
Leukemia (2006) 20, 498–504 & 2006 Nature Publishing Group All rights reserved 0887-6924/06 $30.00 www.nature.com/leu ORIGINAL ARTICLE High Mda-7 expression promotes malignant cell survival and p38 MAP kinase activation in chronic lymphocytic leukemia A Sainz-Perez1,3, H Gary-Gouy1,3, A Portier1, F Davi2, H Merle-Beral2, P Galanaud1 and A Dalloul1 1INSERM Unite´ 131, IFR 13, Universite´ Paris XI 32 Rue des Carnets, Clamart, France and 2Laboratoire d’He´matologie, Hoˆpital de la Pitie´-Salpeˆtrie`re, Paris, France Chronic lymphocytic leukemia (CLL)-B-cells are quiescent stimulation with auto-antigen, a condition shown to induce differentiated cells that produce interleukin (IL)-10 and accu- anergy,13 and CD5 expression on B-cells in experimental models.14 mulate due to resistance to apoptosis. The mechanisms Whether CD5 plays a role in CLL B-cell survival is not yet underlying such resistance are poorly understood. Herein we clear. We have however observed that, contrary to the majority show that all CLL B-cells tested (30/30) display high mRNA and À þ protein expression of the tumor suppressor Mda-7/IL-24, an of CD5 B cells, normal CD5 blood B cells displayed a low IL-10 family member, in comparison to normal B cells. A Ca2 þ response following anti-IgM stimulation,15 confirming the downstream Mda-7 signaling target, p38 mitogen-activated role of CD5 as a negative regulator of BCR signaling.16,17 Even protein kinase (MAPK) was highly phosphorylated in all CLL though BCR-mediated activation is often deficient in CLL, CD5 cells but not in normal B-cells. Mda-7 expression and p38 MAPK may act independently of the BCR by recruiting signaling phosphorylation diminished in culture and the latter could be molecules,18,19 and eliciting the production of B-cell survival reinduced by recombinant (r)-IL-24 or LPS and Mda-7 transfec- 15 tion. Mda-7/IL-24 siRNA specifically inhibited p38 MAPK factors such as interleukin (IL)-10. phosphorylation in CLL without affecting p38 MAPK, bcl2, or IL-10 is indeed produced by most CLL B-cells,20 improves the Lyn expression, further demonstrating the direct role of Mda-7/ survival of malignant CLL B-cells,21 and IL-10 serum levels in IL-24 in p38 MAPK activation. Both pharmacological inhibition CLL correlated with the severity of the disease.22 We compared of p38 MAPK and Mda-7 silencing augmented spontaneous mRNAs from vector- and CD5-transduced Daudi cells,15 by apoptosis by three-fold in CLL cells cultured in autologous means of Affymetrix DNA chips. We found that all IL-10 family serum, which was reversed by LPS and r-IL-24. We established 23 the role of p38 MAPK in CLL cell survival and demonstrated a genes, and receptors were upregulated in CD5-transfected vs paradoxical effect, whereby Mda-7 and IL-24, inducers of vector-transfected Daudi cells (article in preparation). Among apoptosis in diverse cancer cells, promote the survival of CLL these cytokines, IL-24,24 is an alternative transcript of Mda-7, a B-cells through p38 MAPK activation. gene encoding a melanoma differentiation antigen that func- Leukemia (2006) 20, 498–504. doi:10.1038/sj.leu.2404073; tions as a tumor suppressor in the context of cancer cells.25 We published online 12 January 2006 Keywords: CLL; apoptosis; p38MAP kinase; Mda-7; Interleukin-24; confirmed by real-time PCR the augmented expression of Mda- CD5 7/IL-24 transcripts in CD5 þ Daudi cells, and in the CD5 þ B-cell population from normal adult blood in comparison to CD5-negative B-cells. Our DNA chips data were also validated by RT-PCR for IL-10, IL-19 and IL-20.23 Mda-7/IL-24 mRNA Introduction expression in CLL was more than 10-fold that in normal B-cells and a positive correlation between CD5 and Mda-7/RNA B-cell chronic lymphocytic leukemia (CLL) is characterized by expression was found on randomly analyzed CLL samples. This the progressive accumulation of circulating CD5 þ monoclonal prompted us to study the function of Mda-7/IL-24 in CLL. We B-cells.1,2 These cells contrary to normal B-lymphocytes are show herein that this gene acts as a survival factor in part refractory to activation by mitogens,3,4 and have quantitative through phosphorylation of the p38 mitogen-activated protein and qualitative deficiencies in the B-cell receptor (BCR) kinase (MAPK) protein and the importance of this latter pathway expression and signaling.1,2,5,6 As a consequence, these cells in CLL is highlighted in this work. display a resting phenotype, often respond poorly to activation and are mostly in G0/early G1 phase of the cell cycle,7–9 a characteristic that may protect them from drugs- and activation- Materials and methods induced apoptosis.10 CLL cells have been considered as anergic although this may be CLL samples especially true for those with mutated IgV