RNA Splicing in the Transition from B Cells to Antibody-Secreting Cells

RNA Splicing in the Transition from B Cells to Antibody-Secreting Cells: The Influences of ELL2, Small Nuclear RNA, and Endoplasmic Reticulum Stress This information is current as of September 29, 2021. Ashley M. Nelson, Nolan T. Carew, Sage M. Smith and Christine Milcarek J Immunol published online 8 October 2018 http://www.jimmunol.org/content/early/2018/10/05/jimmun ol.1800557 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2018/10/05/jimmunol.180055

Material 7.DCSupplemental http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 29, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2018 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published October 8, 2018, doi:10.4049/jimmunol.1800557 The Journal of Immunology

RNA Splicing in the Transition from B Cells to Antibody-Secreting Cells: The Inﬂuences of ELL2, Small Nuclear RNA, and Endoplasmic Reticulum Stress

Ashley M. Nelson, Nolan T. Carew, Sage M. Smith, and Christine Milcarek

In the transition from B cells to Ab-secreting cells (ASCs) many genes are induced, such as ELL2, Irf4, Prdm1, Xbp1, whereas other mRNAs do not change in abundance. Nonetheless, using splicing array technology and mouse splenic B cells plus or minus LPS, we found that induced and “uninduced” genes can show large differences in splicing patterns between the cell stages, which could influence ASC development. We found that ∼55% of these splicing changes depend on ELL2, a transcription elongation factor that influences expression levels and splicing patterns of ASC signature genes, genes in the cell-cycle and N-glycan biosynthesis and processing pathways, and the secretory versus membrane forms of the IgH mRNA. Some of these changes occur when ELL2 Downloaded from binds directly to the genes encoding those mRNAs, whereas some of the changes are indirect. To attempt to account for the changes that occur in RNA splicing before or without ELL2 induction, we examined the amount of the small nuclear RNA molecules and found that they were significantly decreased within 18 h of LPS stimulation and stayed low until 72 h. Correlating with this, at 18 h after LPS, endoplasmic reticulum stress and Ire1 phosphorylation are induced. Inhibiting the regulated Ire1- dependent mRNA decay with 4u8C correlates with the reduction in small nuclear RNA and changes in the normal splicing patterns at 18 h. Thus, we conclude that the RNA splicing patterns in ASCs are shaped early by endoplasmic reticulum stress and http://www.jimmunol.org/ Ire1 phosphorylation and later by ELL2 induction. The Journal of Immunology, 2018, 201: 000–000.

he majority of multiexon containing mammalian genes to become ASCs (3). Thus far, RNA processing reactions have are alternatively spliced, thereby producing on average been implicated only in a small number of the changes seen in the T four to five differently spliced products (1) with a large differentiation to Ab secretion but are expected to play significant variation in proteins expressed (2). Alternative mRNA isoforms roles in others. play important roles in normal development and physiology. Yet Extensive work from our laboratory (4) and that of others (5, 6) little is known beyond the IgH gene itself and the U1A small has shown that alternative 59 donor and 39 acceptor splice sites nuclear RNA (snRNA) protein expression about the overall in the IgH m gene are used in B cells, whereas in ASCs, the weak by guest on September 29, 2021 landscape of alternative splicing and its effect on the path from 59 splice site embedded in IgH m CH4 is ignored to make secreted B cells to Ab-secreting cells (ASCs). Upon stimulation by Ag, IgH m mRNA and protein. Concomitantly there is a 10–100 fold cytokines, or LPS, naive B cells drastically alter gene expression increase in abundance of that mRNA over B cells because the RNA polymerase II (RNAPII) more efficiently transits the IgH m gene and allows better recognition of the secretory-specific poly Department of Immunology, University of Pittsburgh, Pittsburgh, PA 15261 (A) site while engaging the highly induced transcription elonga- ORCIDs: 0000-0002-3321-1694 (A.M.N.); 0000-0002-6995-6823 (N.T.C.); 0000- tion factor ELL2 (11–19 lysine-rich leukemia gene), an important 0002-3937-6828 (C.M.). part of the super elongation complex (7–11). This led us to ask if Received for publication April 24, 2018. Accepted for publication September 7, ELL2 could influence the splicing of genes other than IgH in the 2018. B cell to ASC transition. This work was supported by AI124241 from the National Institutes of Health Meanwhile, we had also found a significant decrease in the National Institute of Allergy and Infectious Diseases to C.M. and shared resources Grant P30CA047904 to the University of Pittsburgh Cancer Institute. amount of snRNA protein–associated U1A following stimulation to produce ASCs (12). This observation led us to ask if there were A.M.N., N.T.C., S.M.S., and C.M. performed the experiments and analyzed the data as well as helped write the manuscript and Materials and Methods.C.M. changes in the snRNAs that might also be involved in altering designed and supervised the study and wrote the manuscript with the assistance splicing when B cells differentiate into ASCs. Previous studies of the coauthors. show that snRNAs could change splicing patterns, including The microarray data presented in this article have been submitted to the Gene Expres- during Drosophila development (13), in Alzheimer disease where sion Omnibus under accession numbers GSE 113317, GSE113475, and GSE114435. the changed levels of U1 snRNA lead to altered RNA processing Address correspondence and reprint requests to Dr. Christine Milcarek, Department of Immunology, University of Pittsburgh, Room E1059 Biomedical Science Tower, Ter- of several mRNAs (14), and in human diseases such as hema- race and Lothrop Streets, Pittsburgh, PA 15261. E-mail address: [email protected] tolymphoid neoplasia, retinitis pigmentosa, and microcephalic The online version of this article contains supplemental material. osteodysplastic primordial dwarfism type 1 associated with a loss Abbreviations used in this article: ASC, Ab-secreting cell; ChIP, chromatin immu- of U4atac snRNA (15). noprecipitation; ChIP-seq, ChIP sequencing; cKO, conditional knockout; ER, endo- When B cells are stimulated to secrete Ab, the primary pathway plasmic reticulum; GEO, Gene Expression Omnibus; Ire1, inositol-requiring enzyme 1 a; NCBI, National Center for Biotechnology Information; QPCR, quantitative for endoplasmic reticulum (ER) remodeling (also called the un- PCR; RIDD, regulated Ire1-dependent mRNA decay; RNAPII, RNA polymerase folded protein response; UPR) appears to uniquely include only the II; snRNA, small nuclear RNA; TAC, Transcriptome Analysis Console; UPR, un- phosphorylation of inositol-requiring enzyme 1 a (Ire1) (16, 17) folded protein response; UTR, untranslated region. but not the Perk or Atf6 pathways seen in other cells. We had Copyright Ó 2018 by The American Association of Immunologists, Inc. 0022-1767/18/$37.50 previously shown that mouse splenic B cells deficient in ELL2 are

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1800557 2 SPLICING CHANGES IN TRANSITION TO ASCs unable to secrete Ig after LPS stimulation but still maintain Ire1 Chromatin immunoprecipitation sequencing and chromatin phosphorylation, an ER stress sensor (9). Interestingly, the phos- immunoprecipitation quantitative PCR phorylation of Ire1 occurs even when IgH m secretion is rendered Chromatin immunoprecipitation (ChIP) sequencing (ChIP-seq) arrays were moot by mutations in the IgH m gene itself and in the activation- performed by Active Motif (Carlsbad, CA). DNA was prepared for ampli- induced cytidine deaminase AID/Aicda gene to prevent subclass fication by converting overhangs into phosphorylated blunt ends and adding switching (18). Therefore, much of the ER stress that occurs in an adenine to the 39 ends. Illumina genomic adapters were ligated, and the B cell activation precedes Ig secretion. The phosphorylation of sample was size fractionated (200–300 bp) on an agarose gel. After a final PCR amplification step (18 cycles), the resulting DNA libraries were Ire1 results in acquisition of a regulated Ire1-dependent mRNA quantified and sequenced on HiSeq 2000. Sequences (50 nt reads, single end) decay (RIDD) (19, 20). We wondered if this pathway could play a were aligned to the mouse genome (mm10) using the Burrows–Wheeler role in the stark transcriptional divide between B cells and ASCs algorithm. Alignments were extended in silico at their 39 ends to a length of and influence splicing patterns in some way. 150 bp. Active Motif used their proprietary software to analyze the data. More than 17 million reads were obtained, and peaks were called using the In this study, we analyzed the changes in splicing between MACS (v.1.4.2) algorithm, with a cutoff p value of p =0.00005.Readswere resting primary splenic mouse B cells and their resultant LPS- aligned to the mouse genome (mm10) and visualized in the Integrated stimulated ASCs. We sought to understand the forces which Genome Browser (University of California, Santa Cruz, Santa Cruz, CA). could alter the splicing patterns. We compared splicing patterns in The anti-ELL2 mouse polyclonal anti-peptide Ab 4502 (10) was used in B cell conditional knockouts (cKOs) of ELL2 with ELL2-positive triplicate for the positive signal and compared with a control nonspecific rabbit Ab with the AxJ mouse plasma cell line (IgG2a, k, l)wehavestudied litter mates and found that some, but not all, of the changes in extensively (7). The AxJ cells were verified by sequencing the H chain alternative splicing were altered by eliminating that induced V region. Confirmation of a portion of the ChIP-seq data were performed elongation factor. We explored what else might be responsible for with conventional ChIPs as previously described (9), using the quantitative Downloaded from the altered splicing. We found that the levels of all the classical and PCR (QPCR) probes in the list of primers in Supplemental Table I. noncanonical (AT/AC) RNAPII transcribed snRNAs were reduced IRE1 inhibitor treatments following LPS stimulation. Eliminating the RIDD activity of Ire1 Primary splenic B cells were treated with Ire1 ribonuclease inhibitor 4m8c changed snRNA levels and changed splicing patterns. Overall, ER (Sigma-Aldrich) at a concentration of 5 mM(21)inDMSOinthepresence stress and ELL2 induction contribute to the changes seen in RNA of LPS, as described above. Samples were taken at 0, 6, 18, and 24 h. The splicing in the development of ASCs. 18-h samples were used for the array and western data. Control cells were http://www.jimmunol.org/ treated with equivalent amount of DMSO and taken at the same time points. Materials and Methods RNA isolation and quantitative RT-QPCR Affymetrix Clariom D RNA microarray and analysis RNAwas isolated from cells using the RNeasy Mini Kit (no. 74106; Qiagen) RNA samples from at least three independent biological samples were or Macherey-Nagel NucleoSpin RNA/Protein kit (Cat. no. 740933). RNA was copied using SuperScript First-Strand Synthesis for RT-QPCR fol- obtained as described below and sent to the University of Pittsburgh Ge- lowing the random oligonucleotide procedure (no. 11904-018; Invitrogen). nomics Research Core, where the Affymetrix array was performed. Analysis of the data was performed using Transcriptome Analysis Console Quantification by QPCR was performed using Sybr Green PCR Master (TAC) software from Affymetrix. Samples were analyzed using default Mix (no. 4909155; Applied Biosystems) along with the identified primers parameters. An alternative splicing event was defined as a differentially (Supplemental Table I). The instrument used was a StepOnePlus Real-time by guest on September 29, 2021 expressed exon with at least a 2-fold change in expression, at a p value of QPCR System from Applied Biosystems. The cycle quantification time values were normalized as log fold change relative Hprt as a constant, and p = 0.05 or better. The TAC software was set to identify the change in exon GraphPad Prism 7 software was used for graphing and statistical analyses. expression as one of the five classifications for alternative splicing based B cell and Go values were normalized to 100. on the expression patterns of the surrounding exons. For gene enrichment analysis, gene lists were submitted to the ConsensusPathDB Web site developed by the Max Planck Institute for Molecular Genetics. Overrep- Statistics resentation analysis returned pathway-based set results. The most enriched Data are shown with SEM error bars, and significance is calculated using pathways were grouped and tabulated. GraphPad Prism 7 software with a two-way ANOVA such that *p , 0.05, **p , 0.01, ***p , 0.001, and ****p , 0.0001. Experiments in Figs. 1B, Mice 2A, 2C, 4B, 5, and 6 were performed at least three times with at least three independent biological samples. We used Hprt, Gapdh, and Actb mRNAs The derivation and characterization of the ELL2 loxp/loxp exon3 mice as internal controls; the level of Hprt mRNA was previously shown to crossed with the C57BL/6 CD19cre mice (no. 006785; The Jackson remain constant through LPS stimulation of B cells (22, 23). Laboratory) to inhibit Ig secretion was described previously (9). Naive splenic B cells were extracted from those mice that had been crossed with Western blotting either CD19+/+ (designated wild type littermates) or CD19+/cre (exhibiting a cKO of exon 3 in the ELL2 gene). Deletion of the exon 3 of ELL2 in cre+ Protein samples were obtained from whole cell extracts that were sonicated mice in LPS-stimulated B cells and reduction in IgH secretory mRNA were briefly to reduce viscosity. Western protocol from the Bio-Rad Laboratories verified by a real-time PCR assay with the DNA and mRNA, respectively. General Protocol (Bulletin 6376 Rev A) was followed. Molecular weight All mice were maintained at the University of Pittsburgh animal facilities, markers were the Precision Protein Kaleidoscope markers from Bio-Rad Lab- and experiments were undertaken and conducted in accordance with in- oratories (no. 161-0375). Bio-Rad Laboratories Mini-PROTEAN precast gels stitutional policies as per Animal Welfare Assurance number A3187-01. were used. Abs used include anti-Ire1 Abcam no. 37073, anti-Ire1ser724P from The ELL2 exon 3 loxp/loxp mice have been deposited at The Jackson Thermo Fisher Scientific PA1-16927 (Invitrogen), anti-SnapC/43 kDa (k-16; Laboratory as stock no. 029528 and are available for unrestricted use. sc20241) goat polyclonal from Santa Cruz Biotechnology, and other primary and secondary Abs as previously described (9). B cell isolation and stimulation Availability of the data Naive splenic B cells were extracted from 6- to 20-wk-old ELL2 loxp/loxp exon 3 mice, with either CD19+/+ or CD19+/cre, and isolated using the The ChIP-seq and Affymetrix splicing array data have been deposited at the autoMACS system (no. 130-090-862; Miltenyi Biotec) as previously de- National Center for Biotechnology Information (NCBI) Gene Expression scribed (9). The cells were cultured in medium on day 0 at 5 3 106 cells/ml. Omnibus (GEO) (GSE 113317, GSE113475, and GSE114435) publicly The cells were counted via hemocytometer, split, and cultured at 1 3 106 available web sites. Affymetrix splicing array data accession no. GSE113317 cells/mlforupto72hwithLPSat20mg/ml in RPMI 1640 medium con- deposited on April 18, 2018, for plus or minus LPS 72 h and plus or minus taining 50 mM 2-ME, 2 mM glutamine, 10% FBS, 1 mM sodium pyruvate, ELL2 is viewable at https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi? nonessential amino acids, 13 penicillin/streptomycin, and 1 mM HEPES acc=GSE113317. Microarray data no. GSE 113475 for the 0 and 18 h buffer. CD138+ cells were isolated using CD138 MACS MicroBeads from LPS plus or minus 4u8C, deposited on April 21, 2018, is viewable at https:// Miltenyi Biotec (Cat. no 130-098-257) as per the manufacturer’s instructions. www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE113475. Raw data for The Journal of Immunology 3

