Genetic Variations of the Masked Palm Civet Paguma Larvata, Inferred from Mitochondrial Cytochrome B Sequences

Total Page:16

File Type:pdf, Size:1020Kb

Genetic Variations of the Masked Palm Civet Paguma Larvata, Inferred from Mitochondrial Cytochrome B Sequences Mammal Study 33: 19–24 (2008) © the Mammalogical Society of Japan Genetic variations of the masked palm civet Paguma larvata, inferred from mitochondrial cytochrome b sequences Ryuichi Masuda1,*, Yayoi Kaneko2, Boripat Siriaroonrat3, Vellayan Subramaniam4 and Masaharu Hamachi5 1 Department of Genome Dynamics, Creative Research Initiative “Sousei”, Hokkaido University, Sapporo 060-0810, Japan 2 Yamazaki College of Animal Health Technology, 4-7-2 Minami-osawa, Hachiouji 192-0046, Japan 3 Research and Conservation Division, Zoological Park Organization, Dusit, Bangkok 10300, Thailand 4 Zoo Negara Malaysia, 68000 Ampang, Selangor, Malaysia 5 Fukuoka Zoo, Fukuoka 810-0037, Japan Abstract. It is still unclear whether the masked palm civet (Paguma larvata) is native to the Japanese islands or introduced from the outside via human activities. In the present study, we sequenced the whole region (1,140 base-pairs) of the mitochondrial cytochrome b gene for 29 masked palm civets from Japan and Southeast Asia, and investigated their molecular phylogeography. Nine haplotypes were identified from the animals. Five halpotypes identified from 24 animals of Japan were clustered and separated from four haplotypes from five animals of Southeast Asia, showing clear differentiation between Japanese and Southeast Asian lineages. Sequence differences within Japanese haplotypes were smaller than those within Southeast Asian haplotypes and those between Japanese and Southeast Asian haplotypes. Within Japanese animals, all haplotypes found in eastern Honshu (Kanto district) were different from those of central Honshu (Chubu district). The present study highlighted the problem whether the Japanese Paguma larvata is an introduced species showing multiple original routes, or whether it is a native species genetically differentiated from Southeast Asian populations and even within Japan. Key words: cytochrome b, genetic variation, masked palm civet, Paguma larvata. The masked palm civet (Paguma larvata) is included in Torii (1993) reported no intraspecific variations of the family Viverridae and distributed widely in East, karyotypes and morphology within Japanese individuals Southeast, and West Asia (Lekagul and McNeely 1988; of Paguma larvata, and they presumed that introduction Corbet and Hill 1992). This animal is an only viverrid of this species through multiple routes resulted in the species currently living on the main islands of Japan current irregular distribution in Japan. In addition, (Abe et al. 2005). Since 1943 when their occurrence was Harada and Torii (1993) reported the morphological first recorded from Shizuoka Prefecture (Nawa 1965), difference of the Y chromosome of the Japanese animals, Paguma larvata has been found from various localities compared with that of the Chinese animals reported by of Japan (Kuroda 1955; Imaizumi 1960; Obara 1961) Wang et al. (1984), and showed occurrence of geographic and is currently distributed in eastern Honshu and variations of the Y chromosome. Despite these previous Shikoku (Torii 1996; Abe et al. 2005). However, at studies, there has not been enough data to conclude present there are no fossil nor archaeological records of whether Paguma larvata is native to the Japanese islands this species from the Japanese islands. In order to or introduced from the outside. In order to understand uncover the origins of the Japanese populations, some the origin and status of Paguma larvata of Japan, it is researchers have investigated their ecological character- essential to further investigate their phylogeographical istics (Torii 1986; Torii and Miyake 1986). Harada and and zoogeographical characteristics, compared with *To whom correspondence should be addressed. E-mail: [email protected] 20 Mammal Study 33 (2008) native