Disruption of IFT Complex a Causes Cystic Kidneys Without Mitotic Spindle Misorientation

BASIC RESEARCH www.jasn.org

Disruption of IFT Complex A Causes Cystic Kidneys without Mitotic Spindle Misorientation

† ‡ † Julie A. Jonassen,* Jovenal SanAgustin, Stephen P. Baker, and Gregory J. Pazour

*Department of Microbiology and Physiological Systems, †Program in Molecular Medicine, and ‡Department of Information Sciences, University of Massachusetts Medical School, Worcester, Massachusetts

ABSTRACT Intraflagellar transport (IFT) complexes A and B build and maintain primary cilia. In the mouse, kidney- specific or hypomorphic mutant alleles of IFT complex B genes cause polycystic kidneys, but the influence of IFT complex A proteins on renal development is not well understood. In the present study, we found that HoxB7-Cre–driven deletion of the complex A gene Ift140 from collecting ducts disrupted, but did not completely prevent, cilia assembly. Mutant kidneys developed collecting duct cysts by postnatal day 5, with rapid cystic expansion and renal dysfunction by day 15 and little remaining parenchymal tissue by day 20. In contrast to many models of polycystic kidney disease, precystic Ift140-deleted collecting ducts showed normal centrosomal positioning and no misorientation of the mitotic spindle axis, suggesting that disruption of oriented cell division is not a prerequisite to cyst formation in these kidneys. Precystic collecting ducts had an increased mitotic index, suggesting that cell proliferation may drive cyst expansion even with normal orientation of the mitotic spindle. In addition, we observed significant increases in expression of canonical Wnt pathway genes and mediators of Hedgehog and tissue fibrosis in highly cystic, but not precystic, kidneys. Taken together, these studies indicate that loss of Ift140 causes pronounced renal cystic disease and suggest that abnormalities in several different pathways may influence cyst progression.

J Am Soc Nephrol 23: 641–651, 2012. doi: 10.1681/ASN.2011080829

Genesis of primary cilia—specialized microtubular- by kinesin-2 and cytoplasmic dynein-2.7–10 IFT based sensory structures that project from most complex B comprises at least 13 proteins11 and is cells—requires intraflagellar transport (IFT), a required for ciliary assembly.12–16 In the mouse, bidirectional process that builds, maintains, strong alleles of IFT complex B genes typically pro- and disassembles these organelles. IFT also sup- duce midgestational lethality14,15 before renal de- ports diverse signaling roles played by primary velopment. Hypomorphic mutations in Ift88 or cilia that influence development, differentiation, kidney-specific deletion of Ift20, two IFT complex and cell cycle regulation.1–3 In the kidney, primary B genes, cause renal cyst formation.13,16 Similarly, cilia play vital roles in promoting tubular develop- strong alleles of the kinesin-2 or the dynein-2 IFT ment and maintaining normal renal morphology motors produce midgestational lethality,15,17,18 and function. Mutations that produce structural or functional defects in renal cell primary cilia cause abnormal proliferation of tubular epithelia, increased fluid secretion, and polycystic kidney Received August 19, 2011. Accepted November 23, 2011. 4–6 disease. Discerning processes controlling IFT- Published online ahead of print. Publication date available at mediated ciliary assembly and function is essential www.jasn.org. for understanding the pathogenic mechanisms un- Correspondence: Dr.GregoryJ.Pazour,PrograminMolecular derlying cystic renal diseases and other ciliopa- Medicine, University of Massachusetts Medical School, Biotech II, thies. Suite 213, 373 Plantation Street, Worcester, MA 01605. Email: The IFTsystem consists of two large protein com- [email protected] plexes, IFT complexes A and B, that are transported Copyright © 2012 by the American Society of Nephrology

J Am Soc Nephrol 23: 641–651, 2012 ISSN : 1046-6673/2304-641 641 BASIC RESEARCH www.jasn.org whereas kidney-specific deletion of kinesin-2 results in cystic localize to the spindle pole during mitosis.39–42 In contrast, disease.19 IFT140 does not seem to be associated with the spindle pole In contrast, very little is known about what, if any, role bodies during mitosis (Figure 1D). In control postnatal (p)5 is played by IFT complex A proteins on mammalian renal de- kidneys, IFT140 labels the base of the cilium (Figure 1E) just velopment and renal physiology. In invertebrate organisms, adjacent to the centrosome (Figure 1F). Staining of experimen- mutation or RNA interference depletion of individual IFT tal kidneys indicates that, at most, very short cilia remain at p5 complex A proteins produces cilia that are shortened and often and no IFT140 staining is observed. These results indicate that fl dilated and accumulate ciliary proteins.12,20–26 Similarly, RNA the conversion of the Ift140 ox allele to the Ift140null2 allele is interference knockdown of complex A proteins in mamma- efficient and that IFT140 is required for ciliary assembly. lian cells generated shortened cilia that accumulated IFT-B HoxB7-Cre expression begins with mesonephric duct de- proteins.27 In mice, null alleles of individual IFT complex A velopment 6–9daysbeforebirth43 before formation of the proteins, including IFT139,28 IFT122,29,30 and IFT121,31 pro- ureteric bud, the progenitor of adult collecting ducts. Collect- duced defects in skeletal, craniofacial, and nervous systems ing duct deletion of Ift140 led to pronounced postnatal renal that caused embryonic or neonatal death. Because of the cyst formation (Figure 2, A and B). At p0, there are modest early lethality of IFT complex A mutants, there is no informa- medullary collecting duct dilations but no renal cysts. By p5, tion as to whether IFT complex A defects would disrupt renal extensive medullary cysts are evident, with minimal cortical developmentorfunctioninmice.InIft122 zebrafish mor- cysts. By p10, cysts are present in medullary and cortical re- phants, pronephric cysts were observed32;incontrast,Ift140 gions, and by p20, extensive cysts are found throughout the morphants showed no apparent ciliary or sensory neuron de- kidney, with little remaining parenchymal tissue (Figure 2B). fects.33 Missense mutations in IFT-A proteins have been Kidney weights increased progressively (Figure 2C), and blood described in patients with cranioectodermal dysplasia/Sensen- urea nitrogen levels were elevated in mutants at p15 and p20 brenner’ssyndrome,31,32,34,35 a ciliopathy associated with (Figure 2D), consistent with renal failure during the third extensive craniofacial, skeletal, heart, liver, and ectodermal ab- week of life. normalities. Some cranioectodermal dysplasia patients exhibit Control collecting ducts were highly ciliated at birth, renal disease characterized by extensive glomerular sclerosis, whereas experimental p0 collecting ducts had no or very short renal cysts, interstitial fibrosis with focal inflammatory cell cilia (Figure 3A). There was no ciliary loss in noncollecting infiltration, scattered tubular atrophy, and chronic renal fail- duct cells (Figure 3A), supporting the specificity of HoxB7-Cre ure.31,32,36 Nonetheless, our understanding of how IFT com- for the collecting duct system.43 Although there may be a pro- plex A proteins influence renal development and cystic disease gressive loss of these shortened cilia over time, many collecting is extremely limited, and the present studies addressed this duct cells still carried stumpy cilia at p10 and p20 (Figure 3A). question by characterizing IFT140 function in mouse kidney. These shortened cilia show increased staining with IFT88 compared with controls (Figure 3B). Similarly, Ift140-deleted cultured cells showed increased ciliary staining with IFT88 RESULTS and IFT27 antibodies (Figure 3C). During normal tubular development, the mitotic spindle of To understand the role of IFT140 in cystic kidney disease, dividing cells orients in parallel to the longitudinal axis of the we used Knockout Mouse Project (KOMP) embryonic stem (ES) nephron.44 In many different polycystic kidney disease (PKD) cells37,38 to create flox and null1 alleles (Figure 1A). Animals models,16,45,46 randomization of the mitotic spindle axis may fl homozygous for Ift140 ox are viable with no detectable pheno- be a critical part of the cystogenic program. At p5, many ex- types, whereas animals homozygous for Ift140null1 die at mid- perimental collecting ducts were already dilated; these ducts gestation and will be described in a separate publication. In this were excluded from analysis to focus on events occurring be- work, we used HoxB7-Cre to delete Ift140 in the collecting ducts. fore the duct lost its normal architecture. In control collecting fl Control animals have the genotype HoxB7-Cre, Ift140 ox/+,and ducts, mitotic spindles aligned with the long axis of the tubule. fl experimental animals are HoxB7-Cre, Ift140 ox/null1.Theflox al- In contrast to what we observed in Ift20-deleted kidneys,16 loss lele is converted to the null2 allele by Cre, and therefore, exper- of Ift140 did not alter mitotic spindle orientation in precystic imental animals are Ift140null2/null1 in the collecting ducts. An collecting ducts (Figure 4, A and B). Whereas deletion of Ift20 antibody generated against mouse IFT140 (Figure 1B) does from the collecting ducts caused mislocalization of the cen- not detect any IFT140 in extracts made from cell lines derived trosome from the center of the apical end of the cell,16 deletion from experimental collecting ducts (Figure 1B), indicating that of Ift140 did not produce this phenotype, because the centro- the Ift140null2/null1 combination produces a null or strong hypo- somes remained apically positioned even in the highly cystic morphic phenotype. During interphase, IFT140 localizes prom- p20 ducts (Figure 4C). inently to the ciliary base and tip and also is found along the ciliary Increased cell proliferation is a hallmark of cystic kidney shaft (Figure 1, C and D). Ift140null2/null1 cells assembled at most diseases.5 Mouse kidneys undergo substantial postnatal devel- very short cilia that did not stain with the IFT140 antibody opment, and consequently, both experimental and control (Figure 1C). Other IFT proteins including IFT20 (Figure 1D) kidneys have relatively high levels of mitotic cells at p5;

