Iroquois Homeobox 3 Is an Essential Transcription Factor in the Maintenance of Proper Electrical Propagation and Development of the Ventricular Conduction System

Iroquois Homeobox 3 is an Essential Transcription Factor in the Maintenance of Proper Electrical Propagation and Development of the Ventricular Conduction System

Anna Rosen

A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Physiology University of Toronto

Iroquois Homeobox 3 is an Essential Transcription Factor in the Maintenance of Proper Electrical Propagation and Development of the Ventricular Conduction System

Anna Rosen

Master of Science

Department of Physiology University of Toronto

2010

ABSTRACT

The specialized myocytes of the ventricular conduction system (VCS) coordinate ventricular contraction and are critical for efficient pumping by the heart. Impaired VCS conduction is characteristic of inherited forms of cardiac conduction disorders. Here we show that the Iroquois homeobox 3 (Irx3) transcription factor is preferentially expressed in the developing and mature

VCS. Loss of Irx3 in mice results in slowed VCS conduction and prolonged QRS duration with right bundle branch block, caused by reduction (42%) in VCS-specific connexin 40 (Cx40) expression and VCS fiber hypoplasia, absent in littermate controls. Therefore, we show that the role of Irx3 in the heart is two-fold, whereby Irx3 (1) indirectly regulates Cx40 gene expression, by repressing a repressor of Cx40 transcript, and (2) controls VCS maturation, possibly in an

Nkx2-5-dependent manner. To our knowledge, this is the first report of a role for Irx3 in regulating the development and function of the VCS.

ACKNOWLEDGMENTS

I would first like to thank my supervisor Dr. Peter Backx whose attentiveness, guidance and expertise added considerably to my graduate experience. Peter’s contagious passion for science, combined with his excellence in teaching allowed me to gain invaluable experience in the lab aiding in my development as a young scientist. I would also like to thank Peter for his advice and support of my future interests in a veterinary career which combined with his great sense of humour made my graduate studies both valuable and enjoyable.

I would also like to thank my committee members Dr. Scott Heximer and Dr. Peter Pennefather for their insight and stimulating suggestions and discussions. Their guidance throughout this process has been outstanding. I am especially indebted to my collaborator and committee member, Dr. Chi-Chung Hui, for his new prospective on the project allowing it to proceed in new and exciting directions which have greatly contributed to the quality of this thesis.

I would like to show my gratitude to all former and current members of Dr. Backx’s laboratory, which have made my working environment enjoyable, supportive and productive: Kyoung-Han

Kim, Dr. Sanja Beca, Dr. Roozbeh Sobbi, Dr. Peter Helli, Dr. Robert Rose, Dr. Gerrie Farman,

Wallace Yang, Moniba Mirkhani, Farzad Izaddoustdar, Mark Davis, Dr. Brian Panama, Mike

Sellan, Dongling Zhao, Jack Liu, Bill Liang, Roman Pekhletski, Desiree Latour, as well as

Vijitha Puviindran from Dr. Hui’s lab and Brent Steer from Dr. Marsden’s lab. A very special thanks goes to my colleague and friend Kyoung-Han Kim for his limitless patience and guidance which has inspired me both personally and professionally.

iii

I would also like to thank the Heart and Stroke Foundation of Ontario, the Heart and Stroke/

Richard Lewar Centre of Excellence and the University of Toronto for their financial support.

Lastly, I would like to thank my parents and brother for all the support they provided me throughout my life and in particular my husband and best friend, Vitali; without his love, encouragement and editing assistance, I would not have finished this thesis. Finally, I would like to thank my unborn baby for not giving me too much discomfort during the thesis writing process and for opening a new exciting chapter in my life.

TABLE OF CONTENTS

ABSTRACT………………………………………………………………………………….. ii

ACKNOWLEDGEMENTS………………………………………………………………….. iii

TABLE OF CONTENTS…………………………………………………………………….. v

LIST OF TABLES……………………………………………………………………...... viii

LIST OF FIGURES………………………………………………………………………….. ix

LIST OF ABBREVIATIONS……………………………………………………………….. xi

CHAPTER 1: INTRODUCTION………………………………………………………….. 1

1.1 The role of Iroquois Homeobox (Irx) genes in development and physiology………….. 2 1.1.1 Origin and expression of Irx genes……………………………………….. 2 1.1.2 The role of Iroquois homeobox genes in the mammalian heart…………. 4 1.2 The mammalian ventricular conduction system (VCS)………………………………..... 6 1.2.1 Heart conduction and VCS function……………………………………… 6 1.2.2 Molecular components of the fast conducting VCS…………………….... 8 1.2.3 Development of the murine VCS…………………………………………. 11 1.2.4 Disorders of the cardiac conduction system……………………………… 14 1.3 Synopsis………………………………………………………………………...... 17

TECHNICAL CONTRIBUTION & ACKNOWLEDGEMENT………………………... 19

CHAPTER 2: MATERIALS & METHODS……………………………………………… 20

2.1 Experimental Animals…………………………………………………………………... 21 2.2 X-galactosidase staining………………………………………………………………… 22 2.3 In-vivo Electrocardiogram (ECG)……………………………………………………...... 22 2.4 Intracardiac Catheterization…………………………………………………………...... 23 2.5 Optical imaging and analysis…………………………………………………………..... 25 2.5.1 Heart perfusion and optical imaging……………………………………… 25 2.5.2 Signal processing and data analysis………………………………………. 26 2.6 Ex-vivo electrocardiogram……………………………………………………………..... 28 2.7 VCS fiber conduction velocity…………………………………………………………... 29

2.8 Laser Capture Microdissection (LCM)…………………………..…………………….. 30 2.8.1 Heart preparation and sectioning………………………………………..... 30 2.8.2 Dehydration and LCM…………………………………………………..... 30 2.8.3 RNA Isolation and cDNA synthesis……………………………………… 32 2.8.4 Quantitative Real-Time PCR……………………………………………... 33 2.9 Isolation of Neonatal Mouse Ventricular Myocytes………………..……………….…. 34 2.10 Adenoviral Construct Generation……………………………………………………… 35 2.11 Fiber imaging and quantification of EGFP fluorescence………………………………. 36 2.12 Statistical analysis……………………………………………………………………… 37

CHAPTER 3: RESULTS…………………………………………………………………... 38

3.1 Irx3 is preferentially expressed in the developing and mature ventricular conduction system...... 39 3.2 Phenotype of Irx3 deficient mice…...…………………………………………………… 42 3.2.1 Altered ventricular activation in Irx3-/- mice……………………………… 42 3.2.2 Increased His-ventricular conduction time in Irx3-/- mice………………… 46 3.2.3 Irx3-/- mice have functional right bundle branch block………………..….. 48 3.2.4 Irx3-/-;Cx40+/EGFP reporter mice show comparable phenotype to Irx3-/- mice………………………………………………………………………... 52 3.2.5 Slowed VCS fiber conduction in Irx3-/-;Cx40+/EGFP mice…………..……. 54 3.3 Irx3 maintains normal VCS conduction by indirectly regulating Cx40 gene expression. 56 3.3.1 Loss of Irx3 results in decreased Cx40 mRNA expression in VCS cells…. 56 3.3.2 Cx40-/- mice have a conduction phenotype similar to Irx3-/- mice………… 59 3.3.3 Transcriptional regulation of Cx40 gene expression by Irx3...... 61 3.4 Irx3 maintains proper ventricular activation by regulating ventricular conduction system fiber development…...………………………………………………….……….. 63 3.4.1 Decreased fiber complexity and Cx40 promoter activity in adult Irx3 deficient mice……….……….……………………………………………. 63 3.4.2 Decreased fiber complexity in postnatal day 4 (P4) and 0 (P0) of Irx3 deficient mice………………………………..…………………………….. 67 3.4.3 P0 Irx3-/- cardiomyocyte show decreased Cx40 mRNA expression………. 70 3.4.4. Loss of VCS complexity in Irx3 deficient mice is independent of Cx40 levels…...... 71 3.5 Synopsis…………………………………………………………………………………. 73

CHAPTER 4: DISCUSSION……………………………………………………………..... 74

4.1 Irx3 is the first known transcription factor to be preferentially expressed in the developing and mature ventricular conduction system (VCS)...... 75 4.2 Loss of Irx3 results in altered ventricular activation...... 77 4.3 Irx3 controls VCS conduction by indirectly regulating Cx40 expression………………. 83 4.4 Irx3 in required for postnatal VCS development………………………………………... 90 4.4.1 Decreased VCS complexity in Irx3 deficient mice contributes to its VCS conduction defect ………………………………………………………… 90 4.4.2 Irx3 may regulate VCS development in an Nkx2-5 dependent manner…… 92 4.5 Clinical implications…………………………………………………………………….. 95 4.6 Synopsis…………………………………………………………………………………. 98

CHAPTER 5: FUTURE DIRECTIONS…………………………………………………... 100

5.1 Understanding the indirect mechanism of Cx40 regulation by Irx3…………………….. 101 5.2 Understanding the developmental role of Irx3………………………………………….. 103 5.2.1 Prenatal assessment of VCS morphology in Irx3-/- and WT mice………… 103 5.2.2 Determining the underlying cause of hypoplasia in Irx3-/- mice…………... 103

CHAPTER 6: REFERENCES……………………………………………………………... 105

vii

LIST OF TABLES

Table 2.1 - List of Oligonucleotide Primers for Quantitative RT-PCR…………………... 34

Table 3.1 - Quantification of Irx3+/+, Irx3+/- and Irx3-/- mouse ECG parameters………… 45

viii

LIST OF FIGURES

CHAPTER 1: INTRODUCTION FIGURES

Figure 1.1 - Iroquois family in Drosophila and mammalian genomes………………… 3

Figure 1.2 - Mammalian cardiac conduction system and mouse electrocardiogram……. 8

Figure 1.3 - Connexin channel expression pattern……………………………………….. 10

Figure 1.4 - Impulse conduction in the developing mouse heart………………………… 12

CHAPTER 2: MATERIALS & METHODS FIGURES

Figure 2.1 - Gene target insertion of tauLacZ into Irx3 gene locus……………………… 21

Figure 2.2 - Sample velocity vector map………………………………………………… 27

Figure 2.3 - Sample velocity vector histogram.………………………………………….. 28

Figure 2.4 - Isolation of GFP+ ventricular conduction system fibers using laser capture microdissection (LCM)……………………………………………………... 32

CHAPTER 3: RESULTS FIGURES

Figure 3.1 - Irx3 expression delineates the developing and mature ventricular conduction system (VCS)…………………………………………………… 41

Figure 3.2 - In-vivo six-lead ECG showing altered ventricular activation in Irx3-/- mice... 44

Figure 3.3 - Slowed His-Ventricular conduction in Irx3-/- mice…………………………. 47

Figure 3.4 - Activation maps show right bundle branch block in Irx3-/- mice…………… 51

Figure 3.5 - Unchanged ECG traces and activation maps in Irx3+/+ and Irx3-/- mice following loss of a single Cx40 allele………………………………………. 53

Figure 3.6 - Slowed VCS Fiber Conduction Velocity in Irx3-/-;Cx40+/EGFP mice……….. 55

Figure 3.7 - Loss of Irx3 results in decreased Cx40 gene expression with no detectable change to Cx43 mRNA levels.....………………………………………….... 58

Figure 3.8 - Irx3-/- and Cx40-/- mice have a similar conduction phenotype……………… 60

Figure 3.9 - Irx3 indirectly regulates Cx40 expression…………………………………... 62

Figure 3.10 - Decreased VCS fiber complexity and Cx40 promoter activity in adult Irx3-/-;Cx40+/EGFP mice…………...…………………………………………. 65

Figure 3.11 - Decreased VCS fiber complexity in P4 Irx3-/-;Cx40+/EGFP mice……………. 68

Figure 3.12 - Decreased VCS fiber complexity in P0 Irx3-/-;Cx40+/EGFP mice……………. 69

Figure 3.13 - Irx3 regulated Cx40 expression in P0 mouse cardiomyocytes……………… 70

Figure 3.14 - No change in VCS morphology in Cx40EGFP/EGFP versus Cx40+/EGFP mice… 72

CHAPTER 4: DISCUSSION FIGURES

Figure 4.1 - Proposed mechanism of Cx40 regulation by Irx3……………………………… 87

Figure 4.2 - Irx3 regulates Cx40 by repressing a repressor of Cx40 promoter activity….. 88

Figure 4.3 - Stages of VCS development and the proposed role for Irx3………………….. 94

CHAPTER 5: FUTURE DIRECTIONS FIGURES

Figure 5.1 - Rescue of Cx40 expression using siRNA…………………………………… 102

LIST OF ABBREVIATIONS

AH - Atria-His LV - left ventricle

CCS - cardiac conduction system NB - No block

CF - conduction fiber NMVM - neonatal mouse ventricular myocytes CH1 - channel 1 PCR - polymerase chain reaction

CH2 - channel 2 PF - Purkinje fiber

CV - conduction velocity RA - right atrium

DF - distal fibers RBB - right bundle branch

ECG - electrocardiogram RBBB - right bundle branch block

EGFP - enhanced green fluorescence RV - right ventricle protein En-R engrailed repressor TB - trabeculae

ENDO - subendocardium TUNEL - dUTP nick end labeling

EPI - subepicardium VCS - ventricular conduction system

HB - His-bundle

HR - heart rate

HV - His-ventricle

Irx - Iroquois Homeobox

IVS - interventricular septum

LA - left atrium

LBB - left bundle branch

LBBB - left bundle branch block

LCM - laser capture microdissection

CHAPTER 1

INTRODUCTION

1.1 The role of Iroquois Homeobox genes in development and physiology

1.1.1 Origin and expression of Irx genes

Iroquois Homeobox (Irx) gene family members encode transcription factors containing a highly conserved homeodomain (HD) with the three amino acid extension (TALE) superclass at their N-terminus (Burglin 1997) followed by an acidic activation domain, and a conserved 11 amino acid residue motif (IRO box, ib) of unknown function (Figure 1.1). Iroqouis genes were first discovered in the Drosophila melanogaster where loss of the Iro complex resulted in misregulation of developmental patterning genes on the dorsal mesothorax (notum) of the fly.

Mutations in the fly Iroquois genes reduced bristle formation on the lateral notum leaving only a band of bristles in the central part of the notem, reminiscent of the „Mohawk‟ common to the

Iroquois Indians - from which the locus name is derived (Gomez-Skarmeta and Modolell 1996;

Leyns et al. 1996). While only 3 Irx genes are present in the Drosophila, 6 genes have so far been identified in the human and mouse genome (Bosse et al. 1997; Bosse et al. 2000;

Christoffels et al. 2000; Cohen et al. 2000; Peters et al. 2000; Bruneau et al. 2001). These 6 genes cluster in two groups of three genes each, where Irx1, Irx2 and Irx4 are expressed on mouse chromosome 13 (human chromosome 5) and Irx3, Irx5, and Irx6 are expressed on mouse chromosome 8 (human chromosome 16) (Bosse et al. 2000; Peters et al. 2000) (Figure 1.1). The chromosomal clustering of Irx genes and their overlapping expression pattern suggests potential redundancy in their function. This notion was confirmed by genetic studies done in Drosophila and zebrafish showing that several Irx genes with overlapping expression patterns can compensate and even substitute each other‟s function (Cavodeassi et al. 2001; Itoh et al. 2002).

Figure 1.1 Iroquois family in Drosophila and mammalian genomes (Cavodeassi et al., 2001)

Previous studies have shown that Iroquois homeobox genes have conserved roles in early embryonic patterning and specification as well as later roles in tissue differentiation and function (Gomez-Skarmeta and Modolell 2002). In the Drosophila, Irx genes were shown to control specification of large territories by establishing planar polarity in the eye and wing disc, and directing dorsal-ventral axis patterning in the ovary (Gomez-Skarmeta et al. 1996; Gomez-

Skarmeta and Modolell 1996; McNeill et al. 1997; Kehl et al. 1998; Jordan et al. 2000). Studies performed in Xenopus, zebrafish, and chick have also demonstrated the importance of Irx genes in specifying and patterning of the neural plate, neural tube, brain, nephron, and the lung

(Bellefroid et al. 1998; Gomez-Skarmeta et al. 1998; Briscoe et al. 2000; Cavodeassi et al. 2001;

Itoh et al. 2002; van Tuyl et al. 2006; Reggiani et al. 2007). To date, all six Irx genes have been identified in mammals, most of which have been shown to be expressed in overlapping patterns in the developing central nervous system, skin, limbs and heart (Bosse et al. 1997; Bao et al.

1999; Bosse et al. 2000; Bruneau et al. 2000; Christoffels et al. 2000; Cohen et al. 2000;

Bruneau et al. 2001; Houweling et al. 2001; Mummenhoff et al. 2001; Lebel et al. 2003;

Matsumoto et al. 2004). Although the mechanism of transcriptional regulation by Irx genes in these tissues remains unknown (Lee et al. 2004; Matsumoto et al. 2004), Irx proteins have been shown to activate and/or repress transcription in a context-dependent manner (Bao et al. 1999;

Bruneau et al. 2001; Matsumoto et al. 2004; Costantini et al. 2005) making them good candidate factors for regulating development, patterning and function in multiple organisms and organs.

1.1.2 The role of Iroquois homeobox genes in the mammalian heart

Irx genes were found to have unique and overlapping expression patterns in the heart and have been shown to play critical roles in heart function (Bruneau et al. 2001; Costantini et al.

2005). Previous studies have demonstrated that cardiac expression of Irx4 is restricted to the ventricles of the developing heart where it is involved in regulating ventricular identity (Bao et al. 1999; Bruneau et al. 2000; Bruneau et al. 2001; Garriock et al. 2001). In chick embryos, misexpression of Irx4 protein in the atria disrupts the chamber-specific expression of cardiac myosin heavy chain (MHC) genes leading to ectopic expression of the ventricular MHC-1

(VMHC-1) gene in the atria combined with reduction in atrial MHC-1 (AMHC-1) expression.

Overexpression of the engrailed repressor form of Irx4 (EnR-Irx4) leads to reduction in

VMHC-1 expression and increase in AMHC-1 expression in the ventricle demonstrating the dual activator and repressor function of Irx4 necessary for ventricular specification (Bao et al.

1999). Complete loss of Irx4 in mice results in development of cardiomyopathy characterized by hypertrophy and impaired systolic function (Bruneau et al. 2001), establishing the importance of

Irx4 for proper heart function.

Consistent with a critical role for Irx genes in the mammalian heart, Irx5 has been shown to regulate the transmural gradient of electrical repolarization in the mouse ventricle.

Specifically, Irx5 was found to be expressed in a transmural gradient and to repress the potassium channel gene Kv4.2 which contributes to the fast component of the transient outward potassium current (Ito,f). Previous studies have shown that Ito,f is responsible for the electrical gradient in rodent hearts and is also a major determinant of the heterogeneity of action potential profile in human hearts. Loss of Irx5 in mice (Irx5-/-) eliminates the gradient, and thus electrical heterogeneity, leading to increased susceptibility to ventricular tachyarrhythmia (Costantini et al. 2005). Moreover, Irx5-/- hearts subjected to hypertrophic stimuli such as pressure-overload, adrenergic stimulation and constitutively active calcineurin show attenuated cardiac hypertrophy and develop early onset of cardiac failure manifesting in increased fibrosis and ventricular dilation (Kyoung-Han Kim, manuscript in preparation).

The cardiac expression pattern of Irx6 was found to recapitulate the subendocardial to subepicardial expression of Irx5, first reported by Costantini et al. (Mummenhoff et al. 2001;

Costantini et al. 2005). However, despite their overlapping patterns, loss of Irx6 in the mouse does not result in an apparent cardiac phenotype (Dr. Chi-Chung Hui, unpublished data). Irx1 and Irx2 were shown to have overlapping expression patterns in the ventricular septum

(Christoffels et al. 2000). However, similarly to Irx6, loss of Irx2 in the mouse was found to be dispensable for cardiac development and function (Lebel et al. 2003), although it was found to be critical for chick hindbrain prepatterning by acting as an activator and repressor in the FGF signaling pathway (Matsumoto et al. 2004). Irx1, on the other hand, has yet to be studied in the mammalian heart but has shown a potential cardiac role in zebrafish where mutation of the Irx1 gene (Irx1b) results in bradycardia (Joseph 2004). Lack of a cardiac specific phenotype in Irx2

5 and Irx6 deficient mice combined with a relatively mild phenotype seen in zebrafish following

Irx1 mutation is probably a result of their overlapping expression with other Irx transcription factors resulting in functional redundancy (Christoffels et al. 2000; Lebel et al. 2003) consistently seen in Drosophila and zebrafish Irx genes (Cavodeassi et al. 2001; Itoh et al.

2002).

Although many of the Irx transcription factors have been studied in a multitude of organisms and organs, the role of Irx3 in the mammalian heart has yet to be resolved. Whole mount in-situ hybridization has shown that Irx3 is restricted to the trabecular components of the embryonic mouse ventricle thought to substantially contribute to the development of the ventricular conduction system of the heart (Christoffels et al. 2000). This expression pattern suggests a potential role for Irx3 in regulating ventricular conduction system development, patterning and/or function.

1.2 The mammalian ventricular conduction system (VCS)

1.2.1 Heart conduction and VCS function

Unidirectional blood flow is achieved by the coordinated contraction of the atria and ventricles. The mammalian heart achieves this coordinated contraction via the timely initiation and propagation of electrical signal through the cardiac conduction system (CCS) and myocardium of the heart. The electrical signal, originating in the autorhythmic cells of the sinoatrial (SA) node propagates through the right atrium and through Bachmann‟s bundle to the left atrium, stimulating the myocardium of the atria to contract. The electrical signal is then delayed at the atrioventricular (AV) node located at the AV junction between the atria and the

6 ventricle, allowing for ventricular filling, after which it travels through the His-bundle and is rapidly transmitted to each ventricle through the left and right bundle branches and Purkinje fiber network located on the endocardial surfaces of the septum and free wall (Myers and

Fishman 2004) (Figure 1.2 A). This rapid post-AV nodal conduction, through what is referred to as the ventricular conduction system (VCS), is enabled by the cable-like arrangement of VCS fibers combined with a strong expression of sodium channel and specific high-conductance gap junction channel proteins in the VCS. Rapid conduction through the VCS (His-Purkinje system) is critical for coordinated activation of the ventricular myocardium resulting in an apex-to-base and endocardial-to-epicardial ventricular activation. This ventricular depolarization pattern allows for efficient ejection of blood from the ventricles into the great vessels located at the base of the heart, necessary for sufficient perfusion of peripheral organs and tissues, which would otherwise be compromised in the absence of the VCS.

The electrical activity in the heart can be monitored with the use of an electrocardiogram

(ECG) which measures voltage changes across the heart. A typical ECG recording of each conduction system cycle consists of a P wave, a QRS complex, and a T wave (Figure 1.2 B).

The P wave represents the depolarization of the right and left atria following SA nodal activation. The PR interval, measured from the beginning of the P wave to beginning of the

QRS complex, reflects the time the electrical impulse travels from the sinus node through the

AV node prior to entering the ventricles, making it a good estimate for AV nodal function. The

QRS complex reflects the rapid depolarization of the right and left ventricle following activation by the VCS. In the mouse, the ST segment represents ventricular repolarization (T wave in the human) while the QT interval, measured from the beginning of the QRS to the end of the T wave represents ventricular activity, both depolarization and repolarization (London 2001)

(Figure 1.2 B). The ability of the ECG to measure the heart‟s electrical activity makes it an essential tool in identifying conduction system disorders in both clinical and laboratory settings.