populations living outside of Japan. In the present study, we report the findings from sequencing of the whole region (1,140 base-pairs, bp) of the mitochondrial DNA (mtDNA) cytochrome b gene for Paguma larvata from several areas of Japan and South- east Asia, and then discuss their genetic variations and the phylogenetic relationships. Materials and methods Samples and DNA extraction Muscle or hair samples were obtained from 24 indi- viduals collected from five localities (13 animals from Tokyo, one from Saitama, four from Ibaraki, four from Gifu, and two from Aichi Prefectures) of Japan and five individuals from Southeast Asia (four from Thailand and one from the Malay Peninsula: the precise locality in these countries was unknown) (Fig. 1). Muscle tissues of Japanese animals were collected from roadkill animals or pest control, and preserved in 70–99% ethanol at room temperature. Hair roots were obtained from living ani- mals during the course of ecological survey in Japan, and Fig. 1. Sampling localities of the masked palm civet Paguma larvata in Japan and haplotypes JA1, JA2, JA3, JA4 and JA5 iden- from zoo animals of Thailand (Duzit Zoo and Khao tified in the present study. Numerals in parentheses show numbers of Khew Open Zoo) and Malaysia (Zoo Negara Malaysia), animals having those haplotypes. and preserved at room temperature. Total DNA was extracted from muscle tissues (about 2 × 2 × 2 mm) using the DNeasy Tissue kit (Qiagen) and from hair sam- (Felsenstain 1985) and for the unrooted phylogenetic tree ples (about 30 hair roots per individual) using the DNA construction of haplotypes due to the neighbor-joining Micro kit (Qiagen), both in accordance with manufac- method (Saitou and Nei 1987). A parsimony network of turer’s instructions. The DNA extracts were subjected to haplotypes were constructed using the computer program polymerase chain reaction (PCR) analysis described TCS ver. 1.21 (Clement et al. 2000). One only sequence below. (accession no. AF125151: Veron and Heard 2000) of the whole region of the Paguma larvata cytochrome b PCR, nucleotide sequencing and data analysis available in DDBJ/Genebank/EMBL databases was also The PCR amplification of the whole region (1,140 bp) included for analysis, although the nucleotide site 1,113 of the cytochrome b gene and sequencing were per- of this sequence was reported to be “Y (C or T)” and its formed using the method same as Tamada et al. (2005). sampling locality was not available in the reference. In the present study, four additional sequencing primers labeled at the 5' end with the Texas Red were newly Results and discussion designed as follows: PLCBIN-1A (5'-TTTCAGAGAC- ATGAAACATTGG-3'); PCBIN-2 (5'-TAGCAATCAT- Variations of cytochrome b sequences identified from CCCACTACTAC-3'); PLCBIN-3 (5'-TCTGACTCAG- Paguma larvata ACAAAATCCC-3'); and PLCB-R1 (5'-GGCAAATAT- For the present study, we identified five haplotypes GGGTTACTGATG-3'). Sequence alignment was done (JA1, JA2, JA3, JA4 and JA5) of the cytochrome b from using GeneWorks (Intelligenetics). Molecular evolu- Japanese animals, and four haplotypes (SE1, SE2, SE3 tionary analysis was carried out using MEGA version 3.1 and SE4) were from Southeast Asian animals (Table 1). (Kumar et al. 2004) for calculations such as nucleotide The sequence alignment showed that all of the nucleotide compositions, sequence differences, genetic distances of substitutions were transitions (Table 1), except that the Kimura’s (1980) two-parameter model, bootstrap values sequence (accession no. AF125151: Veron and Heard Masuda et al., Genetic variations of Paguma larvata 21 Table 1. Nucleotide sequences of cytochrome b of the masked palm civet Paguma larvata Nucleotide site no. Accession Haplotype no.