Prospective Isolation and Global Gene Expression Analysis of Definitive and Visceral Endoderm ⁎ Richard I
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
THE ROLE of HOMEODOMAIN TRANSCRIPTION FACTOR IRX5 in CARDIAC CONTRACTILITY and HYPERTROPHIC RESPONSE by © COPYRIGHT by KYOUNG H
THE ROLE OF HOMEODOMAIN TRANSCRIPTION FACTOR IRX5 IN CARDIAC CONTRACTILITY AND HYPERTROPHIC RESPONSE By KYOUNG HAN KIM A THESIS SUBMITTED IN CONFORMITY WITH THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY GRADUATE DEPARTMENT OF PHYSIOLOGY UNIVERSITY OF TORONTO © COPYRIGHT BY KYOUNG HAN KIM (2011) THE ROLE OF HOMEODOMAIN TRANSCRIPTION FACTOR IRX5 IN CARDIAC CONTRACTILITY AND HYPERTROPHIC RESPONSE KYOUNG HAN KIM DOCTOR OF PHILOSOPHY GRADUATE DEPARTMENT OF PHYSIOLOGY UNIVERSITY OF TORONTO 2011 ABSTRACT Irx5 is a homeodomain transcription factor that negatively regulates cardiac fast transient + outward K currents (Ito,f) via the KV4.2 gene and is thereby a major determinant of the transmural repolarization gradient. While Ito,f is invariably reduced in heart disease and changes in Ito,f can modulate both cardiac contractility and hypertrophy, less is known about a functional role of Irx5, and its relationship with Ito,f, in the normal and diseased heart. Here I show that Irx5 plays crucial roles in the regulation of cardiac contractility and proper adaptive hypertrophy. Specifically, Irx5-deficient (Irx5-/-) hearts had reduced cardiac contractility and lacked the normal regional difference in excitation-contraction with decreased action potential duration, Ca2+ transients and myocyte shortening in sub-endocardial, but not sub-epicardial, myocytes. In addition, Irx5-/- mice showed less cardiac hypertrophy, but increased interstitial fibrosis and greater contractility impairment following pressure overload. A defect in hypertrophic responses in Irx5-/- myocardium was confirmed in cultured neonatal mouse ventricular myocytes, exposed to norepinephrine while being restored with Irx5 replacement. Interestingly, studies using mice ii -/- virtually lacking Ito,f (i.e. KV4.2-deficient) showed that reduced contractility in Irx5 mice was completely restored by loss of KV4.2, whereas hypertrophic responses to pressure-overload in hearts remained impaired when both Irx5 and Ito,f were absent. -
Expression of HOXB2, a Retinoic Acid Signalingtarget in Pancreatic Cancer and Pancreatic Intraepithelial Neoplasia Davendra Segara,1Andrew V
Cancer Prevention Expression of HOXB2, a Retinoic Acid SignalingTarget in Pancreatic Cancer and Pancreatic Intraepithelial Neoplasia Davendra Segara,1Andrew V. Biankin,1, 2 James G. Kench,1, 3 Catherine C. Langusch,1Amanda C. Dawson,1 David A. Skalicky,1David C. Gotley,4 Maxwell J. Coleman,2 Robert L. Sutherland,1and Susan M. Henshall1 Abstract Purpose: Despite significant progress in understanding the molecular pathology of pancreatic cancer and its precursor lesion: pancreatic intraepithelial neoplasia (PanIN), there remain no molecules with proven clinical utility as prognostic or therapeutic markers. Here, we used oligo- nucleotide microarrays to interrogate mRNA expression of pancreatic cancer tissue and normal pancreas to identify novel molecular pathways dysregulated in the development and progression of pancreatic cancer. Experimental Design: RNA was hybridized toAffymetrix Genechip HG-U133 oligonucleotide microarrays. A relational database integrating data from publicly available resources was created toidentify candidate genes potentially relevant topancreatic cancer. The protein expression of one candidate, homeobox B2 (HOXB2), in PanIN and pancreatic cancer was assessed using immunohistochemistry. Results: We identified aberrant expression of several components of the retinoic acid (RA) signaling pathway (RARa,MUC4,Id-1,MMP9,uPAR,HB-EGF,HOXB6,andHOXB2),manyof which are known to be aberrantly expressed in pancreatic cancer and PanIN. HOXB2, a down- stream target of RA, was up-regulated 6.7-fold in pancreatic cancer compared with normal pan- creas. Immunohistochemistry revealed ectopic expression of HOXB2 in15% of early PanINlesions and 48 of 128 (38%) pancreatic cancer specimens. Expression of HOXB2 was associated with nonresectable tumors and was an independent predictor of poor survival in resected tumors. -
Novel Observations from Next-Generation RNA Sequencing of Highly Purified Human Adult and Fetal Islet Cell Subsets