642 Journal of the American Society of Nephrology J Am Soc Nephrol 23: 641–651, 2012 www.jasn.org BASIC RESEARCH

however, the percentage of mitotic cells is significantly higher when Ift140 is deleted (Figure 5A). Postnatal development normally completes within the first 3 weeks of life and the rate of proliferation declines, but in Ift140-deleted collecting ducts, proliferation remains high (Figure 5A). Apoptosis is normally very low in healthy kidneys but is elevated in cystic kidneys.47 Similar to published reports, we found very low numbers of cleaved caspase-3–positive cells in the collecting ductsofcontrolanimalsateitherp5or p20, and this finding was not significantly altered when Ift140 was deleted. At p20, apoptosis was observed in noncollecting duct cells, probably a result of the expanding cysts impinging on their neighbors (Figure 5B). Abnormalities in diverse signaling pathways have been implicated in renal cyst initiation or expansion.5 For example, canonical Wnt is up-regulated in many cystic kidney models and human autosomal dominant PKD.48,49 Activation of canonical Wnt signaling promotes increased nuclear accumulation of dephospho- b-catenin and transcriptional activation of Wnt-responsive target genes.49 Deletion of Ift140 increases activated dephospho- b-catenin levels in both nucleus and

for both images. (E) Kidneys from control and experimental p5 animals were stained for cilia Figure 1. HoxB7-Cre efficiently deletes the Ift140flox allele. (A) Diagram of targeting (green, 6-11B-1), collecting ducts (green, DBA), vector. Exons are displayed as boxes, whereas the coding region is shaded in black. frt, IFT140 (red), and nuclei (blue, 4’,6-diamidino- FlpE recombinase sites; loxP, Cre recombinase sites; neo, b-galactosidase-neomycin 2-phenylindole [DAPI]). Note that the DBA resistance gene fusion. (B) Affinity-purified anti-MmIFT140 detects a single band in staining is weaker than the 6-11B-1 staining protein extracts from the mouse cell lines 488 and IMCD3 but nothing in the human cell and does project in these images but was visible line hTert-RPE. This band is observed in extracts from mouse epithelial kidney (MEK) to identify collecting ducts. Arrows mark cen- cells derived from a control kidney (+/+) but not from an experimental Ift140null2/null1 trosomes in collecting ducts. Insets are three- kidney. The MEK Western was also probed with a tubulin antibody (B-5-1-2) as a loading time enlargements of cilia/centrosomes at control. (C) In interphase control primary kidney cells, IFT140 (red) is found most arrows. Size bar, 10 mm for all images. Images are strongly at the base (arrow) of the cilium (green, 6-11B-1) and is also found along the maximum projections of 13 confocal Z-images ciliary shaft and at the tip. In experimental cells (Ift140null2/null1), the cilia are very short taken 0.25 mm apart. (F) Kidneys from control or not present, and no IFT140 is associated with the remaining centrioles (arrow) or and experimental p5 animals were stained shortened cilium (arrowhead). These cells were also labeled with Dolichos biflorus for centrosomes (green, g-tubulin), collecting agglutinin (DBA) in green to mark collecting duct cells. Note that DBA staining is far ducts (green, DBA), IFT140 (red), and nuclei weaker than the 6-11B-1 staining. Asterisk marks an unidentified structure labeled by (blue, DAPI). Note that the DBA staining is the IFT140 antibody in both experimental and control cells. Scale bar, 5 mm for both weaker than the g-tubulin staining and does images. Bottom panels are three-time enlargements of the ciliary region shown as project in these images, but it was visible to merged images and green (6-11B-1) and red (IFT140) channels separately. (D) In mi- identify collecting ducts. Arrows mark cen- totic IMCD3 cells, IFT140 (green) is found in puncta in the cytoplasm but is not as- trosomes in collecting ducts. Insets are three- sociated with the spindle pole bodies (arrows). Arrowheads mark cilia stained by time enlargements of centrosomes at arrows. IFT140 in neighboring cells. In contrast, IFT20 (green) is found at the spindle pole Size bar, 10 mm for all images. Images are bodies (arrows) and in the cytoplasm. The arrowhead marks IFT20 staining the Golgi maximum projections of 13 confocal Z-images complex in a neighboring cell. In both images, red is anti–a-tubulin. Scale bar, 5 mm taken 0.25 mmapart.