genes. CLL B cells have Blood samples from patients (22 treated, eight untreated) and 18 membrane markers of mature antigen-experienced cells.11 More- samples from healthy donors were processed after they had over, in up to 70% of cases, their mutational status within Ig V given informed consent to the Pitie´-Salpeˆtrie`re university regions suggest that they have passed through germinal centers.12 In hospital. Patients were 18 males and 12 females, with ages ranging from 49 to 87 years old and lymphocyte counts ranging addition, their mature phenotype associated with a low BCR 3 expression suggest that they have been submitted to a chronic from 3940 to 113 000/mm , with % lymphocytes/PBMC ranging from 32.6 to 97% PBMC were isolated by density centrifugation 15 Correspondence: Dr A Dalloul, INSERM Unite´ 131, 32 Rue des and B-cells were negatively selected as described. Carnets, 92140 Clamart, France. E-mail: [email protected] 3These two authors contributed equally to this work. Cell culture and reagents Received 17 August 2005; revised 31 October 2005; accepted 7 Daudi cells and PBMC from healthy donors and patients were November 2005; published online 12 January 2006 cultured in RPMI medium supplemented with 10% FCS or 10% Mda-7/IL-24 and p38 MAP kinase activation in CLL A Sainz-Perez et al 499 autologous serum, Penicilline (100 U/ml), Streptomycine The schematic structure of the IL-24 gene (Figure 1) was (100 mg/ml), 2 mML-glutamate and 1 mM sodium pyruvate copied from SV Kotenko. The family of IL-10-related cytokines (Invitrogen, Cergy, France). Cells were incubated with r-IL-2, and their receptors: related but to what extent? Cytokine and r-IL-24, (all from R&D systems, Lille, France) at respective final Growth Factor Reviews 2002; 13: 223–240. 0 concentrations of 50 ng/ml and 100 ng/ml. Affinipure F(ab )2 polyclonal Rabbit anti-human IgM (Jackson Immunotech, West Grove, USA) was used at 2 mg/ml and LPS from Escherichia coli RNA interference and gene transfer into CLL cells 6 (VWR International SAS, Fontenay sous bois, France) was used 10 Â 10 CLL-B cells/condition were transfected with 100 nM of at 10 mg/ml. SB 203580 in solution (lot#B64038) (Calbiochem) Mda-7/IL-24 siRNA (Dharmacon cat # M-007977-01) or control was used at doses ranging from 1 to 20 mM. For apoptosis siRNA; or with 10 mg of either empty vector or Mda7 inserted studies, cells were stained with the Apo 2.7 mAb (Beckman- into PCI-neo vector, using the Human B Cell Nucleofectort Kit Coulter, Villepinte, France). (AMAXA, Ko¨ln, Germany) following to the manufacturer’s instructions (selected program U-15). Cells were processed as indicated postnucleofection. Control siRNA or Human Mda-7/ Cell lines and RT-PCR IL-24 siRNA were synthesized annealed, desalted, 20 depro- Full-length cDNA for IL-24 and Mda-7 were amplified by PCR, tected and purified by Dharmacon Inc. (La Fayette Co.). To using the following primers: estimate transfection efficacy, cells were transfected with IL-24: Sense :ggctcgagctcaaatgcagatggttgtgctccc, fluorescent control siRNA: siGLO RISC-free siRNA Dharmacon Opp: aagaggccgctcagagcttgtagaatttctgcat. cat # D-001600-01, a fluorescently labeled siRNA with Mda-7: Sense :gctcgagcgatgaattttcaacagaggctgcaa, impaired ability for RISC interaction and with X4 mismatches Opp: aagcggccgctcagagcttgtagatttctgcat. with known human genes. PCR products were inserted into PCI-neo vector (Promega) at XhoI and NotI sites and cloned in Top-10 bacteria. Preps from empty vector or insert-containing vectors were linearized with Western blots BglII and Daudi cells (5 Â 106 cells) mixed with 20 mg of each CLL cells were processed from fresh blood and washed at room 6 plasmid and electroporated as described.15 Exon 1a-containing temperature in a serum-free RPMI–10 mM HEPES. Cells (2 Â 10 7 region was amplified by RT-PCR in CLL samples using the Daudi, or 10 PBMC or CLL) were lysed at 41C for 30 min in lysis following primers: Sense: gcctgattggtgaatggt, Opp : ctctccgca buffer (20 mM Tris-Hcl, pH 7.5, 140 mM NaCl, 1 mM EDTA, tccgagacgtt. Expression of the different IL-24 receptor subunits 50 U/ml aprotinin, 1 mM PMSF, 1 mM sodium orthovanadate) were analyzed by classic polymerase chain reaction using PCR containing 1% nonidet-P-40 detergent. 60 mg proteins/sample Master Mix (Promega, Charbonnie`res, France) and the following were separated on SDS-PAGE gels under reducing conditions, primers synthesized by Proligo (Paris, France): electrotransferred onto PVDF membranes (Amersham), and blotted with antiphospho-p38 MAPK (T180/Y182) rabbit poly- clonal antibody (R&D) then with anti p38 MAPK mAb (A-12, IL20R1, forward: ccctgtgtctctggtggttt, Santa-Cruz, Heidelberg, Germany) after stripping.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages7 Page
-
File Size-