KCNK17 (NM 031460) Human Recombinant Protein – TP306399
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Potassium Channels in Epilepsy
Downloaded from http://perspectivesinmedicine.cshlp.org/ on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Potassium Channels in Epilepsy Ru¨diger Ko¨hling and Jakob Wolfart Oscar Langendorff Institute of Physiology, University of Rostock, Rostock 18057, Germany Correspondence: [email protected] This review attempts to give a concise and up-to-date overview on the role of potassium channels in epilepsies. Their role can be defined from a genetic perspective, focusing on variants and de novo mutations identified in genetic studies or animal models with targeted, specific mutations in genes coding for a member of the large potassium channel family. In these genetic studies, a demonstrated functional link to hyperexcitability often remains elusive. However, their role can also be defined from a functional perspective, based on dy- namic, aggravating, or adaptive transcriptional and posttranslational alterations. In these cases, it often remains elusive whether the alteration is causal or merely incidental. With 80 potassium channel types, of which 10% are known to be associated with epilepsies (in humans) or a seizure phenotype (in animals), if genetically mutated, a comprehensive review is a challenging endeavor. This goal may seem all the more ambitious once the data on posttranslational alterations, found both in human tissue from epilepsy patients and in chronic or acute animal models, are included. We therefore summarize the literature, and expand only on key findings, particularly regarding functional alterations found in patient brain tissue and chronic animal models. INTRODUCTION TO POTASSIUM evolutionary appearance of voltage-gated so- CHANNELS dium (Nav)andcalcium (Cav)channels, Kchan- nels are further diversified in relation to their otassium (K) channels are related to epilepsy newer function, namely, keeping neuronal exci- Psyndromes on many different levels, ranging tation within limits (Anderson and Greenberg from direct control of neuronal excitability and 2001; Hille 2001). -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Rabbit Anti-KCNK17 Antibody-SL16900R
SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-KCNK17 antibody SL16900R Product Name: KCNK17 Chinese Name: 钾离子Channel protein17抗体 2P domain potassium channel Talk 2; 2P domain potassium channel Talk-2; acid sensitive potassium channel protein TASK 4; Acid-sensitive potassium channel protein TASK-4; K2p17.1; KCNK17; KCNKH_HUMAN; Potassium channel subfamily K Alias: member 17; Potassium channel, subfamily K, member 17; TALK 2; TALK-2; TALK2; TASK 4; TASK4; TWIK related acid sensitive K(+) channel 4; TWIK related alkaline pH activated K(+) channel 2; TWIK-related acid-sensitive K(+) channel 4; TWIK- related alkaline pH-activated K(+) channel 2. Organism Species: Rabbit Clonality: Polyclonal React Species: Human, ELISA=1:500-1000IHC-P=1:400-800IHC-F=1:400-800ICC=1:100-500IF=1:100- 500(Paraffin sections need antigen repair) Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 37kDa Cellular localization: Thewww.sunlongbiotech.com cell membrane Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLH conjugated synthetic peptide derived from human KCNK17:231-332/332 Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. -
Ion Channels 3 1