J Am Soc Nephrol 23: 641–651, 2012 Ift140 Deletion and Kidney Cysts 643 BASIC RESEARCH www.jasn.org

cytoplasm (Figure 6A). To understand the relationship between cyst development and Wnt signaling, we performed a time course analysis, examining expression of genes associated with canonical Wnt signaling (Figure6B).WealsomeasuredIft140 mRNA, which was significantly reduced but not absent at all time points. This finding was expected, because mRNA was iso- lated from whole kidney; however, Ift140 was deleted only in collecting ducts. Ex- pression of Axin2 and Lef1 declined over postnatal development in both groups, with rate of decline greater in controls; therefore, both genes were significantly higher in p20 mutants. Postnatal b-catenin (Ctnnb1) expression gradually declined in control but not in mutant kidneys, result- ing in significantly elevated Ctnnb1 mRNA in mutant kidneys at p15 and p20. c-Myc and RhoU mRNAs showed a similar pattern of expression, declining significantly in both experimental and control kidneys until p10, continuing to decrease in controls at p15 and p20, and significantly rising in mutants at the latter two time points. Wnt10a expression is low in control and experimental kidneys at p0, increases in both groups up until p10, and then declines in controls over the next 10 days while continuing to increase in mutant kidneys. Wnt7a mRNA expression is very low at p0 in control and experimental kidneys, modestly increases in both groups at p5, declines significantly in controls by p20, and rises .50-fold by p20. To understand how deletion of Ift140 affects other signaling processes, selected genes from additional candidate pathways implicated in kidney development and cystic disease were examined. Although Figure 2. Deletion of Ift140 in mouse collecting ducts causes renal cysts and renal Hedgehog signaling has not been impli- failure. (A) Gross morphology of experimental kidneys (top pair) and control kidneys at p20. (B) Hematoxylin/eosin (H&E) -stained sections of control and mutant kidneys at cated in cystic disease, it plays essential p0, p5, p10, and p20. Experimental kidneys at p0 are normal except for some minor roles in kidney development and is highly 50,51 dilation of the medullary collecting ducts (arrows) but become cystic (arrows) with age. interconnected with cilia. Expression Scale bars, 200 mm for both images in a pair. (C) Mean 6 SEM individual kidney of three Hedgehog signaling effectors weights of control (open bars) and experimental (filled bars) animals at 5-day intervals Gli1, Gli2,andGli3 steadily declines in between p0 and p20. **P,0.01 versus age-matched control (5–12 animals per time postnatal control and experimental kid- point). (D) BUN levels (mean 6 SEM) in control and experimental animals at p15 and neys, although decreasing somewhat p20. n=3 animals at p15, and n=4 animals at p20 for each genotype. **P,0.01 more slowly in experimental kidneys. + , comparing control and experimental animals at each time point. P 0.05 comparing Hippo signaling has recently been impli- experimental animals between p15 and p20. cated in cystic disease,52 and expression of the Hippo-regulated gene Birc3 is elevated late in cystic disease development in Ift140- deleted kidneys. The fibrosis-associated

644 Journal of the American Society of Nephrology J Am Soc Nephrol 23: 641–651, 2012 www.jasn.org BASIC RESEARCH

Figure 3. Effects of Ift140 deletion on cilia. (A) Kidneys from control and experimental animals were stained for cilia (red, 6-11B- 1), collecting ducts (green, DBA), and nuclei (blue, DAPI) at the day of birth (p0), and postnatal days 5, 10, and 20. Arrows mark collecting ducts, and arrowheads mark ciliated nephrons near collecting ducts; cysts and dilated ducts are marked with a C. Size bar, 10 mm. Insets are four-time enlargements of areas marked by the arrow. Images are maximum projections of 16 confocal Z-images taken 0.5 mm apart. (B) IFT88 accumulates in mutant cilia. Kidneys from p5 control and experimental animals were stained for IFT88 (red), acetylated tubulin (green, cilia), DBA (green, collecting ducts), and nuclei (blue, DAPI). Size bar, 5 mm for all images in C. Images are maximum projections of 26 confocal Z-images taken 0.2 mm apart. (C) Mouse embryonic fibroblasts derived from wild-type (WT) and Ift140null2/null2 (2/2) animals were stained for acetylated tubulin (red) to mark cilia (arrows) and IFT88 (green) or IFT27 (green) Figure 4. Deletion of Ift140 does not lead to mitotic spindle along with DAPI (blue). Note that Ift140 experimental cells accu- misorientation or centrosomal abnormalities in collecting duct mulate IFT88 and IFT27 in the cilia. Size bar, 10 mmforallimages. cells. (A) In normal p5 kidney tubules, mitotic spindles (red, phospho-histone H3) typically orient parallel to the long axis of the collecting duct (green, DBA; A, left and B, open bars). The genes Ctgf and InhbA are downstream targets of Hippo signal- absence of IFT140 does not alter this relationship in p5 collecting ducts (A, right and B, filled bars). Size bar, 10 mmforallfourimages. ing, and their expression in Ift140-deleted kidneys is similarly Images are maximum projections of 15 confocal Z-images taken elevated late in disease. Consistent with increased expression of 0.5 mm apart. (B) Mitotic spindle orientation quantitation. Mitotic fi fi brosis genes, Ift140-deleted cystic kidneys were brotic, showing collecting duct cells were photographed, and the angle between increased interstitial cell smooth muscle actin staining (Figure the long axis of the tubule and the spindle was measured as 7A) and increased collagen deposition (Figure 7B). Activation depicted in the schematic diagram in left; angles were grouped of innate immunity has been described in cystic kidneys.53 into 10° bins. Inset bar graph shows circular mean mitotic spindle Expression of complement C3, which plays pivotal roles in in- orientation and the 95% confidence interval about the mean in nate immunity, is normally expressed at a very low level but is collecting ducts of control (open bars, n=41) and experimental induced .100-fold late in cystic expansion in Ift140-deleted (filled bars, n=51) kidneys. (P=0.479, NS, Kolmogorov–Smirov kidneys (Figure 6B). test). (C) Centrosome phenotypes. In normal kidneys, centrosomes (red, GTU-88) are normally found at the center of apical surface of the cell. This location is not altered when Ift140 is DISCUSSION deleted. Scale bar, 5 mm for all images in C. Images are maximum projections of three confocal Z-images taken 0.5 mm apart.

It has now well appreciated that ciliary defects lead to cystic disease and thatIFTiscritical for buildingciliaandmaintaining

J Am Soc Nephrol 23: 641–651, 2012 Ift140 Deletion and Kidney Cysts 645 BASIC RESEARCH www.jasn.org