ChIP-seq data (GSE114435) is deposited and viewable at https://www.ncbi. copy analyses for these, but the finding that these genes could be nlm.nih.gov/geo/query/acc.cgi?acc=GSE114435. The data for ChIP-seq are encoding alternative protein forms provides insight into the poten- associated with Fig. 4 and Supplemental Table II. Affymetrix splicing data tial importance of altered RNA splicing during the B cell to ASC are associated with Figs. 1–3 and 7 and Supplemental Table II. There are no restrictions on the availability of the datasets. transition. In the totality of mRNA coding genes that were expressed in both B cells and ASCs at 72 h, many have different splicing patterns that Results have not yet been shown to result in different protein isoforms. Major splicing changes occur when B cells become ASCs There are 9326 genes that show RNA splicing differences in the two Although it is well known that there are changes in the genes conditions, as summarized in Fig. 1C; note, some genes may have expressed between B cells and ASCs, we wanted to determine if several types of splicing alterations, so there are many more overall splicing changes were also occurring. We used splicing changes on summing the events than the total number of genes arrays and the TAC software from Affymetrix to answer this involved. The majority of genes with altered splicing show question. These arrays enable one to assess the differences in changes in a “Cassette Exon” event (6533), which denotes the overall expression levels as well as alternative splicing of individual inclusion or skipping of a single exon in an mRNA isoform. Be- mRNAs. First we validated the differentiation of our samples from cause there are 16,411 exons included or skipped in 6533 genes B cells into ASCs by 72 h of LPS stimulation by observing their where this happens, there are roughly 2.5 of these changes per increased IgH secretory mRNA, ELL2 mRNA production, and gene. This is a remarkable number of changes. Uses of alternative CD138 surface protein acquisition by QPCR and flow cytometry; 59 donor and 39 splice acceptor sites are the next most common these RNA changes in expression were also seen in the array data. alternative splicing events. Intron retention can occur as well, with Downloaded from In addition, in the data we obtained and deposited at the NCBI mutually exclusive exon usage occurring, but less frequently than GEO site, we noted that many key genes are induced to higher the rest (0.7%). The enormity of the changes we see in B cells expression levels in the transition after 72 h of LPS treatment to versus ASCs at 72 h after LPS indicates that the splicing landscape the ASCs, like Irf4, blimp1 (Prdm1) and the ASC “signature is significantly different between the two. genes” previously described (3). Meanwhile, many other genes do Loss of ELL2 changes gene expression levels in ASCs not change mRNA abundance; nonetheless, we noted that they http://www.jimmunol.org/ change their splicing patterns. We show the splicing tracks for Although numerous splicing changes that were heretofore unap- three such genes in which mRNA abundance does not change, but preciated could significantly impact the gene expression profile of splicing does (Fig. 1A); orange means that an exon is enriched in ASCs, we focused not on the consequence of all those changes but B cells, whereas blue means it is enriched in ASCs. The more rather on how these changes in the splicing milieu of the cells are intense the color the larger the enrichment. These genes have been brought about. Because transcription elongation rate and alterna- reported to have mRNA isoforms that can encode different pro- tive splicing had been previously linked (28), we first hypothesized teins based on the splicing alterations. For example, histone that based on its role as a transcription elongation factor, ELL2 deacetylase 9 (Hdac9), which is missing exon 7, is reported to be might have a significant role in changing the landscape of alter- retained in the cytoplasm, whereas proteins encoded by mRNA native splicing in ASCs. We examined global changes in mRNA by guest on September 29, 2021 with exon 7 (dark blue), enriched here in ASCs, are reported to levels that might accompany loss of ELL2. As shown in Fig. 2A, enter the nucleus to acetylate histones to activate gene transcrip- when the ELL2-sufficient splenic B cells were stimulated with tion (24). Polypyrimidine track binding protein 3 (Ptbp3) is an LPS for 72 h they produced 25-fold more of the secreted form of RNA binding protein that mediates precursor mRNA alternative Ig m H chain versus the membrane-specific form. Meanwhile, splicing. Exon 2 inclusion (seen here in orange), previously shown ELL2-deficient cells (cKO Fig. 2A) were impaired in the pro- to be enriched in B cells, is known to result in greater nuclear duction of the secretory specific form as we had previously shown localization and an extra RNA binding domain (25). As shown (9, 29). ELL2 induction is also impaired in the cKO cells. These in this article, forms without exon 2 are enriched in ASCs. were the samples used for our subsequent analyses. In data not MyD88, a universal adapter protein used by almost all TLRs shown, we found that ELL2 is not significantly induced until 24 to (except TLR 3) to transmit signals and activate the transcrip- 36 h after LPS treatment of B cells. tion factor NF-kB, has been shown to exist in a long form (with We assessed global expression after 72 h of LPS stimulation of the orange retained intron) that activates immunity, whereas the splenic B cells, and, as shown in Fig. 2B (upper left and right short form, without the intron, inhibits TLR signals and usually quadrants), in the plus versus minus ELL2, a large number of arises after LPS treatment (26, 27). We see these short forms genes (.1000) are altered in their abundance. The majority show after 72 h of LPS stimulation. Fig. 1B validates the splicing decreased levels in the absence of ELL2. Of these, 192 were V array differences by QPCR for MyD88. The array results for region genes for heavy or light Ig chains. A complete list of the several other genes were also validated by QPCR (data not 851 non–V regions induced by ELL2 is shown in Supplemental shown). Thus, changing splicing patterns can influence mRNA Table II whereas the complete data set is deposited at the NCBI function, and in the examples illustrated, the changed splicing GEO Web site. ELL2 induction therefore has a broad effect on patterns were shown to generate alternative forms of the pro- mRNA abundance in ASCs at 72 h post LPS. tein. We saw changes in the splicing patterns when comparing Among the genes whose mRNA abundances are increased when B cells to ASCs (plus LPS for 72 h) in other genes that have ELL2 is present, we concentrated first on 48 signature ASC genes previously been reported to be capable of producing different described as expressed at higher levels after all modes of stimu- isoforms of mRNA and protein. Among those genes in which lation to produce ASCs by Shi et al. (3); Irf4 and Prdm1 (blimp1) the splicing patterns are changed at least 3-fold after 72 h of are included for completion. As shown in Fig. 2C, a positive fold- LPS in our microarray studies (see GEO data) are the following: change value is shown for the majority of the signature genes Traf7, Zbtb20, DNAjb6 (hsp40), IL-2R g-chain, Ppp2r5c, Srsf1, indicating higher levels of expression in the ELL2+/+ than the Ikzf1, Cmip (c-maf), Elmo, Ugp2, Picalm, Tmem209, Hspa4 ELL2 cKO cells. There are just three exceptions. These data show (hsp70), Mapk1, Xiap, Eifak3, Cstf3, and Srpk2. We have not that ELL2 has a major impact on the expression of the signature pursued potential changes in protein expression by mass spectros- ASC genes, as well as Irf4 and Prdm1. 4 SPLICING CHANGES IN TRANSITION TO ASCs Downloaded from http://www.jimmunol.org/

FIGURE 1. Major splicing changes occur when B cells become ASCs. (A) TAC software analysis of alternative splicing tracks of B cell example genes before and after LPS. The overall abundance of these sample mRNAs in this panel did not change. B cell (2LPS) splicing enrichment is indicated by orange, and +LPS enrichment is represented by blue, with the intensity of the color corresponding to fold change in expression of that region of mRNA, by guest on September 29, 2021 depicted by the scale at the bottom. The indicated P7275/6 forward primer is in the standard exon, whereas the reverse is in the retained intron. The J5320 forward primer spans the junction between section 3b and 3d, whereas the reverse sits downstream in an exon. (B) MyD88 expression levels with validation primers in (A) relative to Hprt and RT-QPCR are shown. The expression ratios (B/CD138+) of validation primers between the unstimulated B cells and stimulated CD138+ cells. Three independent biological samples were used with triplicate determinations in the QPCRs. (C) TAC software classiﬁers for differentially spliced events, broken down by number of genes and number of exons in each class. Comparison in ELL2+/+ cells in B cells versus LPS- stimulated ASCs. Results determined by averaging ﬁve independent biological replicates for the array data, see Materials and Methods.