r r r Cell Signalling Biology Michael J. Berridge Module 3 Ion Channels 3 1 Module 3 Ion Channels Synopsis Ion channels have two main signalling functions: either they can generate second messengers or they can function as effectors by responding to such messengers. Their role in signal generation is mainly centred on the Ca2 + signalling pathway, which has a large number of Ca2+ entry channels and internal Ca2+ release channels, both of which contribute to the generation of Ca2 + signals. Ion channels are also important effectors in that they mediate the action of different intracellular signalling pathways. There are a large number of K+ channels and many of these function in different + aspects of cell signalling. The voltage-dependent K (KV) channels regulate membrane potential and + excitability. The inward rectifier K (Kir) channel family has a number of important groups of channels + + such as the G protein-gated inward rectifier K (GIRK) channels and the ATP-sensitive K (KATP) + + channels. The two-pore domain K (K2P) channels are responsible for the large background K current. Some of the actions of Ca2 + are carried out by Ca2+-sensitive K+ channels and Ca2+-sensitive Cl − channels. The latter are members of a large group of chloride channels and transporters with multiple functions. There is a large family of ATP-binding cassette (ABC) transporters some of which have a signalling role in that they extrude signalling components from the cell. One of the ABC transporters is the cystic − − fibrosis transmembrane conductance regulator (CFTR) that conducts anions (Cl and HCO3 )and contributes to the osmotic gradient for the parallel flow of water in various transporting epithelia. -
Ion Channels
UC Davis UC Davis Previously Published Works Title THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels. Permalink https://escholarship.org/uc/item/1442g5hg Journal British journal of pharmacology, 176 Suppl 1(S1) ISSN 0007-1188 Authors Alexander, Stephen PH Mathie, Alistair Peters, John A et al. Publication Date 2019-12-01 DOI 10.1111/bph.14749 License https://creativecommons.org/licenses/by/4.0/ 4.0 Peer reviewed eScholarship.org Powered by the California Digital Library University of California S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: Ion channels. British Journal of Pharmacology (2019) 176, S142–S228 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: Ion channels Stephen PH Alexander1 , Alistair Mathie2 ,JohnAPeters3 , Emma L Veale2 , Jörg Striessnig4 , Eamonn Kelly5, Jane F Armstrong6 , Elena Faccenda6 ,SimonDHarding6 ,AdamJPawson6 , Joanna L Sharman6 , Christopher Southan6 , Jamie A Davies6 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 3Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 4Pharmacology and Toxicology, Institute of Pharmacy, University of Innsbruck, A-6020 Innsbruck, Austria 5School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 6Centre for Discovery Brain Science, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. -
Experimental Eye Research 129 (2014) 93E106
Experimental Eye Research 129 (2014) 93e106 Contents lists available at ScienceDirect Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer Transcriptomic analysis across nasal, temporal, and macular regions of human neural retina and RPE/choroid by RNA-Seq S. Scott Whitmore a, b, Alex H. Wagner a, c, Adam P. DeLuca a, b, Arlene V. Drack a, b, Edwin M. Stone a, b, Budd A. Tucker a, b, Shemin Zeng a, b, Terry A. Braun a, b, c, * Robert F. Mullins a, b, Todd E. Scheetz a, b, c, a Stephen A. Wynn Institute for Vision Research, The University of Iowa, Iowa City, IA, USA b Department of Ophthalmology and Visual Sciences, Carver College of Medicine, The University of Iowa, Iowa City, IA, USA c Department of Biomedical Engineering, College of Engineering, The University of Iowa, Iowa City, IA, USA article info abstract Article history: Proper spatial differentiation of retinal cell types is necessary for normal human vision. Many retinal Received 14 September 2014 diseases, such as Best disease and male germ cell associated kinase (MAK)-associated retinitis pigmen- Received in revised form tosa, preferentially affect distinct topographic regions of the retina. While much is known about the 31 October 2014 distribution of cell types in the retina, the distribution of molecular components across the posterior pole Accepted in revised form 4 November 2014 of the eye has not been well-studied. To investigate regional difference in molecular composition of Available online 5 November 2014 ocular tissues, we assessed differential gene expression across the temporal, macular, and nasal retina and retinal pigment epithelium (RPE)/choroid of human eyes using RNA-Seq. -
