DOCSLIB.ORG

High Mda-7 Expression Promotes Malignant Cell Survival and P38 MAP Kinase Activation in Chronic Lymphocytic Leukemia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
High Mda-7 Expression Promotes Malignant Cell Survival and P38 MAP Kinase Activation in Chronic Lymphocytic Leukemia Leukemia (2006) 20, 498–504 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE High Mda-7 expression promotes malignant cell survival and p38 MAP kinase activation in chronic lymphocytic leukemia A Sainz-Perez1,3, H Gary-Gouy1,3, A Portier1, F Davi2, H Merle-Beral2, P Galanaud1 and A Dalloul1 1INSERM Unite´ 131, IFR 13, Universite´ Paris XI 32 Rue des Carnets, Clamart, France and 2Laboratoire d’He´matologie, Hoˆpital de la Pitie´-Salpeˆtrie`re, Paris, France Chronic lymphocytic leukemia (CLL)-B-cells are quiescent stimulation with auto-antigen, a condition shown to induce differentiated cells that produce interleukin (IL)-10 and accu- anergy,13 and CD5 expression on B-cells in experimental models.14 mulate due to resistance to apoptosis. The mechanisms Whether CD5 plays a role in CLL B-cell survival is not yet underlying such resistance are poorly understood. Herein we clear. We have however observed that, contrary to the majority show that all CLL B-cells tested (30/30) display high mRNA and À þ protein expression of the tumor suppressor Mda-7/IL-24, an of CD5 B cells, normal CD5 blood B cells displayed a low IL-10 family member, in comparison to normal B cells. A Ca2 þ response following anti-IgM stimulation,15 confirming the downstream Mda-7 signaling target, p38 mitogen-activated role of CD5 as a negative regulator of BCR signaling.16,17 Even protein kinase (MAPK) was highly phosphorylated in all CLL though BCR-mediated activation is often deficient in CLL, CD5 cells but not in normal B-cells. Mda-7 expression and p38 MAPK may act independently of the BCR by recruiting signaling phosphorylation diminished in culture and the latter could be molecules,18,19 and eliciting the production of B-cell survival reinduced by recombinant (r)-IL-24 or LPS and Mda-7 transfec- 15 tion. Mda-7/IL-24 siRNA specifically inhibited p38 MAPK factors such as interleukin (IL)-10. phosphorylation in CLL without affecting p38 MAPK, bcl2, or IL-10 is indeed produced by most CLL B-cells,20 improves the Lyn expression, further demonstrating the direct role of Mda-7/ survival of malignant CLL B-cells,21 and IL-10 serum levels in IL-24 in p38 MAPK activation. Both pharmacological inhibition CLL correlated with the severity of the disease.22 We compared of p38 MAPK and Mda-7 silencing augmented spontaneous mRNAs from vector- and CD5-transduced Daudi cells,15 by apoptosis by three-fold in CLL cells cultured in autologous means of Affymetrix DNA chips. We found that all IL-10 family serum, which was reversed by LPS and r-IL-24. We established 23 the role of p38 MAPK in CLL cell survival and demonstrated a genes, and receptors were upregulated in CD5-transfected vs paradoxical effect, whereby Mda-7 and IL-24, inducers of vector-transfected Daudi cells (article in preparation). Among apoptosis in diverse cancer cells, promote the survival of CLL these cytokines, IL-24,24 is an alternative transcript of Mda-7, a B-cells through p38 MAPK activation. gene encoding a melanoma differentiation antigen that func- Leukemia (2006) 20, 498–504. doi:10.1038/sj.leu.2404073; tions as a tumor suppressor in the context of cancer cells.25 We published online 12 January 2006 Keywords: CLL; apoptosis; p38MAP kinase; Mda-7; Interleukin-24; confirmed by real-time PCR the augmented expression of Mda- CD5 7/IL-24 transcripts in CD5 þ Daudi cells, and in the CD5 þ B-cell population from normal adult blood in comparison to CD5-negative B-cells. Our DNA chips data were also validated by RT-PCR for IL-10, IL-19 and IL-20.23 Mda-7/IL-24 mRNA Introduction expression in CLL was more than 10-fold that in