ELL2 impacts alternative splicing for 72 h in ELL2-deficient cells is significantly reduced in all We then asked how ELL2 would change the landscape of alter- categories relative to when ELL2 is present (Fig. 3B); there are native splicing. The ASC signature genes marked with an asterisk only 5256 genes affected and there are fewer multiple splicing (*) in Fig. 2C show alternative splicing with ELL2 in the micro- events per gene. Loss of ELL2 results in many changes in all the array studies (45 of 52) and are listed as such in Supplemental splicing types (cassette, 39 acceptor, 59 donor, intron retention, Table II with the other ELL2 induced genes. A few examples of mutually exclusive exons); compare Fig. 3B with the ELL2- alternative splicing TAC patterns of nonsignature genes, also listed sufficient cells in Fig. 1C. Proportionally, the mutually exclusive in Supplemental Table II, are shown in Fig. 3A to indicate the exon category is most impacted by the loss of ELL2 (down to specific ELL2-dependent changes in splicing patterns. These three 0.2%). To understand how much of the alternative splicing in have mRNAs isoforms with more abundant, extended 59 un- ELL2-sufficient cells at 72 h requires the action of ELL2, we translated regions (UTRs) when ELL2 is knocked out (orange). created the Venn diagram (Fig. 3C). It shows that mRNA from Longer 59 UTRs have been shown to lead to mRNAs, bearing 9326 genes is alternatively spliced in cells 72 h after LPS addition them to be less effectively translated (30). Thus, when ELL2 is when ELL2 is present, but among these, only 4211 are alterna- absent, the 59 end of the mRNA is retained more often. The tively spliced when ELL2 is absent. Thus, we conclude that sig- splicing pattern of ELL2 mRNA itself is shown in Fig. 3A; when nificantly more than half of the 9326 genes (that is, the remaining comparing the wild type (blue) to the knockout cells, exon 3 is 5115) require ELL2 to be present to have the proper alternative much more abundant in the wild type because this is the exon splicing occur. flanked by loxP sites in the cKO. Extending beyond the 851 ELL2-induced genes, we next turned ELL2 binds to many genes for elongation to the global splicing profile in cells 72 h after LPS when ELL2 is Next, we asked which mRNAs have genes that are direct targets of missing, summarized in Fig. 3B. We see that the number of genes ELL2. To address this, we performed ChIP-seq experiments using affected by differential splicing events in cells stimulated by LPS Ab to ELL2. We previously showed that ELL2 is found on The Journal of Immunology 5 Downloaded from

FIGURE 2. Loss of ELL2 changes gene expression levels in ASCs. (A) mRNA levels in splenic B cells plus or minus ex vivo LPS for 72 h. The ELL2 http://www.jimmunol.org/ cKO mice are ELL2 loxp/loxp CD19cre/+ and the wild type (wt) are their ELL2+/+ litter mates. RNA was converted to cDNA, and real-time PCR was conducted using the secretory-specific or membrane-specific probes for Igmu H chain or a probe for exon 3 of ELL2 normalized to Hprt. Error bars indicate SEM. **p = 0.01 from three independent biological replicates and triplicate QPCRs. (B) mRNA levels in LPS-stimulated ELL2+/+ and ELL22/2 (cKO) cells 72 h after LPS addition. Genes are named in Supplemental Table II. Dashed line indicates p = 0.05 (ANOVA), solid lines show linear fold change of 6 2. (C) Expression profile changes in 48 signature ASC genes, plus Prdm1 and Irf4. Bars represent the linear fold change in expression of each gene, with positive fold-change values indicating higher levels in the ELL2+/+ than the ELL2 cKO cells. Error bars are omitted for clarity. + indicates that the gene binds ELL2 in ChIP, * indicates genes that mRNAs are alternatively spliced after LPS stimulation in ELL2+/+ cells. Three independent biological samples were used for each type of mouse, and QPCRs were performed in triplicate. **p , 0.01. by guest on September 29, 2021 chromatin with RNAPII through its association with the super highly alternatively spliced as shown in this study indicates that elongation complex (10, 31). ChIP was performed on a mouse the genes are in eight cell cycle pathways, six N-glycan biosyn- plasma cell line, and the products were subjected to deep se- thesis and processing pathways, four immune signaling pathways, quencing and analysis with the help of Active Motif and ChIP-IT four in Golgi pathways, and five in protein processing in the ER. software. There are ∼2000 candidates with .10 tags per peak. ELL2 binds to genes in these pathways, increases the abundance Genes that bind ELL2 and that also show increased abundance in of their mRNAs, and changes their splicing patterns. the presence of ELL2 are shown in Supplemental Table II. The complete data set of 2000 ELL2 ChIP targets is deposited at the snRNA expression decreases after LPS stimulation NCBI GEO Web site. ELL2 protein binds to a number of highly Having previously seen changes in U1A expression after stimu- expressed genes, including Atf6, Pou2af1 (OcaB, Bob1, Obf1), lation of B cells to ASC (12), we wondered if the small RNAs several heat shock genes, IgH enhancers (both near the m C region themselves, which directly participate in splicing, are influencing [IgH Emu] and downstream of the IgH a genes [IgH Ealpha]), and perhaps influenced by the differentiation of B cells to ASCs. IgH C regions, Ig H and L chain genes, Prdm1 (blimp1), Irf4, Changing the level of the snRNAs might contribute to the addi- several ASC signature genes, and Mdm2. The tracks of the tional splicing changes seen in this study as it has in the examples ELL2 protein on several of the genes are shown in Fig. 4A. In the cited in the introduction. Splicing arrays and several other mRNA tracks, ELL2 is often associated strongly with the region near deep sequencing techniques underrepresent the snRNAs, so we the promoter where RNAPII is found in abundance on an active used RT-QPCR to investigate their amounts. gene. The results from the ChIP-seq were confirmed using stan- We examined the levels of the snRNAs before and after 72 h of dard ChIP QPCR on several of the genes as shown in Fig. 4B, LPS treatment of mouse splenic B cells by making cDNA using using LPS-stimulated primary splenic B cells that were harvested random primers and then using RT-QPCR with U snRNA gene- 72 h after LPS stimulation and selected as CD138+ (i.e., ASCs). specific primers. As shown in Fig. 5A, the levels of most of the Therefore, the changes in splicing expression of some genes small RNAs falls off in cells treated with LPS for 72 h (ASCs) we see are a direct result of ELL2 association after induction; relative to B cells, set as 100% to normalize for the different basal meanwhile, some changes after ELL2 induction are indirect. levels of expression, with the levels of most of the Uatac snRNAs Some ASC signature genes shown in Fig. 2C are direct targets of (U11, U4atac, U6atac) falling to ,10% of that seen in B cells. ELL2 (indicated by a + sign in that figure) along with more of the The U6 snRNA gene is transcribed by RNAPIII, in contrast to the upregulated RNAs shown in the ELL2+/+ area in Fig. 2B (see others (32). Supplemental Table II). Next, we investigated whether the low levels of the Uatac A pathway analysis (Fig. 4C) of 343 of the ELL2 direct targets snRNAs in particular might correlate with the expression of some (from ChIP-seq) that are also induced in expression and are most genes known to contain the AT/AC style introns, such as U1A, 6 SPLICING CHANGES IN TRANSITION TO ASCs Downloaded from

FIGURE 3. ELL2 impacts alternative splicing. (A) TAC software generated splicing tracks of selected ASC signature genes comparing stimulated ELL2- http://www.jimmunol.org/ sufficient and -deficient cells. ELL2+/+ enrichment is indicated by blue, ELL2 cKO enrichment is represented by orange, with the intensity of the color corresponding to fold change in expression and depicted by the scale at the bottom. (B) TAC software classifiers for differentially spliced events, broken down by number of genes and number of exons. Comparison of ELL22/2 cells plus LPS for 72 h versus B cells and 72 h LPS-stimulated cells comparing ELL2+/+ versus ELL2 cKO. At least three independent biological samples were used for each genotype of mouse for the array data. (C) Venn diagram depicting the amount of overlap between alternatively spliced genes (B cells versus 72 h plus LPS) in the ELL2 +/+ and ELL2 cKO data sets.