* 46 123 178 179 252 280 285 297 312 315 333 342 408 417 471 519 591 741 749 840 891 947 1113 JA1 GCATTTTACTGCCCACGTTTGTT AB303951 JA2 ••••••••TC•••••••••••••AB303952 JA3 ••••C••••••••••••••••••AB303953 JA4 A••••••••••••••••••••••AB303954 JA5 ••••••••••••••••A••••••AB303955 SE1 •T••••••••••••GT•••••••AB303956 SE2 •T••••••••••••GT•••••C•AB303957 SE3 •T•C•••••••T••GT••C••••AB303958 SE4 •T•••••••••••••T••••A••AB303959 AF125151•TG• •CCC• •A•AA•T•C•A• •Y Haplotypes JA1, JA2, JA3, JA4, JA5, SE1, SE2, SE3 and SE4 were identified in the present study. The sequence (accession no. AF125151; Veron and Heard 2000) has Y (C or T) at site 1113. Dots indicate identities with nucleotides of JA1. * Accession numbers will appear in the DDBJ nucleotide database. Table 2. Pairwise comparisons of cytochrome b haplotypes of Paguma larvata Haplotype JA1 JA2 JA3 JA4 JA5 SE1 SE2 SE3 SE4 AF125151 JA1 2111346311 JA20.18333568513 JA30.090.2622457412 JA40.090.260.182457412 JA50.090.260.180.18457412 SE1 0.26 0.44 0.35 0.35 0.35 1 3 2 10 SE2 0.35 0.53 0.44 0.44 0.44 0.09 4 3 11 SE3 0.53 0.70 0.61 0.61 0.61 0.26 0.35 5 13 SE4 0.26 0.44 0.35 0.35 0.35 0.18 0.26 0.44 10 AF125151 0.97 1.14 1.05 1.05 1.05 0.88 0.97 1.14 0.88 Percentage differences are shown below the digonal and numbers of different nucleotides are indicated above diagonal. 2000) available in the DNA databases had some trans- The sequence differences varied 0.09–0.26% (0.18% on versions to all haplotypes (JA1, JA2, JA3, JA4, JA5, average) within the Japanese haplotypes, 0.09–0.44% SE1, SE2, SE3 and SE4) identified in the present study. (0.26% on average) within the Southeast Asian haplo- All transitions among haplotypes occurred at 13 sites types and 0.26–0.70% (0.34% on average) between the (Table 1). When AF125151 was included, five transi- Japanese and Southeast Asian haplotypes (Table 2). tional and four transversional sites were observed, in These values of sequence differences within obtained addition to the 13 polymorphic sites (Table 1). The aver- haplotypes of Paguma larvata show a degree similar to age relative nucleotide frequencies among the obtained intraspecific differences of the cytochrome b gene of sequences (except AF125151) was A = 30.8%, G = other small carnivore species in Japan: less than 1.58% 12.2%, C = 26.7% and T = 30.3%. These values were in the Japanese marten (Martes melampus) and less than similar to those of the Owston’s palm civet (Chrotogale 0.35% in the sable (Martes zibellina) (Kurose et al.
Recommended publications
  • The Taxonomic Status of Badgers (Mammalia, Mustelidae) from Southwest Asia Based on Cranial Morphometrics, with the Redescription of Meles Canescens
    Zootaxa 3681 (1): 044–058 ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2013 Magnolia Press ISSN 1175-5334 (online edition) http://dx.doi.org/10.11646/zootaxa.3681.1.2 http://zoobank.org/urn:lsid:zoobank.org:pub:035D976E-D497-4708-B001-9F8DC03816EE The taxonomic status of badgers (Mammalia, Mustelidae) from Southwest Asia based on cranial morphometrics, with the redescription of Meles canescens ALEXEI V. ABRAMOV1 & ANDREY YU. PUZACHENKO2 1Zoological Institute, Russian Academy of Sciences, Universitetskaya nab. 1, 199034 St. Petersburg, Russia. E-mail: [email protected] 2Institute of Geography, Russian Academy of Sciences, Staromonetnyi per. 22, 109017 Moscow, Russia. E-mail: [email protected] Abstract The Eurasian badgers (Meles spp.) are widespread in the Palaearctic Region, occurring from the British Islands in the west to the Japanese Islands in the east, including the Scandinavia, Southwest Asia and southern China. The morphometric vari- ation in 30 cranial characters of 692 skulls of Meles from across the Palaearctic was here analyzed. This craniometric anal- ysis revealed a significant difference between the European and Asian badger phylogenetic lineages, which can be further split in two pairs of taxa: meles – canescens and leucurus – anakuma. Overall, European badger populations are very sim- ilar morphologically, particularly with regards to the skull shape, but differ notably from those from Asia Minor, the Mid- dle East and Transcaucasia. Based on the current survey of badger specimens available in main world museums, we have recognized four distinctive, parapatric species: Meles meles, found in most of Europe; Meles leucurus from continental Asia; M.