normal B-cells and a positive correlation between CD5 and Mda-7/RNA B-cell chronic lymphocytic leukemia (CLL) is characterized by expression was found on randomly analyzed CLL samples. This the progressive accumulation of circulating CD5 þ monoclonal prompted us to study the function of Mda-7/IL-24 in CLL. We B-cells.1,2 These cells contrary to normal B-lymphocytes are show herein that this gene acts as a survival factor in part refractory to activation by mitogens,3,4 and have quantitative through phosphorylation of the p38 mitogen-activated protein and qualitative deficiencies in the B-cell receptor (BCR) kinase (MAPK) protein and the importance of this latter pathway expression and signaling.1,2,5,6 As a consequence, these cells in CLL is highlighted in this work. display a resting phenotype, often respond poorly to activation and are mostly in G0/early G1 phase of the cell cycle,7–9 a characteristic that may protect them from drugs- and activation- Materials and methods induced apoptosis.10 CLL cells have been considered as anergic although this may be CLL samples especially true for those with mutated IgV genes. CLL B cells have Blood samples from patients (22 treated, eight untreated) and 18 membrane markers of mature antigen-experienced cells.11 More- samples from healthy donors were processed after they had over, in up to 70% of cases, their mutational status within Ig V given informed consent to the Pitie´-Salpeˆtrie`re university regions suggest that they have passed through germinal centers.12 In hospital. Patients were 18 males and 12 females, with ages ranging from 49 to 87 years old and lymphocyte counts ranging addition, their mature phenotype associated with a low BCR 3 expression suggest that they have been submitted to a chronic from 3940 to 113 000/mm , with % lymphocytes/PBMC ranging from 32.6 to 97% PBMC were isolated by density centrifugation 15 Correspondence: Dr A Dalloul, INSERM Unite´ 131, 32 Rue des and B-cells were negatively selected as described. Carnets, 92140 Clamart, France. E-mail: [email protected] 3These two authors contributed equally to this work. Cell culture and reagents Received 17 August 2005; revised 31 October 2005; accepted 7 Daudi cells and PBMC from healthy donors and patients were November 2005; published online 12 January 2006 cultured in RPMI medium supplemented with 10% FCS or 10% Mda-7/IL-24 and p38 MAP kinase activation in CLL A Sainz-Perez et al 499 autologous serum, Penicilline (100 U/ml), Streptomycine The schematic structure of the IL-24 gene (Figure 1) was (100 mg/ml), 2 mML-glutamate and 1 mM sodium pyruvate copied from SV Kotenko. The family of IL-10-related cytokines (Invitrogen, Cergy, France). Cells were incubated with r-IL-2, and their receptors: related but to what extent? Cytokine and r-IL-24, (all from R&D systems, Lille, France) at respective final Growth Factor Reviews 2002; 13: 223–240. 0 concentrations of 50 ng/ml and 100 ng/ml. Affinipure F(ab )2 polyclonal Rabbit anti-human IgM (Jackson Immunotech, West Grove, USA) was used at 2 mg/ml and LPS from Escherichia coli RNA interference and gene transfer into CLL cells 6 (VWR International SAS, Fontenay sous bois, France) was used 10 Â 10 CLL-B cells/condition were transfected with 100 nM of at 10 mg/ml. SB 203580 in solution (lot#B64038) (Calbiochem) Mda-7/IL-24 siRNA (Dharmacon cat # M-007977-01) or control was used at doses ranging from 1 to 20 mM. For apoptosis siRNA; or with 10 mg of either empty vector or Mda7 inserted studies, cells were stained with the Apo 2.7 mAb (Beckman- into PCI-neo vector, using the Human B Cell Nucleofectort Kit Coulter, Villepinte, France). (AMAXA, Ko¨ln, Germany) following to the manufacturer’s instructions (selected program U-15). Cells were processed as indicated postnucleofection. Control siRNA or Human Mda-7/ Cell lines and RT-PCR IL-24 siRNA were synthesized annealed, desalted, 20 depro- Full-length