Drosophila Ift140 produced shortened chordotonal cilia with reduced amounts of a TRPV calcium channel.23 Similarly, RNA interference-induced depletion of IFT-A proteins, including IFT140, blocked Gprotein–coupled receptor trafficking into mammalian primary cilia.27 Taken together, these findings suggest that IFT140 and other complex A proteins play additional roles in ciliary function in addition to mediating retrograde IFT. Our finding that the loss of IFT140 did not affect mitotic spindle orientation was unexpected, because the presence of aberrant mitotic spindle orientation in a number of cystic models suggested that it may be a driving force for the expansion of tubules into cysts.45 However, the presence of normally oriented mitotic spindles in Figure 5. Proliferation and apoptosis in Ift140-defective collecting ducts. (A) p5 kid- Ift140-deleted collecting ducts indicates neys labeled with phospho-histone H3 (red) and DBA (green) to identify mitotic col- that randomization of spindle orientation lecting duct cells (arrows). Size bar, 10 mm. Mitotic (phospho-histone H3-positive) cells is not a prerequisite for cystic disease. This were counted in .1000 cells from cortical collecting ducts or cortical cysts in p5 and result is similar to the work of Nishio p20 Ift140 control (open bars) and experimental (filled bars) kidneys. Bars depict mean et al.55 that found normal spindle orienta- percent 6 SEM; n=4–5 animals of each genotype and age. **P,0.01 comparing tion in Pkd1 and Pkd2 mutant kidneys be- control and experimental animals. (B) p5 and p20 kidneys labeled with cleaved caspase-3 fore cyst formation. The difference in the (red) and DBA (green) to identify apoptotic collecting duct cells (arrow). At p20, most ability of Ift20 and Ift140 mutant cells to apoptotic cells (arrows) were outside of the cysts (C). Images are maximum projections of orient their spindles may relate to our ob- fi m m three wide- eld images taken 2 m apart. Size bar, 10 m for all images in B. Apoptotic servation that, unlike IFT20 and other (cleaved caspase-3–positive) cells were counted in 1000 cells from cortical collecting complex B proteins, IFT140 does not local- ducts or cortical cysts in p5 and p20 Ift140 control (open bars) and experimental (filled bars) kidneys. Bars depict mean percent 6 SEM; n=4–5 animals of each genotype and ize to the mitotic spindle pole. Recent work age. The differences were NS (P was not ,0.05). indicated that IFT88 localizes to the spindle pole and is important in the formation of astral microtubules needed to orient the the proper signaling environment within these organelles. mitotic spindle within cells.42 If astral microtubule formation However, the role of IFT complex A proteins in cystic disease is a general function of IFT complex B proteins, it may explain was not previously known, because all of the mouse IFTmutants why Ift20-deleted cells have misoriented spindles. The absence with cystic phenotypes were in IFT complex B proteins or of IFT140 at the spindle pole suggests that this function is not molecular motors. Analysis of complex A mutants in non- likely a function for this particular protein and possibly all of vertebrates suggested that complex A proteins may not be as complex A. Another difference between IFT20 and IFT140 important to ciliary assembly as complex B proteins.12,20–26 that may contribute to the difference in oriented cell division Whereas complex B defects typically cause a complete lack of is the observation that Ift140 mutant cells still assemble a short ciliary assembly, complex A defects often present with short- ciliary remnant, whereas no ciliary remnants are seen on Ift20 ened cilia containing abnormal accumulations of protein. mutant cells. In Ift20 mutant cells, centrosome position varied These observations suggested that complex B is more impor- widely, localizing anywhere on the apical surface of cells early tant for anterograde transport of materials from the cell body in cyst development and anywhere in the cell in advanced to the cilium tip, whereas complex A is more important for cysts. In contrast, centrosome position was maintained at retrograde transport of materials from ciliary tip to cell body. the center of the apical end of Ift140 mutant cells even in This binary model overlooks the complexity of the IFTsystem. advanced cystic disease. It is possible that the short cilium Complex A and B proteins are trafficked in both directions, assembled on the Ift140 mutant cells is sufficient to properly likely as part of a large train, and retrograde transport requires position the centrosome. If the interphase centrosome posi- prior anterograde transport to deliver IFT particles to the tip of tion determines the division plane, then a short cilium may be the cilium before retrograde transport can actually occur.54 sufficient to maintain proper orientation of cell division. Moreover, two recent studies implicate complex A proteins in How then do kidney cysts form in the face of normally ori- anterograde trafficking of materials into cilia. Mutations in ented mitoses? Increased epithelial proliferation and apoptosis

646 Journal of the American Society of Nephrology J Am Soc Nephrol 23: 641–651, 2012 www.jasn.org BASIC RESEARCH

Figure 6. Altered canonical Wnt signaling and selected gene expression in collecting duct Ift140-deleted kidneys. (A) Western blot analysis of b-catenin. Control (Con) and experimental (Exp) kidneys were fractionated into cytosol and nuclear fractions and analyzed by Western blots with antibodies to b-catenin and dephosphorylated (active) b-catenin. RelB and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) are loading controls. Each lane is a different animal. (B) Quantitative PCR analysis of 12 genes in experimental (filled bars) and control (open bars) kidneys at selected postnatal times. Bars depict mean 6 SEM of 5–11 individual mouse kidneys in each treatment and age group. Gene expression data are normalized to GAPDH expression. **P,0.01, *P,0.05; Tukey HSD post hoc test. Raw data and statistical analysis of temporal changes of gene expression are included in Supplemental Tables 1–3. have been proposed to contribute to cystic expansion.5,6,56 A large unanswered question in ciliary biology and cystic Enhanced proliferation in Ift140-deleted collecting ducts disease research is what is the function of the primary cilium in must certainly play a role in the cystic expansion of these maintaining tubule architecture and preventing cyst forma- kidneys. Enhanced apoptosis is a characteristic in many tion? It is generally agreed that primary cilia are sensory or- PKD models47; however, its role in cyst expansion has not ganelles that integrate extracellular signals and regulate signal been resolved. For example, apoptosis has been posited to transduction to control cell physiology. To understand the promote cyst cavitation, trigger proliferation, or serve as a pathways influenced by the cilium, we interrogated a number line of defense against neoplastic transformation of damaged of signal transduction pathways that had been previously cells.47 However, increased apoptosis after the loss of Pax2 identified as being altered in cystic disease. Canonical Wnt/ reduced cystogenesis in pck mice.57 There was no significant b-catenin signaling is known to play a major role in kidney increase in apoptosis in Ift140-deleted collecting ducts either development and cystic disease,49 and it also influences early or late in the disease, suggesting that apoptosis itself is expression of cMyc, a master regulator of proliferation.58 not driving cytogenesis. However, it is possible that enhanced Hedgehog signaling is critical in kidney development,50 and proliferation in the absence of enhanced apoptosis is respon- in vertebrates, it is organized around the primary cilium.51 sible for the rapid cystic expansion observed in Ift140-deleted Hippo signaling regulates organ size and has recently been collecting ducts. proposed to be altered in cystic disease.52,59 Fibrosis is a

J Am Soc Nephrol 23: 641–651, 2012 Ift140 Deletion and Kidney Cysts 647 BASIC RESEARCH www.jasn.org

CONCISE METHODS

Mouse Breeding Ift140-targeted ES cell line EPD0073_5_F01 was obtained from the National Institutes of Health-supported KOMP Repository (www. komp.org)37 and injected into C57Bl/6J albino blastocysts to generate chimeric animals. Chimeric mice were mated to C57Bl/6J albino mice (B6[Cg]-Tyrc-2J/J, Jax 000058) or C57Bl/6J mice (Jax 000664), and all the animals used in this study were C57Bl/6 congenics. Embryonic ages were determined by timed mating, with the day of the plug designated embryonic day 0.5. The original allele derived from the KOMP cells was designated the Ift140neo allele. As described in Figure 1A, this allele was converted to the Ift140null1 allele by deleting exon 7 by the action of Cre recombinase expressed in the germline (C57Bl/6 Prm-Cre)64 or to the fl Ift140 ox allele by the action of FlpE expressed in the germline (C57Bl/ 6 Flp1).65 HoxB7-Cre43 was used to delete exon 7 in kidney collecting ducts, creating Ift140null2 in these specific cells. Mice with kidney collecting duct deletion of IFT140 were generated by crossing HoxB7-Cre, fl fl fl Ift140null1/+ males to Ift140 ox/ ox females. HoxB7-Cre, Ift140null1/ ox offspring mice were used as experimental animals, and HoxB7-Cre, fl Ift140+/ ox mice were used as controls. All mouse work was carried out at the University of Massachusetts Medical School and was approved by the University of Massachusetts Medical School Institutional Ani- mal Care and Use Committee. Genotyping was carriedout with the following primers: 140komp2 TCAGCCCTCTATGCCACTCT, 140komp3 CTTCCCTATGCCTT- CAGCAG, and 140komp6 TGGTTTGTCCAAACTCATCAA. The ex- pectedproductssizesare 140komp3+140komp2:WT=190bp,neo=269 bp, null1=0, flox=269 bp, and null2=0; 140komp2+140komp6: WT=0, Figure 7. Fibrosis accompanies the development of cystic dis- fl ease. (A) Interstitial cells in experimental p20 animals show in- neo=1099 bp, null1=328 bp, ox=0, and null2=0. creased staining with smooth muscle actin (arrow) compared with controls. Arrowheads depict vascular structures in both geno- Serum Chemistry types. Scale bar, 50 mm. (B) Trichrome blue staining reveals in- Blood urea nitrogenwas analyzed by a Roche Cobra Integra 400 Plus at creased collagen deposition (arrow) in experimental kidneys at the Comparative Pathology Laboratory, Baylor College of Medicine p20. Scale bar, 100 mm. (Houston, TX).