Figure 1.2 (A) Mammalian cardiac conduction system (Sedmera 2007) and (B) Typical mouse electrocardiogram

1.2.2 Molecular components of the fast conducting VCS

The ventricular conduction system is heterogeneous and distinct from its surrounding myocardium and contains a unique expression of proteins called sodium channels and gap junction channels that underlie electrical activity in the heart.

Voltage-gated sodium (Na+) channels are essential for the amplitude and upstroke velocity of the cardiac action potential (AP). Their function is thus critical for initiating and contributing to conduction velocity of the electrical signal, particularly in the fast conducting

VCS (Herfst et al. 2004). At the molecular level, voltage-dependent Na+ channels are composed of α-subunits, which form the pore of the channel (Gellens et al. 1992; Fozzard and Hanck

1996; Catterall 2000), and accessory β-subunits that modulate gating and expression of the sodium channel in the cell membrane (Isom et al. 1992; Isom et al. 1995; Morgan et al. 2000;

Chen et al. 2002; Ko et al. 2005). The expression of sodium channel α- and β-subunits in the heart is highly heterogeneous. The main cardiac Na+ channel α-subunit Nav1.5, encoded by the

Scn5a gene, is expressed in a transmural gradient across the myocardium showing low Nav1.5 expression in the subepicardium compared to the subendocardium (Remme et al. 2009). In the

VCS system, Nav1.5 expression is higher than that seen in the subendocardium (Remme et al.

2009), resulting in faster activation of APs and faster VCS conduction. In addition to high

Nav1.5 expression in the VCS, Haufe et al. (2005) showed high abundance of neuronal sodium channel genes Scn1a (Nav1.1) and Scn2a (Nav1.2) in the bundle of His compared to the surrounding myocardial tissue. Moreover, expression of the auxiliary β-subunit Navβ1, encoded by the Scn1b gene, was also found to be highly expressed in the His-Purkinje network compared to working myocardium (Dominguez et al. 2005). The high expression of cardiac and neuronal sodium channels as well as β-subunit Navβ1 in the VCS highlights their importance in initiation of the electrical impulse and rapid impulse propagation, characteristic of the VCS (Haufe et al.

2005).

Once an AP is initiated, the intercellular conduction and propagation of that AP through the cardiac conduction system and the myocardium is dependent on gap junction channels

(Hinch 2002). Gap junction channels are intercellular channels that form high-conductance aqueous pores connecting the cytoplasm of adjacent cells to allow rapid cell-to-cell electrical conduction through the VCS (Teunissen and Bierhuizen 2004). Three main gap junction channel genes are expressed in the heart: Gja1, Gja5, and Gja7 encoding the connexin (Cx) proteins

Cx43, Cx40 and Cx45, respectively. All three of these channels are expressed in the VCS, with

Cx40 and Cx45 showing expression throughout the entire length of the VCS while Cx43 expression is restricted to distal Purkinje fibers (Delorme et al. 1995; Desplantez et al. 2007).

The specific expression of these connexin channels in the VCS ensures coupling within this tissue compartment, while electrically separating it from the surrounding ventricular myocardium which expresses Cx43. Due to the absence of Cx43 expression in the His-bundle and bundle branches the proximal VCS cells are unable to form electrical connections with adjacent myocardial cells. This electrical insulation of the proximal VCS allows electrical impulses to travel down the His-Purkinje network preventing loss of charge to neighboring cells thus ensuring rapid impulse conduction. Once the electrical impulse reaches the Purkinje fiber network at the apex of the heart, gap junction connections are required to form between Purkinje cells and myocardial cells to enable myocardial activation. This is achieved by an increasing gradient of Cx43 expression in distal Purkinje fibers enabling formation of Cx43 gap junction channels electrically coupling VCS cells and working myocardial cells. The rapid conduction through the VCS down to the apex of the heart results in a wave of ventricular activation to proceed from the apex-to-base of the heart necessary for efficient cardiac contraction.

Figure 1.3 Connexin channel expression pattern

1.2.3 Development of the murine ventricular conduction system

The cardiovascular system is the first organ system to form and function in the developing mammalian embryo (Olson and Srivastava 1996; Brand 2003). In early development, prior to the formation of the VCS, the tubular heart periodically and spontaneously evokes action potentials, which initiate in the primordial sinoatrial pacemaker region (in the right sinus horn) and propagate through the electrically coupled cells of the myocardium via gap junction channels. Once initiated, the electrical signal proceeds through the sinus venosus, the most caudal portion of the tubular heart, towards the cranially located primitive outflow tract by sequentially passing through atrial and ventricular myocardial tissue

(Kamino 1991; Rentschler et al. 2001) (Figure 1.4 A). As the heart begins to loop, prior to ventricular septation in the mouse, a shift in the heart‟s activation pattern becomes necessary to maintain unidirectional blood flow and allow ejection of the blood through the great vessels located at the base of the heart (Figure 1.4 B). This change in activation is achieved by the development of the primordial VCS. In this instance, the wave of electrical impulses that emanates from the atria does not directly activate the ventricular myocardium but rather bypasses its activation by traveling down the primitive VCS resulting in an apex-to-base activation sequence (Figure 1.4 C), characteristic of the adult ventricular activation pattern

(Rentschler et al. 2001; Pennisi et al. 2002).

Figure 1.4 Impulse conduction in the developing mouse heart (modified from High and Epstein, 2008). ot: outflow track; v: ventricle; a: atria; pm: pace maker; san: sinoatrial node, av: atrioventricular; ra: right atrium; la: left atrium; rv: right ventricle; lv: left ventricle.

The development of the primitive VCS, resulting in a shift in the ventricular activation pattern, is dependent on the coordinated differentiation and patterning of myocardial cells. Cells of the primordial VCS population have been shown to be exclusively derived from the myocyte lineage and thus need to be recruited from working myocytes via paracrine signaling from endothelial cells (Mikawa and Hurtado 2007). As the heart loops, a ring-like population of subendocardial myocytes between the future right and left ventricles (the „primary conduction ring‟), along with cells of the growing interventricular septum and proliferating trabeculae, form the initial developmental framework from which the future VCS (His-Purkinje system) will develop. Specification and patterning of this VCS population continues between embryonic day

11 (E11) and E14 in the mouse at which point the apex-to-base contraction sequence evolves from the simple linear activation pattern (Morley and Vaidya 2001) (Figure 1.4). At this stage,

12 first epicardial activation (breakthrough) appears at the right ventricular apex followed by the left, consistent with the earlier functionality of the right versus the left bundle branch

(Rentschler et al. 2001). As conduction myocytes complete their differentiation, they exit the cell cycle between E12 and E14 (Sedmera et al. 2003). Shortly after, VCS cells begin to show restricted expression of markers such as the potassium channel gene minK, the gap junction gene connexin 40 (Gja5), along with other ion channel, gap junction channel, and transcription factor genes. The mature His-Purkinje network is eventually attained through further differentiation of the initial framework, recruitment of working myocytes and neonatal remodeling (Mikawa and Hurtado 2007). The underlying intrinsic molecular signals accompanying the early functional maturation of conduction myocytes and their late maturation remain largely unknown. Interestingly, it has recently been shown that the transcriptional factors

Tbx5 and Nkx2-5, which are expressed in elevated levels in the proximal VCS primordium, are both required for VCS cell differentiation (Thomas et al. 2001; Moskowitz et al. 2007).

Furthermore, a late wave of His-Purkinje maturation has been shown to occur after birth and depend on Nkx2-5 expression in conduction myocytes (Meysen et al. 2007).

The proper differentiation, specification and maturation of the VCS is vital for both pre- and postnatal VCS function. Changes in any of these processes render the heart vulnerable to cardiac conduction system disorders. Therefore, a better understanding of the developmental as well as the molecular and cellular mechanisms regulating electrical properties in the heart‟s electrical conduction-system, is of great importance for understanding the basis of cardiac conduction system defects.

1.2.4 Disorders of the cardiac conduction system

The CCS is anatomically, developmentally and molecularly distinct from the surrounding working myocardium. Abnormalities in CCS function can arise from a variety of factors including acquired or congenital defects, injury, as well as inherited mutations in ion channels, gap junction channels, and transcription factors necessary for conduction system development and function (Shimizu et al. 2005; Wolf and Berul 2006; Sakata et al. 2008).

A mutation in the cardiac-specific sodium channel gene Scn5a has been associated with progressive cardiac conduction defect (PCCD), otherwise known as Lenegre or Lev disease

(Lenegre 1964). PCCD is characterized by progressive alteration of cardiac conduction through the His-purkinje system with right or left bundle branch block, leading to widening of the QRS complex, complete AV block, syncope and sudden cardiac death (Schott et al. 1999; Kyndt et al.

2001; Tan et al. 2001) thus demonstrating the importance of sodium channels for proper VCS conduction.

Loss of the main VCS-specific Cx40 gap junction channel in mice (Cx40-/-) has been associated with first degree atrioventricular block (Simon et al. 1998), right bundle branch block

(RBBB) as well as defective LBB conduction (van Rijen et al. 2001) resulting in blocked transmission of the electrical signal through parts of the VCS leading to slowed and uncoordinated ventricular activation. Defect in VCS conduction responsible for heterogeneous ventricular excitation is thought to be the cause behind the increased susceptibility to ventricular tachycardia observed in the Cx40-/- mice (Bevilacqua et al. 2000).

Mutations in cardiac transcription factors (TFs) can also account for electrical disturbances in the CCS due to their role in regulating conduction system differentiation, specialization and function. These electrical abnormalities can originate from altered cellular/tissue morphology, as a result of developmental abnormalities (Franco and Icardo 2001;

Wolf and Berul 2006), or changes in the expression of ion and gap junction channel genes, regulated by these TFs, which are necessary for proper VCS function (Wolf and Berul 2006).

The Nkx2-5 homeobox TF gene is one of the earliest cardiac markers first identified as tinman for its role in Drosophila melanogaster dorsal mesoderm specification. Mutations in tinman, leading to failure of tinman function, result in loss of heart formation in the fly embryo (Bodmer

1993). In humans, among many congenital heart defects, mutations in the NKX2-5 gene have been associated with conduction system disease (CSD) and atrial and ventricular septal defects, associated with varying degrees of atrioventricular block (Schott et al. 1998; Benson et al. 1999;

Kasahara et al. 2001; Jay et al. 2004). Studies performed in Nkx2-5 deficient mice have shown that Nkx2-5 insufficiency perturbs the conduction system during development resulting in atrioventricular conduction block, slowed ventricular activation and susceptibility to arrhythmias although the mechanisms behind this conduction block was not determined (Tanaka et al. 2002; Wakimoto et al. 2002; Jay et al. 2004). A recent study done by Meysen et al. (2007) shined new light onto the role of Nkx2-5 by demonstrating that Nkx2-5 haploinsufficiency results in hypoplasia of the atrioventricular node, His-bundle and Purkinje system forming the basis for the atrioventricular conduction block and slowed ventricular activation observed in the

Nkx2-5 haploinsufficient mice in previous studies (Tanaka et al. 2002; Wakimoto et al. 2002;

Jay et al. 2004).

The Tbx family of TF has also been associated with heart development. In humans, mutation in TBX5 causes Holt-Oram syndrome (Basson et al. 1997; Basson et al. 1999), manifesting in upper limb deformities, congenital heart defects and conduction system abnormalities such as atrioventricular block, bundle branch block and sick sinus syndrome

(Basson et al. 1994). These conduction system disorders occurred as a result of the role of Tbx5 in patterning and maturation of the proximal VCS made apparent by studies done in mice. In the mouse VCS, Tbx5 haploinsufficiency caused patterning defects in both the left and right bundle branches as well as occasional RBB structural defects resulting in RBBB (Moskowitz et al.

2004). Similarly, based on loss of function studies in mice, Tbx3, another member of the Tbx family, was reportedly required for maturation of the central conduction system consistent with its expression in the SA and AV nodes, His-bundle and proximal bundle branches. Mice lacking

Tbx3 did not survive past embryonic day 14.5 and exhibited abnormal gene expression in conduction system progenitor cells in addition to severe structural malformations (Bakker et al.

2008).

The role of TFs in CCS development rendered them critical for proper CCS structure.

However, in addition to their developmental role, TFs have also been implicated in regulating expression of genes necessary for proper conduction system function. For instance, Nkx2-5,

Tbx5 and Tbx3 have all been shown to regulate the expression of the VCS-specific gap junction

Cx40 (Hoogaars et al. 2004; Linhares et al. 2004; Moskowitz et al. 2007) as well as other genes expressed in the VCS such as Nppa (Houweling et al. 2005) and Id2 (Moskowitz et al. 2007).

Loss of Cx40 expression in the mouse heart was previously shown to results in conduction block (Simon et al. 1998; van Rijen et al. 2001), while loss of Id2 in mice results in ventricular conduction delay with widened QRS duration manifesting in left bundle branch block seen in both newborn and adult mice (Moskowitz et al. 2007). Therefore, regulation of VCS genes such

16 as Cx40 and Id2 by TFs combined with their developmental role in the CCS is thought to result in the electrical defects observed as a result of mutations or deletion of these TFs in humans and mice.

With a growing number of identifiable mutations leading to conduction system disorders there is a necessity for understanding the molecular mechanism responsible for these conduction defects. Unfortunately, only limited insight is available into the specific mechanisms and factors involved in promoting the differentiation, specification and maturation of the mammalian VCS as well as VCS function. Thus, identification and study of new transcription factors, such as

Irx3, potentially involved in VCS development and function is paramount.

1.3 Synopsis

The heart is the first functional organ to develop in the vertebrate and is essential for embryonic life. Precise regulation of tissue-specific transcription by transcription factors is key for proper cell differentiation and patterning during heart morphogenesis, and function in adulthood. The development of the cardiac conduction system, necessary for timely cardiac activation and contraction, has been shown to depend on a variety of transcription factor genes.

Mutation in transcription factors associated with conduction system development and function were shown to lead to a variety of cardiac conduction disorders manifesting in atrioventricular block, bundle branch block, increased susceptibility to arrhythmias and sudden cardiac death.

Previous studies have introduced the Iroquois homeobox (Irx) family of transcription factors

(Irx1-6) found in unique and overlapping patterns in the developing and mature mammalian heart (Christoffels et al. 2000; Mummenhoff et al. 2001) required for cardiac development,

17 patterning and function (Bao et al. 1999; Bruneau et al. 2001; Costantini et al. 2005). Irx3, a member of the Iroquois homeobox family, was shown to be expressed in the trabecular components of the embryonic mouse ventricle which substantially contribute to the ventricular conduction system of the heart (Christoffels et al. 2000). This expression pattern suggested a potential role for Irx3 in VCS development and function. Despite that, the role of Irx3 in the mammalian heart was yet to be studied. As the number of identifiable inherited human syndromes with conduction system disturbances increases, the drive to unravel the molecular mechanisms necessary for proper CCS function and the cause of conduction system disorders has grown, forming the impetus for the study of the role of Irx3 in the murine heart.

TECHNICAL CONTRIBUTION & ACKNOWLEDGEMENT

I would like to acknowledge the following people for contributing to my MSc thesis project:

1. Kyoung-Han Kim - Performed all neonatal myocyte isolations, adenovirus generation and infection. Contributed greatly to intellectual planning and designing of experiments.

2. Jieun Kim - Performed X-gal staining on adult Irx3+/LacZ mice.

3. Mark Davis - Measured intracardiac ECG and conduction velocity in His-Purkinje fibers. Helped with initial set up of optical equipment and provided initial instruction on measurement of ECG.

4. Dr. Gerrie Farman - Measured conduction velocity in His-Purkinje fibers and analyzed conduction data.

5. Vijitha Puviindran - Performed immunoprecipitation, western blot and adenoviral infection.

6. Wallace Yang - Provided instruction for analysis of optical data and wrote macros to assist in data processing. Also, was a great source of technical support.

7. Dr. Roozbeh A. - Helped in making aortic cannulas and building horizontal langendorff Sobbi setup. Also, was a great source of technical and intellectual support.

8. Dongling Zhao - Generated adenoviral constructs.

9. Brent M. Steer - Provided instructions for the use of a cryostat, LCM and PCR machine.

10. Dr. Robert A. Rose - Performed patch clamping on VCS cell. Obtained Cx40-EGFP mouse from Dr. Lucile Miquerol.

11. Shan-Shan Zhang - Initiated the study of Irx3 in heart development and identified its expression pattern in the heart.

I was responsible for the principle planning of all studies and the primary data collection of: In vivo anaesthetized 6-Lead ECGs, Langendorff ECGs, Epicardial optical images, conduction fiber imaging at P0, P4 and adult stages, heart sectioning, isolation of VCS, subendocardial and subepicardial cells using laser capture microdissection, RNA isolation, cDNA synthesis and qPCR as well as analysis and interpretation of all experimental data. Finally, I was responsible for breeding, weaning and genotype the Irx3LacZ and Cx40-EGFP mouse colonies.

CHAPTER 2

MATERIALS & METHODS

2.1 Experimental Animals

Irx3+/- mice, of C57Bl6 background, were generated via a gene targeting technique resulting in tauLacZ insertion at the Irx3 locus (Chi-chung Hui, unpublished) (Figure 2.1).

Irx3+/- mice were intercrossed to generate Irx3-/- and Irx3+/+ mice. Eight to ten week old male mice were used for adult mouse studies. In order to visualize and enable the study of the VCS,

Irx3+/- mice were bred to GJA5-EGFP knockin reporter mice (obtained courtesy of Dr. Lucile

Miquerol) expressing GFP under the control of the GJA5 (Cx40) promoter leading to specific

GFP expression in the VCS, atria and coronary vasculature of the heart (Miquerol et al. 2004).

Experimental mice where double transgenic Irx3-/- or Irx3+/+ with either wildtype (Cx40+/+), heterozygous (Cx40+/eGFP) or knockout (Cx40eGFP/eGFP) Cx40-EGFP expression. All mice were housed in standard vented cages in temperature- and humidity-controlled rooms with 12-hour light-dark cycles in the Department of Comparative Medicine animal facility at the University of Toronto. All experimental protocols conformed to the standards of the Canadian Council on

Animal Care.

Figure 2.1 Gene target insertion of tauLacZ into Irx3 gene locus

2.2 X-galactosidase staining

Irx3+/- and Irx3-/- hearts were dissected in cold 1xPBS, and fixed in 2.7% formaldehyde,

0.02% NP-40 in 1xPBS. After fixation, hearts were washed in 2mM MgCl2, 0.02% NP-40 in

1xPBS at 4ºC for four times for 15 minutes each. For whole mount X-gal staining, hearts were incubated in X-gal solution containing 1mg/ml X-gal, 2mM MgCl2, 0.02% NP-40, 5mM

o K4Fe(CN)6-3H2O, 5mM K3Fe(CN)6 in 1xPBS at 37 C overnight. Following incubation, hearts were serially dehydrated in methanol prior to imaging. For section X-gal staining, the samples were immersed in 30% sucrose at 4°C overnight after fixation and wash. Hearts were embedded in OCT solution and frozen with dry ice. 10μm sections were cut using cryostat machine and X- gal solution was applied after the sections were dried and rehydrated. Counter-staining with eosin for 10 minutes was performed afterward, followed by rehydration with EtOH and xylene, and mounting with permount and xylene.

2.3 In-vivo Electrocardiogram (ECG)

Control and Irx3 deficient mice were anesthetized using a mixture of isoflourane and oxygen (BOC Gases, Toronto, Ontario, Canada; ~1% / 99% respectively) delivered using a

Fluotec Mark 2 vaporizer (Cyprane, Keighley, UK) at a gas flow rate of 2 L/min. Anesthetized mice were secured in a supine position on a regulated heat pad while lead I and lead II ECGs were recorded using platinum subdermal needle electrodes (F-E7, Grass Technologies, West

Warwick, RI, USA) in a 3-limb configuration. Core temperature was continuously monitored using a rectal probe (THM 150, Indus Instruments) and maintained at 36-37ºC. ECG data was acquired and analyzed using Life Science Suite PONEMAH Physiology Platform P3 Plus software and an ACQ - 7700 acquisition interface unit (Gould Instruments, Valley View, OH,

USA). The parameters derived from the ECG measurements include: Heart rate (HR), PR interval (beginning of P wave to the beginning of the QRS complex), QRS complex duration, and QT interval (beginning of Q wave to end of T wave).

In order to obtain traces for the remaining 4 leads (III, aVR, aVL and aVF ), an average of

10 heart beats was taken in the lead I and lead II configuration following a 10 minute equilibration period. Averaging of beats was accomplished by aligning their R wave peaks using a Tcl/Tk script (courtesy of Wallace Yang) that graphically enabled points of ECG to be identified for alignment. The averaged traces for lead I and II were then used to calculate leads

III, aVR, aVL and aVF configurations using equations 2.1-2.4 below. The calculated values were then plotted in Excel to generate the corresponding ECG trace for each lead.

Eq. 2.1

Eq. 2.2

Eq. 2.3

Eq.2.4

2.4 Intracardiac Catheterization

All mice were anaesthetized with 1.5% isoflurane (on 100% oxygen flow) using a

Benson isoflurane chamber and placed on a heating pad to maintain a body temperature between

35.5 and 37C. Three electrodes were placed subcutaneously (30 gage, Grass) near the right and

23 left forearms as well as the left hind leg to allow for continuous surface ECG recordings in a lead II configuration. The right jugular vein was then isolated and cut down under a dissecting microscope to allow for introduction of a 2-French octapolar electrode catheter (CIBer mouse

EP catheter; NuMed Inc., Hopkinton, NY, USA). Each electrode is 0.5mm in length and is separated by a distance of 0.5mm (electrode 1 most distal and ventricular, electrode 8 most proximal and atrial). The catheter was advanced from the right jugular vein into the right atrium, through the tricuspid valve and into the right ventricle. Correct placement of the catheter was confirmed upon visualization of 6 bipolar leads from the octapolar catheter. The most distal lead

(1-2) electrogram in the ventricle should have a large ventricular signal or positive deflection and minimal if any atrial signal. The His-bundle electrogram was confirmed in the middle leads

(4-5 or 5-6), or by visualization of a small deflection (<1mV) in between atrial and ventricular signals. The most proximal lead (7-8) gave the atrial signals and was confirmed by having a larger atrial signal than a ventricular signal. Using these three requirements correct catheter placement was ensured. All ECG signals were recorded and amplified at 5kHz and filtered between 0.3 Hz and 300 Hz using a Gould ACQ-7700 amplifier and DSI Ponemah Physiology

Platform software version 4.60. Atria-His (AH) and His-ventricle (HV) intervals were determined using the His bundle electrogram (4-5 or 5-6). AH was marked from the beginning of the atrial signal to the beginning of the His bundle signal. HV was marked as the beginning of the His bundle signal to the beginning of the ventricular signal.