    [Show full text]
  • Ecologists Warn of Japanese Badger Cull 'Crisis' : Nature News & Comment
    NATURE | NEWS Ecologists warn of Japanese badger cull 'crisis' Population crash feared amid a fad for badger meat. Tim Hornyak 09 June 2017 alpsdake/CC BY-SA 4.0 The Japanese badger (Meles anakuma). On Japan’s Kyushu Island, farmers regularly trap and spear local badgers, which are regarded as pests. But ecologists say the practice is getting out of hand. In Kyushu’s Kagoshima Prefecture, they note, killings spiked from a few hundred to more than 4,000 last year — and that might lead to a population crash. “If the cull continues at this pace, there’s a possibility the Japanese badger could become extinct,” says Yayoi Kaneko, an ecologist at Tokyo University of Agriculture and Technology. A culinary fad for badger meat in Japan's restaurants is also taking off, although it's unclear if that is driving the culls, or is a response to the ready supply. Japan’s government should intervene in the cull and take scientific advice on whether it is sustainable, the scientists say. Ecological crisis Kaneko and two other ecologists, Christina Buesching and Chris Newman at the University of Oxford, UK, first raised their concerns in a correspondence published in Nature on 13 April 1. They warned that the rise in killings could lead to an “ecological crisis” unfolding, and say that the cull is being carried out “without scientific advice or strategic planning”. The Japanese badger (Meles Related stories Related stories anakuma) is endemic to Japan. It is • Japan: Unjustified killing • Japan: Unjustified killing smaller than its European of badgers in Kyushu of badgers in Kyushu counterpart and has less-distinct facial stripes.
    [Show full text]
  • The 2008 IUCN Red Listings of the World's Small Carnivores
    The 2008 IUCN red listings of the world’s small carnivores Jan SCHIPPER¹*, Michael HOFFMANN¹, J. W. DUCKWORTH² and James CONROY³ Abstract The global conservation status of all the world’s mammals was assessed for the 2008 IUCN Red List. Of the 165 species of small carni- vores recognised during the process, two are Extinct (EX), one is Critically Endangered (CR), ten are Endangered (EN), 22 Vulnerable (VU), ten Near Threatened (NT), 15 Data Deficient (DD) and 105 Least Concern. Thus, 22% of the species for which a category was assigned other than DD were assessed as threatened (i.e. CR, EN or VU), as against 25% for mammals as a whole. Among otters, seven (58%) of the 12 species for which a category was assigned were identified as threatened. This reflects their attachment to rivers and other waterbodies, and heavy trade-driven hunting. The IUCN Red List species accounts are living documents to be updated annually, and further information to refine listings is welcome. Keywords: conservation status, Critically Endangered, Data Deficient, Endangered, Extinct, global threat listing, Least Concern, Near Threatened, Vulnerable Introduction dae (skunks and stink-badgers; 12), Mustelidae (weasels, martens, otters, badgers and allies; 59), Nandiniidae (African Palm-civet The IUCN Red List of Threatened Species is the most authorita- Nandinia binotata; one), Prionodontidae ([Asian] linsangs; two), tive resource currently available on the conservation status of the Procyonidae (raccoons, coatis and allies; 14), and Viverridae (civ- world’s biodiversity. In recent years, the overall number of spe- ets, including oyans [= ‘African linsangs’]; 33). The data reported cies included on the IUCN Red List has grown rapidly, largely as on herein are freely and publicly available via the 2008 IUCN Red a result of ongoing global assessment initiatives that have helped List website (www.iucnredlist.org/mammals).