Cell Culture IMCD3 (ATCC) and 48866 cells were grown in DMEM (4.5 g/L glucose)/ 60 common feature of PKDs and intriguingly, may be linked to F12 with penicillin and streptomycin and supplemented with 5% or Hippo signaling and activation of innate immunity pathways 10% FBS, respectively. hTert-RPE cells (Clontech, Mountain View, CA) that are upregulated in cystic disease in both mouse and hu- were grown in DMEM (1.0 g/L glucose)/F12 with penicillin and strep- 53,61 mans. Although several genes showed modest elevations tomycin and supplemented with 10% FBS. early in development of cystic disease, the largest changes Primary kidney cells were generated by dispersing kidneys in came late in the development of the disease and in some cases, 0.25% Trypsin and 2.21 mM EDTA and plating in DMEM (4.5g/L were quite dramatic. It is likely that elevation of proprolifer- glucose)/F12 with penicillin and streptomycin supplemented with ative genes occurs within the rapidly dividing collecting duct 10% FBS. Stable lines were selected in the same medium supplemented fi epithelium, whereas brosis and innate immunity genes may with 150 mM NaCl and 150 mM urea.66 Primary mouse embryonic be upregulated in noncollecting cells in response to cyst for- fibroblasts were generated by dispersing embryos in 0.25% Trypsin mation. The observation that most genes are upregulated after and 2.21 mM EDTA and then plating in 90% DMEM (high glucose) initiation of cyst formation suggests a model in which ciliary and 10% FBS with penicillin and streptomycin. dysfunction does not initiate the pathways leading to cystic disease but rather, serves to restrain these pathways to prevent Immunofluorescence Microscopy disorganized cell division. This idea is consistent with the ob- Cells for immunofluorescence microscopy were grown, fixed, and servation that deletion of ciliary genes after postnatal devel- stained as described previously.40 Mouse tissues were fixed overnight opment is completed does not result in cystic disease unless at 4°C with 4% paraformaldehyde (EM Sciences, Hatfield PA) in PBS, kidney damage occurs.62,63 embedded in paraffin, and processed as described in ref. 16.

648 Journal of the American Society of Nephrology J Am Soc Nephrol 23: 641–651, 2012 www.jasn.org BASIC RESEARCH

Primary antibodies used included antitubulins (6-11B-1, GTU-88, counting the number of phosphohistone-staining cells present in at B-5-1-2; Sigma, St. Louis, MO), antiphospho-histone H3Ser10 (Upstate, least 1000 collecting duct cells) were square root transformed; then, Lake Placid, NY), anti–b-catenin (Cell Signaling, Danvers, MA), datawere analyzed byone-wayANOVAand compared using the Tukey antiactive b-catenin (clone 8E7; Upstate), anti–glyceraldehyde- compromise posthoc test (SuperANOVA; Abacus Concepts, Berkeley, 3-phosphate dehydrogenase (clone 14C10; Cell Signaling), anti-RelB CA). Gene expression data were normalized by transformation to (N-17; Santa Cruz Biotechnology, Santa Cruz, CA), antismooth muscle natural logarithms and analyzed by two-factor factorial ANOVA actin (clone 1A4; Sigma-Aldrich), and anticleaved caspase-3 (Millipore, (PASW version 18; IBM-SPSS Inc., Chicago, IL), examining the effect of Billerica, MA). Anti-MmIFT140 was made by expressing the last 356 kidney genotype and animal age; in the presence of a significant age 3 residues of the mouse protein in bacteria as a maltose binding protein genotype interaction, pairwise posthoc comparisons were made using fusion and injecting into rabbits. Antibodies were affinity-purified Tukey’sHonestlySignificant Difference test. Differences between against the same fragment expressed as a glutathione S-transferase groups were considered statistically significant if P,0.05. Circular fusion. FITC-conjugated Dolichos biflorus agglutinin (Sigma) was mean mitotic spindle orientation, circular standard deviation, and added with the secondary antibodies. AlexaFluor-labeled secondary 95% confidence intervals were calculated as previously described16 us- antibodies (Invitrogen Molecular Probes, Carlsbad, CA) were used ing the von Mises distribution followed by Kolmogorov–Smirov two- to detect the primary antibodies. sample testing to ascertain whether there was a statistically significant Wide-field images were acquired by an Orca ER camera difference in the distribution of mitotic spindle orientation angles in (Hamamatsu, Bridgewater, NJ) on a Zeiss Axiovert 200M microscope control versus experimental mice. Computations were performed using equipped with a Zeiss 1003 plan–Apochromat 1.4 numerical aperture the PMag 4.2a (Hounslow) and PASW Version 18.0 statistical software objective. Images were captured by Openlab (Improvision, Waltham, packages. Accession number for mouse IFT140 is NM_134126. MA) and adjusted for contrast in Adobe Photoshop. For comparisons made between images, the photos were taken with identical condi- tions and manipulated equally. Confocal images were acquired by a ACKNOWLEDGMENTS Nikon TE-2000E2 inverted microscope equipped with a Solamere Technology-modified Yokogawa CSU10 spinning disk confocal scan We thank William Monis, Dr. Brian Keady, and members of the head. Z-stacks were acquired at 0.5-mm intervals and converted to sin- Harvard Center for PKD research for critical comments, Drs. Stephen gle planes by maximum projection with MetaMorph software. Bright- Jones (University of Massachusetts Medical School Transgenic Mouse field images were acquired using a Zeiss Axioskop 2 Plus equipped with Core) and PaulFurcinitti (Universityof Massachusetts Medical School an Axiocam HRC color digital camera and Axiovision 4.0 acquisition Digital Imaging Core) for assistance, Dr. Paul Odgren for use of his software. bright-field microscope, and Bethany Walker for making the IFT140 antibody. Cell Fractionation and Protein Analysis Kidney cytoplasmic and nuclear extracts were prepared using the J.A.J. is a member of the Harvard Center for PKD Research (P50 CelLytic Nuclear Extraction Kit (Sigma) protocol. For Western blot DK074030). Studies were supported by National Institutes of Health analysis, proteins were separated by SDS-PAGE and electrotransferred Grant GM060992 (to G.J.P.) and the Order of the Eagles (G.J.P.). Core to Immobilon P (Millipore, Bedford, MA). After transfer, blots were resources supported by Diabetes Endocrinology Research Center blocked with Tris-buffered saline with 0.05% Tween 20 (TBST) Grant DK32520 were used. containing 5% dry milk and then incubated with primary antibodies in the same solution. DISCLOSURES mRNA Analysis None. Individual kidneys were frozen at 280°C in RNAlater (Qiagen Inc., Valencia, CA). RNA isolation, cDNA synthesis, PCR primer design, and quantitative real-time PCR were performed as described previ- REFERENCES ously16 using an ABI Prism 7500 (Applied Biosystems, Foster City, CA). PCR primers are listed in Supplemental Table 1. All quantitative 1. Berbari NF, O’Connor AK, Haycraft CJ, Yoder BK: The primary cilium – PCR reactions were performed in duplicate, and melting curves ver- as a complex signaling center. Curr Biol 19: R526 R535, 2009 fl fi fi 2. Pedersen LB, Rosenbaum JL: Intra agellar transport (IFT) role in ciliary i ed that a single product was ampli ed. Standard curves were gen- assembly, resorption and signalling. Curr Top Dev Biol 85: 23–61, 2008 erated by 10-fold serial dilutions of a pool of mutant p20 mouse 3. Satir P, Christensen ST: Structure and function of mammalian cilia. kidney cDNA, and for each gene, the threshold cycle was related to Histochem Cell Biol 129: 687–693, 2008 log cDNA dilution by linear regression analysis. Gene expression 4. Pazour GJ: Intraflagellar transport and cilia-dependent renal disease: data were normalized to glyceraldehyde-3-phosphate dehydrogenase The ciliary hypothesis of polycystic kidney disease. J Am Soc Nephrol 15: 2528–2536, 2004 expression. 5. Gallagher AR, Germino GG, Somlo S: Molecular advances in autosomal dominant polycystic kidney disease. Adv Chronic Kidney Dis 17: 118– Statistical Analyses 130, 2010 To normalize the variance, kidney weight and BUN data were 6. Harris PC, Torres VE: Polycystic kidney disease. Annu Rev Med 60: 321– logarithmically transformed, and mitotic index data (calculated by 337, 2009

