. M. Paulsson. 2013. Tapasin facilitation of natural HLA-A and -B allomorphs 14: 347–358. is strongly influenced by peptide length, depends on stability, and separates 20. Rizvi, S. M., N. Salam, J. Geng, Y. Qi, J. H. Bream, P. Duggal, S. K. Hussain, closely related allomorphs. J. Immunol. 191: 3939–3947. J. Martinson, S. M. Wolinsky, M. Carrington, and M. Raghavan. 2014. Distinct 47. Macdonald, W. A., A. W. Purcell, N. A. Mifsud, L. K. Ely, D. S. Williams, assembly profiles of HLA-B molecules. J. Immunol. 192: 4967–4976. L. Chang, J. J. Gorman, C. S. Clements, L. Kjer-Nielsen, D. M. Koelle, et al. 21. van Hateren, A., A. Bailey, J. M. Werner, and T. Elliott. 2015. Plasticity of empty 2003. A naturally selected dimorphism within the HLA-B44 supertype alters major histocompatibility complex class I molecules determines peptide-selector class I structure, peptide repertoire, and T cell recognition. J. Exp. Med. 198: function. Mol. Immunol. doi: 10.1016/j.molimm.2015.03.010. 679–691. 22. Peh, C. A., S. R. Burrows, M. Barnden, R. Khanna, P. Cresswell, D. J. Moss, and 48. DiBrino, M., K. C. Parker, D. H. Margulies, J. Shiloach, R. V. Turner, J. McCluskey. 1998. HLA-B27-restricted antigen presentation in the absence of W. E. Biddison, and J. E. Coligan. 1995. Identification of the peptide binding tapasin reveals polymorphism in mechanisms of HLA class I peptide loading. motif for HLA-B44, one of the most common HLA-B alleles in the Caucasian Immunity 8: 531–542. population. Biochemistry 34: 10130–10138. 23. Chen, M., and M. Bouvier. 2007. Analysis of interactions in a tapasin/class I 49. Thammavongsa, V., G. Raghuraman, T. M. Filzen, K. L. Collins, and complex provides a mechanism for peptide selection. EMBO J. 26: 1681– M. Raghavan. 2006. HLA-B44 polymorphisms at position 116 of the heavy 1690. chain influence TAP complex binding via an effect on peptide occupancy. J. 24. Praveen, P. V., R. Yaneva, H. Kalbacher, and S. Springer. 2010. Tapasin edits Immunol. 177: 3150–3161. peptides on MHC class I molecules by accelerating peptide exchange. Eur. J. 50. Sieker, F., T. P. Straatsma, S. Springer, and M. Zacharias. 2008. Differential Immunol. 40: 214–224. tapasin dependence of MHC class I molecules correlates with conformational 25. Springer, S. 2015. Transport and quality control of MHC class I molecules in the changes upon peptide dissociation: a molecular dynamics simulation study. Mol. early secretory pathway. Curr. Opin. Immunol. 34: 83–90. Immunol. 45: 3714–3722. 26. Schimanski, L. M., H. Drakesmith, E. Sweetland, J. Bastin, D. Rezgui, 51. Elliott, T. 1997. How does TAP associate with MHC class I molecules? Immunol. M. Edelmann, B. Kessler, A. T. Merryweather-Clarke, K. J. Robson, and Today 18: 375–379. A. R. Townsend. 2009. In vitro binding of HFE to the cation-independent 52.Turnquist,H.R.,S.E.Vargas,A.J.Reber,M.M.McIlhaney,S.Li,P.Wang, mannose-6 phosphate receptor. Blood Cells Mol. Dis. 43: 180–193. S. D. Sanderson, B. Gubler, P. van Endert, and J. C. Solheim. 2001. A region 27. Yee, J. K., A. Miyanohara, P. LaPorte, K. Bouic, J. C. Burns, and T. Friedmann. of tapasin that affects L(d) binding and assembly. J. Immunol. 