cDNA for IL-24 and Mda-7 were amplified by PCR, tected and purified by Dharmacon Inc. (La Fayette Co.). To using the following primers: estimate transfection efficacy, cells were transfected with IL-24: Sense :ggctcgagctcaaatgcagatggttgtgctccc, fluorescent control siRNA: siGLO RISC-free siRNA Dharmacon Opp: aagaggccgctcagagcttgtagaatttctgcat. cat # D-001600-01, a fluorescently labeled siRNA with Mda-7: Sense :gctcgagcgatgaattttcaacagaggctgcaa, impaired ability for RISC interaction and with X4 mismatches Opp: aagcggccgctcagagcttgtagatttctgcat. with known human genes. PCR products were inserted into PCI-neo vector (Promega) at XhoI and NotI sites and cloned in Top-10 bacteria. Preps from empty vector or insert-containing vectors were linearized with Western blots BglII and Daudi cells (5 Â 106 cells) mixed with 20 mg of each CLL cells were processed from fresh blood and washed at room 6 plasmid and electroporated as described.15 Exon 1a-containing temperature in a serum-free RPMI–10 mM HEPES. Cells (2 Â 10 7 region was amplified by RT-PCR in CLL samples using the Daudi, or 10 PBMC or CLL) were lysed at 41C for 30 min in lysis following primers: Sense: gcctgattggtgaatggt, Opp : ctctccgca buffer (20 mM Tris-Hcl, pH 7.5, 140 mM NaCl, 1 mM EDTA, tccgagacgtt. Expression of the different IL-24 receptor subunits 50 U/ml aprotinin, 1 mM PMSF, 1 mM sodium orthovanadate) were analyzed by classic polymerase chain reaction using PCR containing 1% nonidet-P-40 detergent. 60 mg proteins/sample Master Mix (Promega, Charbonnie`res, France) and the following were separated on SDS-PAGE gels under reducing conditions, primers synthesized by Proligo (Paris, France): electrotransferred onto PVDF membranes (Amersham), and blotted with antiphospho-p38 MAPK (T180/Y182) rabbit poly- clonal antibody (R&D) then with anti p38 MAPK mAb (A-12, IL20R1, forward: ccctgtgtctctggtggttt, Santa-Cruz, Heidelberg, Germany) after stripping.
Load more

Recommended publications
  • Interleukin-10 Family and Tuberculosis: an Old Story Renewed Abualgasim Elgaili Abdalla1, 2, Nzungize Lambert1, Xiangke Duan1, Jianping Xie1
    Int. J. Biol. Sci. 2016, Vol. 12 710 Ivyspring International Publisher International Journal of Biological Sciences 2016; 12(6): 710-717. doi: 10.7150/ijbs.13881 Review Interleukin-10 Family and Tuberculosis: An Old Story Renewed Abualgasim Elgaili Abdalla1, 2, Nzungize Lambert1, Xiangke Duan1, Jianping Xie1 1. Institute of Modern Biopharmaceuticals, State Key Laboratory Breeding Base of Eco-Environment and Bio-Resource of the Three Gorges Area, Key Laboratory of Eco-environments in Three Gorges Reservoir Region, Ministry of Education, School of Life Sciences, Southwest University, Beibei, Chongqing 400715, China. 2. Department of Clinical Microbiology, College of Medical Laboratory Sciences, Omdurman Islamic University, Omdurman, Khartoum, Sudan. Corresponding author: Jianping Xie E-mail: [email protected] Tel&Fax: 862368367108. © Ivyspring International Publisher. Reproduction is permitted for personal, noncommercial use, provided that the article is in whole, unmodified, and properly cited. See http://ivyspring.com/terms for terms and conditions. Received: 2015.09.17; Accepted: 2016.01.15; Published: 2016.04.27 Abstract The interleukin-10 (IL-10) family of cytokines consists of six immune mediators, namely IL-10, IL-19, IL-20, IL-22, IL-24 and IL-26. IL-10, IL-22, IL-24 and IL-26 are critical for the regulation of host defense against Mycobacterium tuberculosis infections. Specifically, IL-10 and IL-26 can suppress the antimycobacterial immunity and promote the survival of pathogen, while IL-22 and IL-24 can generate protective responses and inhibit the intracellular growth of pathogen. Knowledge about the new players in tuberculosis immunology, namely IL-10 family, can inform novel immunity-based countermeasures and host directed therapies against tuberculosis.