J Am Soc Nephrol 23: 641–651, 2012 Ift140 Deletion and Kidney Cysts 649 BASIC RESEARCH www.jasn.org

7. Cole DG, Diener DR, Himelblau AL, Beech PL, Fuster JC, Rosenbaum 26. Iomini C, Li L, Esparza JM, Dutcher SK: Retrograde intraflagellar JL: Chlamydomonas kinesin-II-dependent intraflagellar transport transport mutants identify complex A proteins with multiple genetic (IFT): IFT particles contain proteins required for ciliary assembly in interactions in Chlamydomonas reinhardtii. Genetics 183: 885–896, Caenorhabditis elegans sensory neurons. JCellBiol141: 993–1008, 2009 1998 27. Mukhopadhyay S, Wen X, Chih B, Nelson CD, Lane WS, Scales SJ, 8. Scholey JM: Intraflagellar transport motors in cilia: Moving along the Jackson PK: TULP3 bridges the IFT-A complex and membrane phos- cell’santenna.JCellBiol180: 23–29, 2008 phoinositides to promote trafficking of G protein-coupled receptors 9. Cole DG, Snell WJ: SnapShot: Intraflagellar transport. Cell 137: 784– into primary cilia. Genes Dev 24: 2180–2193, 2010 784.e1, 2009 28. Tran PV, Haycraft CJ, Besschetnova TY, Turbe-Doan A, Stottmann RW, 10. Ou G, Koga M, Blacque OE, Murayama T, Ohshima Y, Schafer JC, Li C, Herron BJ, Chesebro AL, Qiu H, Scherz PJ, Shah JV, Yoder BK, Beier Yoder BK, Leroux MR, Scholey JM: Sensory ciliogenesis in Caenorhabditis DR: THM1 negatively modulates mouse sonic hedgehog signal trans- elegans: Assignment of IFT components into distinct modules based duction and affects retrograde intraflagellar transport in cilia. Nat on transport and phenotypic profiles. Mol Biol Cell 18: 1554–1569, Genet 40: 403–410, 2008 2007 29. Cortellino S, Wang C, Wang B, Bassi MR, Caretti E, Champeval D, 11. Follit JA, Xu F, Keady BT, Pazour GJ: Characterization of mouse IFT Calmont A, Jarnik M, Burch J, Zaret KS, Larue L, Bellacosa A: Defective complex B. Cell Motil Cytoskeleton 66: 457–468, 2009 ciliogenesis, embryonic lethality and severe impairment of the Sonic 12. Perkins LA, Hedgecock EM, Thomson JN, Culotti JG: Mutant sensory Hedgehog pathway caused by inactivation of the mouse complex A cilia in the nematode Caenorhabditis elegans. Dev Biol 117: 456–487, intraflagellar transport gene Ift122/Wdr10, partially overlapping with 1986 the DNA repair gene Med1/Mbd4. Dev Biol 325: 225–237, 2009 13. Pazour GJ, Dickert BL, Vucica Y, Seeley ES, Rosenbaum JL, Witman GB, 30. Qin J, Lin Y, Norman RX, Ko HW, Eggenschwiler JT: Intraflagellar Cole DG: Chlamydomonas IFT88 and its mouse homologue, polycystic transport protein 122 antagonizes Sonic Hedgehog signaling and kidney disease gene tg737, are required for assembly of cilia and fla- controls ciliary localization of pathway components. Proc Natl Acad gella. J Cell Biol 151: 709–718, 2000 Sci USA 108: 1456–1461, 2011 14. Murcia NS, Richards WG, Yoder BK, Mucenski ML, Dunlap JR, Woychik 31. Mill P, Lockhart PJ, Fitzpatrick E, Mountford HS, Hall EA, Reijns MA, RP: The Oak Ridge Polycystic Kidney (orpk) disease gene is required Keighren M, Bahlo M, Bromhead CJ, Budd P, Aftimos S, Delatycki MB, for left-right axis determination. Development 127: 2347–2355, 2000 Savarirayan R, Jackson IJ, Amor DJ: Human and mouse mutations in 15. Huangfu D, Liu A, Rakeman AS, Murcia NS, Niswander L, Anderson KV: WDR35 cause short-rib polydactyly syndromes due to abnormal cilio- Hedgehog signalling in the mouse requires intraflagellar transport genesis. Am J Hum Genet 88: 508–515, 2011 proteins. Nature 426: 83–87, 2003 32. Walczak-Sztulpa J, Eggenschwiler J, Osborn D, Brown DA, Emma F, 16. Jonassen JA, San Agustin J, Follit JA, Pazour GJ: Deletion of IFT20 in Klingenberg C, Hennekam RC, Torre G, Garshasbi M, Tzschach A, the mouse kidney causes misorientation of the mitotic spindle and Szczepanska M, Krawczynski M, Zachwieja J, Zwolinska D, Beales PL, cystic kidney disease. J Cell Biol 183: 377–384, 2008 Ropers HH, Latos-Bielenska A, Kuss AW: Cranioectodermal Dysplasia, 17. Marszalek JR, Ruiz-Lozano P, Roberts E, Chien KR, Goldstein LSB: Situs Sensenbrenner syndrome, is a ciliopathy caused by mutations in the inversus and embryonic ciliary morphogenesis defects in mouse mu- IFT122 gene. Am J Hum Genet 86: 949–956, 2010 tants lacking the KIF3A subunit of kinesin-II. Proc Natl Acad Sci USA 96: 33. Tsujikawa M, Malicki J: Intraflagellar transport genes are essential for 5043–5048, 1999 differentiation and survival of vertebrate sensory neurons. Neuron 42: 18. Nonaka S, Tanaka Y, Okada Y, Takeda S, Harada A, Kanai Y, Kido M, 703–716, 2004 Hirokawa N: Randomization of left-right asymmetry due to loss of nodal 34. Gilissen C, Arts HH, Hoischen A, Spruijt L, Mans DA, Arts P, van Lier B, cilia generating leftward flow of extraembryonic fluid in mice lacking Steehouwer M, van Reeuwijk J, Kant SG, Roepman R, Knoers NV, KIF3B motor protein. Cell 95: 829–837, 1998 Veltman JA, Brunner HG: Exome sequencing identifies WDR35 variants 19. Lin F, Hiesberger T, Cordes K, Sinclair AM, Goldstein LS, Somlo S, involved in Sensenbrenner syndrome. Am J Hum Genet 87: 418–423, Igarashi P: Kidney-specific inactivation of the KIF3A subunit of kinesin-II 2010 inhibits renal ciliogenesis and produces polycystic kidney disease. Proc 35. Arts HH, Bongers EM, Mans DA, van Beersum SE, Oud MM, Bolat E, Natl Acad Sci USA 100: 5286–5291, 2003 Spruijt L, Cornelissen EA, Schuurs-Hoeijmakers JH, de Leeuw N, 20. Absalon S, Blisnick T, Kohl L, Toutirais G, Doré G, Julkowska D, Tavenet Cormier-Daire V, Brunner HG, Knoers NV, Roepman R: C14ORF179 A, Bastin P: Intraflagellar transport and functional analysis of genes encoding IFT43 is mutated in Sensenbrenner syndrome. J Med Genet required for flagellum formation in trypanosomes. MolBiolCell19: 48: 390–395, 2011 929–944, 2008 36. Zaffanello M, Diomedi-Camassei F, Melzi ML, Torre G, Callea F, Emma 21. Qin H, Rosenbaum JL, Barr MM: An autosomal recessive polycystic F: Sensenbrenner syndrome: A new member of the hepatorenal fi- kidney disease gene homolog is involved in intraflagellar transport in C. brocystic family. Am J Med Genet A 140: 2336–2340, 2006 elegans ciliated sensory neurons. Curr Biol 11: 457–461, 2001 37. Austin CP, Battey JF, Bradley A, Bucan M, Capecchi M, Collins FS, Dove 22. Absalon S, Blisnick T, Bonhivers M, Kohl L, Cayet N, Toutirais G, Buisson WF, Duyk G, Dymecki S, Eppig JT, Grieder FB, Heintz N, Hicks G, Insel J, Robinson D, Bastin P: Flagellum elongation is required for correct TR, Joyner A, Koller BH, Lloyd KC, Magnuson T, Moore MW, Nagy A, structure, orientation and function of the flagellar pocket in Trypano- Pollock JD, Roses AD, Sands AT, Seed B, Skarnes WC, Snoddy J, soma brucei. JCellSci121: 3704–3716, 2008 Soriano P, Stewart DJ, Stewart F, Stillman B, Varmus H, Varticovski L, 23. Lee E, Sivan-Loukianova E, Eberl DF, Kernan MJ: An IFT-A protein is Verma IM, Vogt TF, von Melchner H, Witkowski J, Woychik RP, Wurst W, required to delimit functionally distinct zones in mechanosensory cilia. Yancopoulos GD, Young SG, Zambrowicz B: The knockout mouse Curr Biol 18: 1899–1906, 2008 project. Nat Genet 36: 921–924, 2004 24. Blacque OE, Li C, Inglis PN, Esmail MA, Ou G, Mah AK, Baillie DL, 38. Skarnes WC, Rosen B, West AP, Koutsourakis M, Bushell W, Iyer V, Scholey JM, Leroux MR: The WD repeat-containing protein IFTA-1 is Mujica AO, Thomas M, Harrow J, Cox T, Jackson D, Severin J, Biggs P, required for retrograde intraflagellar transport. MolBiolCell17: 5053– Fu J, Nefedov M, de Jong PJ, Stewart AF, Bradley A: A conditional 5062, 2006 knockout resource for the genome-wide study of mouse gene function. 25. Iomini C, Babaev-Khaimov V, Sassaroli M, Piperno G: Protein particles Nature 474: 337–342, 2011 in Chlamydomonas flagella undergo a transport cycle consisting of four 39. Deane JA, Cole DG, Seeley ES, Diener DR, Rosenbaum JL: Locali- phases. JCellBiol153: 13–24, 2001 zation of intraflagellar transport protein IFT52 identifies basal body