167: 4443– 1994. A general method for the generation of high-titer, pantropic retroviral 4449. vectors: highly efficient infection of primary hepatocytes. Proc. Natl. Acad. Sci. 53. Turnquist, H. R., S. E. Vargas, E. L. Schenk, M. M. McIlhaney, A. J. Reber, and USA 91: 9564–9568. J. C. Solheim. 2002. The interface between tapasin and MHC class I: identifi- 28. Howarth, M., and A. Y. Ting. 2008. Imaging proteins in live mammalian cells cation of amino acid residues in both proteins that influence their interaction. with biotin ligase and monovalent streptavidin. Nat. Protoc. 3: 534–545. Immunol. Res. 25: 261–269. 29. Gakamsky, D. M., D. M. Davis, J. L. Strominger, and I. Pecht. 2000. Assembly 54. Turnquist, H. R., J. L. Petersen, S. E. Vargas, M. M. McIlhaney, E. Bedows, and dissociation of human leukocyte antigen (HLA)-A2 studied by real-time W. E. Mayer, A. G. Grandea, III, L. Van Kaer, and J. C. Solheim. 2004. The Ig- fluorescence resonance energy transfer. Biochemistry 39: 11163–11169. like domain of tapasin influences intermolecular interactions. J. Immunol. 172: 30. van der Burg, S. H., E. Ras, J. W. Drijfhout, W. E. Benckhuijsen, A. J. Bremers, 2976–2984. C. J. Melief, and W. M. Kast. 1995. An HLA class I peptide-binding assay based 55. Simone, L. C., C. J. Georgesen, P. D. Simone, X. Wang, and J. C. Solheim. 2012. on competition for binding to class I molecules on intact human B cells. Iden- Productive association between MHC class I and tapasin requires the tapasin tification of conserved HIV-1 polymerase peptides binding to HLA-A*0301. transmembrane/cytosolic region and the tapasin C-terminal Ig-like domain. Mol. Hum. Immunol. 44: 189–198. Immunol. 49: 628–639. The Journal of Immunology 4513

56. Howarth, M., A. Williams, A. B. Tolstrup, and T. Elliott. 2004. Tapasin enhances 59. Schneeweiss, C., M. Garstka, J. Smith, M. T. Hutt,€ and S. Springer. 2009. The MHC class I peptide presentation according to peptide half-life. Proc. Natl. mechanism of action of tapasin in the peptide exchange on MHC class I mol- Acad. Sci. USA 101: 11737–11742. ecules determined from kinetics simulation studies. Mol. Immunol. 46: 2054– 57. Zarling, A. L., C. J. Luckey, J. A. Marto, F. M. White, C. J. Brame, A. M. Evans, 2063. P. J. Lehner, P. Cresswell, J. Shabanowitz, D. F. Hunt, and V. H. Engelhard. 2003. 60. Wright, C. A., P. Kozik, M. Zacharias, and S. Springer. 2004. Tapasin and other Tapasin is a facilitator, not an editor, of class I MHC peptide binding. J. chaperones: models of the MHC class I loading complex. Biol. Chem. 385: 763– Immunol. 171: 5287–5295. 778. 58. Binz, A. K., R. C. Rodriguez, W. E. Biddison, and B. M. Baker. 2003. Ther- 61. Garstka, M. A., S. Fritzsche, I. Lenart, Z. Hein, G. Jankevicius, L. H. Boyle, modynamic and kinetic analysis of a peptide-class I MHC interaction highlights T. Elliott, J. Trowsdale, A. N. Antoniou, M. Zacharias, and S. Springer. 2011. the noncovalent nature and conformational dynamics of the class I heterotrimer. Tapasin dependence of major histocompatibility complex class I molecules Biochemistry 42: 4954–4961. correlates with their conformational ﬂexibility. FASEB J. 25: 3989–3998. Downloaded from http://www.jimmunol.org/ by guest on September 24, 2021