    [Show full text]
  • Expression of Interleukin-24 and Its Receptor in Human Pancreatic Myofibroblasts
    INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 28: 993-999, 2011 Expression of interleukin-24 and its receptor in human pancreatic myofibroblasts HIROTSUGU IMAEDA1, ATSUSHI NISHIDA1, OSAMU INATOMI1, YOSHIHIDE FUJIYAMA1 and AKIRA ANDOH2 1Department of Medicine and 2Division of Mucosal Immunology, Graduate School of Medicine, Shiga University of Medical Science, Seta Tsukinowa, Otsu, Japan Received July 12, 2011; Accepted August 30, 2011 DOI: 10.3892/ijmm.2011.793 Abstract. Interleukin (IL)-24 is a member of the IL-10 family broblasts play a pivotal role in the progression of pancreatic of cytokines. In this study, we investigated IL-24 expression fibrosis (1-6). Pancreatic myofibroblasts actively proliferate, in chronic pancreatitis tissue and characterized the molecular migrate and produce large amounts of extracellular matrix mechanisms responsible for IL-24 expression in human (ECM) components such as type I collagen and fibronectin. pancreatic myofibroblasts. IL-24 expression in the tissues was In addition, these cells possess proinflammatory functions evaluated by immunohistochemical methods. IL-24 mRNA characterized by the expression of cytokines, chemokines and and protein expression in the pancreatic myofibroblasts was cell adhesion molecules (1-6). determined by real-time-PCR and ELISA, respectively. IL-24 Interleukin (IL)-24, a member of the IL-10 family of was expressed by α-smooth muscle actin-positive myofibro- cytokines (together with IL-10, -19, -20, -22, -26, -28 and -29), blasts in the chronic pancreatitis tissues. In isolated human was originally termed melanoma differentiation-associated pancreatic myofibroblasts, IL-1β significantly enhanced IL-24 protein 7 (MDA-7) (7), and was renamed IL-24 (8). The mRNA and protein expression.
    [Show full text]
  • Evolutionary Divergence and Functions of the Human Interleukin (IL) Gene Family Chad Brocker,1 David Thompson,2 Akiko Matsumoto,1 Daniel W
    UPDATE ON GENE COMPLETIONS AND ANNOTATIONS Evolutionary divergence and functions of the human interleukin (IL) gene family Chad Brocker,1 David Thompson,2 Akiko Matsumoto,1 Daniel W. Nebert3* and Vasilis Vasiliou1 1Molecular Toxicology and Environmental Health Sciences Program, Department of Pharmaceutical Sciences, University of Colorado Denver, Aurora, CO 80045, USA 2Department of Clinical Pharmacy, University of Colorado Denver, Aurora, CO 80045, USA 3Department of Environmental Health and Center for Environmental Genetics (CEG), University of Cincinnati Medical Center, Cincinnati, OH 45267–0056, USA *Correspondence to: Tel: þ1 513 821 4664; Fax: þ1 513 558 0925; E-mail: [email protected]; [email protected] Date received (in revised form): 22nd September 2010 Abstract Cytokines play a very important role in nearly all aspects of inflammation and immunity. The term ‘interleukin’ (IL) has been used to describe a group of cytokines with complex immunomodulatory functions — including cell proliferation, maturation, migration and adhesion. These cytokines also play an important role in immune cell differentiation and activation. Determining the exact function of a particular cytokine is complicated by the influence of the producing cell type, the responding cell type and the phase of the immune response. ILs can also have pro- and anti-inflammatory effects, further complicating their characterisation. These molecules are under constant pressure to evolve due to continual competition between the host’s immune system and infecting organisms; as such, ILs have undergone significant evolution. This has resulted in little amino acid conservation between orthologous proteins, which further complicates the gene family organisation. Within the literature there are a number of overlapping nomenclature and classification systems derived from biological function, receptor-binding properties and originating cell type.