2.5 Optical imaging and analysis

2.5.1 Heart perfusion and optical imaging

Control and Irx3 deficient mice were heparinized (0.2 ml intraperitoneal injection (I.P.) of 1000 IU/ml heparin) to prevent blood clotting and were killed under isofluorane via cervical dislocation. The thorax was opened by midsternal incision, and the beating heart was rapidly removed and placed in cold Krebs solution consisting of (in mmol/L) 118 NaCl, 4.2 KCl, 1.2

KH2PO4, 1.5 CaCl2, 1.2 MgSO4, 11 D-Glucose, 2 Sodium Pyruvate, and 25 NaHCO3, with pH adjusted to 7.4 via bubbling with carbogen (95% CO2/5% O2). The heart was then rapidly transferred to the bath of a modified horizontal Langendorff in cold Krebs solution where the aorta was cannulated onto a blunted 20-gauge needle attached to a bubble trap and a water jacket-heated perfusion system to allow for retrograde perfusion of the coronary arteries while enabling the rotation of the heart about its vertical axis. Once mounted, the heart was perfused with Krebs solution at a constant flow rate of 3.5 ml/min, for a 15 minute equilibration period followed by 10 minute of voltage sensitive dye, di-4-ANEPPS, perfusion and wash. A concentration of 0.1 µM ATP dependent K+ channel opener, P1075, was added to the perfusing

Krebs solution in order to offset the coronary constriction and rise in aortic pressure observed during dye administration (Cheng et al. 1998; Nygren et al. 2000; Novakova et al. 2008).

Perfusion rates were maintained such that a coronary pressure of 70-90 mmHg was observed during measurements using a custom apparatus including a pressure transducer connected to an amplifier with an LED display and calibrated using a sphingometer. Perfusion temperature was monitored and held at 36-37ºC throughout the experiment. All mapping studies were performed in the absence of any motion reduction techniques.

Dye perfused hearts were excited using a 200 W EXFO X-Cite exacte source filtered at

543 ± 11nm. The intensity of filtered emission at 645 ± 37.5 nm decreases with depolarization, typically at a fraction of -8% per 100 mV (Fluhler et al. 1985). Optical images of the hearts were captured using an upright Olympus MVX-10 microscope equipped with a 0.63x c-mount adapter, a 0.38x lens relay, and a Photometric Cascade 128+ CCD camera interfaced with

ImagePro Plus 5.1 software resulting in image sequences resolution of 16-bit, 63 x 64 pixel at

923 Hz.

2.5.2 Signal processing and data analysis

A visual basic for applications (VBA) macro written in ImagePro Plus 5.1 (courtesy of

Wallace Yang) was used to calculate AP output in the form of an image sequence. This was done by subtracting the values of each pixel from the time average for each pixel, using equation 2.5, to obtain the action potential (AP).

Eq.2.5. Optical image signal processing where, is the pixel value of the captured image sequence at pixel coordinate and frame (time) , is the number of frames in the sequence and in an offset constant identical for all pixels and chosen so that the value of the AP ≥ 0.

In order to generate an activation map for the heart, Scroll, an image analysis program

(courtesy of Sergey Marinov) was used. Briefly, the calculated APs were passed through a 3 3 pixel spatial averaging kernel after which activation times were defined as the time of 50% depolarization (Kikuchi et al. 2010) during the rising phase of the AP at each pixel. Isochronal

26 maps that displayed the position of the wavefront at constant 0.5 ms intervals were constructed from the activation times using Scroll.

To calculate epicardial conduction velocities (CVs), local velocity vectors were calculated using Scroll by fitting the depolarization time measure at each pixel to a 3 3 pixel plane using least squares and finding their gradients. Epicardial CVs were estimated by averaging the magnitudes of these gradients combined with the size of the field of view, neglecting the curvature of the heart. These values were used to generate a velocity map (Figure

2.2) exported into a .txt file in a 2D pixel coordinate format. A C program was written (Wallace

Yang) that uses Origin 8 Pro to arrange all the CV values into a single column file for conventional spreadsheet software analysis. Data was then plotted as a histogram (Figure 2.3) consisting of a main body of data comprising approximately 90% of the velocity vectors followed by a tail of “outliers” at higher velocities. To reduce the influence of such outliers we discarded the top 10% of computed values prior to calculations and statistical analysis of the average epicardal CVs (Nygren et al. 2000). The majority of these were discarded prior to determination of the averaged epicardial CV for the heart and statistical analysis of the average epicardial CV. The majority of these outliers arose due to synchronously activated areas around points of breakthrough (Nygren et al. 2000) or points influenced by movement artifacts particularly at the heart edges. Figure 2.2 Sample velocity vector map

Figure 2.3 Sample velocity vector histogram

2.6 Ex-vivo electrocardiogram

Ex-vivo ECG measurement were taken simultaneously and continuously with optical imaging by placing platinum needle electrodes (F-E7, Grass Technologies, West Warwick, RI,

USA) in close proximity to the excised heart. Electrode arrangement was such that the negative electrode was placed at the right atrium, the positive electrode was placed on the left side of the apex and the ground electrode was placed at the left atrium similarly to the standard lead II configuration. ECG data was acquired and analyzed using Life Science Suite PONEMAH

Physiology Platform P3 Plus software and an ACQ-7700 acquisition interface unit (Gould

Instruments, Valley View, OH, USA). The parameters derived from the ECG measurements include: Heart rate (HR), PR interval (beginning of P wave to the beginning of the QRS complex), QRS complex duration, and QT interval (beginning of Q wave to end of T wave).

2.7 VCS fiber conduction velocity

Age matched Irx3+/+;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP mice were anaesthetized and sacrificed via cervical dislocation. The hearts were rapidly excised with the aorta placed around a small gauge needle and perfused retrograde with a modified Krebs-Henseleit solution (at room temperature), containing 118.5 mM NaCl, 5 mM KCl, 2 mM NaH2PO4, 1.2 mM MgSO4, 10 mM glucose, 26.4 mM NaHCO3, and 0.3 mM CaCl2. At room temperature this bubbled solution has a pH of ~7.35; the lower calcium concentration and cooler temperature were used to dampen the force of the contraction and slow down the speed of the action potential allowing for accurate recordings. Once cannulated the heart was allowed to stabilize for ~5-10 minutes to ensure any remaining blood had been flushed out of the heart. After this stabilization period the

RV outer wall was carefully cut open, making sure no major arteries were damaged, and was pinned down to allow access to the Purkinje fibers along the septal wall.

Action potentials (AP‟s) were gathered using 2 fine tip glass electrodes (~1-1.5 mm outer diameter) attached to an A-M Systems model 3100 6-pin headstage and corresponding amplifier. Traces of the action potential were recorded at 5 kHz sampling rate using a BioPAC

A/D convertor and AcqKnowledge version 3.82 allowing for precise measurements of the peak voltage for each channel. Once stable AP‟s were obtained a 10-15 second recording was taken and the distance between the electrodes was measured, using a graded reticle to measure the 2D distances. For analysis of the conduction velocity approximately 10 consecutive beats were randomly chosen out of the entire recording and filtered using a 60 Hz low-pass filter, each channel was treated the same to ensure no alteration in the timing of the AP. Once filtered both channels were simultaneously cut, preserving the timing difference, and averaged together. Each

29 channel then was normalized to the peak voltage and the difference between the peaks in each channel was calculated. The resulting differences in time and distance between the channels were converted to seconds and meters respectively and the conduction velocity was calculated.

2.8 Laser Capture Microdissection (LCM)

2.8.1 Heart preparation and sectioning

Four Irx3+/+;Cx40+/EGFP and four Irx3-/-;Cx40+/EGFP mouse hearts were isolated and rinsed in cold DEPC treated standard PBS solution (pH 7.4). Atria were removed and hearts were mounted on cryomolds (Cedarlane laboratories, Burlington, ON) using optimal cutting temperature (OCT) compound (Tissue-Tek 4583, Sakura Finetek, Torrance, CA) and flash frozen in liquid nitrogen. Frozen hearts were mounted on a Leica CM3050 S cryostat (Leica

Microsystems, Bannockburn, IL) and longitudinal, 10µm, sections were sliced and placed onto precleaned, uncharged, RNase-free slides (VWR, Mississauga, ON). Tissue sections were kept frozen at -80oC and used for LCM within 2 days.

2.8.2 Dehydration and LCM

Frozen sections were allowed to thaw at room temperature for not more that 30 s before immersion in 75% ethanol for 30 s followed by a 30 s rigorous wash in RNase-free water required to remove traced of OCT medium. Following, the slides were sequentially dehydrates by immersion in 70%, 95%, 100%, 100% ethanol for 30s each. In order to remove the hygroscopic ethanol solution from the tissue, dehydrated slides were twice incubated in xylenes

(Sigma-Aldrich, Oakville, ON) for 5 minutes each. Following dehydration slides were air dried for 10 minutes after which they were used for laser capture.

Dehydrated slides were placed in an Arcturus PixCell II LCM system equipped with epifluorescence optics (455-495 nm excitation and 510+ nm emission) (Arcturus Engineering,

Mountain View, CA) allowing to visualize EGFP-labeled ventricular conduction system fibers

(Figure 2.4 A, B). An optically transparent thermoplastic CapSure Macro LCM cap (Molecular

Devices, Sunnyvale, CA) was placed on top of the tissue. An infra red laser beam was then used to melt the thermoplastic membrane located directly on top of cells of interest (GFP positive conduction cells) using a spot size of 7.5 µm; power = 60-80 mV; pulse duration = 700 µs.

Melting of the thermoplastic membrane allowed cells of interest to „stick‟ to the membrane allowing their extraction from the tissue following cap removal (Figure 2.4 C, D). Any non- fluorescent (non VCS) cells picked up by the LCM cap (caused by cell-cell binding) were removed by dabbing the cap on a sticky RNase-free paper. The isolated cells remained attached to the cap (Figure 2.4 E, F) and were placed in stabilizing extraction buffer (Arcturus, KIT0204) where they were incubated for 30 min at 42oC followed by 2 minute centrifugation at 800g required to remove the cell extract from the cap and into the buffer solution. Following, the cap was removed and buffer containing cell extract was stored at -80oC until RNA isolation. This protocol was repeated for isolation of GFP+ VCS cells as well as non fluorescent subendocardial and subepicardial control cells from both Irx3+/+;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP mice. GFP+

VCS cells were collected from the proximal and distal ends of the septal and free walls of both the left and right ventricles (Figure 3.7 A). Subendocardial cells were collected from the left ventricular free wall side while subepicardial cells were collected from the outer curvature of the left ventricle (Figure 3.7 A).

Figure 2.4 Isolation of GFP+ ventricular conduction system fibers using laser capture microdissection (LCM). LVSW: left ventricular septal wall; LVL: left ventricular lumen; CF: conduction fiber

2.8.3 RNA Isolation and cDNA synthesis

LCM isolated VCS, subendocardial and subepicardial cells were processed for RNA extraction using the PicoPure RNA isolation kit (Arcturus, KIT0204) according to the manufacturer‟s protocol. Briefly, cell extract was combined with 70% ethanol and added to a preconditioned RNA purification column. Following RNA binding, the RNA was washed with

32 wash buffer one followed by treatment with DNase according to manufacture specifications

(Qiagen, #79254, Mississauga, ON). Following two additional washing steps the RNA was eluted in 11µl of elution buffer and frozen at -80oC until cDNA synthesis.

For first strand synthesis, RNA was thawed and quantified at A260 using a NanoDrop

3300 (Thermo Scientific, Wilmington, DE). The RNA concentrations ranged between

14-30 ng/µl therefore cDNA was synthesized from 112 ng of RNA using Superscript II reverse transcriptase (Invitrogen Life Technologies, Carlsbad, CA) as described in the manufacturer‟s protocol available at: tools.invitrogen.com/content/sfs/manuals/superscript_firststrand_man.pdf. cDNA was diluted 3× for quantitative PCR reaction.

2.8.4 Quantitative Real-Time PCR

Gene expression assay was conducted on 10 ng of template cDNA by Quantitative PCR

(qPCR) using Taqman and SYBR Green PCR methods equipped with ABI 7900HT (Applied

Applied Biosystems, Foster City, CA). Primers were designed for the following genes: Gja5

(Cx40), Gja1 (Cx43), Gja7 (Cx45), Irx3 (Table 2.1) using the Primer Express® software and the Primer-BLAST in the National Center for Biotechnology Information (NCBI) website, followed by confirmation with nucleotide BLAST. Primers for SYBR green based PCR, optimized with different concentration and dissociation curve, and validated by the PCR efficiencies near 100% were used for experiments. PCR results described as threshold cycle value (CT) were compared using relative quantitation of gene expression with Comparative CT

Method (ΔΔ CT Method). The amount of target, normalized to an endogenous reference

(GAPDH) and relative to a control group, is given by: 2-ΔΔCt.

Table 2.1 List of Oligonucleotide Primers for Quantitative RT-PCR

Protein RefSeq Primer Sequence (5’-3’) (Gene)

Fwd: GGCCGCCTCTGGGTCCCTAT Irx3 NM_008393 Rev: GAGCGCCCAGCTGTGGGAAG

Cx40 Fwd: AAGCAGAAGGCTCGGCCTC NM_008121 (Gja5) Rev: GGAAGCTCCAGTCACCCATCTT

Cx43 Fwd: TCATTAAGTGAAAGAGAGGTGCCC NM_010288 (Gja1) Rev: TGGAGTAGGCTTGGACCTTGTC

Cx45 Fwd: ATCACCCTGCCTTGTCACCTA NM_008122 (Gja7) Rev: GAATTGGTTTGCCCTGTTCAC

GAPDH NM_008084 TaqMan® Rodent GAPDH Control Reagents

2.9 Isolation of Neonatal Mouse Ventricular Myocytes

Neonatal mouse ventricular cardiomyocytes (NMVM) were isolated by a modification of the previous methods used to culture neonatal rat cardiomyocyte (Kassiri et al. 2002); (Deng et al. 2000) and culture neonatal mouse cardiomyocyte (Kim et al. 2008). Hearts were removed from 1 day old neonatal Irx3 mice. Using aseptic technique, atria and blood vessels were removed, and ventricles were cut into 2 - 4 pieces. Ventricular tissue was washed repetitively in ice-cold calcium- and bicarbonate-free Hanks with HEPES buffer (CBFHH) [(mmol/L) 137

NaCl, 5.36 KCl, 0.81 MgSO4 ·7H2O, 0.44 KH2PO4·7H2O, 0.34 NaH2PO4 ·4H2O, 20 HEPES, and 5.6 dextrose, pH 7.4] and predigested overnight in 0.5 mg/mL trypsin in CBFHH at 4°C on constant rocking. 12 - 16 hours later, cardiomyocytes were dissociated at 37°C by gentle stirring

(about 40 - 60 rpm) in 4 ml of digestion media containing 50 U/mL of collagenase type II

(Worthington Biochemicals, Lakewood, NJ), 0.2 mg/ml trypsin (Invitrogen), and 0.1%

Gentamycin (50 µg/mL, Sigma) in bicarbonate-free Hanks with HEPES buffer (BFHH).

Dispersed cells were collected every 6 – 12 minutes into conical polycarbonate tubes containing ice cold 10% fetal bovine serum (FBS) to stop the digestion. Dissociated cell suspension were centrifuged at 1000 rpm at 4°C for 5 minutes and resuspended in serum media (SM) containing

DMEM:HAM F-12 (1:1. v/v), 10% FBS and 100 units/mL penicillin/streptomycin (P/S). Non- myocyte contamination with fibroblast and endothelial cells were prohibited by differential plating for 1 hour onto 100 mm Primaria® culture dish (25382-1701, BD Biosciences). Purity of

NMVM have been previously confirmed by using immunofluorescence microscopy using anti- cardiac α-actinin antibody (A7811, SIGMA), showing that 93% of isolated cells are cardiomyocytes (Kim et al. 2008). Myocytes were counted using trypan blue exclusion (0.4%,

T8154, Sigma) on hematocytometer (Z35,962-9, Sigma), plated at a density of 2.5 x 105 cells/mL and cultured at 37 °C in a humidified atmosphere of 5% CO2. 0.1 mM bromodeoxyuridine (BrdU, B9285, Sigma) and 20 μM arabinosylcytosine (Ara-C, #C1768,

Sigma) were added in culture medium to inhibit non-myocyte proliferation (Deng et al. 2000). cells were infected for 3 – 4 hours with adenovirus (see below), at 5 multiplicity of infection

(MOI), and then cultured in fresh serum media. At day 4, cells were harvested for quantitative

PCR or protein experiments.

2.10 Adenoviral Construct Generation

Adenoviral Irx3 constructs were generated using Adeno-XTM ViraTrakTM Expression

System 2 (Clontech). The mouse cDNA encoding the entire Irx3 was fused with FLAG-tag, the

VP16 activation domain, and the Engrailed suppressor (EnR) domain in N-terminus of Irx3,

35 then were sub-cloned into the Creator Donor vector pDNR-CMV. Sequence between two loxP sites of pDNR-CMV vector was transferred into the single loxP site in the adenoviral genome of the Adeno-X ViraTrak Acceptor vector by Cre recombinase. After selecting of recombinants with chloramphenicol, the recombinant adenoviral genome was release by enzyme digestion with PacI to produce infectious recombinant adenovirus, and transfected into low passage HEK-

293 cells. Two days later, transfection efficiency was visually confirmed under a fluorescent microscope. Seven to ten days later, recombinant adenovirus was harvested and stored in -80°C after titer was determined.

2.11 Fiber imaging and quantification of EGFP fluorescence

Irx3+/+;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP adult, P4 and P0 mouse hearts were anaesthetized and sacrificed via cervical dislocation. The hearts were rapidly excised and placed in room temperature standard PBS solution (pH 7.4). For right ventricular conduction system imaging done in adult and P4 hearts the RV outer wall was carefully cut open, making sure no major arteries or conduction fibers were damaged. Similarly, for left ventricular imaging LV wall was cut open at the centre of the free wall in adult, P4 and P0 mouse hearts. In both positions the heart was pinned down and occasionally flattened with a glass slide to maximize the number of fibers in focus. Images of the hearts were taken using an upright Olympus MVX-

10 microscope equipped with a CoolSnap HQ (Photometrics, Surrey, BC) camera interfaced with ImagePro Plus 5.1 software resulting in image sequence resolution of 1390 × 1038. Irx3 deficient, heterozygous and wildtype mice with the Cx40-EGFP reporter were excited using a

200W EXFO X-Cute exacte source. For comparison purposes mouse littermates were images on the same day at comparable magnification, exposure and light intensity.

Cx40 promoter-dependent GFP expression was determined by measuring the intensity of

EGFP fluorescence in the LBB and distal Purkinje fibers of Irx3-/-;Cx40+/EGFP, Irx3+/-

;Cx40+/EGFP and Irx3+/+;Cx40+/EGFP mice. For control purposes, EGFP fluorescence intensity was also measured in the atria and septal artery of all three mouse groups, where Irx3 is not expressed (Figure 3.1). Intensity of fluorescence was measured using ImageJ software in multiple fibers divided by the fiber area and averaged to obtain a value for the LBB and purkinje fibers. For comparison purposes, the intensity of fluorescence in both Irx3-/-;Cx40+/EGFP and

Irx3+/-;Cx40+/EGFP mice was compared with respect to Irx3+/+;Cx40+/EGFP mice.

2.12 Statistical Analysis

All results are expressed as mean ± S.E.M. (the standard error of the mean). Significance and difference of multiple groups was determined by student t-test, and one-or two- way

ANOVA with post-hoc analysis using Student-Newman-Keuls test. Differences at P < 0.05 were considered statistically significant. Calculations and statistical test were performed using the Sigma Stat 3.0 program.

CHAPTER 3

RESULTS

3.1 Irx3 is preferentially expressed in the developing and mature ventricular conduction system

To begin understanding the role of Irx3 in the heart its specific expression pattern was examined throughout development and into adulthood. For this purpose an Irx3tauLacZ

(Irx3LacZ) mouse line was generated via replacement of the endogenous allele by a tauLacZ reporter insertion at the ATG start codon (Courtesy of Dr. Chi-chung Hui, Figure 2.1).

Histological analysis of embryonic day 10 (E10) Irx3+/LacZ mice by -galactosidase staining shows that the reporter faithfully recapitulates endogenous expression of the Irx3 transcript in the central nervous system (Kobayashi et al. 2002; Kiecker and Lumsden 2004) while showing restricted Irx3 expression in the ventricular ring of the heart, which forms the precursor to the distal ventricular conduction system (Moorman et al. 1998; Christoffels et al. 2000) (Figure 3.1

A). By E14, Irx3 expression is detected in cardiomyocytes at the top of the interventricular septum (IVS) where the atrioventricular bundles will develop and in longitudinally arranged trabeculae astride the IVS that will form the bundle branches and Purkinje fiber network (Figure

3.1 B). In the adult mouse, Irx3-specific LacZ expression forms a gradient extending from the ventricular conduction system (VCS) to the subendocardium as observed in both short axis and longitudinal slices of 8 week-old Irx3+/LacZ mice (Figure 3.1 C, D). Specifically in the VCS, Irx3 dependent LacZ expression delineated the His-bundle and left and right bundle branches (LBB and RBB, respectively) extending to the distal Purkinje fibers of the left and right ventricle

(Figure 3.1 D, E), consistent with the early expression pattern seen at embryonic day 14 mice

(Figure 3.1 B).

In order to further confirm the expression pattern of Irx3 in the heart, I measured Irx3 mRNA expression in cells isolated from the VCS (VCS), subendocardium (ENDO) and subepicardium (EPI) of Irx3 wildtype (WT, Irx3+/+) mice.VCS cells were identified by Cx40 promoter-driven EGFP expression (described in methods section 2.1). As shown in Figure 3.1 F,

VCS cells exhibit higher Irx3 mRNA expression than cells isolated from the left ventricular working myocardium consistent with the observed LacZ staining. Moreover, gene expression data showed an ENDO to EPI gradient in Irx3 transcript expression also seen in LacZ staining.

Taken together, histology data and qRT-PCR results establish that Irx3 is preferentially expressed in the VCS throughout embryogenesis and into adulthood suggesting a role for Irx3 in

VCS function.

A B HB C Epi

IVS LV

Endo E10 8W D E HB F 1.5 HB Irx3 RA

LBB 1.0 LV RBB * # RV 0.5 IVS * 0.0

8W mRNARelative Expression VCS ENDO EPI

Figure 3.1. Irx3 expression delineates the developing and mature ventricular conduction system (VCS). (A) Global expression pattern of Irx3 revealed by LacZ staining of Irx3+/LacZ mice at E10. In the heart, Irx3 expression is specific to the ventricular ring (red arrow head). (B) Sagital sections reveal the expression of Irx3 along the IVS and the trabeculae at E14 specifically delineating the early His-bundle and left and right bundle branches. (C) x-gal staining of transverse sections of 8-week-old Irx3+/LacZ hearts showed Irx3 expression in the subendocardium of the left and right ventricles, otherwise absent in the subepicardium (D) Sagital heart section showed Irx3-specific LacZ expression in the His bundle extending down the conductioction system along the right and left ventricular endocardium. (E) Magnified view of (D) shows specific Irx3LacZ expression in the His– bundle area as well as the left and right bundle branches. (E) Relative expression of Irx3 in cells isolated from the VCS (VCS), subendocardium (ENDO) and subepicardium (EPI) of wild-type mice assessed by quantitative real-time RT-PCR. mRNA levels are relative to average wildtype Purkinje values normalized by GAPDH; n = 4, *p < 0.02 ENDO and EPI compared with Purkinje, #p < 0.01 Epi compared with Endo. Data are mean ± SEM. HB: His-bundle; RBB: right bundle branch; LBB: left bundle branch; IVS: intervetricular septum; RA: right atrium; TB: Trabeculae; LV: left ventricle; RV: right ventricle; PF: Purkinje fiber. Panels A-E are courtesy of Dr. Chi-Chung Hui’s lab and Jieun Kim

41 3.2 Phenotype of Irx3 deficient mice

Given that Irx3 is expressed in the fast-conducting VCS, we enquired after the effect of Irx3 ablation (Irx3-/-) on heart function. To address this question, we performed structural, hemodynamic, and electrophysiology analysis of WT and Irx3-/- mouse hearts. Although smaller in size, Irx3-/- mice are viable and fertile. We found no appreciable differences in overall heart morphology, size (heart weight to tibia ratio), or cardiac function (echocardiography) between

Irx3-/- and WT controls (Shan-Shan Zhang, unpublished data). Although no difference in heart function was observed, Irx3-/- mice were found to have an altered conduction phenotype when compared to their WT littermate controls.