And Right-Sided Colon Cancer Wangxiong Hu1, Yanmei Yang2, Xiaofen Li1,3, Minran Huang1, Fei Xu1, Weiting Ge1, Suzhan Zhang1,4, and Shu Zheng1,4
Published OnlineFirst November 29, 2017; DOI: 10.1158/1541-7786.MCR-17-0483 Genomics Molecular Cancer Research Multi-omics Approach Reveals Distinct Differences in Left- and Right-Sided Colon Cancer Wangxiong Hu1, Yanmei Yang2, Xiaofen Li1,3, Minran Huang1, Fei Xu1, Weiting Ge1, Suzhan Zhang1,4, and Shu Zheng1,4 Abstract Increasing evidence suggests that left-sided colon cancer determined between LCC and RCC. Especially for Prostate (LCC) and right-sided colon cancer (RCC) are emerging as two Cancer Susceptibility Candidate 1 (PRAC1), a gene that was different colorectal cancer types with distinct clinical character- closely associated with hypermethylation, was the top signif- istics. However, the discrepancy in the underlying molecular icantly downregulated gene in RCC. Multi-omics comparison event between these types of cancer has not been thoroughly of LCC and RCC suggests that there are more aggressive markers elucidated to date and warrants comprehensive investigation. in RCC and that tumor heterogeneity occurs within the loca- To this end, an integrated dataset from The Cancer Genome tion-based subtypes of colon cancer. These results clarify the Atlas was used to compare and contrast LCC and RCC, covering debate regarding the conflicting prognosis between LCC and mutation, DNA methylation, gene expression, and miRNA. RCC, as proposed by different studies. Briefly, the signaling pathway cross-talk is more prevalent in RCC than LCC, such as RCC-specific PI3K pathway, which often Implications: The underlying molecular features present in LCC exhibits cross-talk with the RAS and P53 pathways. Meanwhile, and RCC identified in this study are beneficial for adopting methylation signatures revealed that RCC was hypermethylated reasonable therapeutic approaches to prolong overall survival relative to LCC. -
Supplementary Information Genomic Variations in Paired Normal Controls
Supplementary Information Genomic variations in paired normal controls for lung adenocarcinomas Li-Wei Qu,1* Bo Zhou,1,2* Gui-Zhen Wang,1 Ying Chen,1 Guang-Biao Zhou1# Supplementary Figures and Legends Supplementary Tables 1 Figure S1. Study design of this study. 2 Figure S2. Comparison of genomic variations in CNCs and tumors in smokers and nonsmokers. 3 Figure S3. The KEGG and GO analyses of the CNC mutations. (A) The GO analysis of pathways altered in CNCs. (B). KEGG analysis. 4 Supplementary Tables Table S1. Sequences of primers used to validate genomic variations in normal lung tissues. Gene name Sequence F1: GGATGGAGGACTGGAAGATG R1: GGTTATAGAGTGAGGGCAGGA ZNF521 F2: ATGGAGGACTGGAAGATGAA R2: AAGAGTGTTGAGGTCGTTGA F1: GGCATCTCCCTGGGTAGTGG R1: CAAGGCGCTTGTGAGGTAAG TMC6 F2:GCCTGTGGTGAGCCCATCCT R2:CAGTCGCCAATCAGCCGTGT F1: AGTCAGTCCTCCCGGCATCA R1: GCCTTCTCCCTCCACTCAATCT CEP250 F2: CAGGCAGTGCTCAAGGAACG R2: CCCTGGCTTCTGTCTGTCTCA F1: GGGTTCATGCTATCATCTGG R1: CTCCTCGGACCTCACTGCTC UNC93A F2: TTGCTTGGAGTTGTCTTGCCTTTC R2: TTGACCTGTCCTGGAGCGTGGG F1: TGCTCAGGACGACAGAAGGC R1: AGAAGGTGGAAATGCGGAAGT C9orf66 F2: AAAGGAAGGAGCCGTTTATGAGA R2: CGGCTTAGAAGGTGGAAATGC F1: CAATCATCACTCAGCGTCTC R1: GCTGGCTTCTTTACCTTCTTA HIST1H1D F2: AGAGCCTGTGCTATTGTTCC R2: AGCTTGATACGGCTGTTGTT 5 Table S2. The characteristics of the 513 patients whose samples were analyzed in this study. Characteristics Total (n=513) Lung tissue (n=135) Blood (n=378) Gender Male 239 58 181 Female 274 77 197 Age (years) <65 219 61 158 ≥65 275 74 201 n.d. 19 0 19 Median (range) 66 (33 – 68) 66 (39 – 86) 66 (33 – 68) Race White 389 110 279 Black 50 21 29 Asian 8 2 6 n.d. 66 2 64 Smoking Smoker 425 114 311 Non-smoker 74 14 60 n.d. 14 7 7 Histology Adenocarcinoma 481 128 353 Bronchioloalveolar carcinoma 23 4 19 Mucinous (colloid) carcinoma 9 3 6 Survival Alive 388 79 309 Dead 125 56 69 Anatomic subdivision R-lower 96 20 76 R-middle 23 7 16 R-upper 182 42 140 L-lower 77 20 57 L-middle 0 0 0 L-upper 122 39 83 Bronchial 1 0 1 n.d. -