3172 Diabetes Volume 64, September 2015 David M. Blodgett,1 Anetta Nowosielska,2 Shaked Afik,3 Susanne Pechhold,1 Anthony J. Cura,1 Norman J. Kennedy,4 Soyoung Kim,2 Alper Kucukural,5 Roger J. Davis,6 Sally C. Kent,1 Dale L. Greiner,2 Manuel G. Garber,3 David M. Harlan,1 and Philip diIorio2† Novel Observations From Next-Generation RNA Sequencing of Highly Purified Human Adult and Fetal Islet Cell Subsets Diabetes 2015;64:3172–3181 | DOI: 10.2337/db15-0039 Understanding distinct gene expression patterns of blindness, kidney failure, amputation, lost work, and pre- normal adult and developing fetal human pancreatic a- mature mortality (2,3). While diabetes is easily diagnosed and b-cells is crucial for developing stem cell therapies, by simple blood glucose measurements, it ultimately islet regeneration strategies, and therapies designed to results from a loss of functional b-cell mass. We need increase b-cell function in patients with diabetes (type 1 to better understand the molecular mediators driving or 2). Toward that end, we have developed methods to that loss and limited b-cell regeneration capacity (4,5). highly purify a-, b-, and d-cells from human fetal and This knowledge gap exists because it has not previously adult pancreata by intracellular staining for the cell- been possible to study homogeneous, highly enriched en- specific hormone content, sorting the subpopulations docrine cell populations from human islets. Recent stud- by flow cytometry, and, using next-generation RNA se- ies have reported expression profiles on whole islets (6) quencing, we report the detailed transcriptomes of fetal and individual cell types using techniques like laser cap- and adult a- and b-cells. -
Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells
The Journal of Clinical Investigation RESEARCH ARTICLE Prospective isolation of NKX2-1–expressing human lung progenitors derived from pluripotent stem cells Finn Hawkins,1,2 Philipp Kramer,3 Anjali Jacob,1,2 Ian Driver,4 Dylan C. Thomas,1 Katherine B. McCauley,1,2 Nicholas Skvir,1 Ana M. Crane,3 Anita A. Kurmann,1,5 Anthony N. Hollenberg,5 Sinead Nguyen,1 Brandon G. Wong,6 Ahmad S. Khalil,6,7 Sarah X.L. Huang,3,8 Susan Guttentag,9 Jason R. Rock,4 John M. Shannon,10 Brian R. Davis,3 and Darrell N. Kotton1,2 2 1Center for Regenerative Medicine, and The Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, Massachusetts, USA. 3Center for Stem Cell and Regenerative Medicine, Brown Foundation Institute of Molecular Medicine, University of Texas Health Science Center, Houston, Texas, USA. 4Department of Anatomy, UCSF, San Francisco, California, USA. 5Division of Endocrinology, Diabetes and Metabolism, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA. 6Department of Biomedical Engineering and Biological Design Center, Boston University, Boston, Massachusetts, USA. 7Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts, USA. 8Columbia Center for Translational Immunology & Columbia Center for Human Development, Columbia University Medical Center, New York, New York, USA. 9Department of Pediatrics, Monroe Carell Jr. Children’s Hospital, Vanderbilt University, Nashville, Tennessee, USA. 10Division of Pulmonary Biology, Cincinnati Children’s Hospital, Cincinnati, Ohio, USA. It has been postulated that during human fetal development, all cells of the lung epithelium derive from embryonic, endodermal, NK2 homeobox 1–expressing (NKX2-1+) precursor cells. -
Detailed Review Paper on Retinoid Pathway Signalling
1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process. -
Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897 -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Methylome and Transcriptome Maps of Human Visceral and Subcutaneous
www.nature.com/scientificreports OPEN Methylome and transcriptome maps of human visceral and subcutaneous adipocytes reveal Received: 9 April 2019 Accepted: 11 June 2019 key epigenetic diferences at Published: xx xx xxxx developmental genes Stephen T. Bradford1,2,3, Shalima S. Nair1,3, Aaron L. Statham1, Susan J. van Dijk2, Timothy J. Peters 1,3,4, Firoz Anwar 2, Hugh J. French 1, Julius Z. H. von Martels1, Brodie Sutclife2, Madhavi P. Maddugoda1, Michelle Peranec1, Hilal Varinli1,2,5, Rosanna Arnoldy1, Michael Buckley1,4, Jason P. Ross2, Elena Zotenko1,3, Jenny Z. Song1, Clare Stirzaker1,3, Denis C. Bauer2, Wenjia Qu1, Michael M. Swarbrick6, Helen L. Lutgers1,7, Reginald V. Lord8, Katherine Samaras9,10, Peter L. Molloy 2 & Susan J. Clark 1,3 Adipocytes support key metabolic and endocrine functions of adipose tissue. Lipid is stored in two major classes of depots, namely visceral adipose (VA) and subcutaneous adipose (SA) depots. Increased visceral adiposity is associated with adverse health outcomes, whereas the impact of SA tissue is relatively metabolically benign. The precise molecular features associated with the functional diferences between the adipose depots are still not well understood. Here, we characterised transcriptomes and methylomes of isolated adipocytes from matched SA and VA tissues of individuals with normal BMI to identify epigenetic diferences and their contribution to cell type and depot-specifc function. We found that DNA methylomes were notably distinct between diferent adipocyte depots and were associated with diferential gene expression within pathways fundamental to adipocyte function. Most striking diferential methylation was found at transcription factor and developmental genes. Our fndings highlight the importance of developmental origins in the function of diferent fat depots. -
Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.