3.2.1 Altered ventricular activation in Irx3-/- mice

To assess the effect of Irx3 ablation on the integrity of electrical propagation in the heart, surface ECG measurements were taken from Irx3-/- mice and compared to the ECG of their WT controls. Irx3-/- mice, contrary to WT, exhibited slowed ventricular activation when assessed by

6-lead ECG. Mice lacking Irx3 showed consistent prolongation of the QRS interval and appearance of notched R waves seen in leads II, III, aVL and aVF, otherwise absent in WT mice

(Figure 3.2). A negative QRS deflection in Lead I combined with positive deflections in Leads

II and III, indicative of right ventricular axis deviation, was observed in 70% of Irx3-/- mice but in none of the WT mice. Since the heart‟s electrical axis denotes the general direction of the heart‟s depolarization wavefront (or mean electrical vector) in the frontal plane, change in the direction of the axis confirms the notion of altered ventricular activation in mice lacking Irx3.

Other changes in the ECG were also found as summarized in Table 3.1 for 7 WT

(Irx3+/+) and 7 Irx3-/- mice. On average, the QRS interval was prolonged (p < 0.01) from 9.1 ±

0.1 ms in WT mice to 12.1 ± 0.7 ms in Irx3-/- mice with no change in heart rate, PR and QT intervals. Irx3+/- mice, similarly to Irx3+/+, lacked an R notch and right axis deviation in their

ECG profile however their QRS interval proved to be heterogeneous. Among the 10 Irx3+/- mice studied, 50% showed a QRS duration identical (P = 0.711) to those of WT mice (9.2 ± 0.1 ms versus 9.1 ± 0.1 ms in WT) while the remainder 50% had an intermediate QRS duration of

11.0 ± 0.1 ms different (p < 0.01) from both Irx3+/+ and Irx3-/- (p < 0.05) QRS values. Since heterozygous mice had a variable QRS phenotype this thesis focused on comparison of WT and

Irx3-/- mice only.

The altered ECG phenotype, manifesting in a widened QRS, notched R waves and right ventricular axis deviation, combined with normal heart function and absence of ventricular enlargement observed in Irx3-/- mice suggested that altered ventricular activation could be a result of defective conduction through the VCS system (Rotman and Triebwasser 1975;

Kawasuji and Iwa 1978), consistent with the VCS-specific expression pattern of Irx3 (Figure

3.1).

Figure 3.2 In-vivo six-lead ECG showing altered ventricular activation in Irx3-/- mice Representative six-lead surface ECG traces recorded from anesthetized WT and Irx3-/- mice. Irx3-/- mice show prolonged QRS duration and notched R waves seen in leads II, III, aVL and aVF (black arrow) which are absent in WT mice. Negative QRS deflection in Lead I of Irx3-/- mice, absent in WT mice, indicates a ventricular axis deviation. Combined, these results indicate that Irx3-/- mice have altered ventricular activation relative to their WT littermate controls.

44 Table 3.1 Quantification of Irx3+/+, Irx3+/- and Irx3-/- mouse ECG parameters.

Interval Irx3+/+ Irx3+/- Irx3-/- (msec) (n = 7) (n = 10) (n = 7)

PR 39.2 ± 0.6 38.1 ± 0.8 39.2 ± 2.0

QRS 9.1 ± 0.1 10.1 ± 0.3* 12.1 ± 0.7*§

QT 46.7 ± 1.5 44.1 ± 1.6 44.3 ± 0.5

Heart rate (bpm) 466 ± 19 468 ± 8 448 ± 13

Values are mean ± SEM. *p < 0.01 compared to Irx3+/+, §p < 0.05 compared to Irx3+/-

45 3.2.2 Increased His-Ventricular Conduction Time in Irx3-/- mice

To further pinpoint the source of the conduction abnormality observed in surface ECGs of Irx3-/- mice, we measured the time required for the depolarizing impulse to spread from the atria to the ventricle (AV), from atria to His-bundle (AH) and from the His-bundle to the ventricle (HV) using octapolar intracardiac ECG. The octapolar catheter was inserted into the right ventricle through the right jugular vein of anesthetized WT and Irx3-/- mice. Catheter placement was chosen based on the largest His-bundle electrogram recorded in the middle leads

(4 - 5 or 5 - 6) while maintaining a large positive ventricular deflection in the distal leads (1 - 2) and a prominent atrial electrogram in the most proximal leads (7 - 8). This position was chosen to allow for consistency between recordings done in multiple mice.

According to the representative intracardiac trace depicted in Figure 3.3 A, Irx3-/- mice showed widening of the HV interval from 13.1 ± 0.4 ms in the WT to 14.6 ± 0.6 ms in the Irx3-/-

(p < 0.05) representing an increase in the time electrical conduction proceeds from the His- bundle to the point of ventricular activation (Figure 3.3 A, B). No change in AH duration was found upon loss of Irx3 (Figure 3.3 B) indicating that conduction through the AV node, forming the bulk of AH duration, was unchanged, consistent with the absence of Irx3 expression in AV nodal tissue. This data support the conclusion that Irx3-ablation slows conduction specifically in the ventricular conduction system of mice lacking Irx3, consistent with the strong VCS- specific expression pattern of Irx3.

A Irx3+/+ Irx3-/-

50 Irx3+/+ Irx3-/- 40

20 * Duration(ms)

0 AV AH HV

Figure 3.3. Slowed His-Ventricular conduction in Irx3-/- mice (A) Representative trace of WT and Irx3-/- mice intracardiac ECG depicting atrial (A) ventricular (V) and His-bundle (H) electrograms. Raw traces show a widening of the HV interval in Irx3-/- mice compared to WT controls. (B) Quantification of the time required for depolarization to spread from the atria to the ventricle (AV), from atria to His-bundle (AH) and from the His-bundle to the ventricle (HV). Values are mean ± SEM, n = 9; *p < 0.05. Data courtesy of Mark Davis.

47 3.2.3 Irx3-/- Mice have functional right bundle branch block

Up to this point I have established a role for Irx3 in the ventricular conduction system using surface ECG, and intracardiac catheterization combined with the Irx3 expression pattern.

To more directly examine the affects of Irx3 ablation on heart conduction and thereby determine the mechanisms underlying the surface ECG alterations, optical imaging of WT and Irx3-/- hearts was performed using the voltage sensitive dye, di-4-ANEPPS. This allowed us to look at the temporal activation of the external surface of the heart assessed by a change in dye fluorescence as a result of membrane depolarization.

As shown in the left column of Figure 3.4 A, epicardial activation maps were obtained during sinus rhythm in two orientations with the apical four chamber view (top row) as well as the apical right ventricular (RV) two chamber view (bottom row). In all WT mouse hearts (n =

24) epicardial activation began in two separate locations: one in the lower part (apex) of the left ventricular free wall and the second in the mid region of the right ventricular free wall.

Presumably these two areas of "breakthrough" are a consequence of separate ventricular activation by the left and right bundle branches (Figure 3.4 A centre column). After breakthrough at these locations, the activation spread in all directions as a wavefront leading to full depolarization of the entire external surface of the heart . In all but one WT heart the left ventricular breakthrough either preceded or occurred simultaneously with right ventricular breakthrough consistent with previous literature (Nygren et al. 2000). The recording that differed shows a similar activation pattern with two breakthrough points, but with the right ventricle activating shortly prior to the left ventricle. It is plausible, however, that these differences are due to slight variation in the orientation of the hearts compared to each other.

In the right column of Figure 3.4 A, the representative activation pattern recorded from an Irx3-/- heart appeared grossly different from its WT control. Irx3-/- mouse hearts often (77%, n = 13) lacked a right ventricular breakthrough. Hence, in these mice, epicardial activation initiated via a single breakthrough point emanating from the apex of the left ventricle which spread towards the base of the heart thereby activating the right ventricle. The absence of right ventricular breakthrough, and hence delayed right ventricular activation, in the Irx3-/- mice provides direct evidence for a functional right bundle branch block (RBBB) phenotype, a common human conduction defect (Rotman and Triebwasser 1975; Schneider et al. 1981), caused by either slowed or blocked conduction through the RBB.

In isochrome maps of the ventricular activation pattern (see Methods 2.5.2), the RBBB activation pattern seen in majority of Irx3-/- mice was accompanied by reduced physical distances between isochrome lines (i.e. "crowding" of isochrone lines), when compared to WT hearts, establishing conduction slowing. In order to compare epicardial conduction velocities of

Irx3-/- mice with RBBB to those of WT and remaining Irx3-/- mice which showed no block

(NB), velocity vector maps were generated for each heart using the Scroll software (see

Methods 2.5.2) . As seen in Figure 3.4 B, Irx3-/- mice with functional RBBB showed slowed epicardial conduction velocity (1.0 ± 0.2 m/s) compared to WT controls (1.6 ± 0.1 m/s).

Interestingly, Irx3-/- mice without block had faster conduction velocities than Irx3-/- mice with

RBBB (1.7 ± 0.1 m/s) with values comparable to those of WT control mice (1.6 ± 0.1 m/s). This data suggests that the observed slowing of epicardial conduction velocity seen in Irx3-/- mice with RBBB was not a result of decreased intrinsic conduction properties of the myocardium but rather a consequence of the altered pattern of ventricular activation caused by changes (i.e. slowing or blocking) in conduction through the VCS which manifested as functional RBBB.

Consistent with in-vivo surface ECG data (Table 3.1), ex-vivo ECG measurements, recorded simultaneously with optical activations maps, showed prolongation in the QRS interval of Irx3-/- mice compared to WT controls (Figure 3.4 C). Specifically within the Irx3-/- group, we found that QRS prolongation was restricted to Irx3-/- mice with a RBBB phenotype (12.4 ± 1.2 ms) which also exhibited decreased epicardiac conduction velocities (CVs) (Figure 3.4 B). On the other hand, Irx3-/- mice with no block showed QRS durations comparable (P = 0.5) to those of WT mice (8.8 ± 0.5 ms versus 8.3 ± 0.3 in WT) (Figure 3.4 C) consistent with their equivalent epicardial CVs (Figure 3.4 B). Due to the apparent relationship between epicardial

CV and QRS interval, a plot of the two was generated revealing the existence of a linear relationship between the two parameters such that the QRS interval increases linearly with decrease in epicardial conduction velocity.

Taken together, these results suggest that the observed QRS prolongation seen in both in-vivo and ex-vivo ECGs was a result of slowed epicardial conduction and slowed right ventricular activation, a consequence of RBBB.

Figure 3.4. Activation maps show right bundle branch block in Irx3-/- mice. (A) Epicardial activation pattern of WT (Irx3+/+) and Irx3-/- mice in sinus rhythm with an apical four chamber view (top row) and apical right ventricular (RV) two chamber view (bottom row). Irx3+/+ mice show two breakthrough points in the apex of the left and the right ventricle (centre column) while Irx3-/- mice lack a right ventricular breakthrough (right column) indicative of functional right bundle branch block. Isochrone lines outline the areas where depolarization reached 50% intensity in consecutive 0.5 ms time intervals where red indicates earliest activation. n = 12 (Irx3+/+), n = 9 (Irx3-/-). Quantification of the epicardial conduction velocity (B) and corresponding QRS intervals (C) of Irx3+/+ as well as Irx3-/- hearts grouped based on the presence (RBBB) or absence (NB) of right bundle branch block. Values are mean ± SEM, n = 4 - 6, *p < 0.05. (D) Plot represents the existence of a negative linear relationship between QRS duration and epicardial conduction velocity. LA: left atrium; RA: right atrium; LV: right ventricle; RV: right ventricle; RBBB: right bundle branch block; NB: no block: CV: conduction velocity.

B C N.S D N.S 15 20 2.0 * y = -4.0x + 15.5 r2 = 0.522 1.5 15 p = 0.0023 * 10

CV (m/s)CV 10 1.0 5 5 0.5

0 QRS Duration (ms) Duration QRS 77% 23% (ms) Duration QRS Epicardial 0.0 0 RBBB NB RBBB NB 0.0 0.5 1.0 1.5 2.0 Irx3+/+ Irx3+/+ Irx3-/- Irx3-/- Conduction Velocity (m/s)

51 3.2.4 Irx3-/-;Cx40+/EGFP reporter mice show comparable phenotype to Irx3-/- mice

The ventricular conduction system is difficult to study without proper visualization due to the lack of contrast between the VCS and the underlying working myocardium. Therefore, we bred Irx3LacZ mice to reporter mice with EGFP expression under the control of the Gja5 promoter, encoding Cx40, leading to EGFP expression in the VCS, atria and coronary vasculature (Miquerol et al. 2004). Since subsequent experiments required the use of double transgenic Irx3+/+;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP mice we have first compared the electrical phenotype of these mice to those of the Irx3+/+ (Irx3+/+;Cx40+/+) and Irx3-/- (Irx3-/-;Cx40+/+) mice with wildtype (WT) Cx40 expression, respectively. According to our surface ECGs and optical measurements, Irx3+/+;Cx40+/EGFP mice were found to be indistinguishable from

Irx3+/+;Cx40+/+ showing comparable QRS durations without notched R waves (Figure 3.5 A, B) combined with a two breakthrough activation pattern (Figure 3.5 C). This comparison showed that heterozygous Cx40 expression was sufficient for normal heart activation. Similarly, phenotypes of Irx3-/-;Cx40+/EGFP mice were identical to Irx3-/-;Cx40+/+, showing a prolonged

QRS duration with notched R waves combined with a RBBB activation pattern in optical activation maps (Figure 3.5 A - C). These comparable results have enabled the use of

Irx3+/+;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP mice to investigate both VCS fiber conduction velocity and analyze the VCS-specific molecular targets of Irx3 which would otherwise be more challenging in studying Irx3+/+ and Irx3-/- mice.

A Irx3+/+ Irx3-/- B 2mV

+/+ 20ms QRS Duration (ms)

Irx3+/+ Irx3-/- Cx40

Cx40+/+ 9.4 ±0.3 11.9 ±0.7 *

Cx40+/EGFP 9.1 ±0.1 11.2 ±0.5 #

+/EGFP *p < 0.05 versus Cx40+/+

# p < 0.05 versus Cx40+/EGFP Cx40

C Irx3+/+;Cx40+/EGFP Irx3-/-;Cx40+/EGFP

Figure 3.5. Unchanged ECG traces and activation maps in Irx3+/+ and Irx3-/- mice following loss of a single Cx40 allele (A) Representative ECG traces (lead II) recorded from Irx3+/+;Cx40+/+, Irx3-/- ;Cx40+/+, Irx3+/+;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP mice. Consistent with Irx3-/-;Cx40+/+ mice (Figure 3.3), Irx3-/-;Cx40+/EGFP mice showed prolonged QRS duration and notched R waves (arrow) which were absent in Irx3+/+;Cx40+/EGFP and Irx3+/+;Cx40+/+ mice. (B) Comparable QRS intervals were seen between Irx3+/+;Cx40+/+ and Irx3+/+;Cx40+/EGFP mice as well as Irx3-/-;Cx40+/+ and Irx3-/-;Cx40+/EGFP mice. (C) Representative epicardial activation maps of langendorff-perfused Irx3+/+;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP mouse hearts. Irx3-/-;Cx40+/EGFP mice, consistent with Irx3-/-;Cx40+/+ , lacked a right ventricular breakthrough while WT littermates had both left and right ventricular breakthroughs (Irx3+/+;Cx40+/EGFP, n = 7; Irx3-/-;Cx40+/EGFP, n = 9).

53 3.2.5 Slowed VCS fiber conduction in Irx3-/-;Cx40+/EGFP mice A B C To examine whether the observed RBBB phenotype is caused by conduction slowing or

complete block, conduction velocity (CV) was measured in VCS fibers of Irx3-/-;Cx40+/EGFP and

Irx3+/+;Cx40+/EGFP mice. Action potentials (AP) were recorded simultaneously from two glass

electrodes placed onto GFP+ VCS fibers on the right ventricular septal wall (Figure 3.6 A).

Fiber segments between the electrodes were chosen such that the fiber was continuous, linear, D E F and devoid of branching. Time between proximal and distal Purkinje fiber activation was

determined by the difference between the AP signal peaks for each electrode. Four successive

AP time differences were averaged and divided by the distance between the electrodes to

determine the CV in VCS fibers of both animal groups (see Methods 2.7). According to figure

3.6 B, electrical signal traveling from electrode 1 (recorded in channel 1: CH1) took longer to

reach the second electrode (channel 2: CH2) in Irx3-/-;Cx40+/EGFP mice compared to

Irx3+/+;Cx40+/EGFP mice with equally spaced electrodes (750 µm). This data, summarized in

Figure 3.6 C showed that Irx3-/-;Cx40+/EGFP mice had decreased CV (0.116 ± 0.035 m/s) through

their VCS fibers compared to their Irx3+/+;Cx40+/EGFP littermate controls (0.249 ± 0.043 m/s).

Slowing of VCS fiber CV seen in Irx3-/-;Cx40+/EGFP establishes a longer propagation through the

VCS consistent with the previously observed increase in HV duration seen in Irx3-/- mice

compared to Irx3+/+ (Figure 3.3 B). Taken together, these results demonstrate that the abnormal

ventricular activation patterns seen in RBBB associates with slowed, rather than blocked,

conduction through the VCS of Irx3 deficient.

Irx3+/+;Cx40+/EGFP Irx3-/-;Cx40+/EGFP A B C Irx3+/+;Cx40+/EGFP CH1 CH1 Irx3-/-;Cx40+/EGFP CH2 CH2 0.3 * 1 * 1.1 0.8 1.05

1 0.2 0.6 *

0.95 Normalized Action Potential Action Normalized 0.4 0.9 45 50 55 RV Time (msec) 0.1

0.2

Purkinje CV (m/s) CV Purkinje

Normalized AP Normalized -

Normalized Action Potential Action Normalized 0 His 0.0 0 50 100 150 200 TimeTime (msec) (ms)

Figure 3.6. Slowed VCS Fiber Conduction Velocity in Irx3-/-;Cx40+/EGFP mice (A) Representative image of GFP+ fibers (arrow head) on the mouse right septal wall. Asterisks denote the two micropipettes placed on top of VCS fiber to measure fiber conduction velocity. (B) Normalized and filtered action potential profiles measured from Irx3-/-;Cx40+/EGFP (blue) and Irx3+/+;Cx40+/EGFP (red) VCS fibers using two microelectrode (CH1 and CH2) inserted 750μm apart. According to the graph insert, electrical signal took longer to travel from electrode 1 (channel 1 (CH1)) to the second electrode (to channel 2 (CH2)) in Irx3-/-;Cx40+/EGFP versus Irx3+/+;Cx40+/EGFP mice indicative of slowed VCS fiber conduction. (C) Quantification of VCS fiber conduction velocity showed slowed conduction velocity in Irx3-/-;Cx40+/EGFP fibers compared to those of Irx3+/+;Cx40+/EGFP mice. Values are means ± SEM, n = 6 - 7; *P < 0.05. Data curtesy of Mark Davis and Dr. Gerrie Farman.

55 3.3 Irx3 maintains normal VCS conduction by indirectly regulating Cx40 gene expression

Distinct gap junctions containing the connexins Cx40, Cx43, and Cx45 ensure rapid impulse propagation in the His-Purkinje system (Teunissen and Bierhuizen 2004). Since loss of Irx3 resulted in slowing of VCS conduction velocity, we sought to determine the cellular origin of the observed conduction defect and specifically whether Irx3 could regulate connexin expression.

3.3.1 Loss of Irx3 results in decreased Cx40 mRNA expression in VCS cells

To assess the molecular impact of Irx3 deficiency in the VCS, qRT-PCR was performed on mRNA obtained from Irx3+/+;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP GFP+ VCS myocytes

(VCS) isolated from the septal and free wall of the left and right ventricles (Figure 3.7 A) using a Laser Capture Microdissection (LCM) technique (see Methods 2.8 and Figure 2.4). Gene expression in the subendocardium (ENDO) and subepicardium (EPI) was also examined (Figure

3.7 A). Among the three connexin genes investigated, it was found that the expression level of the VCS-specific gap junction channel, Cx40, was 42 ± 4% reduced in the VCS of Irx3-/-

;Cx40+/EGFP hearts, compared with that of Irx3+/+;Cx40+/EGFP. No significant difference in Cx40 expression was observed in ENDO and EPI samples between Irx3-/-;Cx40+/EGFP and

Irx3+/+;Cx40+/EGFP hearts. Additionally, no change in Cx43 expression was observed in the

Irx3-/-;Cx40+/EGFP versus Irx3+/+;Cx40+/EGFP mice in any of the three cell types (Figure 3.7 C) while Cx45 expression was too low for detection in the VCS samples. Decreased Cx40 expression observed in the VCS of adult Irx3-/-;Cx40+/EGFP mice suggested that Irx3 is necessary

56 for proper conduction through the VCS due to its regulation of cell-cell coupling via Cx40 gene expression.

The 7 fold higher Cx40 and 1.5 fold lower Cx43 expression seen in Irx3+/+;Cx40+/EGFP

VCS myocytes compared to adjacent myocardial cells (ENDO), indicated that cells were harvested specifically from the VCS with minimal contamination (Figure 3.7 B, C), consistent with the VCS-specific expression pattern of Cx40 and the low expression of Cx43 in the VCS

(Delorme et al. 1995; van Kempen et al. 1995; Gros and Jongsma 1996; Kaba et al. 2001;

Miquerol et al. 2004; van Veen et al. 2005). Even though some previous studies have concluded that Cx40 is not expressed in adult myocardial cells, I observed low levels of Cx40 mRNA in both the ENDO and EPI samples from Irx3+/+;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP mice. This

Cx40 expression can be explained by Cx40 present in the vasculature which is found throughout the ventricles (Bastide et al. 1993; Gros et al. 1994; Delorme et al. 1995) and was not excluded from my ENDO and EPI "myocyte samples".

Irx3+/+;Cx40+/EGFP Irx3-/-;Cx40+/EGFP

A B C 1.5 Gja5 2.5 Gja1 (Cx40) (Cx43) 2.0 Endo 1.0 Epi 1.5 * 1.0 0.5

0.5 Relative mRNA Expression Relative mRNA VCS Expression mRNA Relative 0.0 0.0 VCS ENDO EPI VCS ENDO EPI

Figure 3.7. Loss of Irx3 results in decreased Cx40 gene expression with no detectable change to Cx43 mRNA levels. (A) Representative image illustrating the heart location from which ventricular conduction cells (VCS), subendocardial (ENDO) and subepicardial (EPI) cells were isolated using laser capture microdissection (LCM). (B) Relative quantitative RT- PCR results showed decreased Cx40 mRNA expression in VCS cells of mice lacking Irx3 with no change in ENDO and EPI sample. (C) Relative quantitative RT-PCR results showed no change in Cx43 expression in VCS, ENDO and EPI sample between Irx3+/+;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP hearts. mRNA levels are relative to average Irx3+/+ ;Cx40+/EGFP Purkinje fibers normalized to GAPDH. n = 4, *, P < 0.05 vs. Irx3+/+;Cx40+/EGFP.