    [Show full text]
  • Molecular Phylogeny and Taxonomy of the Genus Mustela
    Mammal Study 33: 25–33 (2008) © the Mammalogical Society of Japan Molecular phylogeny and taxonomy of the genus Mustela (Mustelidae, Carnivora), inferred from mitochondrial DNA sequences: New perspectives on phylogenetic status of the back-striped weasel and American mink Naoko Kurose1, Alexei V. Abramov2 and Ryuichi Masuda3,* 1 Department of Biological Sciences, Faculty of Science, Kanagawa University, Kanagawa 259-1293, Japan 2 Zoological Institute, Russian Academy of Sciences, Saint-Petersburg 199034, Russia 3 Creative Research Initiative “Sousei”, Hokkaido University, Sapporo 060-0810, Japan Abstract. To further understand the phylogenetic relationships among the mustelid genus Mustela, we newly determined nucleotide sequences of the mitochondrial 12S rRNA gene from 11 Eurasian species of Mustela, including the domestic ferret and the American mink. Phylogenetic relationships inferred from the 12S rRNA sequences were similar to those based on previously reported mitochondrial cytochrome b data. Combined analyses of the two genes demonstrated that species of Mustela were divided into two primary clades, named “the small weasel group” and “the large weasel group”, and others. The Japanese weasel (Mustela itatsi) formerly classified as a subspecies of the Siberian weasel (M. sibirica), was genetically well-differentiated from M. sibirica, and the two species clustered with each other. The European mink (M. lutreola) was closely related to “the ferret group” (M. furo, M. putorius, and M. eversmanii). Both the American mink of North America and the back-striped weasel (M. strigidorsa) of Southeast Asia were more closely related to each other than to other species of Mustela, indicating that M. strigidorsa originated from an independent lineage that differs from other Eurasian weasels.
    [Show full text]
  • Revealed Via Genomic Assessment of Felid Cansines
    Evolutionary and Functional Impacts of Short Interspersed Nuclear Elements (SINEs) Revealed via Genomic Assessment of Felid CanSINEs By Kathryn B. Walters-Conte B. S., May 2000, University of Maryland, College Park M. S., May 2002, The George Washington University A Dissertation Submitted to The Faculty of Columbian College of Arts and Sciences of The George Washington University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy May 15 th , 2011 Dissertation Directed By Diana L.E. Johnson Associate Professor of Biology Jill Pecon-Slattery Staff Scientist, National Cancer Institute . The Columbian College of Arts and Sciences of The George Washington University certifies that Kathryn Walters-Conte has passed the Final Examination for the degree of Doctor of Philosophy as of March 24 th , 2011. This is the final and approved form of the dissertation. Evolutionary and Functional Impacts of Short Interspersed Nuclear Elements (SINEs) Revealed via Genomic Assessment of Felid CanSINEs Kathryn Walters-Conte Dissertation Research Committee: Diana L.E. Johnson, Associate Professor of Biology, Dissertation Co-Director Jill Pecon-Slattery, Staff Scientist, National Cancer Institute, Dissertation Co-Director Diana Lipscomb, Ronald Weintraub Chair and Professor, Committee Member Marc W. Allard, Research Microbiologist, U.S. Food and Drug Administration, Committee Member ii Acknowledgements I would like to first thank my advisor and collaborator, Dr. Jill Pecon-Slattery, at the National Cancer Institute of the National Institutes of Health, for generously permitting me to join her research group. Without her mentorship this dissertation would never have been possible. I would also like to express gratitude to my advisor at the George Washington University, Dr.