HnrnpLL, and Ints10. As shown in Fig. 5B, the level of these It seemed possible that the decrease in snRNA levels could be mRNAs was significantly reduced after 72 h of LPS. Other genes attributed to decreases in the SnapC mRNAs that we saw, the ER with AT/AC introns, such as Fyn, were previously shown to de- stress induced by LPS treatment, and/or the Ire1-linked RIDD by guest on September 29, 2021 crease in ASCs (33, 34). When U4atac is mutated in humans, a pathway (20). The phosphorylation of Ire1 is apparent by 18 and condition called microcephalic osteodysplastic primordial dwarf- 24 h after LPS treatment and also at 72 h (see Figs. 5D and 6B), ism type 1 results, and AT/AC introns are not properly spliced and as expected, Xbp1 expression and the short form of Xbp1 (35). This suggests that the drop we see in U snRNAs between increase with time after LPS. Meanwhile, SnapC1 (Snap43) pro- splenic B cells and ASCs could influence the splicing of some AT/ tein is decreased by 18 h, similar to its mRNA. AC intron–containing genes and perhaps other genes as well, ei- To determine if the decrease in SnapC1 and 2 might be correlated ther directly or indirectly. with the RIDD activity of Ire1, we cultured primary splenic B cells We examined the levels of the mRNA encoding some of the stimulated for 18 h with LPS plus and minus the RIDD inhibitor, snRNA transcription factors. The transcription of snRNAs requires 4m8c (21). With 18 h of LPS, the splicing of Xbp1 to create the cooperative binding of five SnapC subunit proteins with Oct1 (and short form of the protein is increased, indicating that RIDD is or Oct2) to the octamer sequence for each of the snRNA enhancers active; but in LPS plus the inhibitor 4u8C, there is little to no (36, 37). A little elongation complex including Ice1 and Zc3h8 Xbp1 splicing (Fig. 6). The analysis of the Ire1 protein showed with ELL1 forms and travels with RNAPII to synthesize the that its autophosphorylation was occurring without 4u8C but not snRNAs (38). The Integrator complex of at least five proteins is in its presence (Fig. 6B). Meanwhile, at 18 h with LPS and no necessary for snRNA transcription termination. We showed that inhibitor, the SnapC1 mRNA is decreased, whereas in the pres- the mRNA for the Ints10 gene is decreased in Fig. 5B, and in ence of the drug there is a significant increase in its level. Like- Fig. 5C we show that the levels of mRNA for SnapC1 and SnapC2 wise, in LPS and with no 4u8c, the U1 and U11 snRNA levels are are also decreased. This is also true for the SnapC1 43 kDa subunit slightly decreased at 18 h, whereas the addition of the RIDD in- protein, as shown in Fig. 5D. hibitor dramatically increases their amount (Fig. 6A). Altering the snRNA content in the cell could cause changes in expression of Loss of snRNAs occurs early with ER stress other regulators such as U1A, HnrnpLL and Ints10 and could thus contribute to the altered splicing patterns in ASCs. The data indicate a marked drop off of snRNAs between B cells and cells treated with LPS for 72 h. We did a time course of expression ER stress influences splicing patterns of the U RNAs and saw that the drop off begins within 18 h of LPS Next we sought to determine if the ER stress response was ac- treatment (Fig. 6A) before ELL2 is induced, which occurs around companied by alterations in the B cell splicing patterns at 18 h post- 24–36 h. We also examined the relative loss of the small RNAs in LPS. The Affymetrix splicing arrays were used to analyze splenic blimp1 (Prdm1) knockout mice and saw a reduction similar to that B cell samples at time 0 and 18 h after LPS stimulation, plus and seen in blimp1+ mice (data not shown). Thus, the changes start minus 4u8C, the drug shown above to influence the RIDD activity early and seem to be Prdm1/blimp1 independent. of Ire1-P (21). We compiled the differential splicing events and The Journal of Immunology 7 Downloaded from http://www.jimmunol.org/

FIGURE 4. ELL2 binds to many genes. (A) ChIP-seq tracks of ELL2 on the IgH enhancer a region, along with other genes of interest. Track numbers on by guest on September 29, 2021 the left indicate the highest number of tags per peak. mRNA coding region of each gene is shown below the tracks, exons in dark boxes. Direct targets of ELL2 with an influence on mRNA abundance and or splicing are enumerated in Supplemental Table II. (B) ChIP analysis of LPS-stimulated ASC chromatin from ELL2+/+ immunoprecipitated with Ab to RNAPII or ELL2. Normal rabbit anti-sera (nrs) is a control. Immunoprecipitated (I.P.) DNA was analyzed by real-time PCR relative to the input sample taken before the ChIP steps. At least three independent biological replicates were used for ChIP, and the QPCRs were performed in triplicate. (C) Tally of pathway analyses of 343 alternatively spliced ELL2 direct targets by ChIP that are also alternatively spliced between the ELL2 +/+ and ELL2 cKO plus LPS, with p = 0.001. report them in Fig. 7A and on the NCBI GEO Web site. Blocking alternatively spliced but also the pathways in which those genes the RIDD function of Ire1-P by 4u8C was correlated with sig- map. The time line of the changes we found is indicated in Fig. 8. nificantly reduced overall number of splicing events in mRNA in Thus, we conclude that the Ire1-P pathway and RIDD have all categories. Mutually exclusive exon splicing, in particular, was profound effects on the differentiation of the B cell into an ASC. reduced by 3-fold. The number of genes that were alternatively spliced was reduced from 11,144 without inhibitor to 7248 with Discussion the 4u8C inhibitor. We have shown that large changes in mRNA splicing occur in the B When we cross referenced the 4211 genes that are alternatively to ASC transition. In Fig. 8, we summarized the many factors that spliced at 72 h of LPS regardless of ELL2, the ELL2-independent may contribute to the large number of changes in splicing seen, genes, with the 0–18 h family of alternatively spliced genes, we including ELL2 upregulation and ER stress. Although genes that see that many of the ELL2-independent genes (∼90%, 3783 of get induced to higher levels in one stage or another have been the 4211) are included in the 0–18 h group (Fig. 7B). Thus, they focus of many studies, it is important to realize that some genes change early and before ELL2 is induced, as we predicted. We have mRNAs that do not increase in abundance, and yet they can conclude that many splicing changes occur before ELL2 is in- show alternative splicing. Many of these changes may be missed duced, but while RIDD is activated and U snRNA levels are in flow cytometry and standard Western blotting using Abs that falling, some of these alternative splicing events persist until the recognize only one exon. The genome project found that most 72 h plus LPS stage, whereas others do not. multiexon genes can produce four to five different splicing prod- As shown in the pathway analyses (Fig. 7C), RNAs in 15 cell ucts. Not all of these changes result in different proteins, yet many cycle pathways are altered in 18 h after LPS with immune sig- do. In our array studies, we have seen examples of such genes that naling and metabolism represented by nine and six pathways, have been documented in the literature to result in proteins with respectively. There are several pathways in the alternative splicing different amino or carboxyl termini, altered cellular location, or and mRNA processing pathways induced early after LPS. Addi- altered translation based on inclusion of alternative exons. We see tion of 4u8C and LPS modifies not only the number of genes splicing changes in exons in which the differences are 3-fold or 8 SPLICING CHANGES IN TRANSITION TO ASCs

FIGURE 5. snRNAs decrease after LPS stimulation. (A) QPCR was performed with snRNA primers on random-primed cDNA from either ELL2+/+ B cells (BC) or from ELL2+/+ cells stimulated with LPS for 72 h (+LPS). The amount of PCR product was normalized relative to the determination of Hprt mRNA in the same sample on the same PCR plate. The amount of product in the BC sample was set to 100%, and the amount of product +LPS was calculated as a percentage so that the data could be presented succinctly on one graph. A minimum of three independent biological replicates was used, and QPCRs were performed at least three times at each time point for each snRNA. (B) Primers for the indicated mRNAs were used to determine the amount of each mRNA in BC and +LPS samples. Results are plotted as percentage of time zero and performed multiple times as described in (A). (C) Primers for the SnapC subunits were used in RT-QPCR and plotted and performed Downloaded from multiple times as described in (A). (D) Western blot of protein samples from BC or cells treated for 24 or 72 h with LPS. SnapC1 mRNA encodes a 43 kDa protein. Xbp1 long and short forms are indicated. Actin was used as a loading control. This represents one sample of the rep- http://www.jimmunol.org/ resentative data from among three independent biological replicates. *p , 0.05, **p , 0.01, ****p , 0.0001. more in Hadc9, Ptbp3, MyD88, and, not illustrated, Traf7, Zbtb20, number of splicing changes per gene are more numerous with ELL2 DNAjb6 (hsp40), IL-2R g-chain, Ppp2r5c, Srsf1, Ikzf1, Cmip present. When we performed an overlap analysis as shown in the (c-maf), Elmo, Ugp2, Picalm, Tmem209, Hspa4 (hsp70), Mapk1, Venn diagram (Fig. 3C), we saw that in ∼55% of the genes, Xiap, Eifak3, Cstf3, and Srpk2, listed in order of descending splicing events are dependent on the presence of ELL2.

splicing indexes. These genes fall in many pathways and it will be Of the 1039 genes with increased mRNA levels after the tran- by guest on September 29, 2021 important for future research to determine the relevance of these sition from B cells to ASCs at 72 h after LPS in ELL2-sufficient changes in gene expression to the development of ASCs. cells, 188 were V regions genes. Out of the remaining 851 non–V We show in this article that ELL2 has a widespread influence on region genes, 635 showed changes in splicing both between gene expression beyond the IgH gene. We found changes in the B cells and ASC in ELL2+/+ mice and between ELL2+/+ and ELL2 splicing of many genes both between B cells and ASCs in ELL2- cKO mice (Supplemental Table II). Only some of those were on sufficient mice and between cells that are ELL2 sufficient versus the list of 2000 strong ChIP targets for ELL2 (see NCBI GEO list) deficient, which were especially pronounced in the mutually ex- (35). Therefore, we conclude that some mRNAs are influenced clusive exon category. ELL2 induction causes increased expression straightforwardly by ELL2 binding to their gene. Some are in- of most of the ASC signature genes, Irf4, Prdm1, Pou2af2, and duced in the presence of ELL2 indirectly or fall below the strict Xbp1 mRNAs, all previously shown to influence gene expression to cutoff of 10 tags per gene that we imposed. ASCs, and many of which bind ELL2 in our ChIP-seq studies. But We did a pathway analysis on the 343 genes that are induced by many more genes in toto (5115) undergo alternative splicing 72 h of LPS treatment when ELL2 is present and that are also without changes in abundance when ELL2 is induced, and the differentially spliced between B cells and the ASCs. These genes