Gene and Microrna Signatures and Their Trajectories Characterizing Human Ipsc-Derived Nociceptor Maturation
bioRxiv preprint doi: https://doi.org/10.1101/2021.06.07.447056; this version posted June 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. NOCICEPTRA: Gene and microRNA signatures and their trajectories characterizing human iPSC-derived nociceptor maturation Maximilian Zeidler1, Kai K. Kummer*,1, Clemens L. Schöpf1, Theodora Kalpachidou1, Georg Kern1, M. Zameel Cader2 and Michaela Kress*,1,§ 1 Institute of Physiology, Medical University of Innsbruck, Innsbruck, 6020, Austria. 2 Weatherall Institute of Molecular Medicine, University of Oxford, Oxford, OX3 9DS, United Kingdom. * Shared correspondence § Lead contact Corresponding authors: Univ.-Prof. Michaela Kress, MD Kai Kummer, PhD Medical University of Innsbruck Medical University of Innsbruck Institute of Physiology Institute of Physiology Schoepfstraße 41/EG Schoepfstraße 41/EG 6020 Innsbruck 6020 Innsbruck Austria Austria Phone: 0043-512-9003-70800 Phone: 0043-512-9003-70849 Fax: 0043-512-9003-73800 Fax: 0043-512-9003-73800 E-Mail: [email protected] E-Mail: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.07.447056; this version posted June 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Nociceptors are primary afferent neurons serving the reception of acute pain but also the transit into maladaptive pain disorders. Since native human nociceptors are hardly available for mechanistic functional research, and rodent models do not necessarily mirror human pathologies in all aspects, human iPSC-derived nociceptors (iDN) offer superior advantages as a human model system. -
Recurrent Copy Number Changes in Mentally Retarded Children Harbour Genes Involved in Cellular Localization and the Glutamate Receptor Complex
European Journal of Human Genetics (2010) 18, 39–46 & 2010 Macmillan Publishers Limited All rights reserved 1018-4813/10 $32.00 www.nature.com/ejhg ARTICLE Recurrent copy number changes in mentally retarded children harbour genes involved in cellular localization and the glutamate receptor complex Martin Poot*,1, Marc J Eleveld1, Ruben van ‘t Slot1, Hans Kristian Ploos van Amstel1 and Ron Hochstenbach1 To determine the phenotypic significance of copy number changes (CNCs) in the human genome, we performed genome-wide segmental aneuploidy profiling by BAC-based array-CGH of 278 unrelated patients with multiple congenital abnormalities and mental retardation (MCAMR) and in 48 unaffected family members. In 20 patients, we found de novo CNCs composed of multiple consecutive probes. Of the 125 probes making up these probably pathogenic CNCs, 14 were also found as single CNCs in other patients and 5 in healthy individuals. Thus, these CNCs are not by themselves pathogenic. Almost one out of five patients and almost one out of six healthy individuals in our study cohort carried a gain or a loss for any one of the recently discovered microdeletion/microduplication loci, whereas seven patients and one healthy individual showed losses or gains for at least two different loci. The pathogenic burden resulting from these CNCs may be limited as they were found with similar frequencies among patients and healthy individuals (P¼0.165; Fischer’s exact test), and several individuals showed CNCs at multiple loci. CNCs occurring specifically in our study cohort were enriched for components of the glutamate receptor family (GRIA2, GRIA4, GRIK2 and GRIK4) and genes encoding proteins involved in guiding cell localization during development (ATP1A2, GIRK3, GRIA2, KCNJ3, KCNJ10, KCNK17 and KCNK5). -