650 Journal of the American Society of Nephrology J Am Soc Nephrol 23: 641–651, 2012 www.jasn.org BASIC RESEARCH

transitional fibers as the docking site for IFT particles. Curr Biol 11: intraflagellar transport particle trains in situ. JCellBiol187: 135–148, 1586–1590, 2001 2009 40. Follit JA, Tuft RA, Fogarty KE, Pazour GJ: The intraflagellar transport 55. Nishio S, Tian X, Gallagher AR, Yu Z, Patel V, Igarashi P, Somlo S: Loss of protein IFT20 is associated with the Golgi complex and is required for oriented cell division does not initiate cyst formation. J Am Soc Nephrol cilia assembly. Mol Biol Cell 17: 3781–3792, 2006 21: 295–302, 2010 41. Robert A, Margall-Ducos G, Guidotti JE, Brégerie O, Celati C, Bréchot 56. Hu B, He X, Li A, Qiu Q, Li C, Liang D, Zhao P, Ma J, Coffey RJ, Zhan Q, C, Desdouets C: The intraflagellar transport component IFT88/polaris Wu G: Cystogenesis in ARPKD results from increased apoptosis in is a centrosomal protein regulating G1-S transition in non-ciliated cells. collecting duct epithelial cells of Pkhd1 mutant kidneys. Exp Cell Res J Cell Sci 120: 628–637, 2007 317: 173–187, 2011 42. Delaval B, Bright A, Lawson ND, Doxsey S: The cilia protein IFT88 is 57. Ostrom L, Tang MJ, Gruss P, Dressler GR: Reduced Pax2 gene dosage required for spindle orientation in mitosis. Nat Cell Biol 13: 461–468, increases apoptosis and slows the progression of renal cystic disease. 2011 Dev Biol 219: 250–258, 2000 43. Yu J, Carroll TJ, McMahon AP: Sonic hedgehog regulates proliferation 58. Soucek L, Evan GI: The ups and downs of Myc biology. Curr Opin Genet and differentiation of mesenchymal cells in the mouse metanephric Dev 20: 91–95, 2010 kidney. Development 129: 5301–5312, 2002 59. Habbig S, Bartram MP, Müller RU, Schwarz R, Andriopoulos N, Chen S, 44. Costantini F, Kopan R: Patterning a complex organ: Branching mor- Sägmüller JG, Hoehne M, Burst V, Liebau MC, Reinhardt HC, Benzing phogenesis and nephron segmentation in kidney development. Dev T, Schermer B: NPHP4, a cilia-associated protein, negatively regulates Cell 18: 698–712, 2010 the Hippo pathway. JCellBiol193: 633–642, 2011 45. Fischer E, Legue E, Doyen A, Nato F, Nicolas JF, Torres V, Yaniv M, 60. Norman J: Fibrosis and progression of autosomal dominant polycystic Pontoglio M: Defective planar cell polarity in polycystic kidney disease. kidney disease (ADPKD). Biochim Biophys Acta 1812: 1327–1336, Nat Genet 38: 21–23, 2006 2011 46. Saburi S, Hester I, Fischer E, Pontoglio M, Eremina V, Gessler M, 61. Zhou J, Ouyang X, Cui X, Schoeb TR, Smythies LE, Johnson MR, Guay- Quaggin SE, Harrison R, Mount R, McNeill H: Loss of Fat4 disrupts PCP Woodford LM, Chapman AB, Mrug M: Renal CD14 expression corre- signaling and oriented cell division and leads to cystic kidney disease. lates with the progression of cystic kidney disease. Kidney Int 78: 550–560, Nat Genet 40: 1010–1015, 2008 2010 47. Goilav B: Apoptosis in polycystic kidney disease. Biochim Biophys Acta 62. Davenport JR, Watts AJ, Roper VC, Croyle MJ, van Groen T, Wyss JM, 1812: 1272–1280, 2011 Nagy TR, Kesterson RA, Yoder BK: Disruption of intraflagellar transport 48. Saadi-Kheddouci S, Berrebi D, Romagnolo B, Cluzeaud F, Peuchmaur in adult mice leads to obesity and slow-onset cystic kidney disease. Curr M, Kahn A, Vandewalle A, Perret C: Early development of polycystic Biol 17: 1586–1594, 2007 kidney disease in transgenic mice expressing an activated mutant of the 63. Patel V, Li L, Cobo-Stark P, Shao X, Somlo S, Lin F, Igarashi P: Acute beta-catenin gene. Oncogene 20: 5972–5981, 2001 kidney injury and aberrant planar cell polarity induce cyst formation in 49. Merkel CE, Karner CM, Carroll TJ: Molecular regulation of kidney de- mice lacking renal cilia. Hum Mol Genet 17: 1578–1590, 2008 velopment: is the answer blowing in the Wnt? Pediatr Nephrol 22: 64. O’Gorman S, Dagenais NA, Qian M, Marchuk Y: Protamine-Cre re- 1825–1838, 2007 combinase transgenes efficiently recombine target sequences in the 50. Reidy KJ, Rosenblum ND: Cell and molecular biology of kidney de- male germ line of mice, but not in embryonic stem cells. Proc Natl Acad velopment. Semin Nephrol 29: 321–337, 2009 Sci USA 94: 14602–14607, 1997 51. Wong SY, Reiter JF: The primary cilium at the crossroads of mammalian 65. Farley FW, Soriano P, Steffen LS, Dymecki SM: Widespread re- hedgehog signaling. Curr Top Dev Biol 85: 225–260, 2008 combinase expression using FLPeR (flipper) mice. Genesis 28: 106– 52. Happé H, van der Wal AM, Leonhard WN, Kunnen SJ, Breuning MH, de 110, 2000 Heer E, Peters DJ: Altered Hippo signalling in polycystic kidney dis- 66. Pazour GJ, San Agustin JT, Follit JA, Rosenbaum JL, Witman GB: Polycystin-2 ease. J Pathol 224: 133–142, 2011 localizes to kidney cilia and the ciliary level is elevated in orpk mice with 53. Mrug M, Zhou J, Woo Y, Cui X, Szalai AJ, Novak J, Churchill GA, Guay- polycystic kidney disease. Curr Biol 12: R378 –R380, 2002 Woodford LM: Overexpression of innate immune response genes in a model of recessive polycystic kidney disease. Kidney Int 73: 63–76, 2008 54.PiginoG,GeimerS,LanzavecchiaS,PaccagniniE,CanteleF,Diener This article contains supplemental material online at http://jasn.asnjournals. DR, Rosenbaum JL, Lupetti P: Electron-tomographic analysis of org/lookup/suppl/doi:10.1681/ASN.2011080829/-/DCSupplemental.