FIGURE 6. Loss of snRNA occurs early with ER stress. (A) QPCR was performed on RNA isolated from ELL2+/+ B cells (0 h), cells treated for 18 h plus LPS with or without 4u8C, an inhibitor of Ire1 phosphorylation, and the RIDD activity. Non- canonical Xbp1 splicing to the short form (Xbp1-S) as indicated. Three independent biological replicates were assay in triplicate. (B) Western blot of protein levels from B cells or cells treated for 18 h plus LPS with or without 4u8C. SnapC1 mRNA encodes a 43 kDa protein. Xbp1 long and short forms are indicated. Actin was used as a loading control. Rep- resentative of three independent biological replicates. *p , 0.05, **p , 0.01, ***p , 0.001. The Journal of Immunology 9 Downloaded from http://www.jimmunol.org/ FIGURE 7. ER stress influences splicing patterns. (A) TAC software generated classifiers for differentially spliced events, broken down by number of genes and number of exons. Two-way comparison of each of the three 4u8c conditions (0 h, 18 h plus 4u8c, and 18 h minus 4u8c). Results determined with three independent biological replicates for the array data, see Materials and Methods.(B) Overlap between alternatively spliced genes in the ELL2- independent genes (genes differentially spliced in LPS-stimulated ELL22/2 versus ELL2+/+) and plus and minus 4u8c at 18 h after stimulation. (C) Tally of pathway analyses of alternatively spliced genes mined from the 18 h plus LPS minus 4u8c dataset (significance p value cutoff at p =13 109) and the 18 h plus LPS plus 4u8c dataset (significance p value cutoff at p =13 105). are primarily associated with the cell cycle, N-glycan synthesis and mRNAs made after LPS, loss of some 0 h RNAs by the RIDD processing, immune signaling, Golgi associated, and ER protein process, and persistence of the previously made, undegraded, by guest on September 29, 2021 processing genes. A number of the genes in which ELL2 deficiency B cell mRNAs. When the ER phosphorylation of Ire1 is blocked influences splicing show extended 59 UTRs. This phenomena of by 4u8C, the number of genes displaying alternative splicing extended 59 UTRs was observed in meiotic differentiation in events in all categories relative to B cells is decreased. The RNAs budding yeast in which these RNAs were poorly translated (30). in 0 versus 18 h plus 4u8C show fewer cell cycle genes but an This is yet another way in which mRNA sequence could influence increase in immune system signaling and intracellular signaling the resulting protein products aside from overt changes in coding pathways. Noncanonical splicing of Xbp1 to the short form is regions by alternative exon use. inhibited in 4u8C. Because it is the short form of Xbp1 that Genome-wide association studies of altered IgG N-glycosylation encodes a transcription factor causing induction of the UPR phenotypes uncovered ELL2 as a significant gene for IgG gly- genes, these genes would not be turned on in the presence of 4u8C cosylation in humans (39), consistent with the results we found in and thus they would be underrepresented. The levels of the our study. ELL2 is lacking in certain kinds of nonsecreting mul- snRNAs rise in 4u8C, which could be expected to perturb splicing tiple myelomas (40), and an analysis of 505 patients with an ELL2 patterns. Comparing genes that are expressed both plus and minus deficiency revealed decreased expression of mRNAs for Bip and 4u8C, .4990 cassette exon splicing changes and changes in Atf6 in the UPR pathway and decreased Pou2af1 and ELL1 (41), all the other categories occur. Ire1 phosphorylation appears to all of which we see here in the ELL2-altered pathways, either have a large effect on alternative splicing patterns, some of it directly or indirectly. Pou2af1 is especially interesting because the perhaps through changes in the levels of the RNAs in the snRNA gene is found associated with ELL2 by ChIP-seq and it encodes a pathway. protein that binds to Oct1 and Oct2 to stimulate transcription of RIDD appears to require both Ire1-P activity and ER stress (43). genes that have the octamer sequence associated (42). Under severe stress, Ire1-mediated RNA decay can even promote At 18 h after LPS stimulation, many genes are being alternatively apoptosis (44). Through RIDD, selective mRNA decay is able to spliced relative to the B cells at 0 h, more than the number seen at alleviate some of the stress on the ER and presumably make space 72 h when the ASCs are focused on the task of Ig production and for the massive upregulation of UPR proteins and their mRNAs export. Many of these 18 h genes are involved in cell division and (43); this may then contribute to the diversity of the splicing immune signaling pathways. Ninety percent of the genes that are pattern of the RNAs that survive at 18 h because RIDD inhibition alternatively spliced independently of ELL2 in the 72 h plus LPS reduces diversity of alternatively spliced products. samples overlap with 0–18 h alternatively spliced genes. Because We have shown that changing the splicing pattern of RNAs in the ELL2 is not significantly upregulated until more than 24 h after B to ASC transition is a complex process that depends on induction LPS, this is understandable. of ELL2 and may require Ire1-phosphorylation and RIDD. ELL2 Thenumberofgenesscoredasalternativelyspliced0hversus may act with either direct binding to genes or indirect effects on 18 h after LPS represents a combination of newly synthesized their expression. Clearly, more work needs to be done to understand 10 SPLICING CHANGES IN TRANSITION TO ASCs

11. Nelson, A. M., and C. Milcarek. 2017. Transcription elongation factor ELL2 in antibody secreting cells, myeloma, and HIV infection: a full measure of activity. Curr. Trends Immunol. 18: 1–11. 12. Milcarek, C., K. Martincic, L.-H. Chung-Ganster, and C. S. Lutz. 2003. The snRNP-associated U1A levels change following IL-6 stimulation of human B- cells. Mol. Immunol. 39: 809–814. 13. Ray, R., K. Ray, and C. K. Panda. 1997. Differential alterations in metabolic pattern of the six major UsnRNAs during development. Mol. Cell. Biochem. 177: 79–88. 14. Cheng, Z., Z. Du, Y. Shang, Y. Zhang, and T. Zhang. 2017. A preliminary study: PS1 increases U1 snRNA expression associated with AD. J. Mol. Neurosci. 62: 269–275. 15. Singh, R. K., and T. A. Cooper. 2012. Pre-mRNA splicing in disease and ther- apeutics. Trends Mol. Med. 18: 472–482. 16. Aragon, I. V., R. A. Barrington, S. Jackowski, K. Mori, and J. W. Brewer. 2012. The specialized unfolded protein response of B lymphocytes: ATF6a-independent development of antibody-secreting B cells. Mol. Immunol. 51: 347–355. 17. Aronov, M., and B. Tirosh. 2016. Metabolic control of plasma cell differentiation- what we know and what we don’t know. J. Clin. Immunol. 36(Suppl. 1): 12–17. 18. Kumazaki, K., B. Tirosh, R. Maehr, M. Boes, T. Honjo, and H. L. Ploegh. 2007. AID-/-mus-/- mice are agammaglobulinemic and fail to maintain B220-CD138+ plasma cells. J. Immunol. 178: 2192–2203. 19. Tirasophon, W., K. Lee, B. Callaghan, A. Welihinda, and R. J. Kaufman. 2000. The endoribonuclease activity of mammalian IRE1 autoregulates its mRNA and is required for the unfolded protein response. Genes Dev. 14: 2725–2736. Downloaded from 20. So, J.-S., K. Y. Hur, M. Tarrio, V. Ruda, M. Frank-Kamenetsky, K. Fitzgerald, V. Koteliansky, A. H. Lichtman, T. Iwawaki, L. H. Glimcher, and A.-H. Lee. 2012. Silencing of lipid metabolism genes through IRE1a-mediated mRNA decay lowers plasma lipids in mice. Cell Metab. 16: 487–499. 21. Cross, B. C. S., P. J. Bond, P. G. Sadowski, B. K. Jha, J. Zak, J. M. Goodman, R. H. Silverman, T. A. Neubert, I. R. Baxendale, D. Ron, and H. P. Harding. FIGURE 8. Summary. Data presented in this work are summarized in a 2012. The molecular basis for selective inhibition of unconventional mRNA time line depicting alternative splicing at 18 and 72 h after LPS treatment and splicing by an IRE1-binding small molecule. Proc. Natl. Acad. Sci. USA 109: http://www.jimmunol.org/ the potential influences on it. The exon splicing patterns are figuratively meant E869–E878. 22. Genovese, C., and C. Milcarek. 1990. Increased half-life of mu immunoglobulin to show increasing complexity with time. We hypothesize that SnapC and mRNA during mouse B cell development increases its abundancy. Mol. Immu- snRNA decreases may be linked to the RIDD activity induced by ER stress, nol. 27: 733–743. although this is speculative at this point. 23. Genovese, C., S. Harrold, and C. Milcarek. 1991. Differential mRNA stabilities affect mRNA levels in mutant mouse myeloma cells. Somat. Cell Mol. Genet. 17: 69–81. 24. Petrie, K., F. Guidez, L. Howell, L. Healy, S. Waxman, M. Greaves, and the interplay of all of these factors and the effect of the changing A. Zelent. 2003. The histone deacetylase 9 gene encodes multiple protein iso- levels of the snRNAs which may contribute. forms. J. Biol. Chem. 278: 16059–16072. 25. Tan, L.-Y., P. Whitfield, M. Llorian, E. Monzon-Casanova, M. D. Diaz-Munoz, M. Turner, and C. W. J. Smith. 2015. Generation of functionally distinct isoforms by guest on September 29, 2021 Disclosures of PTBP3 by alternative splicing and translation initiation. Nucleic Acids Res. 43: 5586–5600. The authors have no financial conflicts of interest. 26. De Arras, L., and S. Alper. 2013. Limiting of the innate immune response by SF3A-dependent control of MyD88 alternative mRNA splicing. PLoS Genet. 9: e1003855. References 27. Janssens, S., K. Burns, J. Tschopp, and R. Beyaert. 2002. Regulation of 1. Johnson, J. M., J. Castle, P. Garrett-Engele, Z. Kan, P. M. Loerch, C. D. Armour, interleukin-1- and lipopolysaccharide-induced NF-kappaB activation by alter- R. Santos, E. E. Schadt, R. Stoughton, and D. D. Shoemaker. 2003. Genome-wide native splicing of MyD88. Curr. Biol. 12: 467–471. survey of human alternative pre-mRNA splicing with exon junction microarrays. 28. de la Mata, M., C. R. Alonso, S. Kadener, J. P. Fededa, M. Blaustein, F. Pelisch, Science 302: 2141–2144. P. Cramer, D. Bentley, and A. R. Kornblihtt. 2003. A slow RNA polymerase II 2. Rozen, S., A. Tieri, G. Ridner, A.-K. Stark, T. Schmaler, G. Ben-Nissan, affects alternative splicing in vivo. Mol. Cell 12: 525–532. W. Dubiel, and M. Sharon. 2013. Exposing the subunit diversity within protein 29. Martincic, K., R. Campbell, G. Edwalds-Gilbert, L. Souan, M. T. Lotze, and complexes: a mass spectrometry approach. Methods 59: 270–277. C. Milcarek. 1998. Increase in the 64-kDa subunit of the polyadenylation/ 3. Shi, W., Y. Liao, S. N. Willis, N. Taubenheim, M. Inouye, D. M. Tarlinton, cleavage stimulatory factor during the G0 to S phase transition. Proc. Natl. G. K. Smyth, P. D. Hodgkin, S. L. Nutt, and L. M. Corcoran. 2015. Transcrip- Acad. Sci. USA 95: 11095–11100. tional profiling of mouse B cell terminal differentiation defines a signature for 30. Cheng, Z., G. M. Otto, E. N. Powers, A. Keskin, P. Mertins, S. A. Carr, antibody-secreting plasma cells. Nat. Immunol. 16: 663–673. M. Jovanovic, and G. A. Brar. 2018. Pervasive, coordinated protein-level 4. Bayles, I., and C. Milcarek. 2014. Plasma cell formation, secretion, and per- changes driven by transcript isoform switching during meiosis. Cell 172: 910– sistence: the short and the long of it. Crit. Rev. Immunol. 34: 481–499. 923.e16. 5. Peterson, M. L. 2007. Mechanisms controlling production of membrane 31. Smith, E., C. Lin, and A. Shilatifard. 2011. The super elongation complex (SEC) and secreted immunoglobulin during B cell development. Immunol. Res. 37: and MLL in development and disease. Genes Dev. 25: 661–672. 33–46. 32. Listerman, I., A. S. Bledau, I. Grishina, and K. M. Neugebauer. 2007. Extragenic 6. Ma, J., S. I. Gunderson, and C. Phillips. 2006. Non-snRNP U1A levels decrease accumulation of RNA polymerase II enhances transcription by RNA polymerase during mammalian B-cell differentiation and release the IgM secretory poly(A) III. PLoS Genet 3: e212. site from repression. RNA 12: 122–132. 33. Underhill, G. H., D. George, E. G. Bremer, and G. S. Kansas. 2003. Gene ex- 7. Shell, S. A., K. Martincic, J. Tran, and C. Milcarek. 2007. Increased phos- pression profiling reveals a highly specialized genetic program of plasma cells. phorylation of the carboxyl-terminal domain of RNA polymerase II and loading Blood 101: 4013–4021. of polyadenylation and cotranscriptional factors contribute to regulation of the ig 34. Underhill, G. H., K. P. Kolli, and G. S. Kansas. 2003. Complexity within the heavy chain mRNA in plasma cells. J. Immunol. 179: 7663–7673. plasma cell compartment of mice deficient in both E- and P-selectin: implica- 8. Milcarek, C., M. Albring, C. Langer, and K. S. Park. 2011. The eleven-nineteen tions for plasma cell differentiation. Blood 102: 4076–4083. lysine-rich leukemia gene (ELL2) influences the histone H3 protein modifica- 35. Baumgartner, M., C. Lemoine, S.AlSeesi,D.K.P.Karunakaran, tions accompanying the shift to secretory immunoglobulin heavy chain mRNA N. Sturrock, A. R. Banday, A. M. Kilcollins, I. Mandoiu, and R. N. Kanadia. production. J. Biol. Chem. 286: 33795–33803. 2015. Minor splicing snRNAs are enriched in the developing mouse 9. Park, K. S., I. Bayles, A. Szlachta-McGinn, J. Paul, J. Boiko, P. Santos, J. Liu, CNS and are crucial for survival of differentiating retinal neurons. Dev. Z. Wang, L. Borghesi, and C. Milcarek. 2014. Transcription elongation factor Neurobiol. 75: 895–907. ELL2 drives Ig secretory-specific mRNA production and the unfolded protein 36. Murphy, S., J. B. Yoon, T. Gerster, and R. G. Roeder. 1992. Oct-1 and Oct-2 response. J. Immunol. 193: 4663–4674. potentiate functional interactions of a transcription factor with the proximal 10. Martincic, K., S. A. Alkan, A. Cheatle, L. Borghesi, and C. Milcarek. 2009. sequence element of small nuclear RNA genes. Mol. Cell. Biol. 12: 3247–3261. Transcription elongation factor ELL2 directs immunoglobulin secretion 37. Henry, R. W., V. Mittal, B. Ma, R. Kobayashi, and N. Hernandez. 1998. SNAP19 in plasma cells by stimulating altered RNA processing. Nat. Immunol. 10: mediates the assembly of a functional core promoter complex (SNAPc) shared 1102–1109. by RNA polymerases II and III. Genes Dev. 12: 2664–2672. The Journal of Immunology 11