    [Show full text]
  • Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
    Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651
    [Show full text]
  • Autocrine Regulation of Mda-7/IL-24 Mediates Cancer-Specific Apoptosis
    Autocrine regulation of mda-7/IL-24 mediates cancer-specific apoptosis Moira Sauane*, Zao-zhong Su*†‡, Pankaj Gupta*, Irina V. Lebedeva*, Paul Dent‡§¶, Devanand Sarkar*†‡¶ʈ, and Paul B. Fisher*†‡¶ʈ**†† Departments of *Urology, ʈPathology, and **Neurosurgery, College of Physicians and Surgeons, Columbia University, New York, NY 10032; and Departments of †Human and Molecular Genetics and §Biochemistry and Molecular Biology, ¶Virginia Commonwealth Universtiy Institute of Molecular Medicine, ‡Massey Cancer Center, School of Medicine, Virginia Commonwealth University, School of Medicine, Richmond, VA 23298 Communicated by George J. Todaro, Targeted Growth, Inc., Seattle, WA, April 29, 2008 (received for review January 19, 2008) A noteworthy aspect of melanoma differentiation-associated immunostimulatory, radiosensitizing and ‘‘bystander’’ antitumor gene-7/interleukin-24 (mda-7/IL-24) as a cancer therapeutic is its activities (6, 11, 17, 18). ability to selectively kill cancer cells without harming normal mda-7/IL-24 expression is detected in human tissues and cells cells. Intracellular MDA-7/IL-24 protein, generated from an ad- associated with the immune system such as spleen, thymus, periph- enovirus expressing mda-7/IL-24 (Ad.mda-7), induces cancer- eral blood leukocytes, and normal melanocytes (19). Secreted specific apoptosis by inducing an endoplasmic reticulum (ER) MDA-7/IL-24 stimulates monocytes and specific populations of T stress response. Secreted MDA-7/IL-24 protein, generated from lymphocytes and promotes proinflammatory cytokine production. cells infected with Ad.mda-7, induces growth inhibition and When expressed at low, presumably physiological levels, MDA-7/ apoptosis in surrounding noninfected cancer cells but not in IL-24 binds to currently recognized MDA-7/IL-24 receptor com- normal cells, thus exerting an anti-tumor ‘‘bystander’’ effect.
    [Show full text]
  • Interleukin-24 (Il-24) Is Suppressed by Pax3-Foxo1 and Is a Novel
    Author Manuscript Published OnlineFirst on September 6, 2018; DOI: 10.1158/1535-7163.MCT-18-0118 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 1 INTERLEUKIN-24 (IL-24) IS SUPPRESSED BY PAX3-FOXO1 AND IS A NOVEL THERAPY FOR RHABDOMYOSARCOMA Alexandra Lacey1, Erik Hedrick1, Yating Cheng1, Kumaravel Mohankumar1, Melanie Warren2, and Stephen Safe1 1 Department of Veterinary Physiology and Pharmacology Texas A&M University College Station, TX 77843 2 Department of Molecular and Cellular Medicine Texas A&M Health Science Center College Station, TX 77843 Running Title: PAX3-FOXO1 regulates IL-24 in ARMS cells Keywords: ARMS, PAX3-FOXO1, IL-24, tumor inhibition Funding: Funding was provided by the National Institutes of Health (P30-ES023512), the Sid Kyle Endowment, and Texas AgriLife Research. To whom correspondence should be addressed: Stephen Safe Department of Veterinary Physiology and Pharmacology Texas A&M University 4466 TAMU College Station, TX 77843-4466 Tel: 979-845-5988 / Fax: 979-862-4929 Email: [email protected] Conflict of Interest: There are no conflicts of interest to declare. Word Count: 4535 words Figures: 7 figures Table: 0 tables Downloaded from mct.aacrjournals.org on September 29, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on September 6, 2018; DOI: 10.1158/1535-7163.MCT-18-0118 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 2 ABSTRACT Alveolar Rhabdomyosarcoma (ARMS) patients have a poor prognosis and this is primarily due to overexpression of the oncogenic fusion protein PAX3-FOXO1.