58 3.3.2 Cx40-/- mice have a conduction phenotype similar to Irx3-/- mice

To better understand the functional consequences of reductions in Cx40 gap junction channel expression in our Irx3-/- mice and determine whether a decreased in Cx40 can underlie the observed conduction phenotype, we have generated mice deficient in Cx40 (Cx40EGFP/EGFP or Cx40-/-). Cx40-/- mice, similarly to Irx3-/- exhibited a widened QRS duration combined with notched R waves observed both in surface (Figure 3.8 A) and Langendorff ECG traces consistent with previous literature (Tamaddon et al. 2000). Furthermore, 6-lead ECG measurements revealed a negative QRS complex in Lead I combined with a positive deflection in Lead II (Figure 3.8 A) (Tamaddon et al. 2000) consistent with the notion of right axis deviation previously observed in Irx3-/- mice (Figure 3.2).

Previous studies done on Cx40 deficient mice have also shown decreased conduction velocities in the proximal left and right bundle branched of the VCS (Tamaddon et al. 2000; van

Rijen et al. 2001). Our results, although focused on the distal VCS, similarly showed decreased

VCS fiber conduction velocities in Irx3-/- mice (Figure 3.6 B). Moreover, Cx40-/- mice showed a loss of right ventricular breakthrough in optical mapping studies (Figure 3.8 B), as seen in Irx3-/- and Irx3-/-;Cx40+/EGFP mice, consistent with a functional RBBB conduction phenotype. This data demonstrate that a sufficient decrease in Cx40 can result in impaired conduction observed in the

Irx3-/- mice further supporting the notion that Irx3, through regulation of Cx40 mRNA expression, is necessary for proper electrical conduction in the heart.

A Irx3-/- Cx40-/-

Lead I

R notch R notch

Lead II

QRS QRS 10ms

B Irx3-/- Cx40-/-

Figure 3.8. Irx3-/- and Cx40-/- mice have a similar conduction phenotype (A) Representative surface ECG traces show that Cx40-/- (Irx3+/+;Cx40-/-) mice, similarly to Irx3-/- (Irx3-/-;Cx40+/+) mice have widened QRS duration and notched R waes in lead II configuration. Additionally, both Cx40 and Irx3 deficient mice show a negative QRS deflection in lead I combined with a positive deflection in lead II suggestive of right axis deviation. (B) Representative epicardial activation maps of langendorff-perfused Irx3-/- ;Cx40+/+ and Irx3+/+;Cx40-/- mouse hearts showed that Irx3+/+;Cx40-/- mice, similarly to Irx3-/-;Cx40+/+ mice, lacked a right ventricular breakthrough suggestive of RBBB.

60 3.3.3 Transcriptional regulation of Cx40 gene expression by Irx3

To gain mechanistic insight into Cx40 regulation by Irx3, different types of adenoviral

Irx3 constructs were generated as illustrated in Figure 3.9 A. In addition to the endogenous form of Irx3 (Ad-Irx3), Irx3 was fused to FLAG-tag (Ad-FLAG-Irx3), the VP16 activation domain

(Ad-VP16-Irx3), which maintains Irx3 in its activator form, or the Engrailed repressor domain

(Ad-EnR-Irx3), which forces Irx3 into a repressor form, located in N-terminus of Irx3.

Adenovirus-mediated delivery of these constructs to cultured neonatal mouse ventricular myocytes (NMVM) revealed considerably higher Irx3 protein expressions, compared to controls

(non-infected and Ad-GFP infected cells) (Figure 3.9 B). Over-expression of endogenous Irx3 led to an increase in Cx40 expression, compared with controls (Figure 3.9 C), while an opposite expression pattern was seen in Irx3-/- hearts. Similar results were observed in Ad-FLAG-Irx3 infected cells, suggesting that FLAG-tag fused to the N-terminus of Irx3 (Ad-FLAG-Irx3) did not affect Irx3-mediated gene regulation. Unlike our initial expectation that Irx3 activates Cx40,

EnR-Irx3 resulted in further increase in Cx40 expression, similarly to the endogenous Irx3 result, indicating that Irx3 endogenously acts as a repressor of Cx40 expression, rather than an activator. Consistent with this notion, forcing Irx3 into an activator form by VP16 led to a decrease in Cx40 expression. The observed changes, either increase or decrease, in Cx40 mRNA expression that occurred in response to the different adenoviral vector similarly translated into protein expression (Figure 3.9 B). These results suggest that Irx3 indirectly regulates Cx40 gene and hence protein expression, possibly via repressing a repressor of Cx40 promoter activity

(Figure 3.9 D).

Irx3

- Irx3

A B -

No Infection No

GFP Irx3 EnR VP16

(kD) 150 100 Irx3: Irx3 Irx3 75 FLAG-Irx3: FLAG Irx3 50 EnR-Irx3: EnR Irx3 FLAG Cx40 VP16-Irx3: VP16 Irx3 FLAG Tubulin C Gja5 D 5 (Cx40) * 4 EnR-Irx3 Irx3Rep Irx3Act VP16-Irx3 3 * * 2 Repressor? ** 1 * Cx40

0 Relative mRNA Expression mRNA Relative

Figure 3.9. Irx3 indirectly regulates Cx40 expression. (A) Schematic of Irx3 constructs. Irx3 were fused to either the VP16 activation domain (VP16-Irx3) or the Engrailed repressor domain (EnR-Irx3). It was also tagged with FLAG (Flag-Irx3). (B) Western blot analysis revealed that significant amounts of Irx3 were expressed in all Irx3, EnR-Irx3, and VP16-Irx3 groups compared to non-infected or GFP groups leading to increased Cx40 protein expression in the Irx3 and EnR-Irx3 groups while resulting in decreased Cx40 protein in the VP16-Irx3 group. (C) Cx40 mRNA expression was elevated by Irx3 over-expressed cells (Irx3 and FLAG-Irx3), compared to non-infected cells and GFP-infected cells. This result was consistently observed in the EnR-Irx3 expressed cells while the VP16-Irx3 expressed cells showed reduced Cx40 mRNA expression, suggesting that Irx3 acts as a repressor and indirectly regulates Cx40 gene expression. Values are mean ± SEM, n =3. *p < 0.01 compared to GFP; **p < 0.01 compared to EnR-Irx3 .(D) A schematic representation of the mechanism of Cx40 regulation by Irx3. Irx3 indirectly regulates Cx40 gene expression, possibly by repressing a repressor of Cx40 promoter activity. Data courtesy of Kyoung-Han Kim and Vijitha Puviindran. 62 3.4 Irx3 maintains proper ventricular activation by regulating ventricular conduction system fiber development

Irx3+/+;Cx40+/EGFP mice had epicardial activation patterns comparable to WT mice suggesting that a 50% reduction in Cx40 does not result in abnormal conduction (Figure 3.8). Since mice lacking Irx3 have ~42% loss of Cx40 mRNA expression (Figure 3.7 B), reduction in the gap junction channel expression alone cannot fully account for the observed ventricular activation phenotype and must therefore involve other, potentially developmental factors.

3.4.1 Decreased fiber complexity and Cx40 promoter activity in adult Irx3 deficient mice

In order to further explore the role of Irx3 in the conduction system and its regulation of

Cx40 activity we looked at the left and right VCS structure and fluorescence intensities of Irx3-/-

;Cx40+/EGFP and Irx3+/+;Cx40+/EGFP mice. Consistent with the notion that Irx3 regulates Cx40 gene expression, we saw a decrease in the level of Cx40 promoter-dependent GFP expression in the left bundle branch and distal fibers of Irx3-/-;Cx40+/EGFP mice (58 ± 3% and 35.1 ± 4.5%, respectively) compared to Irx3+/+;Cx40+/EGFP (Figure 3.10 A, B). Irx3+/-;Cx40+/EGFP mice used as control did not show a similar reduction in fluorescence intensity suggesting that a single allele knockout of Irx3 is insufficient to cause a measurable decrease in Cx40 promoter activity.

Moreover, no change in Cx40 promoter-dependent GFP expression was seen in the atria and septal artery of Irx3-/-;Cx40+/EGFP and Irx3+/-;Cx40+/EGFP mice consistent with the lack of Irx3 expression in these regions.

In addition to changes in Cx40-dependent GFP expression Irx3-/-;Cx40+/EGFP mice showed decreased VCS fiber number and complexity in the free and septal walls of both the left and right ventricles (Figure 3.10 A) establishing that Irx3 plays a role in conduction fiber development in addition to regulating Cx40 gene expression.

A Irx3+/+;Cx40+/EGFP Irx3-/-;Cx40+/EGFP

LBB Atria

SA HB

RBB

RSW

RFW DF

65 Irx3+/-;Cx40+/EGFP B Irx3-/-;Cx40+/EGFP

Septal Distal Atria Artery LBB FibersFibres

(%) 20 +/EGFP

;Cx40 +/+

-20 Irx3

-40

-60

Intensity Change from from Change Intensity -80

Figure 3.10. Decreased VCS fiber complexity and Cx40 promoter activity in Irx3-/-;Cx40+/EGFP mice. (A) Fluorescence images of Irx3+/+Cx40+/EGFP and Irx3-/-Cx40+/EGFP show reduced fiber complexity and fluorescence intensity in VCS of the left ventricle (LV), and right ventricular septal and free walls (RSW and RFW, respectively) of Irx3-/-Cx40+/EGFP mice compared to their WT littermates. (B) Quantification of Cx40-dependent GFP fluorescence intensity in the atria, septal artery, LBB and distal Purkinje fibers of Irx3+/-;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP mice as a percent change of Irx3+/+;Cx40+/EGFP mice. Values are mean ± SEM, n = 3.

66 3.4.2 Decreased fiber complexity in postnatal day 4 (P4) and 0 (P0) of Irx3 deficient mice

Since Irx genes have been shown to play a role in cardiac patterning and development we were interested in determining the time point when changes to conduction system morphology take place. Hence, we looked at VCS fiber morphology and measured surface

ECGs of Irx3+/+;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP mice at postnatal days 4 (P4) and 0 (P0).

Irx3-/-;Cx40+/EGFP mice at P4 showed decreased VCS fiber complexity manifested in narrowing of the His bundle and LBB, decrease in the number of left ventricular distal fibers (see box) and narrowing of the RBB on the right septal wall (Figure 3.11), when compared to WT controls.

This change in VCS structure was accompanied by widening of the QRS interval and notching of R waves. Interestingly, although all Irx3-/-;Cx40+/EGFP mice showed decreased VCS complexity relative to Irx3+/+;Cx40+/EGFP, there was noticeable variability in the degree of fiber loss. More importantly, upon observation, the severity of fiber loss correlated well with QRS duration such that mice exhibiting greater fiber loss showed wider QRS interval while those with fewer lost fibers showed a milder increase in QRS duration. This result suggested that VCS fiber arrangement and number can influence the duration of ventricular activation (i.e. QRS interval) and thus can contribute to the ECG and optical phenotype observed in the adult Irx3-/- mice (Figure 3.2 and 3.4).

At P0, Irx3-/-;Cx40+/EGFP hearts also showed decrease in VCS fiber complexity particularly in the distal Purkinje fibers (Figure 3.12 A), suggesting that Irx3 plays a role in VCS development as early as at postnatal day 0. Preliminary ECG traces of P0 Irx3-/-;Cx40+/EGFP mice were wider than those of their WT littermate controls (Figure 3.12 B) although the difference in QRS duration between WT and Irx3 deficient mice was lower at P0 compared to

P4 suggesting that fiber morphology and hence QRS widening exacerbates with age.

A Irx3+/+;Cx40+/EGFP (P4) Irx3-/-;Cx40+/EGFP (P4)

His

RBB His RBB RSW

B Irx3+/+;Cx40+/EGFP (P4) Irx3-/-;Cx40+/EGFP (P4)

Figure 3.11. Decreased VCS fiber complexity in P4 Irx3-/-;Cx40+/EGFP mice. (A) Fluorescence images of Irx3+/+Cx40+/EGFP and Irx3-/-Cx40+/EGFP at postnatal day 4 show reduced fiber complexity in left ventricular distal fibers (dashed square) as well as right septal fibers and right bundle branch (RBB). (B) Irx3-/-Cx40+/EGFP mice show widened QRS duration and notched R waves absent in Irx3+/+Cx40+/EGFP mice. 68 A Irx3+/+;Cx40+/EGFP (P0) Irx3-/-;Cx40+/EGFP (P0)

His

LBB

B Irx3+/+;Cx40+/EGFP (P0) Irx3-/-;Cx40+/EGFP (P0)

R notch

Figure 3.12. Decreased VCS fiber complexity in P0 Irx3-/-;Cx40+/EGFP mice. (A) Fluorescence images of Irx3+/+Cx40+/EGFP and Irx3-/-Cx40+/EGFP mice at postnatal day 0 show slight reduction in fiber complexity in left ventricular distal fibers (dashed square). (B) Irx3-/-Cx40+/EGFP mice show widened QRS duration and notched R waves absent in Irx3+/+Cx40+/EGFP mice. His: His-bundle; LBB: left bundle branch; DF: distal fibers

69 3.4.3 P0 Irx3-/- cardiomyocytes show decreased Cx40 mRNA expression

In order to determine whether the decrease in fiber complexity seen in Irx3 P0 hearts was accompanied by a decrease in Cx40 mRNA expression, as seen in the adult Irx3 deficient mice, we used qRT-PCR of P0 cultured mouse neonatal cardiomyocytes. Consistent with the adult phenotype and the proposed mechanism for Cx40 regulation by Irx3, overexpression of

Irx3 (AdIrx3) in P0 cardiomyocytes resulted in a 16 fold increase in Irx3 expression (Figure

3.13 A) which led to a 3 fold increase in Cx40 expression (Figure 3.13 B). On the contrary, cardiomyocytes isolated from Irx3-/- P0 pups showed an 80% reduction in Cx40 expression

(Figure 3.13 B).

Figure 3.13. Irx3 regulated Cx40 expression in P0 mouse cardiomyocytes (A) Relative quantitative PCR results done in postnatal day 0 (P0) cardiomyocytes of Irx3-/- (Irx3KO) mice and cardiomyocytes transfected with GFP (AdGFP) and overexpression Irx3 (AdIrx3). Overexpression of Irx3 resulted in a 16 fold Increase in Irx3 mRNA levels compared to AdGFP control. No Irx3 expression was seen in Irx3 deficient mice. (B) Relative quantitative PCR results showed a 3 fold increase in Cx40 mRNA expression in response to Irx3 overexpression as well as an 80% reduction in Cx40 in Irx3-/- P0 cardiomyocytes. mRNA levels are relative to average AdGFP samples normalized to GAPDH. n = 3 - 6, *p < 0.01 vs. AdGFP. Data courtesy of Kyoung-Han Kim.

3.4.4. Loss of VCS complexity in Irx3 deficient mice is independent of Cx40 levels

In order to determine whether loss in Cx40 expression plays a role in decreased VCS fiber number seen in postnatal day 0, 4 and adult mice we compared the VCS expression pattern of Cx40+/EGFP mice to Cx40EGFP/EGFP (Cx40-/-) mice. According to Figure 3.14 there was no apparent change in VCS morphology between Cx40+/EGFP and Cx40EGFP/EGFP mice in either the

LV or the right septal wall. Even though images were taken at the same magnification, exposure and light intensity, Cx40EGFP/EGFP mice showed increased EGFP fluorescence intensity compared to Cx40+/EGFP mice (Figure 3.14). This difference is most probably the results of the double dose of EGFP due to the presence of EGFP on both alleles of Cx40EGFP/EGFP mice compared to expression on a single allele in Cx40+/EGFP mice.

Based on the above results we can conclude that the decrease in VCS fiber number seen in Irx3-/- mice is independent of the decreased in Cx40 expression. Hence, since Irx3 plays a role both in conduction system development and function, loss of Irx3 expression results in a conduction defect in the VCS.

Irx3+/+;Cx40+/EGFP Irx3+/+;Cx40EGFP/EGFP

His

LBB

His SA

RBB

RSW

Figure 3.14. No change in VCS morphology in Cx40EGFP/EGFP versus Cx40+/EGFP mice. Fluorescence images of Irx3+/+Cx40+/EGFP and Irx3+/+Cx40EGF{/EGFP adult mice showing similar conduction fiber morphology in the left ventricle (LV) and right septal wall (RSW) taken at the same exposure and magnification. His: His-bundle; LBB: left bundle branch; RBB: right bundle branch; DF: distal fibers; SA: Septal artery

72 3.5 Synopsis

The results presented in this study demonstrate that the transcription factor Irx3 is preferentially expressed in the VCS and is required for VCS development and conduction function. Mice with targeted deletion of Irx3 showed functional right bundle branch block manifested in widened QRS interval, notched R waves, right axis deviation, slowed HV conduction and altered epicardial activation pattern caused by slowed VCS fiber conduction and

VCS fiber hypoplasia. In light of the increasing number of congenital mutations responsible for conduction system disorders, understanding the role of transcription factors, such as Irx3, in regulating development and function of the VCS will contribute to a better understanding of the underlying mechanisms responsible for conduction defects in the VCS.

CHAPTER 4

DISCUSSION

Intact VCS conduction proceeds rapidly through the His-bundle, left and right bundle branches and Purkinje fiber network resulting in coordinated apex-to-base activation of the ventricular myocardium necessary for normal heart function. Proper conduction through the VCS of the heart is an intricate process which depends on a multitude of factors. Such factors include the sodium and gap junction channel composition of the VCS, which dictate the fast conduction velocity of His-Purkinje fibers, as well as the organisation and number of VCS fibers which are critical for ventricular activation. Due to the rapid nature of VCS conduction it is relatively difficult to detect changes in its conduction velocity unless conduction is sufficiently slowed to generate a functional conduction block, as occurs in cases of bundle branch block. When bundle branch block occurs it results in global changes to ventricular activation which can be detected using ECG or optical mapping techniques which look at the activation pattern of the heart as a whole. A change in the number of conduction fibers may also result in altered, uncoordinated ventricular activation while change in the fiber morphology of the bundle branches may result in bundle branch block. Therefore, since changes in ventricular conduction system activation can be caused by multiple factors it is important to critically look at the role of Irx3 in the VCS and to assess the cause of the functional right bundle branch block defect seen in Irx3 deficient mice.

4.1 Irx3 is the first known transcription factor to be preferentially expressed in the developing and mature ventricular conduction system (VCS)

Before assessing the functional role of Irx3 in the heart we search the literature for a transcription factor (TF) with a similar expression pattern to Irx3, in the hope of gaining insight into its role in the VCS. Despite multiple studies describing TFs involved in development and

75 function of the CCS, none were found to be specifically expressed in the VCS. For instance,

Tbx5 expression (Bruneau et al. 1999; Moskowitz et al. 2004), similarly to Hop (Ismat et al.

2005) and Id2 (Moskowitz et al. 2007), was found in the AV node and proximal VCS with no expression in distal Purkinje fibers (PFs). Tbx3 expression, which delineates the entire CCS from the SA node to the proximal bundle branches is excluded from the distal PFs (Hoogaars et al. 2004), while Nkx2-5 having the most similar expression to Irx3 was found to be present in

AV nodal tissue, where Irx3 expression is not found (Tanaka et al. 1999; Thomas et al. 2001).

Although many transcription factors have been shown to be expressed in different patterns in the heart‟s CCS, we have identified the Iroquois Homeobox 3 (Irx3) transcription factor as a novel marker preferentially expressed in the developing and mature mouse ventricular conduction system (VCS) (Figure 3.1). To our knowledge, Irx3 was the first transcription factor in the CCS to be specifically expressed in the VCS including the His-bundle, left and right bundle branches and distal Purkinje fiber network, suggesting a specific role for

Irx3 in VCS function.

4.2 Loss of Irx3 results in altered ventricular activation

Preliminary structural and hemodynamic studies showed that, despite their smaller size, Irx3 null mice are viable, fertile and have no appreciable difference in overall heart morphology, size

(heart weight to tibia ratio) or cardiac function (echocardiography) when compared to littermate controls. Electrophysiological analysis, on the other hand, revealed that loss of Irx3 expression results in altered ventricular activation of Irx3-/- mice.

When assessed by in-vivo and ex-vivo ECG, Irx3 deficient mice showed prolonged QRS duration, indicative of slowed ventricular activation, compared to littermate controls. QRS duration is composed of conduction through the His-Purkinje system and ventricular depolarization. Therefore, in humans widened QRS interval has been associated with a variety of conduction disorders pertaining both to the VCS, as in bundle branch block (Khan 2008), and to the ventricular myocardium, as in congestive heart failure (Shenkman et al. 2002). Since Irx3 was shown to be expressed in both the VCS and the myocardium, it raised the question whether widening of the QRS complex occurred as a result of slowed VCS conduction, slowed myocardial conduction or a change in VCS morphology. Generally, conduction through the

VCS occurs very rapidly resulting in only a minor contribution to QRS duration, which is generally dominated by depolarization of the ventricular myocardium (Durrer et al. 1970; Ideker et al. 2009). It was therefore speculated that if slowing of VCS conduction had occurred, it might not have been sufficient to explain widening of the QRS interval observed in the Irx3 deficient mice. Moreover, in the absence of myocardial defects in Irx3-/- mice we could not conclude that slowed myocardial conduction resulted in QRS prolongation. Therefore, further investigation into the cause of QRS prolongation was required.

One method for determining the source of changed ventricular activation is through examination of the electrical axis of the heart, which depends on the net QRS deflection measured from surface ECG traces. The heart‟s electrical axis refers to the general direction of the heart‟s depolarization wavefront (or mean electrical vector) in the frontal plane (Goldberger

2006). With proper conduction, the cardiac axis is related to where the major muscle bulk of the heart lies which normally is in the left ventricle with slight contribution from the right ventricle.

This results in the electrical axis pointing in the direction of the left inferior quadrant of the hexiaxial reference system commonly represented by a positive QRS deflection in leads I and II of the surface ECG (Goldberger 2006). QRS complexes of WT control mice had positive deflections in leads I and II configurations consistent with normal direction of the cardiac electrical axis (Goldberger 2006). QRS complexes of Irx3-/- mice, on the other hand, showed a positive deflection in lead II configuration combined with a negative QRS deflection in lead I

(Figure 3.2), implying a significant rightward deviation in the mean frontal plane axis. Right axis deviation in humans has been shown in cases of abnormal heart orientation (Dougherty

1970; Goldberger 2006), structural changes in the ventricular walls resulting from hypertrophy, dilation or myocardial infarction (Fitchett et al. 1984; Harrigan and Jones 2002) as well as CCS pathology (Castellanos et al. 1970). We found no histological evidence of ventricular hypertrophy or dilation and observed no sign of abnormal cardiac orientation in Irx3-/- mice, implying that right axis deviation signified the presence of pathology in the CCS of Irx3 deficient mice. Although electrical axis measurements may help in discerning the source of electrical defect in the heart this method is not reliable for determining the type of conduction pathology since similar conduction system disorders may have variable axis orientations. For instance, right bundle branch block in patients has been associated with left, right and normal

78 axis deviations (Lasser et al. 1968; Khan 2008; Lokhandwala et al. 2009; Okamoto et al. 2009) preventing the sole use of the electrical axis to conclusively diagnose a patient with right bundle branch block.