    [Show full text]
  • Small Carnivore CAMP 1993.Pdf
    SMALL CARNIVORE CONSERVATION ASSESSMENT AND MANAGEMENT PLAN Final Review Draft Report 1G May 1994 Edited and compiled by Roland Wirth, Angela Glatston, Onnie Byers, Susie Ellis, Pat Foster-Turley, Paul Robinson, Harry Van Rompaey, Don Moore, Ajith Kumar, Roland Melisch, and Ulysses Seal Prepared by the participants of a workshop held in Rotterdam, The Netherlands 11-14 February 1993 A Collaborative Workshop IUCN/SSC MUSTELID, VIVERRID, AND PROCYONID SPECIALIST GROUP IUCN/SSC OTTER SPECIALIST GROUP IUCN/SSC CAPTIVE BREEDING SPECIALIST GROUP Sponsored by The Rotterdam Zoo IUCN/SSC Sir Peter Scott Fund United Kingdom Small Carnivore Taxon Advisory Group A contribution of the IUCN/SSC Captive Breeding Specialist Group, IUCN/SSC Mustelid, Viverrid, and Procyonid Specialist Group and the IUCN/SSC Otter Specialist Group. The Primary Sponsors of the Workshop were: The Rotterdam Zoo, IUCN/SSC Peter Scott Fund, United Kingdom Small Carnivore Taxon Advisory Group. Cover Photo: Malayan Civet, Viverra tangalunga by Roland Wirth. Wirth, R., A Glatston, 0. Byers, S. Ellis, P. Foster-Turley, P. Robinson, H. Van Rompaey, D. Moore, A Kumar, R. Melisch, U.Seal. (eds.). 1994. Small Carnivore Conservation Assessment and Management Plan. IUCN/SSC Captive Breeding Specialist Group: Apple Valley, MN. Additional copies of this publication can be ordered through the IUCN/SSC Captive Breeding Specialist Group, 12101 Johnny Cake Ridge Road, Apple Valley, MN 55124. Send checks for US $35.00 (for printing and shipping costs) payable to CBSG; checks must be drawn on a US Bank. Funds may be wired to First Bank NA ABA No. 091000022, for credit to CBSG Account No.
    [Show full text]
  • Summer 2010 in Japan
    Summer 2010 in Japan From Late June through early August I spent my time in Japan doing research in relation to my dissertation, as part of the EAPSI Fellowship I was awarded. This was my first time in East Asia (or really, Asia) so of course I tried to get as many lifers of birds, mammals, and herps as possible. However most of my trips were bird focused and of short duration, as I generally only had a weekend (or usually a single day) for birding and mammalwatching. Also July and August are rather horrible months to be in Japan, with high humidity and heat, and animal activity tended to be rather low. Probably the most rewarding (mammal wise) was a night drive with Neil Davidson, an expat birder, in Ashyu forest near Kyoto. I managed 4 lifer mammals on this trip. Major references I used were the excellent Wild Mammals of Japan, the old and increasingly out of date bird finding guide to Japan (which actually contains a lot of good mammalwatching info) and the Kantori birding list. Japanese Macaque: Iwatayama Monkey Park I made a special Saturday morning visit to Iwatayama Monkey park in June to see this species, which is basically guaranteed. The monkeys are fed here and so a large troop is resident at the top of the steep hill. For a couple of hundred yen tourists can buy food to feed monkeys through the chainlink feeding hut at the top. Overall good lucks, but expect a zoo like atmosphere. Convenient for visitors in Kyoto, and covered in the Lonely Planet Guide for Japan Eurasian Red Squirrel: Supposedly common, but like the Siberian Chipmunk only a last minute encounter, and only encountered at Obhiro Forest Park in Hokkaido, where they were fairly common Japanese Squirrel: One individual seen near bird feeders at the Mount Fuji Bird Sanctuary.