    [Show full text]
  • Human Cytokine Response Profiles
    Comprehensive Understanding of the Human Cytokine Response Profiles A. Background The current project aims to collect datasets profiling gene expression patterns of human cytokine treatment response from the NCBI GEO and EBI ArrayExpress databases. The Framework for Data Curation already hosted a list of candidate datasets. You will read the study design and sample annotations to select the relevant datasets and label the sample conditions to enable automatic analysis. If you want to build a new data collection project for your topic of interest instead of working on our existing cytokine project, please read section D. We will explain the cytokine project’s configurations to give you an example on creating your curation task. A.1. Cytokine Cytokines are a broad category of small proteins mediating cell signaling. Many cell types can release cytokines and receive cytokines from other producers through receptors on the cell surface. Despite some overlap in the literature terminology, we exclude chemokines, hormones, or growth factors, which are also essential cell signaling molecules. Meanwhile, we count two cytokines in the same family as the same if they share the same receptors. In this project, we will focus on the following families and use the member symbols as standard names (Table 1). Family Members (use these symbols as standard cytokine names) Colony-stimulating factor GCSF, GMCSF, MCSF Interferon IFNA, IFNB, IFNG Interleukin IL1, IL1RA, IL2, IL3, IL4, IL5, IL6, IL7, IL9, IL10, IL11, IL12, IL13, IL15, IL16, IL17, IL18, IL19, IL20, IL21, IL22, IL23, IL24, IL25, IL26, IL27, IL28, IL29, IL30, IL31, IL32, IL33, IL34, IL35, IL36, IL36RA, IL37, TSLP, LIF, OSM Tumor necrosis factor TNFA, LTA, LTB, CD40L, FASL, CD27L, CD30L, 41BBL, TRAIL, OPGL, APRIL, LIGHT, TWEAK, BAFF Unassigned TGFB, MIF Table 1.
    [Show full text]
  • RT² Profiler PCR Array (384-Well Format) Human Inflammatory Response & Autoimmunity
    RT² Profiler PCR Array (384-Well Format) Human Inflammatory Response & Autoimmunity Cat. no. 330231 PAHS-3803ZE For pathway expression analysis Format For use with the following real-time cyclers RT² Profiler PCR Array, Applied Biosystems® models 7900HT (384-well block), Format E ViiA™ 7 (384-well block); Bio-Rad CFX384™ RT² Profiler PCR Array, Roche® LightCycler® 480 (384-well block) Format G Description The Human Inflammatory Response & Autoimmunity RT² Profiler PCR Array profiles the expression of 370 key genes involved in immune response during autoimmunity and inflammation. It represents the expression of inflammatory cytokines, chemokines, and their receptors. It also contains genes related to the production and metabolism of cytokines. Genes involved in cytokine-cytokine receptor interactions are as well as thoroughly researched panels of genes involved in the acute-phase, inflammatory, and humoral immune responses. Using real-time PCR, you can easily and reliably analyze the expression of a focused panel of genes related to autoimmunity and inflammation with this array. For further details, consult the RT² Profiler PCR Array Handbook. Sample & Assay Technologies Shipping and storage RT² Profiler PCR Arrays in formats E and G are shipped at ambient temperature, on dry ice, or blue ice packs depending on destination and accompanying products. For long term storage, keep plates at –20°C. Note: Ensure that you have the correct RT² Profiler PCR Array format for your real-time cycler (see table above). Note: Open the package and store