Although axis deviation could not be used to determine the type of conduction defect found in Irx3-/- mice, nor could it pinpoint the exact source and cause of altered conduction, it did suggested that loss of Irx3 resulted in alteration in CCS activity. To ascertain the source of altered CCS conduction we looked at heart rate (HR) and PR intervals representative of SA and

AV nodal function, respectively. According to in-vivo and ex-vivo ECGs, HR and PR intervals were unchanged between WT and Irx3-/- mice indicating that lost expression of Irx3 in Irx3-/- mice did not significantly affect SA or AV nodal function, consistent with the absence of Irx3 expression in nodal tissue. The absence of changes in PR interval also challenged the possibility of slowed VCS conduction in Irx3-/-. Since the PR interval is composed of both AV nodal conduction and VCS conduction it could be construed that slowed VCS conduction might have been detected by a widening of the PR interval. However, due to the much slower AV nodal conduction, compared to the rapidly conducting His-Purkinje fibers, the PR interval is primarily dominated by AV nodal delay. Therefore, slowed VCS conduction, if occurred, would most probably remain undetected by the PR interval. Therefore, a more sensitive method of measuring VCS conduction was required to assess its specific value in Irx3-/- mice.

To further resolve whether Irx3 deficient mice have slowed conduction through the

VCS, we employed intracardiac ECG. This system, frequently used in clinical settings, assesses the source of electrical disturbances in the conduction system, by allowing quantification of the rate of depolarizing impulse spread from the atria to His-bundle (AH), and the His-bundle to the

79 ventricle (HV) (Damato et al. 1969). Since AH interval represents the time taken for the impulse to pass through the atrioventicular node it is generally used to verify the presence of AV nodal dysfunction (Ohkubo et al. 2010). The HV interval, which reflects the time taken for the impulse to travel down the VCS, informs of any VCS conduction problems (Lawrenz et al. 2007). No change was observed in AH conduction of Irx3-/- mice, indicating normal AV nodal conduction, consistent with the lack of Irx3 expression in the AV node and the previously observed normal

PR interval. HV duration, on the other hand, was very slightly, but significantly, prolonged in

Irx3-/- mice, compared to WT controls, suggestive of slowed conduction within the VCS. This slight increase in HV duration, as previously discussed, cannot explain the larger QRS prolongation seen in Irx3-/- mice requiring an alternate explanation for QRS widening, which was conveniently suggested by early clinical studies.

In humans prolonged HV in the presence of normal AH interval is generally suggestive of infra-Hisian (or below His-bundle) block occurring in the VCS which includes some forms of type II second degree heart block, as well as left and right bundle branch block (Dhingra et al.

1981). Patients with the two later forms of infra-hisian block also frequently exhibit prolonged

QRS duration and notched R waves in their surface ECG (Schneider et al. 1981; Grines et al.

1989), similar to the Irx3-/- ECG phenotype. Moreover, studies performed in Cx40 deficient mice (Cx40-/-) have also resulted in similar ECG parameters to those observed in the Irx3-/- mice. Specifically, complete loss of Cx40 expression was shown to lead to widened QRS duration, with notched R waves and axis deviation of the mean cardiac axis (van Rijen et al.

2001; Simon et al. 2004) in addition to slowed HV conduction (VanderBrink et al. 2000;

Schrickel et al. 2009). Studies in Cx40-/- mice concluded that complete loss of Cx40 expression results in right bundle branch block (RBBB), further confirmed by epicardial activation maps

80 which showed a change in ventricular activation consistent with RBBB (van Rijen et al. 2001;

Simon et al. 2004).

To observe whether our Irx3-/- mice, similarly to Cx40-/- mice, underwent a change in their ventricular activation sequence, we used optical mapping, a common method for observing the timely epicardial activation of the heart (Nygren et al. 2000; Morley and Vaidya 2001). The normal sequence of ventricular activation in the mouse heart has been previously described

(Rentschler et al. 2001). According to Rentschlet et al., after the development of the primitive

VCS at E12.5 all WT hearts showed an apex-to-base activation pattern characteristic of the adult phenotype. Such activation pattern was characterized by two activations points (breakthroughs) one at the apex of the left and one at the apex of the right ventricle, consistent with activation by the left and right bundle branches, respectively. This activation pattern proceeded into adulthood and was observed both in mice and canines (Kawasuji and Iwa 1978; Nygren et al. 2000). In agreement with previous mouse and canine studies, Irx3 WT mice showed two breakthrough points at the apex of the left and right ventricle, indicating intact conduction through the left and right bundle branches of the VCS. Irx3-/- mice, on the other hand, lacked a right ventricular breakthrough. In these mice ventricular activation was first observed in the apex of the left ventricle from which the whole heart depolarized through cell-to-cell conduction, via myocardial Cx43 gap junction channels, identical to the optical activation pattern seen in dogs with RBBB (Kawasuji and Iwa 1978). Therefore, optical mapping results conclusively demonstrated that loss of Irx3 in the mouse results in a RBBB phenotype.

In order to determine whether RBBB was associated with complete block of conduction through the RBB or slowed conduction, we measured conduction velocity (CV) in VCS fibers

81 located on the right septal wall of Irx3-/- and WT mice. Velocity measurements in the VCS revealed that conduction velocity through the VCS was slowed in Irx3 deficient mice compared to WT mice. The ability to measure CV downstream from the RBB indicated that RBBB did not result from “blocked” conduction but possibly sufficiently slowed CV, which inhibited the timely activation of the right ventricle. Slowed VCS conduction in Irx3-/- hearts was consistent with the loss of Cx40 expression measured in Irx3-/- VCS cells. As Cx40 levels decreased so did intercellular electrical coupling resulting in slowed cell-to-cell propagation of electrical signal down the VCS. Although CV was not measured in left VCS fibers, it was expected that decreased Cx40 expression resulted in slowed fiber conduction in both the left and right VCS fibers. This was seen in Cx40-/- mice where loss of Cx40 resulted in slowed conduction in both the left and right bundle branches (van Rijen et al. 2001). Surprisingly, in our study and the study by van Rijen et al, complete loss of Irx3 or Cx40 expression, respectively, resulted in

RBBB with no cases of left bundle branch block (LBBB). The same result was also found in humans where studies have shown that the vulnerability of the right bundle branch is greater than the left bundle for conduction block (Tuzcu et al. 1990; Newby et al. 1996; Golshayan et al.

1998).

It can only be speculated why RBBB occurred instead of LBBB. One possible reason could be uneven gap junction channel expression in the left versus the right bundle resulting in increased RBB vulnerability for decrease in Cx40 seen in Irx3-/- mice.

However, since levels of Cx40 expression were not compared separately for the right and left branches this speculation cannot be resolved from our current data. The structural asymmetry of the bundle branch may however be the most plausible explanation for the increased occurrence of RBBB cases. In both humans and mice the His-bundle branches

82 into approximately 20 smaller bundles along the left septal flank forming the left bundle branch while only 1-2 branches are formed on the right septum composing the right bundle branch (Miquerol et al. 2004; van Veen et al. 2005). Multiple fibers in the left bundle allow numerous pathways for the signal to travel down, increasing the probability of ventricular activation, compared to the single path present in the form of the right bundle in the right ventricle. Therefore, structural asymmetry could be the reason for the prevalence of RBBB both in the clinical setting and in the laboratory.

Typically, causes of RBBB in patients can be broken down into two categories. The first, includes cases of physical injury to the RBBB, which occur during corrective surgery (Wolff et al. 1972; Okoroma et al. 1975; Pedersen et al. 2008) or some instances of cardiomyopathy

(Corrado et al. 1996). The second category includes patients whose RBBB has been shown to occur as a result of mutations in transcription factors (Benson et al. 1999) or ion channel genes

(Kyndt et al. 2001; Wang et al. 2002) required for VCS development and/or function. Since no signs of heart disease and RBB injury or discontinuity were observed in Irx3-/- mice, we postulated that loss of Irx3 can lead to a RBBB phenotype as a result of its potential role in VCS development and/or function through regulation or interaction with other transcription factors, ion channels, or gap junction channel genes required for proper VCS formation and propagation.

4.3 Irx3 controls VCS conduction by indirectly regulating Cx40 expression

The major constituents underlying fast impulse propagation in the VCS include 1) membrane excitability, which depends on sodium channel α and β subunit genes 2) electrical coupling via gap junction channels and 3) intact morphogenesis of the ventricular conduction system. In

83 order to identify the molecular basis for the conduction slowing observed in Irx3 deficient mice, changes in gene expression of Na+ channel alpha (Scn1a-Scn3a, Scn5a) and beta subunits

(Scn1b-Scn4b) as well as connexin channels (Gja5 (Cx40), Gja1 (Cx43), Gja7 (Cx45)) were compared in VCS cells of Irx3-/- and WT mice. VCS cells were identified using the Cx40-EGFP reporter gene (Miquerol et al. 2004).

The first determinant of VCS conduction, namely membrane excitability is dependent on sodium channel α and β subunits. The higher expression of cardiac (Scn5a) (Remme et al.

2009), neuronal (Scn1a, Scn2a) (Haufe et al. 2005; Haufe et al. 2005), and auxiliary beta subunit

(Scn1b) (Dominguez et al. 2005) in the VCS contributes to the fast conducting properties of the

His-Purkinje system (Remme et al. 2009). Therefore, loss of expression in these ion channels may explain the slowed VCS conduction observed in the Irx3-/- mice. In humans, loss of function mutation in the cardiac sodium channel SCN5A has been shown to result in cardiac conduction defects (Schott et al. 1999; Kyndt et al. 2001; Tan et al. 2001), also observed in mice

(Royer et al. 2005), characterized by progressive alteration of cardiac conduction through the

His-Purkinje system with right or left bundle branch block, complete AV block, syncope and sudden cardiac death (Schott et al. 1999; Kyndt et al. 2001; Tan et al. 2001). Recent clinical studies have also associated mutations in the genes encoding for β subunits with cardiac conduction defects and arrhythmogenesis. One mutation involving the human Scn4b subunit

(SCN4B) has been associated with long-QT syndrome manifesting in intermittent 2:1 atrioventricular (AV) block and a family history of sudden cardiac death (Medeiros-Domingo et al. 2007). Three mutations in the human Scn1b (SCN1B) and one mutation in SCN3B have been associated with Brugada syndrome and cardiac conduction defect, manifesting in ST segment elevation, RBBB or 2:1 atrioventricular block (Watanabe et al. 2008; Hu et al. 2009). These data

84 demonstrated the importance of sodium channel α- and β-subunits in cardiac conduction and function. Preliminary electrophysiology studies done in our lab, have shown loss of sodium current density and decreased upstroke velocity in VCS cells of Irx3-/- mice compared to WT, with no change in potassium (K+) or calcium (Ca2+) current (Dr. Robert A. Rose, unpublished data). This data suggested a decrease in expression or gating of sodium channel genes leading to investigation of their specific mRNA expression in Irx3 deficient mice using quantitative PCR.

Gene expression studies done in WT and Irx3-/- mice showed no change in Scn5a expression in

VCS cells of Irx3-/- mice compared to WT controls. Additionally, no change in neuronal channels Scn1a, Scn2a or the beta subunit Scn1b resulted from loss of Irx3. On the other hand, endocardial samples containing VCS cells showed a 28 ± 3% and 42 ± 5% reduction in the sodium channel beta subunits Scn3b and Scn4b expression, respectively, in Irx3-/- mice versus

WT littermates suggesting that Irx3 may regulate the expression of these auxiliary subunits. A decrease in Scn3b and Scn4b is thought to result in decreased expression or altered gating of sodium channels at the cell membrane thus explaining the decreased sodium current density and hence slowed VCS conduction in Irx3 deficient mice. Unfortunately, since the expression levels of Scn3b and Scn4b were too low to be specifically detected in VCS cells, it still remains to be ascertained whether regulation of Scn3b and Scn4b by Irx3 contributes to decreased sodium channel protein expression and hence slowed VCS fiber conduction observed in Irx3-/- mice.

The second determinant of VCS propagation is gap junction expression. Distinct gap junctions containing the connexins; Cx40, Cx43, and Cx45 ensure rapid impulse propagation in the His-Purkinje system (Teunissen and Bierhuizen 2004). Rapid conduction is ensured by the formation of intercellular low-resistance channels and by electrical insulation of the proximal

VCS from the surrounding myocardium achieved by the gap junction channels. Loss of

85 connexin channel expression results in decreased number of low-resistance pathways leading to slowed cell-to-cell conduction. This was observed in Cx43 deficient mice which showed slowed myocardial CV, where Cx43 is preferentially expressed (van Rijen et al. 2004), while loss of the

VCS-specific gap junction channel Cx40 showed slowed bundle branch conduction velocities in

Cx40-/- mice (van Rijen et al. 2001). Quantitative-PCR results revealed that Irx3 deficient mice showed a 42% reduction in Cx40 expression in VCS cells, compared to WT controls. Reduction in electrical coupling between cells, due to decreased Cx40 expression, explains the slowed conduction velocity measured in VCS fibers of Irx3-/- mice. No change in level of Cx43 channels has been detected in VCS cell of Irx3 deficient mice while levels of Cx45 were too low to be compared between Irx3-/- and WT mice. Hence, from these results we can conclude that

Cx40 regulation by Irx3 is critical for proper VCS conduction resulting in slowed VCS conduction phenotype observed in Irx3-/- mice.

To gain a mechanistic insight into Cx40 regulation by Irx3, neonatal ventricular myocytes (NVMs) were isolated and infected with adenoviruses encoding constitutively active

VP16-Irx3, or dominant negative EnR-Irx3, after which Cx40 expression was measured in these cells. The use of VP16-Irx3 maintained Irx3 in its activator form while overexpression of EnR-

Irx3 resulted in expression of the repressor form of Irx3. Consistent with our previous speculation that Irx3 positively regulates Cx40 expression, concluded from loss of Cx40 expression in Irx3-/- mice, we predicted that Cx40 expression would be reduced by EnR-Irx3 and increased by constitutively active VP16-Irx3. However, contrary to these predictions, Cx40 levels increased in the presence of EnR-Irx3 and decreased upon addition of VP16-Irx3 suggesting that Irx3 indirectly regulates Cx40 expression by repressing a repressor of Cx40 promoter activity (Figure 4.1). Consistent with indirect activation of Cx40 by Irx3, genome

86 alignment of the Cx40 promoter did not reveal any evolutionarily conserved element containing putative Irx3 binding sites (Bilioni et al. 2005; Berger et al. 2008; Noyes et al. 2008). To our knowledge, this was the first report of a role for Irx3 in His-Purkinje system function where it precisely controls Cx40 gene expression necessary for proper cell-cell coupling.

Repressor

Figure 4.1. Proposed mechanism of Cx40 regulation by Irx3

Regulation of Cx40 expression has been shown in other TFs involved in development and function of the CCS. Haploinsuficiency of Nkx2-5 and Tbx5 (Linhares et al. 2004) has been shown to decrease Cx40 expression. Knockout mouse studies done in Id2 (Moskowitz et al.

2007) and Hop (Ismat et al. 2005) have shown that loss of these transcription factors similarly leads to decreased Cx40 expression. These data suggested that Nkx2.5, Tbx5, Id2 and Hop all function as positive regulators of Cx40 function. On the other hand, loss of Tbx3 (Hoogaars et al. 2004) and Tbx2 (Christoffels et al. 2004) expression has been associated with increased Cx40 expression implying that both Tbx3 and Tbx2 act as transcriptional repressors of Cx40 activity.

Therefore, we postulate that Irx3 might, by repressing the Cx40 repressors Tbx2 or Tbx3

(Tbx2/3), regulate Cx40 gene expression. In such a mechanism the presence of Irx3 in the VCS

87 would results in inhibition of Tbx2/3 leading to removal of Cx40 repression, which would result in increased Cx40 expression (Figure 4.2 A). On the contrary, loss of Irx3, as occurs in the

Irx3-/- mouse, would prevent repression of Tbx2/3, leading to an increase in Tbx2/3 dependent

Cx40 repression, which would result in decreased Cx40 levels (Figure 4.2 B). Although we have no evidence of regulation or interaction of Irx3 with Tbx2 or Tbx3 to support the proposed mechanism, co-immunoprecipitation experiments showed that Irx3 can bind Irx5 (Vijitha

Puviindran, unpublished data). Therefore, since Tbx5, Tbx2 and Tbx3 are members of the same family, and hence share some sequence homology, it can be postulated that Irx3 might similarly interact with Tbx2/3. However, additional experiments are still required to verify their interaction and the proposed mechanism of Cx40 regulation.

Figure 4.2. Irx3 regulates Cx40 by repressing a repressor of Cx40 promoter activity

When studying factors that play a role in the VCS it is important to be able to visualize the conduction system, which does not standout from the surrounding myocardium. Therefore,

88 we have used the enhanced-green fluorescent protein (EGFP) expressed under the control of the

Cx40 promoter in both WT (Irx3+/+;Cx40+/EGFP) and Irx3-/- (Irx3-/-;Cx40+/EGFP) mice. The

EGFP-Cx40 reporter allowed for visualization of the His-Purkinje system of the mouse heart necessary for fiber conduction velocity measurements and isolation of VCS cells for gene expression analysis. Since, the use of the heterozygous Cx40 reporter results in approximately

50% reduction in Cx40 expression we first compared the phenotypes of WT (Irx3+/+) and Irx3-/- mice to those of Irx3+/+;Cx40+/EGFP and Irx3-/-;Cx40+/EGFP, respectively to determine whether the reporter-dependent loss Cx40 may affect interpretation of results. According to in-vivo and ex- vivo ECG as well as optical mapping experiments we found that Irx3+/+;Cx40+/EGFP mice were indistinguishable from those of WT. In other words, heterozygous Cx40 expression resulted in a normal conduction despite having half-normal Cx40 protein levels, indicating that a greater than

50% reduction in Cx40 is necessary to cause a conduction defect. Therefore, it was surprising to find that Irx3-/- mice showed widened QRS duration and RBBB block activation patterns comparable to Irx3-/-;Cx40+/EGFP mice. The appearance of RBBB, widened QRS interval and slowed fiber conduction velocity was of no surprise in Irx3-/-;Cx40+/EGFP which in addition to the 50% reduction in Cx40, caused by the use of the Cx40 reporter, showed a 42% reduction in

Cx40 as a result of Irx3 deficiency, leading to a conduction phenotype similar to that reported for Cx40-/- mice (van Rijen et al. 2001). It is therefore surprising that Irx3-/- mice which experienced an approximate 42% reduction in Cx40, due to loss of Irx3, should show the same phenotype when a greater than 50% reduction is necessary to cause conduction defect. This data suggested that even though decreased Cx40 expression, in Irx3-/- mice resulted in slowed fiber conduction velocity, this slowed conduction was insufficient to cause conduction block and thus lead to the RBBB phenotype and widened QRS interval observed in these mice. This is further supported by the observation that only 23% or Irx3-/- mice did not exhibit a RBBB phenotype

(Figure 3.4 B) while all (100%) of Irx3-/- mice showed slowed fiber conduction velocities.

Therefore, another potential, Irx3 dependent mechanism, must contribute to the conduction defect observed in Irx3-/- mice.

So far we have looked at two out of three components required for proper VCS function, membrane excitability via regulation of sodium channel genes, and intercellular coupling, through regulation of connexin gap junction channel. However, since changes in VCS morphology may also result in cardiac conduction defects we proceeded to compare the VCS morphology of WT and Irx3-/- mice.

4.4 Irx3 is required for postnatal VCS fiber development

4.4.1 Decreased VCS complexity in Irx3 deficient mice contributes to its VCS conduction defect

Using Irx3-/- and WT mice with the Cx40-EGFP reporter gene we found that loss of Irx3 resulted in anatomical defects in the formation of the His-Purkinje system characterized by hypoplasia of the proximal bundles and distal fibers of the VCS, suggesting an anatomical basis for the conduction defect observed in Irx3-/- mice. Morphological analysis of the VCS in Irx3 deficient mice revealed that the degree of Purkinje fiber defect deteriorated over time. Around birth, at postnatal (P) day 0, Irx3-/- mice showed a slight reduction in the number and complexity of the Purkinje fiber network at the base of the heart, compared with their WT littermates.

Reduction in Purkinje fibers, however, became progressively more striking with age where

Irx3-/- mice at P4 showed more progressive hypoplasia than those at P0, while adult mice showed severe decreases in fiber number and complexity. Similar findings were reported for

Nkx2-5+/- mice (Jay et al. 2004; Meysen et al. 2007). According to Meysen et al. (2007) adult

Nkx2-5+/- mice showed Purkinje fiber hypoplasia at the ventricular apex. Moreover, timing of fiber defect occurrence revealed that, similarly to Irx3-/- mice, hypocellularity in the distal VCS of Nkx2-5+/- initiated postnatally and progressively worsened (Meysen et al. 2007). The decreased fiber number observed in Nkx2-5+/- mice has been proposed to be the source behind the atrioventricular conduction block, slowed ventricular activation and susceptibility to arrhythmias observed in Nkx2-5+/- mice (Tanaka et al. 2002; Wakimoto et al. 2002; Jay et al.

2004; Meysen et al. 2007) and humans with NKX2-5 mutations (Schott et al. 1998; Benson et al.

1999; Kasahara et al. 2001; Jay et al. 2004). This data suggested that decreased VCS fiber number and complexity, seen in Irx3 deficient mice, may contribute to the widened QRS duration and RBBB seen as a result of lost Irx3 expression.

Hypocellularity of the Purkinje fiber network can contribute to prolongation of the QRS interval. Since each terminal Purkinje cell must depolarize a larger region of the contractile myocardium, where conduction is slower relative to the Purkinje fibers, decrease in the number of myocardial activation points will result in slower ventricular activation leading to widening of the QRS interval. A similar effect was observed in Nkx2-5+/- mice which had decreased VCS fiber number and widened QRS duration without changes to Cx40 levels (Jay et al. 2004).

Therefore, in the Irx3 deficient mice prolonged QRS duration is most probably a result of VCS fiber hypoplasia rather than slowed VCS conduction due to decreased Cx40 mRNA expression.

The prolonged QRS interval cannot otherwise be attributed to the downregulation of Cx43, the major gap junction isoform in the contractile myocardium, or to myocardial dysfunction since no decrease in Cx43 expression or change in ventricular chamber morphology were observed in

Irx3-/- mice.

Hypoplasia of the VCS, seen in Irx3 deficient mice, can also potentially explain the observed RBBB activation pattern of the heart. Due to structural asymmetry of the VCS, the

RBB of WT mice has only 1-2 fibers making it more vulnerable to changes in conduction and structure compared to the LBB. Loss of Irx3 in mice resulted in a decrease in the diameter of the right bundle which, in combination with the slowed fiber conduction caused by decreased Cx40 expression, resulted in sufficiently slowed conduction leading to delayed right ventricular activation appearing as a RBBB on epicardial activation maps. Suggesting that it is the combined effect of fiber hypoplasia and decreased fiber conduction velocity that resulted in the observed conduction defect in Irx3-/- mice. This is further supported by the absence of any reported RBBB in patients with NKX2-5 mutations (Schott et al. 1998; Benson et al. 1999;

Kasahara et al. 2001; Jay et al. 2004) or in Nkx2-5+/- mice (Tanaka et al. 2002; Wakimoto et al.

2002; Jay et al. 2004; Meysen et al. 2007) which had a defect in fiber development without changes in fiber conduction. Therefore, it is the role of Irx3 in regulating Cx40 expression and

VCS development that primarily maintains the integrity of conduction through the VCS. Thus, the loss of Irx3 results in slowed conduction and hypoplasia of the VCS manifesting in a RBBB phenotype.