38. Smith, E. R., C. Lin, A. S. Garrett, J. Thornton, N. Mohaghegh, D. Hu, to multiple myeloma at 5q15 is mediated by an ELL2 enhancer polymorphism. J. Jackson, A. Saraf, S. K. Swanson, C. Seidel, et al. 2011. The little elongation Cell Rep. 20: 2556–2564. complex regulates small nuclear RNA transcription. Mol. Cell 44: 954–965. 42. Greiner, A., K. B. Mu¨ller, J. Hess, K. Pfeffer, H. K. Mu¨ller-Hermelink, and 39. Shen, X., L. Klaric´, S. Sharapov, M. Mangino, Z. Ning, D. Wu, I. Trbojevic´- T. Wirth. 2000. Up-regulation of BOB.1/OBF.1 expression in normal germinal Akmacic´,M.Pucic´-Bakovic´, I. Rudan, O. Polasek, et al. 2017. Multivariate center B cells and germinal center-derived lymphomas. Am. J. Pathol. 156: 501– discovery and replication of five novel loci associated with immunoglobulin G 507. N-glycosylation. Nat. Commun. 8: 447. 43. Hollien, J., J. H. Lin, H. Li, N. Stevens, P. Walter, and J. S. Weissman. 2009. 40. Swaminathan, B., G. Thorleifsson, M. Joüd, M. Ali, E. Johnsson, R. Ajore, Regulated Ire1-dependent decay of messenger RNAs in mammalian cells. J. Cell P. Sulem, B.-M. Halvarsson, G. Eyjolfsson, V. Haraldsdottir, et al. 2015. Variants Biol. 186: 323–331. in ELL2 influencing immunoglobulin levels associate with multiple myeloma. 44. Han, D., A. G. Lerner, L. Vande Walle, J. P. Upton, W. Xu, A. Hagen, Nat. Commun. 6: 7213. B. J. Backes, S. A. Oakes, and F. R. Papa. 2009. IRE1alpha kinase activation 41. Li, N., D. C. Johnson, N. Weinhold, S. Kimber, S. E. Dobbins, J. S. Mitchell, modes control alternate endoribonuclease outputs to determine divergent cell B. Kinnersley, A. Sud, P. J. Law, G. Orlando, et al. 2017. Genetic predisposition fates. Cell 138: 562–575. Downloaded from http://www.jimmunol.org/ by guest on September 29, 2021 ActinP 18189345 F:CGGAGGCTATTCCTGTACATCTG 127530800 R:CATCATGAATGCAGTCCCC 18189346 R:CGAGATTGAGGAAGAGGATGAAGA RNU2musF/R 127530801 F:CGCTTCTCGGCCTTTTGG Beta actin 18189351 F:GGGCCGGACTCATCGTACT 127530802 R:CTCGGATAGAGGACGTATC 18189350 R:GCTCCATCCTGGCCTCACT RNU6musF/R 127530807 F:GTGCTCGCTTCGGCAGC BiP347 118235980 F:CACCTTCGATGTGTCTCTTCTC 127530808 R:GGAACGCTTCACGAATTTG 118235981 R:ACCCGCTGATCAAAGTCTTC SNAP1 136763466 F:GCGACCATCTTCTGTGGCAA BiP663 118235978 F:CTGTTCCGCTCTACCATGAA 136763467 R:ATCTGGAACGTGTGTGGAGG 118235979 R:GAGTAGATCCACCAACCAGAAC SNAP2 137977476 F:TGCGGCATCTACTGAGACTA CHOP36106 161106619 F:CATGTTGAAGATGAGCGGGTG 137977477 R:ATCCATCCATACCTCTACCGGG 161106620 R:TGGAACACTCTCTCCTCAGGT SNAP5 137977482 F:TACACGACCAACTGAACCGC CHOP83196 161106621 F:GGAACCTGAGGAGAGAGTGTT 137977483 R:AACTACCCTGCCCTTGATCC 161106622 R:AAGGTGAAAGGCAGGGACTC SNAPc1P 144902727 F:AGGTAAGACCCGGATGAAGG ELL2 23545157 F:ATCCTCAGGGCAGCTTTGAC 144902728 R:CCCCAGTCACGTCACATCA 23545158 R:TGGGTCATTCTTTCTCGCGT SNU12 123386737 F:ATAACGATTCGGGGTGACGC ELL3mRNA 85776881 F:AGAGCCTCTCAGCTCCATCAGCC 123386738 R:TGCAACCTATACCCGCTCAA 85776882 R:GCCCCAACTCGAGCATGCAG SNU4atac 123386739 F:TTCTTGGGGTTGCGCTACTG ELL3P 144902721 F:AGTTACGGCTTTCTGCTCTCT 123386740 R:AGCTCTAGTTGATGCGGGTG 144902722 R:TGCCTCGCAGATTTGGAAGT SNU6atac 123386741 F:AGGTTAGCACTCCCCTTGAC GAPDH 44582765 F:TCTCCTCTGACTTCAACAGAGACA 123386742 R:CCACGAAGTAGGTGGCAATG 44582766 R:CCCTGTTGCTGTAGCCAAATTCGT TCEA1Var1 123386727 F:CCACACTTGACCTCTCCAGC hnRNPLL 118562143 F:ATGCCGGATGTTGCACACTA 123386728 R:TCCAATTCTTGTGGACTGTAGC 118562144 R:AGCCAACAACAACCTCGTCT U1Avar1and3 123386735 F:AGCTCGTGCCCTTCTTTGAT HPRT 136018793 F:CCTAAGATGAGCGCAAGTTGAA 123386736 R:ACACAACTATCTTCCCCGGC 136018794 R:CCACAGGACTAGAACACCTGCTAA INST10 123386731 F:CTTCCAAGGTCCTAACGCCC U11 118562141 F:AACTCGATTGCTGTGCGTG 123386732 R:CTCTTCCCTCAGCTAGCTTCC 118562142 R:ACCAGCTGCCCAATTACCAAA MED26 78433467 F:CTTGGACGGGCAGGTGGCTG U4 127530803 F:AGCTTTGCGCAGTGGCAG 78433466 R:CCGCACCGGCTCTTTCTGGG 127530804 R:CAGTCTCCGTAGCTGTCA Myd88P7275/6 161088929 F:CGGCAACTAGAACAGACAGACT XBP1spliced 148945277 F:TCTGCTTTGAGTCCGCAGCAGGT 161088930 R:AAGGACTACATTACCCAGGCG 148945278 R:ACATGACAGGGTCCAACTTGTCC Myd88J5320 161088931 F:GCTAATTGAGAAAAGGTGTCGCC XBP1total 86298154 F:GGCAGCAGGGTCGGAGGCGA 161088932 F:TCAGTCGCTTCTGTTGGACA 86298155 R:CCGCTGCCGCTTGCGAGCCT Zc3h8 136763468 F:CTGGCACTGGAGACAAAGGG RNU1musF/R 127530799 F:CTTACCTGGCAGGTGAGAT 136763469 R:AGGTTCATCAGTCTGTTCCCG

Supplemental Table 1. Primers Used for Quantitative PCR. The use of primers is discussed in the manuscript.

Supplemental Table 2. Table of 851 genes that have upregulated gene expression comparing the ELL2 sufficient vs deficient B cells (no LPS) vs cells treated with LPS for 72 hrs (Figure 2B); the 150 V region genes that are induced by ELL2 have been omitted. Column 1: Direct targets of ELL2 via ChIPseq are assigned a value indicating the number of tags per peak for the highest peak. A value of 0 means it had less than 10 tags/ peak. Column 2: alternative splicing positive (+) or negative (-) in that gene when comparing wild type B cells versus ASCs (72hs + LPS). Column 3: changes in splicing between cells that are ELL2 +/+ versus ELL2 -/- at 72hs post LPS. Positive for alternative splicing indicated by (+) or negative (-).