    [Show full text]
  • Evolutionary Dynamics of Pathoadaptation Revealed by Three Independent Acquisitions of the Virb/D4 Type IV Secretion System in Bartonella
    GBE Evolutionary Dynamics of Pathoadaptation Revealed by Three Independent Acquisitions of the VirB/D4 Type IV Secretion System in Bartonella Alexander Harms1,6, Francisca H.I.D. Segers2,7, Maxime Quebatte1, Claudia Mistl1, Pablo Manfredi1, Jonas Ko¨ rner1, Bruno B. Chomel3,MichaelKosoy4, Soichi Maruyama5, Philipp Engel2,and Christoph Dehio1,* 1Focal Area Infection Biology, Biozentrum, University of Basel, Switzerland 2Department of Fundamental Microbiology, University of Lausanne, Switzerland 3Department of Population Health and Reproduction, School of Veterinary Medicine, University of California Davis 4Bacterial Diseases Branch, Division of Vector-Borne Disease, Centers for Disease Control and Prevention, Fort Collins, Colorado 5Laboratory of Veterinary Public Health, Department of Veterinary Medicine, College of Bioresource Sciences, Nihon University, Tokyo, Japan 6Present address: Department of Biology, Center of Excellence for Bacterial Stress Response and Persistence, University of Copenhagen, Denmark 7Present address: Institute of Zoology, Johannes Gutenberg University Mainz, Germany *Corresponding author: E-mail: [email protected]. Accepted: March 3, 2017 Data deposition: The genome sequences of all (re)sequenced or reannotated bartonellae have been deposited in the NCBI GenBank database under BioProject accession PRJNA360985 with accession numbers KY583505 (B. ancashensis 20.00), CP019789 (genome of B. schoenbuchensis R1), CP019790 (pVbh of B. schoenbuchensis R1), CP019489 (B. sp. 1-1c), CP019780 (B. sp. A1379B), MUYE00000000 (B. sp. AR15-3), CP019782 (B. sp. CDCskunk), CP019785 (B. sp. Coyote22sub2), CP019784 (B. sp. HoopaDog 114), CP019783 (B. sp. HoopaFox 11B), CP019787 (B. sp. JB15), CP019788 (B. sp. JB63), CP019786 (B. sp. Raccoon60), MUBG00000000 (B. sp. SikaDeer WD12.1), CP019781 (B. sp. SikaDeer WD16.2), and MUYW00000000 (B. taylorii IBS296). All sequence alignments are available from the corresponding author upon request.
    [Show full text]
  • Temporal Niche Partitioning Between Carnivores Differs Depending on The
    Temporal niche partitioning between carnivores differs depending on the analytical method: comparison between temporal overlap and co- occurrence, and time-to-encounter analyses Ryoga Watabe Yamagata University Hiroshi Tsunoda Center for Environmental Science in Saitama Masayuki U. Saito ( [email protected] ) Yamagata University Research Article Keywords: Temporal niche partitioning, carnivores, analytical method, temporal overlap, time-to-encounter analyses, co-occurrence Posted Date: August 26th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-841897/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/21 Abstract Temporal niche partitioning is one of the most important strategies for carnivore coexistence. Camera- trap data has been analyzed through several methods to assess the temporal niche partitioning. When different analytical approaches used to evaluate niche partitioning detect different results, the mechanisms of species coexistence may be misinterpreted. As such, it is important to evaluate the temporal niche partitioning from multiple analytical approaches. In this study, we compared three analytical methods–the temporal overlap, temporal co-occurrence, and time-to-encounter analysis–to evaluate the temporal niche partitioning among sympatric medium-sized carnivores: red foxes, raccoon dogs, and Japanese martens. From May to October 2019 and 2020, we obtained the activity of the target species using camera-traps in northeastern Japan. We analyzed the data with the coecient of temporal overlap, probabilistic co-occurrence analysis, checkerboard score, and multi-response permutation procedures. The results of the assessment of the niche partitioning differed depending on the analytical methods. Therefore, we conclude that the choice of analytical approach is important for understanding the mechanisms of species coexistence through temporal niche partitioning.