4.4.2 Irx3 may regulate VCS development in an Nkx2-5 dependent manner

It has been proposed that the process of VCS fiber development proceeds in two stages

(or waves) occurring at two distinct time points: prenatally and postnatally (Meysen et al. 2007).

The first, prenatal, wave includes recruitment of cells from the trabecular layer of the embryonic heart which establishes the primary ventricular conduction network (Moorman et al. 1998). The second, postnatal, wave involves the differentiation of VCS cells resulting in the formation of

92 the mature Purkinje fiber network (Meysen et al. 2007). According to studies performed on haploinsufficient Nkx2-5 mice there was no change in the prenatal recruitment of conduction cells during the first wave of VCS development signifying that changes in VCS morphology of

Nkx2-5+/- mice occurred postnatally, proposing that Nkx2-5 plays a role in the second wave of

VCS fiber development (Figure 4.3). Although the prenatal state of VCS fiber morphology was not assessed in the Irx3-/- mice, and is the subject of future investigation, the absence of severe differences in VCS morphology at P0 suggests that Irx3, similarly to Nkx2-5, does not play a role in the first wave of cell recruitment. Rather, it is potentially involved in the differentiation of VCS cells in the second wave (Figure 4.3) required for the formation of the mature Purkinje fiber network, as seen by the progressively worsening VCS fiber morphology in Irx3 deficient mice. It would be interesting to study the functional consequence of lost VCS fiber number in the Irx3 deficient mice at P0 and P4, and thus observe whether the conduction defect, like VCS morphology, is age dependent. Particularly, since conduction defects in human patients have previously been shown to progressively worsen with age (Schott et al. 1998). Preliminary, surface ECG measurements, taken from P4 and P0 pups, suggested aggravation of QRS duration with age. While QRS durations were only slightly increased in the P0 Irx3-/- mice compared to

WT, in the P4 group and adult mice the difference in QRS prolongation became more pronounced as fiber morphology degraded. Although these studies are still in their infancy, and are subject for future investigation, the preliminary results supported our hypothesis that VCS hypoplasia is responsible for the prolonged QRS duration. Therefore, increased QRS duration correlated with decreased fiber number occurring with age.

Irx3

Figure 4.3. Stages of VCS development and the proposed role for Irx3 (modified from Meysen et al., 2007)

The similarity between the degree and age-dependence of Purkinje fiber defect, observed in Irx3-/- and Nkx2-5+/- mice, suggests that the two TFs are both necessary for proper VCS development and thus might potentially form a complex necessary for proper postnatal maturation of the VCS. This is consistent with the notion that loss of either Irx3 or Nkx2-5 results in disruption of Purkinje fiber morphology which is further strengthened by co- immunoprecipitation experiments showing that Nkx2-5 and Irx3 are able to bind each other

(Vijitha Puviindran, unpublished data). This demonstrates that Irx3 is necessary for proper VCS development, possibly in an Nkx2-5 dependent manner.

Although we have determined that Irx3 plays a critical role in VCS development. The exact mechanism behind the developmental defect in the Purkinje fiber network of Irx3-/- mice has not been looked at. Generally, hypoplasia could result due to a defect in the proliferation and/or differentiation of newly formed conduction myocytes (i.e. recruitment), or due to a defect

94 our results, we could not discriminate between these two hypotheses. Therefore, additional studies are necessary to comprehend the mechanism behind VCS fiber loss in Irx3 deficient mice.

Future studies aimed at investigating the mechanisms behind Irx3 regulation of sodium channel and Cx40 gap junction channel expression, in addition to its role in VCS development, are paramount for understanding onset of ventricular conduction system diseases which might provide insight into modes of treatment and diagnosis of VCS disorders in patients.

4.5 Clinical implication

In order to study human related diseases and defects it is critical to choose a good animal model. The human, canine, rat and mouse ventricular conduction systems are very similar in their gap junction composition. Like the human VCS (Davis et al. 1995), the mouse (Gros and

Jongsma 1996; Coppen et al. 1999; Miquerol et al. 2004), canine (Kanter et al. 1993) and rat

(Bastide et al. 1993; Coppen et al. 1999) all express Cx40, Cx43 and Cx45 in their His-Purkinje network. The VCS-specific connexin channel expression in highly conserved between the different mammals while connexin expression in the ventricle, atria and nodal tissue is highly variable. For instance, contrary to the mouse, which solely expresses Cx43 in the ventricular myocardium, human ventricles express both Cx43 and Cx45 gap junction channels. Similarly, while mouse atrial cells express primarily Cx40 and Cx43, human and canine atria also express high levels of Cx45 (Kanter et al. 1993; Davis et al. 1995). Therefore, the conserved interspecies

VCS-specific connexin channel expression pattern indicates the importance of these gap

95 junction channels for proper His-Purkinje conduction. While the similarities in VCS-specific gap junction composition make both the mouse and dog good candidate animal models for the study of human VCS defects, the mouse providing a wider range of research opportunities due to our ability to alter its genetic background.

In addition to their conserved VCS connexin expression pattern, mice and humans share a similar structural asymmetry and morphology of the VCS. The mature mouse (Miquerol et al.

2004) and human (Davies et al. 1983) VCS include the bundle of His, bundle branches and

Purkinje fibers which are found beneath the endocardial surface of the heart. In both species, the left bundle branch is composed of multiple bundles extending from the His-bundle and spreading into a highly elaborate, left ventricular, Purkinje fiber network. The mouse and human right bundle branch, on the other hand, is composed of about 1-2 fibers extending from the His- bundle and splitting into the right ventricular Purkinje fiber network (Davies et al. 1983;

Miquerol et al. 2004). This structural asymmetry plays a role in the increased susceptibility of both mice (Simon et al. 1998; van Rijen et al. 2001) and humans (Tuzcu et al. 1990; Newby et al. 1996; Golshayan et al. 1998) to develop right, rather than left, bundle branch block, as previously discussed.

In addition to structural asymmetry, both mice (Shan-Shan Zhang, unpublished data) and humans (Davies et al. 1983; Macedo et al. 2010) have fibrous insulation of the His-bundle and proximal bundle branches. This minimizes their contact with the surrounding working myocardium preventing loss of charge to neighboring myocardial cells thus ensuring rapid impulse propagation through the VCS. The rapid propagation of electrical impulse down the

VCS, to the apex of the heart, results in activation of the ventricular myocardium to proceed

96 from endocardium-to-epicardium, and apex-to-base direction, which has been documented both in human (Ramanathan et al. 2006) and mouse (Liu et al. 2004) hearts.

The molecular and structural similarity between the mouse and human VCS demonstrates the relevance of using mice, as an animal model, for studying conduction defects associated with the human His-Purkinje system. A recently published paper, describing the expression pattern of ion channels in the healthy human heart, showed that Irx3 is expressed in a transmural gradient across the human heart, similarly to what is seen in mice (Gaborit et al.

2010). Hence, due to the comparable VCS structure and VCS-specific Cx40 expression, combined with the similar Irx3 expression pattern in the human and mouse heart it is speculated that Irx3 might regulate VCS development and Cx40 expression in the human as it does in the mouse and thus might help in understanding the basis for RBBB in the human.

RBBB is a common human VCS defect with potentially detrimental effects. A clinical study done to characterize patients with RBBB and ST segment elevation found that 27% of patients initially diagnosed with RBBB had at least 1 episode of ventricular fibrillation which aggravated with age while 19% of patients had episodes of syncope. Three of the patients initially diagnosed with RBBB and ST segment elevation, with no change in PR and QT intervals, died suddenly (Atarashi et al. 1996). In another follow-up study performed on 394 subjects with right bundle branch block, most of which were asymptomatic at the time of RBBB diagnosis, 6% of subjects were found to have coronary heart disease and hypertension by the second follow-up period (Rotman and Triebwasser 1975). Moreover, RBBB frequently was found to be associated with cardiac enlargement and congestive heart failure (Schneider et al.

1981). Since diagnosis with RBBB may be a predictor of other cardiac pathology, understanding

97 the mechanism and molecular causes of RBBB might be beneficial for studying the onset of

RBBB and its effect on heart disease in patients, making the study of Irx3 particularly relevant.

The study of Irx3 becomes more relevant in patients that are diagnosed with RBBB and show no known RBBB causing mutations, no structural heart defects, bundle branch injury or changes in PR and QT intervals despite their recorded RBBB and ST segment (Atarashi et al.

1996; Brugada et al. 1998). Although the source of RBBB in these patients remains unknown they were found to be at a higher risk for sudden cardiac death (Atarashi et al. 1996; Brugada et al. 1998). Moreover, upon follow up in these patients, it was found that amiodarone and/or β- blockers did not protect them against sudden cardiac death while an implantable defibrillator seemed to be the treatment of choice (Brugada et al. 1998). Due to poor understanding of the mechanism behind RBBB in these patients it can be speculated that a mutation in Irx3 may be the underlying cause of their RBBB. Therefore, understanding the molecular mechanisms by which Irx3 regulated VCS development and function is necessary in order to provide better treatment options to these patients in the future and decrease their chances of sudden cardiac death.

4.6 Synopsis

Precise regulation of tissue- and time-specific transcription is key to normal patterning and differentiation of the heart. Recent studies of the conduction system support a causal relationship between locally acting transcription factors and their role in development as well as regulation of regionalized expression of genes involved in impulse conduction (Boukens et al.

2009). This study has identified Iroquois homeobox 3 to be preferentially expressed in the

98 developing and mature VCS. More so, consistent with its VCS-specific expression pattern, we showed that Irx3 is necessary for proper VCS conduction and ventricular activation by indirectly regulating Cx40 expression and VCS development. Loss of Irx3 in the mouse results in decreased cell-cell coupling in the VCS, due to decreased Cx40 expression, leading to slowed

VCS conduction. Additionally, fiber hypoplasia, observed in Irx3 deficient mice resulted in slowed myocardial activation consistent with the observed wide QRS interval. However, it is the combined effect of slowed VCS conduction, decreased RBB diameter and slowed myocardial activation which have resulted in the observed right bundle branch block phenotype characteristic of the Irx3-/- mouse. To our knowledge, this is the first report of a role for Irx3 in development and function of the ventricular conduction system rendering it an important candidate gene in congenital or acquired ventricular conduction system diseases such as RBBB.

CHAPTER 5

FUTURE DIRECTIONS

100

The primary goal of my MSc thesis project was to unveil the phenotype of Irx3-/- mice and determine the role of Irx3 in the ventricular conduction system of the heart. We have so far found that loss of Irx3 in mice results in slowed ventricular activation, wide QRS interval and slowed conduction through the VCS resulting in right bundle branch block, a common human conduction defect. Investigation of the role of Irx3 in the heart revealed that Irx3 controls cell- cell coupling in the VCS by indirectly regulating the expression of, the VCS-specific gap junction channel, Cx40. However, the specific mechanism of Cx40 regulation has yet to be resolved. Additionally, by observing the presence of VCS fiber hypolpasia in Irx3-/- hearts, we have concluded that Irx3 plays a role in postnatal VCS development. However, whether Irx3 also plays a role in embryonic VCS remains unknown. Similarly, the specific cause underlying hypoplasia in Irx3-/- mice has yet to be resolved. Therefore, my future experiments will aim to address the above.

5.1 Understanding the indirect mechanism of Cx40 regulation by Irx3

Proposal: In this thesis we have shown that Irx3 indirectly regulate Cx40 expression by repressing an unknown repressor of Cx40 promoter activity. We also postulated that Tbx2 or

Tbx3 (Tbx2/3), which are known Cx40 repressors (Christoffels et al. 2004; Hoogaars et al.

2004), may act downstream of Irx3 to regulate Cx40 levels in the VCS. Therefore, we propose to measure the levels of Tbx2 and Tbx3 in VCS cells of WT and Irx3-/- mice to observe whether

Irx3 can negatively regulate their expression. Once, this regulation by Irx3 is confirmed we can do a “rescue” study using RNA interference (siRNA) to confirm whether these TFs work downstream of Irx3 in regulating Cx40 expression.

101

Expected results: If Tbx2/3 is repressed by Irx3 and works downstream of it to regulate Cx40 expression, it is expected that infection of Irx3-/- neonatal cardiomyocytes with truncated siRNA

(complementary to Tbx2/3) would result in decreased Tbx2/3 protein expression and thus decreased Cx40 repression. This will result in higher Cx40 levels in cells treated with siRNA compared with Irx3-/- cells that were not infected with siRNA, thereby rescuing the decreased

Cx40 expression normally seen the absence of Irx3 (Figure 5.1 A, B).

Figure 5.1 Rescue of Cx40 expression using siRNA (A) Irx3-/- cells without siRNA (B) Irx3-/- cells with siRNA

102

5.2 Understanding the developmental role of Irx3

5.2.1 Prenatal assessment of VCS morphology in Irx3-/- and WT mice

Proposal: We have so far looked at VCS morphology of WT and Irx3-/- mice at 8 weeks-of-age, postnatal day 4 and 0. Since Irx3-/- mice at P0 showed slight reduction in VCS fiber number compared to WT, we were unable to conclude whether Irx3 plays a sole role in postnatal VCS development, as was shown in Nkx2-5 heterozygous mice (Meysen et al. 2007), or is it also involved in embryonic VCS development. To answer this question, we propose to compare the the morphology of WT and Irx3-/- embryos at E19, and E16 to see if Irx3 has a prenatal role in

VCS development.

5.2.2 Determining the underlying cause of hypoplasia in Irx3-/- mice

Proposal: Hypoplasia, seen in Irx3-/- mice, can be explained by impaired proliferation, differentiation or apoptosis of VCS cells. Therefore, to determine the source of hypoplasia in

Irx3-/- mice we can do the following tests:

1. To assess whether Irx3-/- mice have a defect in proliferation we can perform BrdU

incorporation to compare proliferation rate in Irx3-/- and WT mice at P0 and P3.

2. To determine whether hypoplasia in Irx3-/- mice is caused by apoptosis, a TUNEL essay

can be used on heart slices of WT and Irx3-/- mice at P0 and P4 to compare the level of

TUNEL-positive nuclei, a marker for apoptosis.

3. To assess whether VCS cell of Irx3-/- mice have a defect in differentiation, which

prevents VCS from differentiating into mature conduction cells, we can use EH-

myomesin staining. Since the EH-myomesin splice variant is expressed in

103

cardiomyocytes during embryonic development but is downregulated in adult hearts

(Agarkova et al. 2000; Agarkova et al. 2004) we can use antibodies which specifically

recognize the mouse EH-myomesin isoform to compare its expression in GFP+ cells of

WT and Irx3-/- mice (Meysen et al. 2007).

Expected Results:

1. If Irx3-/- mice have a defect in VCS proliferation we would expect to see a lower number

of EGFP/BrdU double-positive cells in Irx3 deficient heart slices versus WT slices.

2. If hypoplasia in Irx3-/- mice is cause by apoptosis we should find a larger number of

TUNEL-positive nuclei in Irx3-/- heart slices versus WT.

3. If Irx3-/- mice have defect in differentiation of VCS cells we would expect to find a

larger number of GFP+ cells with missexpression of EH-myomesin in Irx3-/-, compared

to WT, heart slices.

104

CHAPTER 6

REFERENCES

105

Agarkova, I., D. Auerbach, et al. (2000). "A novel marker for vertebrate embryonic heart, the

EH-myomesin isoform." J Biol Chem 275(14): 10256-10264.

Agarkova, I., R. Schoenauer, et al. (2004). "The molecular composition of the sarcomeric M-

band correlates with muscle fiber type." Eur J Cell Biol 83(5): 193-204.

Atarashi, H., S. Ogawa, et al. (1996). "Characteristics of patients with right bundle branch block

and ST-segment elevation in right precordial leads. Idiopathic Ventricular Fibrillation

Investigators." Am J Cardiol 78(5): 581-583.

Bakker, M. L., B. J. Boukens, et al. (2008). "Transcription factor Tbx3 is required for the

specification of the atrioventricular conduction system." Circ Res 102(11): 1340-1349.

Bao, Z. Z., B. G. Bruneau, et al. (1999). "Regulation of chamber-specific gene expression in the

developing heart by Irx4." Science 283(5405): 1161-1164.

Basson, C. T., D. R. Bachinsky, et al. (1997). "Mutations in human TBX5 [corrected] cause

limb and cardiac malformation in Holt-Oram syndrome." Nat Genet 15(1): 30-35.

Basson, C. T., G. S. Cowley, et al. (1994). "The clinical and genetic spectrum of the Holt-Oram

syndrome (heart-hand syndrome)." N Engl J Med 330(13): 885-891.

Basson, C. T., T. Huang, et al. (1999). "Different TBX5 interactions in heart and limb defined

by Holt-Oram syndrome mutations." Proc Natl Acad Sci U S A 96(6): 2919-2924.

Bastide, B., L. Neyses, et al. (1993). "Gap junction protein connexin40 is preferentially

expressed in vascular endothelium and conductive bundles of rat myocardium and is

increased under hypertensive conditions." Circ Res 73(6): 1138-1149.

Bellefroid, E. J., A. Kobbe, et al. (1998). "Xiro3 encodes a Xenopus homolog of the Drosophila

Iroquois genes and functions in neural specification." EMBO J 17(1): 191-203.

106

Benson, D. W., G. M. Silberbach, et al. (1999). "Mutations in the cardiac transcription factor

NKX2.5 affect diverse cardiac developmental pathways." J Clin Invest 104(11): 1567-

1573.

Berger, M. F., G. Badis, et al. (2008). "Variation in homeodomain DNA binding revealed by

high-resolution analysis of sequence preferences." Cell 133(7): 1266-1276.

Bevilacqua, L. M., A. M. Simon, et al. (2000). "A targeted disruption in connexin40 leads to

distinct atrioventricular conduction defects." J Interv Card Electrophysiol 4(3): 459-467.

Bilioni, A., G. Craig, et al. (2005). "Iroquois transcription factors recognize a unique motif to

mediate transcriptional repression in vivo." Proc Natl Acad Sci U S A 102(41): 14671-

14676.

Bodmer, R. (1993). "The gene tinman is required for specification of the heart and visceral

muscles in Drosophila." Development 118(3): 719-729.

Bosse, A., A. Stoykova, et al. (2000). "Identification of a novel mouse Iroquois homeobox gene,

Irx5, and chromosomal localisation of all members of the mouse Iroquois gene family."

Dev Dyn 218(1): 160-174.

Bosse, A., A. Zulch, et al. (1997). "Identification of the vertebrate Iroquois homeobox gene

family with overlapping expression during early development of the nervous system."

Mech Dev 69(1-2): 169-181.

Boukens, B. J., V. M. Christoffels, et al. (2009). "Developmental basis for electrophysiological

heterogeneity in the ventricular and outflow tract myocardium as a substrate for life-

threatening ventricular arrhythmias." Circ Res 104(1): 19-31.

Brand, T. (2003). "Heart development: molecular insights into cardiac specification and early

morphogenesis." Dev Biol 258(1): 1-19.

107

Briscoe, J., A. Pierani, et al. (2000). "A homeodomain protein code specifies progenitor cell

identity and neuronal fate in the ventral neural tube." Cell 101(4): 435-445.

Brugada, J., R. Brugada, et al. (1998). "Right bundle-branch block and ST-segment elevation in

leads V1 through V3: a marker for sudden death in patients without demonstrable

structural heart disease." Circulation 97(5): 457-460.

Bruneau, B. G., Z. Z. Bao, et al. (2001). "Cardiomyopathy in Irx4-deficient mice is preceded by

abnormal ventricular gene expression." Mol Cell Biol 21(5): 1730-1736.

Bruneau, B. G., Z. Z. Bao, et al. (2000). "Cardiac expression of the ventricle-specific homeobox

gene Irx4 is modulated by Nkx2-5 and dHand." Dev Biol 217(2): 266-277.

Bruneau, B. G., M. Logan, et al. (1999). "Chamber-specific cardiac expression of Tbx5 and

heart defects in Holt-Oram syndrome." Dev Biol 211(1): 100-108.

Burglin, T. R. (1997). "Analysis of TALE superclass homeobox genes (MEIS, PBC, KNOX,

Iroquois, TGIF) reveals a novel domain conserved between plants and animals." Nucleic

Acids Res 25(21): 4173-4180.

Castellanos, A., Jr., O. Maytin, et al. (1970). "Significance of complete right bundle-branch

block with right axis deviation in absence of right ventricular hypertrophy." Br Heart J

32(1): 85-92.

Catterall, W. A. (2000). "From ionic currents to molecular mechanisms: the structure and

function of voltage-gated sodium channels." Neuron 26(1): 13-25.

Cavodeassi, F., J. Modolell, et al. (2001). "The Iroquois family of genes: from body building to

neural patterning." Development 128(15): 2847-2855.

Chen, C., V. Bharucha, et al. (2002). "Reduced sodium channel density, altered voltage

dependence of inactivation, and increased susceptibility to seizures in mice lacking

sodium channel beta 2-subunits." Proc Natl Acad Sci U S A 99(26): 17072-17077.

108

Cheng, Y., D. R. Van Wagoner, et al. (1998). "Voltage-sensitive dye RH421 increases

contractility of cardiac muscle." Can J Physiol Pharmacol 76(12): 1146-1150.

Christoffels, V. M., W. M. Hoogaars, et al. (2004). "T-box transcription factor Tbx2 represses

differentiation and formation of the cardiac chambers." Dev Dyn 229(4): 763-770.

Christoffels, V. M., A. G. Keijser, et al. (2000). "Patterning the embryonic heart: identification

of five mouse Iroquois homeobox genes in the developing heart." Dev Biol 224(2): 263-

274.

Cohen, D. R., C. W. Cheng, et al. (2000). "Expression of two novel mouse Iroquois homeobox

genes during neurogenesis." Mech Dev 91(1-2): 317-321.

Coppen, S. R., N. J. Severs, et al. (1999). "Connexin45 (alpha 6) expression delineates an

extended conduction system in the embryonic and mature rodent heart." Dev Genet

24(1-2): 82-90.

Corrado, D., A. Nava, et al. (1996). "Familial cardiomyopathy underlies syndrome of right

bundle branch block, ST segment elevation and sudden death." J Am Coll Cardiol 27(2):

443-448.

Costantini, D. L., E. P. Arruda, et al. (2005). "The homeodomain transcription factor Irx5

establishes the mouse cardiac ventricular repolarization gradient." Cell 123(2): 347-358.

Damato, A. N., S. H. Lau, et al. (1969). "Recording of specialized conducting fibers (A-V nodal,

His bundle, and right bundle branch) in man using an electrode catheter technic."

Circulation 39(4): 435-447.

Davies, M. J., R. H. Anderson, et al. (1983). The conduction system of the heart. London,

Butterworth.

Davis, L. M., M. E. Rodefeld, et al. (1995). "Gap junction protein phenotypes of the human

heart and conduction system." J Cardiovasc Electrophysiol 6(10 Pt 1): 813-822.

109

Delorme, B., E. Dahl, et al. (1995). "Developmental regulation of connexin 40 gene expression

in mouse heart correlates with the differentiation of the conduction system." Dev Dyn

204(4): 358-371.

Deng, X. F., D. G. Rokosh, et al. (2000). "Autonomous and growth factor-induced hypertrophy

in cultured neonatal mouse cardiac myocytes. Comparison with rat." Circ Res 87(9):

781-788.

Desplantez, T., E. Dupont, et al. (2007). "Gap junction channels and cardiac impulse

propagation." J Membr Biol 218(1-3): 13-28.