Adk Arl1 2.B vs +LPS 3.ELL2+/+ 13 + + 0 + + 1.Tags/ Gene name ELL2+/+ vs ELL2- Alcam Arl6ip4 peak splicing /- splicing 0 + + 0 - + Aldh18a1 Armcx3 0 + - 0 + + 0610011F06Rik Aldh9a1 Arrdc3 23 + + 0 + + 15 + + 1500011B03Rik Alg11 Atat1 0 - + 0 + + 0 + + 1700017B05Rik Alg12 Atf6 21 + - 0 + - 0 + + 1700109H08Rik Alg14 Atf6b 0 + + 15 + + 13 + + 2010109A12Rik Alg2 Atg13 0 - - 0 + + 0 + + 2610524H06Rik Alg5 Atg9a 0 + + 12 + + 0 + + 3110040N11Rik Alg8 Atl2 13 + + 0 + + 0 + + 4833439L19Rik Alpl Atp13a1 0 + + 19 + + 0 + + 4933402N22Rik Amigo2 Atp5h 0 + + 0 + + 19 + + 5031425E22Rik Amigo3 Atp6v0a1 14 + + 0 - + 0 + + 6330562C20Rik; Amz2 Atp6v0a2 RP24-372P19.1; 17 + + 14 + + Ankrd28 Atp8b2 AK144859; 0 + + 11 + + Gm10691 Anxa9 Atraid 0 - - 0 + + 0 + + 6430548M08Rik Ap2a2 Aurka 0 + + 0 + - 0 + + A430035B10Rik Ap2m1 AW011738 0 + + 0 + + 0 - + A730008H23Rik; Ap3m1 Azin1 0 + + 15 + + Hjurp; Ap3s1 B3galnt2 6430706D22Rik 12 + + 0 + + 0 + + Appbp2 Bach1 Abcb1b 15 + + 0 + - 0 + + Arcn1 BC003331 Abhd14b 21 + + 13 + + 0 - + Arfgap1 BC004004 Abhd4 0 + + 0 + + 0 + + Arfgap3 BC023829 Acad8 0 + + 0 + - 0 + + Arfip2 Bckdk Acbd5 0 + + 0 + + 12 + + Arid3a Bcl2l1 Ada 0 + + 0 + + 0 + + Bet1 Cdc23 Cope 0 + + 11 + + 0 + + Bet1l Cdca3 Copg1 0 - - 0 + + 0 + + Bglap3 Cdk16 Copz2 0 + + 0 + + 0 + + Bhlha15 Cdk2ap2 Coro2a 0 + + 0 + + 15 + + Bloc1s6 Cdk5rap3 Coro2b 0 + + 0 + + 22 + + Bmf Cdkl5 Cpeb3 0 + + 0 + + 17 + + Bpgm Cdo1 Cped1 0 + + 0 - + 0 + + Bsg Cds1 Cpox 0 + + 0 + + 13 + + Bst2 Cdt1 Cptp 0 - - 0 + + 0 + + Btd Cecr2 Crat 0 + + 19 + + 0 + + C2cd2l Cenpk Crb3 0 + + 0 + + 0 + + C4bp Cenpm Creb3l2 0 + + 0 + + 14 + + Cad; Mir6369 Cep76 Creld2 0 + + 10 + + 14 + + Calcoco1 Cep97 Crls1 0 + + 18 + + 0 + + Calu Cers2 Csnk1e 0 + + 46 + + 0 + + Camk2b Cfap20 Cst3 0 + + 0 - - 0 + + Capn5 Chac1 Ctla4 0 + + 0 + + 0 + + Car5b Chkb Cwc15 0 + - 0 - + 0 + + Cbx4 Chpf2; Mir671 Cyp4f18 0 + + 0 + + 0 - - Cbx7 Chrnb1 D17H6S56E-5 0 + + 0 + + 0 + + Ccdc117 Ciapin1 Dad1 0 + + 0 + + 0 + - Ccdc130 Cited2 Dcaf12 0 + + 21 + + 10 + + Ccdc134 Ckap2l Dcaf6 0 + + 0 + + 15 + + Ccdc167 Clint1 Dclre1b 0 + + 0 + + 0 + + Ccdc28b Clk3 Dcp1a 0 + + 18 - - 18 + + Ccdc9 Cln8 Dcun1d5 0 + + 0 + + 0 - + Ccnl2 Clptm1l Ddias 0 + + 0 + - 0 + + Ccpg1 Cltb Ddost 0 + + 0 + + 18 + - Ccser2 Cmas Ddx20 0 + + 0 + + 11 - + Cd28 Cnep1r1 Ddx26b 0 + + 0 + - 14 - + Cd2bp2 0 + - Cnnm2 0 + + Deaf1 0 + + Cd9 Cog2 Deb1 0 + + 0 - + 0 + - Cd93 Copa Degs1 0 + + 0 + + 15 + + Cdc123 Copb2 Dennd3 0 + + 0 + + 0 - + Dennd5b Elovl6 Fdx1l; Zglp1; 25 + + 18 + + Raver1; Derl1 Emc7 0 + + 0 + + Gm38431; Derl2 Emp3 Mir7082 0 + + 0 - + 0 - + Derl3 Endou Fkbp11 0 + + 18 + + 0 + + Dgkg Entpd1 Fkbp2 13 + - 0 + + 0 + + Dhdds Entpd4 Fndc3a 0 + + 0 + + 14 + + Dhrs1 Entpd4; 0 + + Fndc3b Gm21685 10 + + Dhrs7 0 + + Fos 0 + + Entpd7 0 - + Dnajb11 0 + + Foxn3 0 - + Ergic1 13 + + Dnajb9 0 + + Fpgs; Mir8093 0 + - Ergic3 0 + + Dnajc25 0 + + Ftl1 0 + + Erlec1 0 + + Dnajc3 0 + + Ftsj1 0 + + Ermard 0 + + Dnpep 0 - + 0 + + Fut1 Ern1 0 + - Dnttip1 14 + + Fut8 0 + - Ero1lb 0 + + Dpagt1 0 + + Fzd1 0 + - Evi5 0 - + Dph3 16 + + Gadd45a 0 + + Eya1 0 - - Dpp3 0 - + Gadd45b 0 + + F9 0 - - Dus1l 0 - + 0 + + Galns Faah 0 + + Dusp1 13 + + Galnt2 16 + - Fadd 0 + + Dusp4 0 - + Galnt7 0 + - Fads1 14 + + Dvl3 22 + + Ganab 0 + + Fads2 0 + + Dxo 0 + - Gas2l3 0 + + Fads3 0 + + Dym 18 + + Gba 0 + + Faf2 0 + + Dyrk3 0 + + Gdap2 11 + + Fam110a 0 + + Eaf2 0 + + 0 + + Gfpt1 Fam117a 0 + + Ebp 15 + + Ggcx 0 + + Fam173a 0 + + Edem1 0 - + Ggh 18 + + Fam214a 0 + + Edem2 21 + + Ggta1 0 + + Fam221a 0 + + Edem3 0 + + Glce; Mir5133 0 + + Farp2 0 + + Ehd4 0 + + 0 + + Gle1 Fastk 0 + + Eif5; Snora28 0 + + Glipr1 0 + + Fbxw7 0 + + Elk4 0 + + Glmp 0 - + Fcho2 0 + + Ell2 0 - + Glt8d1 14 + + 0 + - Elmod2 Gm10177 0 + + 0 - + Gm10495 Gmppa Hist1h4i 0 - - 0 + + 30 - - Gm11575 Gne Hist2h2aa1; 0 - - 31 + + Hist2h2aa2 Gm13736; Srp9 Gnpnat1 0 + + 0 - - 0 + - Hist2h2ac Gm14577 Golga1 0 + + 0 - - 0 - + Hist2h2bb Gm14863 Golph3 0 + + 0 - - 21 + - Hist2h3c1; Gm15393 Gorasp2 0 - - 0 + + Hist2h3c2; Gm15590; Got2 Hist2h3b 14 + - 0 + + Gm22774 0 - - Gpm6a Hist2h3c2; 0 + + Gm15900 Hist2h3b 0 - - Gpr108 0 + + Gm16072 0 + - Hist2h4 0 - - Gpr160 0 - - Gm16412 19 + + Hivep3 0 - - Gpr19 0 + + Gm19774 0 + + Hk2 0 - - Grina 0 + + Gm20094 0 + + Hmbox1 0 - - Grk4 0 + + 21 + + Gm20563 Hmces 0 - - H13 0 + + Gm20721 0 + + Hook1 0 + - H1f0 0 + + Gm20730 19 + + Hsp90b1 0 + + H2-Q8; H2-Q6 0 + + Gm20746 0 - - Hspa13 0 - - Hadhb 0 + + Gm21464; 0 + - Hspa5 Hars 0 + + Gm16867 0 + + 19 + - Htatip2 0 + + Gm21807 Haus7 0 + + 0 - - Htra2 0 + + Gm22751; Hbp1 0 + + Hyou1 Gm12164 0 - - Hbs1l 0 + + 0 + - Ide Gm2436 Hcfc2 0 + + 0 - + 0 + + Gm2446 Idh2 0 - + Hdac3 0 + + 0 + + Ifi27l2a Gm24871; Hdlbp 0 + + B930036N10Rik; 0 + + Ift20 RP23-116M12.2 Heatr5a 0 + + 0 + + 0 + + Ift27 Gm24950 Herpud1 14 + + 0 + + 0 + + Il5ra 0 - + Gm25313 Hexdc 0 - - 0 + + Il6st Gm4024 Hid1 0 + + 0 - - 21 + + Impdh1 Gm4184 Hinfp 0 + + 0 - - 0 + + Inpp1 Gm5152 Hipk1 0 + + 0 + + 0 + + Inpp5a Gm6104 Hist1h1c 0 + + 0 - - 0 - - Insl6 Gm6460 Hist1h2ac 0 - - 0 + - 0 + + Insr Gm6465 Hist1h3c 0 + + 0 + + 0 + - Iqcb1 0 + + Gm6568 Hist1h3e 0 + + 0 - - Irf4 21 + - Irs2 Lrp12 Mir202 15 + + 0 + + 0 + + Iscu Lrrc59 Mir692-2 15 + + 19 + - 0 - - Isg20 Lrrc8a Mir692-3; Ftl1; 0 + + 10 + + Ftl2-ps Itga4 Lrrc8d 0 + - 14 + + 0 + + Mis18bp1 Itpr3; Mir7677 Lrrn3 0 + + 0 - + 0 + + Mknk1 Izumo1; Rasip1 Ly6c1 12 + + 0 + + 0 + + Mlx Jade1 Ly6c2 0 + + 0 - - 0 + - Mmadhc Jchain Lysmd3 13 + - 0 + + 0 + + Mob4 Josd1 Maf1 0 + + 26 + - 0 + - Mocs2 Kansl1l Magt1 0 + + 0 + + 0 + + Mogs Kcnab3 Man1b1 0 - + 0 + + 14 + + Morf4l2 Kcnk6 Man1c1 0 + + 0 + + 13 + + Mospd1 Kctd12; Mir5130 Man2a2 0 - - 0 + + 0 + + Mospd3 Kdelr1 Manea 14 + + 0 + + 0 + + Mrgpra2b Kdelr2 Manf; Rbm15b 0 - - 0 + + 0 + + Mrpl13 Kdelr3 Map2k3 0 + + 17 + + 0 + + Mrpl37 Kdm8 Mapk1ip1 0 + - 0 - + 16 - - Mrpl57 Krtcap2 Mapk6 0 + + 0 + + 35 + + Mrps14 Lamp2 Mbd1 0 + - 0 + + 0 + + Mrps34 Laptm4a Mbnl2 0 + - 13 + + 0 + + Mtcp1; Cmc4 Laptm4b Mcl1 0 - - 0 - + 0 + + Mtmr10 Larp1b Mcoln2 0 + + 11 + + 13 - + Mvb12a Lax1 Mcts2 0 + - 0 - - 0 - - Mvb12b Lcorl Mdm2 12 + + 0 + + 65 + + Mxd4 Ldlrap1 Med30 0 - - 15 + + 0 - + Myadm Leprot Mettl9 0 - + 0 + + 0 + + Mycbp Leprotl1 Mfsd10 0 + + 0 + + 0 + + Mydgf Lgals1 Mfsd11 0 + + 0 + + 0 + + Myo1h Lin54 Mfsd6 0 + + 0 + + 0 + + Mzb1 Lman1 Mgat1 0 + - 0 + + 16 + + Naa20 Lman2 Mgat2 0 + + 0 + - 18 + + Naglu Lmbr1l Mia3 0 + + 0 + + 10 + + Nans Lmf2 Mib1 0 + + 0 + + 0 + + Napa Lrp10 Mios 0 + - 0 - - 0 + + Nbas 0 + + Ncoa2 P4hb Ppp2cb 0 + + 0 + + 0 + + Ncstn Pafah1b3 Ppp2r5a 0 + + 11 + + 0 + + Ndel1 Pck2 Pqlc3 14 + + 14 + + 0 + + Ndfip1 Pcyt1a Prdm1 0 + + 0 + - 45 + + Ndufa1 Pdia4; Mir704 Prdm2 0 - - 0 + + 11 + - Ndufa11 Pdia6 Prdx4 0 + + 0 + + 0 + + Ndufa4 Pecr Preb 0 + + 0 + + 0 + + Ndufa9 Pgm3 Prob1 0 + + 17 + + 0 - - Ndufb9 Phyhd1 Prr5 0 + + 0 + + 12 - + Nelfa Pick1 Prrc1 0 + - 12 + + 0 + + Nfxl1 Pigb Prrg4 0 + + 20 + + 0 + + Ngly1 Pigk Psd3 10 + + 0 + + 0 + + Nme2 Pigt Psmd1 30 + + 0 + - 0 + + Nomo1 Pik3cg Ptges 0 + + 0 + + 0 + + Nploc4 Pim1 Ptk2b 17 + + 19 + + 0 + + Nr1d2 Pink1; Mir7019 Ptpn21 15 - + 0 + + 0 + + Nsmce2 Pkd2l2 Ptpre 16 + - 0 + + 0 + + Nt5c2 Pla2g6 Pycr1 0 + + 0 + + 0 + + Nt5dc2 Plbd2 Qpctl 0 + + 0 + + 0 + + Ntng2; Plcd3 Qsox1 23 + + 0 + + 6530402F18Rik 0 + - Plcxd2 Rab1a Nucb1 0 + + 0 + + 0 + + Plpp5 Rab26 Nudcd1 0 + + 0 + + 0 + - Pls1 Rab2a Nudt22 0 + + 15 + + 0 + + Pnpla2 Rab39b Nudt4 0 + + 0 + - 0 + + Pnpla8; Gm2027 Rab3b 0 + + 0 + + Nuggc 0 + + Pnrc1 Rab3d Oip5 0 + + 0 + + 0 + + Pofut2 Rabac1 Olfml3 0 + + 0 + + 0 + + Polr2k Rabgef1 Oosp1 0 - + 0 + + 0 + + Pomt2 Rabggta Oosp2 0 + + 0 - + 0 + + Pon2 Rabl3 0 + + 0 + - Ormdl3 0 + + Pon3 Rabl6 Os9 0 + - 13 + + 0 + + Pop4 Ranbp2 Ost4 0 + - 0 + + 0 + - Pou2af1 Rapgef3 Ostm1 51 + - 16 + + 20 + + Ppib Raph1 Oxr1 0 + + 0 + + 0 + + Rasal1 Scrn3 Slc15a2 0 + + 0 - + 0 + + Rbm47 Scyl1 Slc16a6 13 + + 13 - - 25 + + Rcbtb2 Sdc1 Slc17a5 21 + + 18 + + 13 + + Rchy1 Sdf2 Slc22a17 0 + + 0 + + 0 + + Rdh10 Sdf2l1 Slc30a7 16 + + 0 - - 0 + - Reep4 Sdf4 Slc33a1 0 + - 0 + + 0 + + Reep5 Sdhb Slc35b1 0 + - 0 + + 0 + + Rer1 Sec11c Slc35e1 0 + + 0 + + 0 + + Rexo1 Sec13 Slc35e2 0 - + 0 + + 11 + + Rexo2 Sec16a Slc35f5 23 + - 0 + + 0 + + Rgcc Sec22b Slc38a10 20 + + 0 + - 0 + + Rheb Sec23a Slc39a4 0 + + 0 + + 0 + + Rhob Sec23b Slc39a7 0 - - 0 + + 0 + + Rhobtb1 Sec24a Slc39a9 0 + + 16 + + 0 + + Rhpn2 Sec24d Slc3a2 0 + + 0 + + 0 + + Rint1 Sec31a Slc41a2 0 + + 0 + + 0 + + Rnf10 Sec61a1 Slc43a1 18 + + 0 + + 0 + + Rnf122 Sec61b Slc44a1 0 + - 0 + + 0 + + Rnf123 Sec61g Slc46a3 20 + + 0 + + 15 - + Rnf185 Sec63 Slc48a1 12 + + 0 + + 0 + + Rnu1b2 Sel1l Slc7a3 0 + + 0 + + 0 + + Rpn1 Selk Slc7a5 16 + + 0 + + 17 + + Rpn2 Selplg Slc7a7 16 + + 0 + - 0 + - Rps6ka2 Selt Slc7a8 10 + + 0 + - 0 + + Rps6kb2 Serinc5 Slco4a1 0 + + 0 + + 0 + + Rrbp1 Serp1 Slco5a1 0 + + 16 + - 0 + + Rsph9 Serpina3f Smpd1 0 + + 0 + + 0 + + Samm50 Sesn2 Snord93 0 + + 16 + + 0 - - Sar1b Sfr1 Snx14 0 + - 0 + - 14 + + Saraf Sft2d2 Spcs1 0 + + 0 + + 0 + + Scfd1 11 + + Sik1 0 + + Spcs2 0 + + Scfd2 Sil1 Spcs3 0 + + 0 + + 0 + + Sco1 Ska3 Speer1 0 + - 0 + - 0 + + Scpep1 Slamf7 Spint2 0 + + 0 + + 0 + + Spn Tbc1d15 Tmem258 0 + + 0 + + 0 + + Spop Tbl2 Tmem39a 12 + + 0 + + 0 + + Spty2d1 Tecr Tmem41b 0 + - 0 + + 0 + + Srgn Tex2 Tmem62 0 + + 13 + + 0 + + Srp19 Tex261 Tmem65 0 + - 23 + + 0 + + Srp54a Tex30 Tmem9 0 + + 18 + - 0 + + Srp54b; Srp54a Tgfbr1 Tmem9b 0 + + 0 + + 0 + + Srp54b; Srp54c Themis2 Tmppe; Glb1 0 + + 16 + - 0 + + Srp68 Ticrr Tmub2 0 + + 0 + + 0 + - Srp9 Timm21 Tnfrsf13b 0 + - 0 - - 0 + + Srpr Tinf2 Tns3 0 + + 0 + - 0 + + Srprb Tirap Tom1 17 + + 13 + + 0 + + Ssr1 Tm2d2 Tpd52 0 + + 0 + - 0 + + Ssr2 Tm9sf2 Tpp2 0 + - 0 + - 0 + - Ssr3 Tm9sf3 Tpst1 12 + + 0 + - 20 + + Ssr4 Tmbim4 Trabd 0 + + 0 + + 0 + + St14 Tmcc1 Traf6 20 + + 0 + + 0 + + St6gal1 Tmed10 Tram1 15 + + 0 + - 0 - - St7 Tmed2 Tram2 0 + + 0 + + 17 + - St8sia6 Tmed6 Trib1 0 + + 0 + + 21 + + Stag3 Tmed9 Trim24 0 + + 0 + + 0 + + Stard5 Tmem115 Trim39 0 + + 0 + - 14 - + Stk3 Tmem120a Troap 0 - + 0 + + 0 + + Ston2 Tmem147 Trp53bp2 0 + + 0 + + 0 - - Stx18 Tmem154 Trp53i11 18 + + 0 + + 17 + + Stx5a; Mir6992 Tmem163 Trp53inp1 0 + + 19 + + 17 + + Supt5 Tmem167 Trp53inp2 0 + + 12 + + 0 + + Surf4 Tmem181a Trp73 0 + + 0 + + 0 + + Swi5 Tmem181b-ps; Tsc2 0 + - 0 - + Tmem181a Sys1 0 + + Tsc22d1; 0 + + Tmem184b Gm19597 Syvn1 15 + + 0 + + 11 + + Tmem184c Tspan13 Tapbpl 0 + + 22 + + 0 - + Tmem208 Tspan15 Tas1r3 0 + + 12 - + 0 - - Tmem214 Tspyl2 Tbc1d10b 17 + + 0 - + 0 + + Tmem248 Tssc4 0 + + 0 - - Ttc17 Usp28 Yipf6 0 + + 0 + + 0 + + Ttc32 Usp38 Ythdf1 0 - + 0 - + 0 + + Ttc41 Usp53 Zdhhc7 0 + + 0 + + 0 + + Tubb4b Uxt Zfp119a 0 + + 0 + - 0 - + Tvp23b Vamp1 Zfp119b 0 + + 0 + - 0 - + Txndc11 Vamp3 Zfp260 0 + + 0 + - 0 + + Txndc5 Vegfa Zfp280b 15 + + 15 + + 14 + + Tyk2 Vimp Zfp280c 0 - + 0 - - 0 + - Uap1 Vps11 Zfp358 0 + + 0 + + 0 + + Uba5 Vps37a Zfp36 0 + + 0 + + 12 - + Ubac2 Vps37c Zfp384 17 + + 0 + + 0 + - Ube2e3 Vsir Zfp61 0 + + 0 + + 0 - + Ube2j1 Wbp5 Zfp64 0 + + 0 + - 0 + + Ube4a Wdr45 Zfp658 0 + + 0 + + 0 + + Ubxn4 Wdr61 Zfp687 0 + + 0 + - 0 - + Uchl1 Wdyhv1 Zfp719 0 + + 0 + + 0 - + Ufc1 Wfs1 Zfp771 0 + + 14 + + 0 - + Ufd1l Wipi1 Zfp810 0 + + 25 + + 23 + + Ufl1 Xbp1 Zfp9 18 + + 0 + + 0 + - Ufm1 Xk Zfpm1 0 + + 0 - - 0 + + Ulk1 Yars Zhx3 0 + - 0 + + 0 + + Umad1 Yif1b Zmynd11 0 + + 0 + + 20 + + Unc50 Yipf2 Znhit3 0 + + 0 + + 0 + + Uqcrq Yipf3 Zswim1 0 + - 0 + + 0 + + Uso1 Yipf5 0 + + 0 + +