    [Show full text]
  • Standards for Caniform Sanctuaries
    Global Federation of Animal Sanctuaries Standards For Caniform Sanctuaries Version: February, 2018 ©2012 Global Federation of Animal Sanctuaries Global Federation of Animal Sanctuaries – Standards for Caniform Sanctuaries Table of Contents INTRODUCTION...................................................................................................................................... 1 GFAS PRINCIPLES ................................................................................................................................................... 1 ANIMALS COVERED BY THESE STANDARDS ............................................................................................................ 1 STANDARDS UPDATES……………………………………………………………………………………………………………………………………….. 4 CANIFORM STANDARDS ........................................................................................................................................ 4 CANIFORM HOUSING ............................................................................................................................ 5 H-1. Types of Space and Size ..................................................................................................................................... 5 H-2. Containment ...................................................................................................................................................... 7 H-3. Ground and Plantings ........................................................................................................................................
    [Show full text]
  • Long Live the King the Future of Eaza’S King Penguin Population
    QUARTERLY PUBLICATION OF THE EUROPEAN ASSOCIATION OF ZOOS AND AQUARIA WINTERZ 2013/14OO QUARIAISSUE 84 LONG LIVE THE KING THE FUTURE OF EAZA’S KING PENGUIN POPULATION Gene genius HOW GENETIC STUDIES CAN BENEFIT THE GREAT APES 1 1 Age of aquariums MEET JOAO FALCATO, CHAIR OF EAZA’S AQUARIUM COMMITTEE Contents Zooquaria Winter 2013/14 6 12 20 32 4 From the Director’s chair 19 Breeding Programme There’s a brighter way to spread the The quest continues for a solution to the problem conservation message of sub-specific hybridised African lions in zoos 5 Announcements 20 Campaigns A round-up of news from EAZA including King penguins, tackling climate change, and a exciting births and hatchings look back at the SE Asia Campaign 9 Endangered animals 26 Education A conservation breeding programme will help How the IUCN Red List is being introduced to a us find out more about the ecology of the saola larger audience 12 International cooperation 28 Collection management Long-distance teaching methods that could Why it’s important to bring more mustelids back help save the black rhino. Plus, a look at to our zoos how Brazil is making its way back onto the 30 international zoological map Training How funding can help growing zoos gain 16 Interview experience through international internships Meet Joao Falcato, the new chair of EAZA’s 32 Aquarium Committee Science Conservation of the great apes can be enhanced through a greater study of genetics Zooquaria EDITORIAL BOARD: EAZA Executive Office, PO Box 20164, 1000 HD Amsterdam, The Netherlands.
    [Show full text]
  • May 16, 2011 Federal Trade Commission Office of the Secretary
    May 16, 2011 Federal Trade Commission Office of the Secretary, Room H–113 (Annex O) 600 Pennsylvania Avenue, NW Washington, DC 20580 RE: Advance Notice of Proposed Rulemaking under the Fur Products Labeling Act; Matter No. P074201 On behalf of the more than 11 million members and supporters of The Humane Society of the United States (HSUS), I submit the following comments to be considered regarding the Federal Trade Commission’s (FTC) advance notice of proposed rulemaking under the federal Fur Products Labeling Act (FPLA), 16 U.S.C. § 69, et seq. The rulemaking is being proposed in response to the Truth in Fur Labeling Act (TFLA), Public Law 111–113, enacted in December 2010, which eliminates the de minimis value exemption from the FPLA, 16 U.S.C. § 69(d), and directs the FTC to initiate a review of the Fur Products Name Guide, 16 C.F.R. 301.0. Thus, the FTC indicated in its notice that it is specifically seeking comment on the Name Guide, though the agency is also generally seeking comment on its fur rules in their entirety. As discussed below, the HSUS believes that there is a continuing need for the fur rules and for more active enforcement of these rules by the FTC. The purpose of the FPLA and the fur rules is to ensure that consumers receive truthful and accurate information about the fur content of the products they are purchasing. Unfortunately, sales of unlabeled and mislabeled fur garments, and inaccurate or misleading advertising of fur garments, remain all too common occurrences in today’s marketplace.
    [Show full text]