Dhingra, R. C., E. Palileo, et al. (1981). "Significance of the HV interval in 517 patients with

chronic bifascicular block." Circulation 64(6): 1265-1271.

Dominguez, J. N., F. Navarro, et al. (2005). "Temporal and spatial expression pattern of beta1

sodium channel subunit during heart development." Cardiovasc Res 65(4): 842-850.

Dougherty, J. D. (1970). "The relation of the frontal QRS axis to the anatomic position of the

heart." J Electrocardiol 3(3-4): 267-284.

Durrer, D., R. T. van Dam, et al. (1970). "Total excitation of the isolated human heart."

Circulation 41(6): 899-912.

Fitchett, D. H., D. D. Sugrue, et al. (1984). "Right ventricular dilated cardiomyopathy." Br Heart

J 51(1): 25-29.

Fluhler, E., V. G. Burnham, et al. (1985). "Spectra, membrane binding, and potentiometric

responses of new charge shift probes." Biochemistry 24(21): 5749-5755.

Fozzard, H. A. and D. A. Hanck (1996). "Structure and function of voltage-dependent sodium

channels: comparison of brain II and cardiac isoforms." Physiol Rev 76(3): 887-926.

110

Franco, D. and J. M. Icardo (2001). "Molecular characterization of the ventricular conduction

system in the developing mouse heart: topographical correlation in normal and

congenitally malformed hearts." Cardiovasc Res 49(2): 417-429.

Gaborit, N., A. Varro, et al. (2010). "Gender-related Differences in Ion-channel and Transporter

Subunit Expression in Non-diseased Human Hearts." J Mol Cell Cardiol.

Garriock, R. J., S. A. Vokes, et al. (2001). "Developmental expression of the Xenopus Iroquois-

family homeobox genes, Irx4 and Irx5." Dev Genes Evol 211(5): 257-260.

Gellens, M. E., A. L. George, Jr., et al. (1992). "Primary structure and functional expression of

the human cardiac tetrodotoxin-insensitive voltage-dependent sodium channel." Proc

Natl Acad Sci U S A 89(2): 554-558.

Goldberger, A. L. (2006). Clinical electrocardiography : a simplified approach. Philadelphia,

Mosby Elsevier.

Golshayan, D., C. Seydoux, et al. (1998). "Incidence and prognostic value of

electrocardiographic abnormalities after heart transplantation." Clin Cardiol 21(9): 680-

684.

Gomez-Skarmeta, J. L., R. Diez del Corral, et al. (1996). "Araucan and caupolican, two

members of the novel iroquois complex, encode homeoproteins that control proneural

and vein-forming genes." Cell 85(1): 95-105.

Gomez-Skarmeta, J. L., A. Glavic, et al. (1998). "Xiro, a Xenopus homolog of the Drosophila

Iroquois complex genes, controls development at the neural plate." EMBO J 17(1): 181-

190.

Gomez-Skarmeta, J. L. and J. Modolell (1996). "araucan and caupolican provide a link between

compartment subdivisions and patterning of sensory organs and veins in the Drosophila

wing." Genes Dev 10(22): 2935-2945.

111

Gomez-Skarmeta, J. L. and J. Modolell (2002). "Iroquois genes: genomic organization and

function in vertebrate neural development." Curr Opin Genet Dev 12(4): 403-408.

Grines, C. L., T. M. Bashore, et al. (1989). "Functional abnormalities in isolated left bundle

branch block. The effect of interventricular asynchrony." Circulation 79(4): 845-853.

Gros, D., T. Jarry-Guichard, et al. (1994). "Restricted distribution of connexin40, a gap

junctional protein, in mammalian heart." Circ Res 74(5): 839-851.

Gros, D. B. and H. J. Jongsma (1996). "Connexins in mammalian heart function." Bioessays

18(9): 719-730.

Harrigan, R. A. and K. Jones (2002). "ABC of clinical electrocardiography. Conditions affecting

the right side of the heart." BMJ 324(7347): 1201-1204.

Haufe, V., J. A. Camacho, et al. (2005). "Expression pattern of neuronal and skeletal muscle

voltage-gated Na+ channels in the developing mouse heart." J Physiol 564(Pt 3): 683-

696.

Haufe, V., J. M. Cordeiro, et al. (2005). "Contribution of neuronal sodium channels to the

cardiac fast sodium current INa is greater in dog heart Purkinje fibers than in ventricles."

Cardiovasc Res 65(1): 117-127.

Herfst, L. J., M. B. Rook, et al. (2004). "Trafficking and functional expression of cardiac Na+

channels." J Mol Cell Cardiol 36(2): 185-193.

High, F. A. and J. A. Epstein (2008). "The multifaceted role of Notch in cardiac development

and disease." Nat Rev Genet 9(1): 49-61.

Hinch, R. (2002). "An analytical study of the physiology and pathology of the propagation of

cardiac action potentials." Prog Biophys Mol Biol 78(1): 45-81.

Hoogaars, W. M., A. Tessari, et al. (2004). "The transcriptional repressor Tbx3 delineates the

developing central conduction system of the heart." Cardiovasc Res 62(3): 489-499.

112

Houweling, A. C., R. Dildrop, et al. (2001). "Gene and cluster-specific expression of the

Iroquois family members during mouse development." Mech Dev 107(1-2): 169-174.

Houweling, A. C., M. M. van Borren, et al. (2005). "Expression and regulation of the atrial

natriuretic factor encoding gene Nppa during development and disease." Cardiovasc Res

67(4): 583-593.

Hu, D., H. Barajas-Martinez, et al. (2009). "A mutation in the beta 3 subunit of the cardiac

sodium channel associated with Brugada ECG phenotype." Circ Cardiovasc Genet 2(3):

270-278.

Ideker, R. E., W. Kong, et al. (2009). "Purkinje fibers and arrhythmias." Pacing Clin

Electrophysiol 32(3): 283-285.

Ismat, F. A., M. Zhang, et al. (2005). "Homeobox protein Hop functions in the adult cardiac

conduction system." Circ Res 96(8): 898-903.

Isom, L. L., K. S. De Jongh, et al. (1992). "Primary structure and functional expression of the

beta 1 subunit of the rat brain sodium channel." Science 256(5058): 839-842.

Isom, L. L., D. S. Ragsdale, et al. (1995). "Structure and function of the beta 2 subunit of brain

sodium channels, a transmembrane glycoprotein with a CAM motif." Cell 83(3): 433-

442.

Itoh, M., T. Kudoh, et al. (2002). "A role for iro1 and iro7 in the establishment of an

anteroposterior compartment of the ectoderm adjacent to the midbrain-hindbrain

boundary." Development 129(10): 2317-2327.

Jay, P. Y., B. S. Harris, et al. (2004). "Function follows form: cardiac conduction system defects

in Nkx2-5 mutation." Anat Rec A Discov Mol Cell Evol Biol 280(2): 966-972.

Jay, P. Y., B. S. Harris, et al. (2004). "Nkx2-5 mutation causes anatomic hypoplasia of the

cardiac conduction system." J Clin Invest 113(8): 1130-1137.

113

Jordan, K. C., N. J. Clegg, et al. (2000). "The homeobox gene mirror links EGF signalling to

embryonic dorso-ventral axis formation through notch activation." Nat Genet 24(4): 429-

433.

Joseph, E. M. (2004). "Zebrafish IRX1b in the embryonic cardiac ventricle." Dev Dyn 231(4):

720-726.

Kaba, R. A., S. R. Coppen, et al. (2001). "Comparison of connexin 43, 40 and 45 expression

patterns in the developing human and mouse hearts." Cell Commun Adhes 8(4-6): 339-

343.

Kamino, K. (1991). "Optical approaches to ontogeny of electrical activity and related functional

organization during early heart development." Physiol Rev 71(1): 53-91.

Kanter, H. L., J. G. Laing, et al. (1993). "Distinct patterns of connexin expression in canine

Purkinje fibers and ventricular muscle." Circ Res 72(5): 1124-1131.

Kasahara, H., H. Wakimoto, et al. (2001). "Progressive atrioventricular conduction defects and

heart failure in mice expressing a mutant Csx/Nkx2.5 homeoprotein." J Clin Invest

108(2): 189-201.

Kassiri, Z., C. Zobel, et al. (2002). "Reduction of I(to) causes hypertrophy in neonatal rat

ventricular myocytes." Circ Res 90(5): 578-585.

Kawasuji, M. and T. Iwa (1978). "Spread of the epicardial excitation in right bundle branch

block pattern." Jpn Circ J 42(9): 1041-1056.

Kehl, B. T., K. O. Cho, et al. (1998). "mirror, a Drosophila homeobox gene in the Iroquois

complex, is required for sensory organ and alula formation." Development 125(7): 1217-

1227.

Khan, M. I. G. (2008). Rapid ECG interpretation. Totowa, N.J., Human Press: xvii, 416 p.

114

Kiecker, C. and A. Lumsden (2004). "Hedgehog signaling from the ZLI regulates diencephalic

regional identity." Nat Neurosci 7(11): 1242-1249.

Kikuchi, K., J. E. Holdway, et al. (2010). "Primary contribution to zebrafish heart regeneration

by gata4(+) cardiomyocytes." Nature 464(7288): 601-605.

Kim, K. H., G. Y. Oudit, et al. (2008). "Erythropoietin protects against doxorubicin-induced

cardiomyopathy via a phosphatidylinositol 3-kinase-dependent pathway." J Pharmacol

Exp Ther 324(1): 160-169.

Ko, S. H., P. W. Lenkowski, et al. (2005). "Modulation of Na(v)1.5 by beta1-- and beta3-

subunit co-expression in mammalian cells." Pflugers Arch 449(4): 403-412.

Kobayashi, D., M. Kobayashi, et al. (2002). "Early subdivisions in the neural plate define

distinct competence for inductive signals." Development 129(1): 83-93.

Kyndt, F., V. Probst, et al. (2001). "Novel SCN5A mutation leading either to isolated cardiac

conduction defect or Brugada syndrome in a large French family." Circulation 104(25):

3081-3086.

Lasser, R. P., J. I. Haft, et al. (1968). "Relationship of right bundle-branch block and marked left

axis deviation (with left parietal or peri-infarction block) to complete heart block and

syncope." Circulation 37(3): 429-437.

Lawrenz, T., F. Lieder, et al. (2007). "Predictors of complete heart block after transcoronary

ablation of septal hypertrophy: results of a prospective electrophysiological investigation

in 172 patients with hypertrophic obstructive cardiomyopathy." J Am Coll Cardiol

49(24): 2356-2363.

Lebel, M., P. Agarwal, et al. (2003). "The Iroquois homeobox gene Irx2 is not essential for

normal development of the heart and midbrain-hindbrain boundary in mice." Mol Cell

Biol 23(22): 8216-8225.

115

Lee, S. K., L. W. Jurata, et al. (2004). "Analysis of embryonic motoneuron gene regulation:

derepression of general activators function in concert with enhancer factors."

Development 131(14): 3295-3306.

Lenegre, J. (1964). "Etiology and Pathology of Bilateral Bundle Branch Block in Relation to

Complete Heart Block." Prog Cardiovasc Dis 6: 409-444.

Leyns, L., J. L. Gomez-Skarmeta, et al. (1996). "iroquois: a prepattern gene that controls the

formation of bristles on the thorax of Drosophila." Mech Dev 59(1): 63-72.

Linhares, V. L., N. A. Almeida, et al. (2004). "Transcriptional regulation of the murine

Connexin40 promoter by cardiac factors Nkx2-5, GATA4 and Tbx5." Cardiovasc Res

64(3): 402-411.

Liu, G., J. B. Iden, et al. (2004). "In vivo temporal and spatial distribution of depolarization and

repolarization and the illusive murine T wave." J Physiol 555(Pt 1): 267-279.

Lokhandwala, Y., G. K. Panicker, et al. (2009). "Left bundle-branch block with right axis

deviation--a unique aberrancy during supraventricular tachycardia." J Electrocardiol

42(6): 674-676.

London, B. (2001). "Cardiac arrhythmias: from (transgenic) mice to men." J Cardiovasc

Electrophysiol 12(9): 1089-1091.

Macedo, P. G., S. M. Patel, et al. (2010). "Septal accessory pathway: anatomy, causes for

difficulty, and an approach to ablation." Indian Pacing Electrophysiol J 10(7): 292-309.

Matsumoto, K., S. Nishihara, et al. (2004). "The prepattern transcription factor Irx2, a target of

the FGF8/MAP kinase cascade, is involved in cerebellum formation." Nat Neurosci 7(6):

605-612.

116

McNeill, H., C. H. Yang, et al. (1997). "mirror encodes a novel PBX-class homeoprotein that

functions in the definition of the dorsal-ventral border in the Drosophila eye." Genes

Dev 11(8): 1073-1082.

Medeiros-Domingo, A., T. Kaku, et al. (2007). "SCN4B-encoded sodium channel beta4 subunit

in congenital long-QT syndrome." Circulation 116(2): 134-142.

Meysen, S., L. Marger, et al. (2007). "Nkx2.5 cell-autonomous gene function is required for the

postnatal formation of the peripheral ventricular conduction system." Dev Biol 303(2):

740-753.

Mikawa, T. and R. Hurtado (2007). "Development of the cardiac conduction system." Semin

Cell Dev Biol 18(1): 90-100.

Miquerol, L., S. Meysen, et al. (2004). "Architectural and functional asymmetry of the His-

Purkinje system of the murine heart." Cardiovasc Res 63(1): 77-86.

Moorman, A. F., F. de Jong, et al. (1998). "Development of the cardiac conduction system."

Circ Res 82(6): 629-644.

Morgan, K., E. B. Stevens, et al. (2000). "beta 3: an additional auxiliary subunit of the voltage-

sensitive sodium channel that modulates channel gating with distinct kinetics." Proc Natl

Acad Sci U S A 97(5): 2308-2313.

Morley, G. E. and D. Vaidya (2001). "Understanding conduction of electrical impulses in the

mouse heart using high-resolution video imaging technology." Microsc Res Tech 52(3):

241-250.

Moskowitz, I. P., J. B. Kim, et al. (2007). "A molecular pathway including Id2, Tbx5, and

Nkx2-5 required for cardiac conduction system development." Cell 129(7): 1365-1376.

117

Moskowitz, I. P., A. Pizard, et al. (2004). "The T-Box transcription factor Tbx5 is required for

the patterning and maturation of the murine cardiac conduction system." Development

131(16): 4107-4116.

Mummenhoff, J., A. C. Houweling, et al. (2001). "Expression of Irx6 during mouse

morphogenesis." Mech Dev 103(1-2): 193-195.

Myers, D. C. and G. I. Fishman (2004). "Toward an understanding of the genetics of murine

cardiac pacemaking and conduction system development." Anat Rec A Discov Mol Cell

Evol Biol 280(2): 1018-1021.

Newby, K. H., E. Pisano, et al. (1996). "Incidence and clinical relevance of the occurrence of

bundle-branch block in patients treated with thrombolytic therapy." Circulation 94(10):

2424-2428.

Novakova, M., J. Bardonova, et al. (2008). "Effects of voltage sensitive dye di-4-ANEPPS on

guinea pig and rabbit myocardium." Gen Physiol Biophys 27(1): 45-54.

Noyes, M. B., R. G. Christensen, et al. (2008). "Analysis of homeodomain specificities allows

the family-wide prediction of preferred recognition sites." Cell 133(7): 1277-1289.

Nygren, A., R. B. Clark, et al. (2000). "Voltage-sensitive dye mapping of activation and

conduction in adult mouse hearts." Ann Biomed Eng 28(8): 958-967.

Ohkubo, K., I. Watanabe, et al. (2010). "Functional atrioventricular conduction block in an

elderly patient with acquired long QT syndrome: elucidation of the mechanism of

block." J Electrocardiol.

Okamoto, A., S. Inoue, et al. (2009). "Application of prophylactic gel-pads for transcutaneous

pacing in patients with complete right bundle-branch block with axis deviation when

surgical procedures are performed: 10-year experience from a single Japanese university

hospital." J Anesth 23(4): 616-619.

118

Okoroma, E. O., B. Guller, et al. (1975). "Etiology of right bundle-branch block pattern after

surgical closure of ventricular-septal defects." Am Heart J 90(1): 14-18.

Olson, E. N. and D. Srivastava (1996). "Molecular pathways controlling heart development."

Science 272(5262): 671-676.

Pedersen, T. A., N. H. Andersen, et al. (2008). "The effects of surgically induced right bundle

branch block on left ventricular function after closure of the ventricular septal defect."

Cardiol Young 18(4): 430-436.

Pennisi, D. J., S. Rentschler, et al. (2002). "Induction and patterning of the cardiac conduction

system." Int J Dev Biol 46(6): 765-775.

Peters, T., R. Dildrop, et al. (2000). "Organization of mouse Iroquois homeobox genes in two

clusters suggests a conserved regulation and function in vertebrate development."

Genome Res 10(10): 1453-1462.

Ramanathan, C., P. Jia, et al. (2006). "Activation and repolarization of the normal human heart

under complete physiological conditions." Proc Natl Acad Sci U S A 103(16): 6309-

6314.

Reggiani, L., D. Raciti, et al. (2007). "The prepattern transcription factor Irx3 directs nephron

segment identity." Genes Dev 21(18): 2358-2370.

Remme, C. A., A. O. Verkerk, et al. (2009). "The cardiac sodium channel displays differential

distribution in the conduction system and transmural heterogeneity in the murine

ventricular myocardium." Basic Res Cardiol 104(5): 511-522.

Rentschler, S., D. M. Vaidya, et al. (2001). "Visualization and functional characterization of the

developing murine cardiac conduction system." Development 128(10): 1785-1792.

Rotman, M. and J. H. Triebwasser (1975). "A clinical and follow-up study of right and left

bundle branch block." Circulation 51(3): 477-484.

119

Royer, A., T. A. van Veen, et al. (2005). "Mouse model of SCN5A-linked hereditary Lenegre's

disease: age-related conduction slowing and myocardial fibrosis." Circulation 111(14):

1738-1746.

Schneider, J. F., H. E. Thomas, Jr., et al. (1981). "Comparative features of newly acquired left

and right bundle branch block in the general population: the Framingham study." Am J

Cardiol 47(4): 931-940.

Schott, J. J., C. Alshinawi, et al. (1999). "Cardiac conduction defects associate with mutations in

SCN5A." Nat Genet 23(1): 20-21.

Schott, J. J., D. W. Benson, et al. (1998). "Congenital heart disease caused by mutations in the

transcription factor NKX2-5." Science 281(5373): 108-111.

Schrickel, J. W., M. M. Kreuzberg, et al. (2009). "Normal impulse propagation in the

atrioventricular conduction system of Cx30.2/Cx40 double deficient mice." J Mol Cell

Cardiol 46(5): 644-652.

Sedmera, D. (2007). "Development of cardiac conduction system in mammals with a focus on

the anatomical, fucntional and medical/genetical aspects." Journal of Applied

Biomedicine 5: 9.

Sedmera, D., M. Reckova, et al. (2003). "Spatiotemporal pattern of commitment to slowed

proliferation in the embryonic mouse heart indicates progressive differentiation of the

cardiac conduction system." Anat Rec A Discov Mol Cell Evol Biol 274(1): 773-777.

Shenkman, H. J., V. Pampati, et al. (2002). "Congestive heart failure and QRS duration:

establishing prognosis study." Chest 122(2): 528-534.

Simon, A. M., D. A. Goodenough, et al. (1998). "Mice lacking connexin40 have cardiac

conduction abnormalities characteristic of atrioventricular block and bundle branch

block." Curr Biol 8(5): 295-298.

120

Simon, L., N. Kariya, et al. (2004). "Effect of bupivacaine on the isolated rabbit heart:

developmental aspect on ventricular conduction and contractility." Anesthesiology

101(4): 937-944.

Tamaddon, H. S., D. Vaidya, et al. (2000). "High-resolution optical mapping of the right bundle

branch in connexin40 knockout mice reveals slow conduction in the specialized

conduction system." Circ Res 87(10): 929-936.

Tan, H. L., M. T. Bink-Boelkens, et al. (2001). "A sodium-channel mutation causes isolated

cardiac conduction disease." Nature 409(6823): 1043-1047.

Tanaka, M., C. I. Berul, et al. (2002). "A mouse model of congenital heart disease: cardiac

arrhythmias and atrial septal defect caused by haploinsufficiency of the cardiac

transcription factor Csx/Nkx2.5." Cold Spring Harb Symp Quant Biol 67: 317-325.

Tanaka, M., S. B. Wechsler, et al. (1999). "Complex modular cis-acting elements regulate

expression of the cardiac specifying homeobox gene Csx/Nkx2.5." Development 126(7):

1439-1450.

Teunissen, B. E. and M. F. Bierhuizen (2004). "Transcriptional control of myocardial

connexins." Cardiovasc Res 62(2): 246-255.

Thomas, P. S., H. Kasahara, et al. (2001). "Elevated expression of Nkx-2.5 in developing

myocardial conduction cells." Anat Rec 263(3): 307-313.

Tuzcu, E. M., A. Emre, et al. (1990). "Incidence and prognostic significance of intraventricular

conduction abnormalities after coronary bypass surgery." J Am Coll Cardiol 16(3): 607-

610. van Kempen, M. J., I. ten Velde, et al. (1995). "Differential connexin distribution accommodates

cardiac function in different species." Microsc Res Tech 31(5): 420-436.

121 van Rijen, H. V., D. Eckardt, et al. (2004). "Slow conduction and enhanced anisotropy increase

the propensity for ventricular tachyarrhythmias in adult mice with induced deletion of

connexin43." Circulation 109(8): 1048-1055. van Rijen, H. V., T. A. van Veen, et al. (2001). "Impaired conduction in the bundle branches of

mouse hearts lacking the gap junction protein connexin40." Circulation 103(11): 1591-

1598. van Tuyl, M., J. Liu, et al. (2006). "Iroquois genes influence proximo-distal morphogenesis

during rat lung development." Am J Physiol Lung Cell Mol Physiol 290(4): L777-L789. van Veen, T. A., H. V. van Rijen, et al. (2005). "Discontinuous conduction in mouse bundle

branches is caused by bundle-branch architecture." Circulation 112(15): 2235-2244.

VanderBrink, B. A., C. Sellitto, et al. (2000). "Connexin40-deficient mice exhibit

atrioventricular nodal and infra-Hisian conduction abnormalities." J Cardiovasc

Electrophysiol 11(11): 1270-1276.

Wakimoto, H., H. Kasahara, et al. (2002). "Developmentally modulated cardiac conduction

failure in transgenic mice with fetal or postnatal overexpression of DNA nonbinding

mutant Nkx2.5." J Cardiovasc Electrophysiol 13(7): 682-688.

Wang, D. W., P. C. Viswanathan, et al. (2002). "Clinical, genetic, and biophysical

characterization of SCN5A mutations associated with atrioventricular conduction block."

Circulation 105(3): 341-346.

Watanabe, H., T. T. Koopmann, et al. (2008). "Sodium channel beta1 subunit mutations

associated with Brugada syndrome and cardiac conduction disease in humans." J Clin

Invest 118(6): 2260-2268.

Wolf, C. M. and C. I. Berul (2006). "Inherited conduction system abnormalities--one group of

diseases, many genes." J Cardiovasc Electrophysiol 17(4): 446-455.

122

Wolff, G. S., T. W. Rowland, et al. (1972). "Surgically induced right bundle-branch block with

left anterior hemiblock. An ominous sign in postoperative tetralogy of Fallot."

Circulation 46(3): 587-594.

123