    [Show full text]
  • Rh IL-24 / IL-10B)
    data sheet Recombinant Human Interleukin-24 (rh IL-24 / IL-10B) Synonyms: Suppression of Tumorigenicity 16 protein (ST16), Melanoma Differentiation-Associated gene 7 protein (MDA-7), C49A, FISP, Mob-5. Introduction: IL-24 is a member of the IL-10 family of cytokines. It was identified as a gene induced during terminal differentiation in melanoma cells. IL-24 encoded can induce apoptosis selectively in various cancer cells. Overexpression IL-24 leads to elevated expression of several GADD family genes which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38) and heat shock 27 kDa protein 1 (HSB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Alternatively spliced transcript variants encoding distinct isoforms have been reported. The glycosylation is essential for activity of IL-24. IL-24 has diverse functional activities. At low concentrations it induces type I proflammatory cytokines such as IFN-γ, IL-1β, IL-12 and TNF-α. At high concentration it is a strong inducer of apoptosis in tumor cells, but not normal cells. IL-24 is being hailed as a “magic bullet” for cancer gene therapy. Description: Recombinant human IL-24 produced in yeast is a single, glycosylated, polypeptide chain containing 158 amino acids and having a molecular mass of 18 kDa. As a result of glycosilation, the protein migrates at 19.5 kDa on SDS-Page. Source: Sacharomyces cerevisiae Physical Appearance: Sterile filtered white lyophilized (freeze-dried) powder. Formulation: Lyophilized from a 0.2µm filtered solution in PBS with BSA.
    [Show full text]
  • Uniprot Nr. Proseek Panel 2,4-Dienoyl-Coa Reductase, Mitochondrial
    Protein Name (Short Name) Uniprot Nr. Proseek Panel 2,4-dienoyl-CoA reductase, mitochondrial (DECR1) Q16698 CVD II 5'-nucleotidase (5'-NT) P21589 ONC II A disintegrin and metalloproteinase with thrombospondin motifs 13 (ADAM-TS13) Q76LX8 CVD II A disintegrin and metalloproteinase with thrombospondin motifs 15 (ADAM-TS 15) Q8TE58 ONC II Adenosine Deaminase (ADA) P00813 INF I ADM (ADM) P35318 CVD II ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase 1 (CD38) P28907 NEU I Agouti-related protein (AGRP) O00253 CVD II Alpha-2-macroglobulin receptor-associated protein (Alpha-2-MRAP) P30533 NEU I Alpha-L-iduronidase (IDUA) P35475 CVD II Alpha-taxilin (TXLNA) P40222 ONC II Aminopeptidase N (AP-N) P15144 CVD III Amphiregulin (AR) P15514 ONC II Angiopoietin-1 (ANG-1) Q15389 CVD II Angiopoietin-1 receptor (TIE2) Q02763 CVD II Angiotensin-converting enzyme 2 (ACE2) Q9BYF1 CVD II Annexin A1 (ANXA1) P04083 ONC II Artemin (ARTN) Q5T4W7 INF I Axin-1 (AXIN1) O15169 INF I Azurocidin (AZU1 P20160 CVD III BDNF/NT-3 growth factors receptor (NTRK2) Q16620 NEU I Beta-nerve growth factor (Beta-NGF) P01138 NEU I, INF I Bleomycin hydrolase (BLM hydrolase) Q13867 CVD III Bone morphogenetic protein 4 (BMP-4) P12644 NEU I Bone morphogenetic protein 6 (BMP-6) P22004 CVD II Brain-derived neurotrophic factor (BDNF) P23560 NEU I, INF I Brevican core protein (BCAN) Q96GW7 NEU I Brorin (VWC2) Q2TAL6 NEU I Brother of CDO (Protein BOC) Q9BWV1 CVD II Cadherin-3 (CDH3) P22223 NEU I Cadherin-5 (CDH5) P33151 CVD III Cadherin-6 (CDH6) P55285 NEU I Carbonic anhydrase 5A, mitochondrial
    [Show full text]
  • Characteristics of Cytokines in Regeneration of Injured Peripheral Nerves