A Genetic Investigation of the Muscle and Neuronal Channelopathies: from Sanger to Next – Generation Sequencing
A Genetic Investigation of the Muscle and Neuronal Channelopathies: From Sanger to Next – Generation Sequencing Alice Gardiner MRC Centre for Neuromuscular Diseases and UCL Institute of Neurology Supervised by Professor Henry Houlden and Professor Mike Hanna 1 Declaration I, Alice Gardiner, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Signature A~~~ . Date ~.'t..J.q~ l.?,.q.l.~ . 2 Abstract The neurological channelopathies are a group of hereditary, episodic and frequently debilitating diseases often caused by dysfunction of voltage-gated ion channels. This thesis reports genetic studies of carefully clinically characterised patient cohorts with different episodic neurological and neuromuscular disorders including paroxysmal dyskinesias, episodic ataxia, periodic paralysis and episodic rhabdomyolysis. Genetic and clinical heterogeneity has in the past, using traditional Sanger sequencing methods, made genetic diagnosis difficult and time consuming. This has led to many patients and families being undiagnosed. Here, different sequencing technologies were employed to define the genetic architecture in the paroxysmal disorders. Initially, Sanger sequencing was employed to screen the three known paroxysmal dyskinesia genes in a large cohort of paroxysmal movement disorder patients and smaller mixed episodic phenotype cohort. A genetic diagnosis was achieved in 39% and 13% of the cohorts respectively, and the genetic and phenotypic overlap was highlighted. Subsequently, next-generation sequencing panels were developed, for the first time in our laboratory. Small custom-designed amplicon-based panels were used for the skeletal muscle and neuronal channelopathies. They offered considerable clinical and practical benefit over traditional Sanger sequencing and revealed further phenotypic overlap, however there were still problems to overcome with incomplete coverage. -
Investigating the Roles of Neurogenin 3 in Human Pancreas and Intestine
University of Cincinnati March 2, 2016 Investigating the roles of Neurogenin 3 in human pancreas and intestine development and disease. A dissertation submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate Program in Molecular and Developmental Biology of the College of Medicine by Patrick Sean McGrath Bachelor of Science, Colorado State University, May 2009 Committee Chair: James M. Wells, Ph.D. Brian Gebelein, Ph.D. Michael A. Helmrath, MD, MS Stacey S. Huppert, Ph.D. Aaron M. Zorn, Ph.D. Summary The incidence of diabetes mellitus, a disease defined by the inability to properly regulate glucose, is increasing at an alarming rate and affects an estimated 26 million people in the U.S. creating an economic cost of $245 billion per year (American Diabetes, 2013). Glucose homeostasis is regulated through a complex interplay of hormones produced by both the pancreatic and intestinal endocrine systems. Neurogenin 3 is a basic helix-loop-helix (bHLH) transcription factor which acts as a “master regulator” of endocrine cell specification. Mouse studies have shown Neurog3 to be necessary and sufficient for the formation of all endocrine lineages in both the pancreas and intestine. Human patients harboring NEUROG3 mutations have a complete loss of intestinal endocrine cells, but surprisingly retain at least some endocrine pancreas function, calling into question whether NEUROG3 is required for human endocrine pancreas development. To test this directly, we generated human embryonic stem cell (hESC) lines where both alleles of NEUROG3 were disrupted using CRISPR/Cas9-mediated gene targeting.