    Characteristics of cytokines in regeneration of injured peripheral nerves Ruirui Zhang Nantong University Sailing Chen Nantong University Yinying Shen Nantong University Sheng Yi ( [email protected] ) Nantong University Hui Xu Nantong University Research Keywords: peripheral nerve injury, rat sciatic nerve crush injury, sciatic nerve stumps, dorsal root ganglia, upstream cytokines Posted Date: March 25th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-18898/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published on November 23rd, 2020. See the published version at https://doi.org/10.1186/s40779-020-00286-0. Page 1/16 Abstract Background Cytokines are essential cellular modulators of a variety of physiological and pathological activities, including peripheral nerve repair and regeneration. However, the molecular changes of these cellular mediators during peripheral nerve regeneration are not well claried. The study is aimed to discover critical cytokines for the regenerative process of injured peripheral nerves. Methods The sequencing data of the injured nerve stumps and the dorsal root ganglia (DRGs) of Sprague-Dawley (SD) rats subjected to sciatic nerve (SN) crush injury was analyzed to determine expression patterns of genes coding for cytokines. PCR experiments were used to validate the accuracy of sequencing data. Results A total of 46, 52, and 54 upstream cytokines were differentially expressed in SNs at 1 day, 4 days, and 7 days after nerve injury. And a total of 25, 28, and 34 upstream cytokines were differentially expressed in DRGs at these time points.
    [Show full text]
  • Is Suppressed by PAX3-FOXO1 and Is a Novel Therapy For
    Published OnlineFirst September 6, 2018; DOI: 10.1158/1535-7163.MCT-18-0118 Cancer Biology and Translational Studies Molecular Cancer Therapeutics Interleukin-24 (IL24) Is Suppressed by PAX3-FOXO1 and Is a Novel Therapy for Rhabdomyosarcoma Alexandra Lacey1, Erik Hedrick1, Yating Cheng1, Kumaravel Mohankumar1, Melanie Warren2, and Stephen Safe1 Abstract Alveolar rhabdomyosarcoma (ARMS) patients have a poor with results reported for this tumor suppressor–like cytokine prognosis, and this is primarily due to overexpression of the in other solid tumors. We also observed in double knockdown oncogenic fusion protein PAX3-FOXO1. Results of RNA- studies that the inhibition of ARMS cell proliferation, survival, sequencing studies show that PAX3-FOXO1 represses expres- and migration after knockdown of PAX3-FOXO1 was signif- sion of interleukin-24 (IL24), and these two genes are inverse- icantly (>75%) reversed by knockdown of IL24. Adenoviral- ly expressed in patient tumors. PAX3-FOXO1 also regulates expressed IL24 was directly injected into ARMS tumors in histone deacetylase 5 (HDAC5) in ARMS cells, and results of athymic nude mice, and this resulted in decreased tumor RNA interference studies confirmed that PAX3-FOXO1– growth and weight. Because adenoviral IL24 has already suc- mediated repression of IL24 is HDAC5-dependent. Knock- cessfully undergone phase I in clinical trials, this represents an down of PAX3-FOXO1 decreases ARMS cell proliferation, alternative approach (alone and/or combination) for treating survival, and migration, and we also observed similar ARMS patients who currently undergo cytotoxic drug thera- responses in cells after overexpression of IL24, consistent pies. Mol Cancer Ther; 17(12); 2756–66. Ó2018 AACR.
    [Show full text]