J Am Soc Nephrol 23: 641–651, 2012 Ift140 Deletion and Kidney Cysts 651 Supplemental Table 1: qRT-PCR Primers

PCR primers were designed using online tools (http://fokker.wi.mit.edu/primer3/input.htm and http://www.idtdna.com/Scitools/Applications/Primerquest/ ) to produce 100-150 nucleotide amplicons. PCR primers were synthesized by Integrated DNA Technologies Inc (Coralville, IA).

Primer Accession Number Sequence Tm Amplicon MmAxin2Exon3for NM_027732 gacgcactgaccgacgattcca 61.5 120 MmAxin2Exon4rev attggccttcacactgcgatgc 60.7 MmBirc3Exon2for NM_007464 tgcagacacacgcagcccgtat 63.6 147 MmBirc3Exon3rev acctcagcccaccatcacagca 63.3 MmC3Exon56for NM_009778 tggtcaacatggggcagtggaa 61.4 118 MmC3Exon7Rev tccacccggacctcaaaactgg 61.5 MmCMycExon2for NM_010849 caccaccagcagcgactctgaa 61.7 125 MmCMycExon3rev tgtggcctcgggatggagatga 62.4 MmCtgfexon3for NM_010217 ggtcaagctgcctgggaaatgc 61.3 118 MmCtgfexon4rev tgggtctgggccaaatgtgtct 61.2 MmGAPDHExon3for NM_008084 gcaatgcatcctgcaccacca 61.1 138 MmGAPDHExon4rev ttccagaggggccatccaca 61.1 MmGli1Exon4for NM_010296 cccgggttatggagcagccaga 61.2 135 MmGli1Exon5rev ctggcatcagaaaggggcgaga 61.5 MmGli2Exon8for NM_001081125 agcatccccgcttggactgaca 63.2 120 MmGli2Exon9rev tctgcccagtggcagttggtct 63.2 MmGli3Exon5for NM_008130 ttgcacagcagcccatccctct 63.6 122 MmGli3Exon6rev tggcctgrcagcagagccatct 63.0 MmIft140exon6for NM_134126 ggagagaggcactggttgtggtca 62.6 117 MmIft140exon7rev ggcagcctgtcttcccactcaact 63.1 MmInhbAexon2for NM_008380 tggcaggagggccgaaatgaat 61.5 148 MmInhbAexon3rev ccacacttctgcacgctccact 61.9 MmLef1Exon3for NM_010703 ttctccacccatcccgaggaca 62.1 122 MmLef1Exon4rev acgggtgggatcccggagaaaa 62.8 MmRhoUExon2for NM_133955 tgtagatgggcggcctgtgaga 62.5 119 MmRhoUExon3rev ccacgctgaagcacagcaggaa 62.4 MmWnt7aExon3for NM_009527 gatgcccgggagatcaagcaga 61.3 122 MmWnt7aExon4rev gagcctgacacaccatggcact 61.9 MmWnt10aExon1for NM_009518 ttctgggcgctcctgttcttcc 61.7 123 MmWnt10aExon2rev caggcacactgtgttggcgttg 61.6 Supplemental Table 2: Individual means + SEM for time course analysis of gene expression and age-matched statistical comparisons

Mean + SEM for the gene expression data plotted in Figure 6B. p values for age-matched pair comparisons of gene expression, obtained using Tukey HSD post-hoc tests are shown in the right hand column.

Gene Age (days) Control +/- SEM Mutant +/- SEM p value for age-matched pair Axin2 0 1.213+0.1361 1.3541+0.1795 ns 5 1.346+0.0924 1.3538+0.0973 ns 10 1.3662+0.2676 0.9143+0.1158 ns 15 0.8677+0.1076 0.8375+0.072 ns 20 0.1366+0.0221 0.7256+0.0442 0.000 Birc3 0 0.2302+0.0389 0.2097+0.0222 ns 5 0.2844+0.0177 0.267+0.0208 ns 10 0.3316+0.0288 0.3204+0.0504 ns 15 0.2515+0.0171 0.775+0.0669 0.000 20 0.2027+0.0137 1.41+0.2048 0.000 C3 0 0.0017+0.0006 0.001+0.0002 ns 5 0.005+0.002 0.0023+0.0008 ns 10 0.0023+0.0004 0.0021+0.0003 ns 15 0.0027+0.0008 0.0603+0.0132 0.000 20 0.0022+0.0006 0.1384+0.0312 0.000 cMyc 0 0.4262+0.0352 0.5336+0.05 ns 5 0.2979+0.024 0.2994+0.0295 ns 10 0.1574+0.0089 0.1791+0.0165 ns 15 0.1589+0.0111 0.3865+0.0186 0.000 20 0.0755+0.0057 0.5829+0.0819 0.000 CTGF 0 0.4453+0.1151 0.3878+0.0599 ns 5 0.3121+0.0178 0.3174+0.0272 ns 10 0.3362+0.0224 0.4382+0.0173 ns 15 0.5417+0.0333 0.8519+0.0876 ns 20 0.5233+0.043 1.7169+0.2748 0.000 Ctnnb1 0 1.49+0.0687 1.53+0.085 ns 5 1.49+0.06 1.38+0.05 ns 10 1.24+0.103 1.04+0.056 ns 15 0.935+0.033 1.25+0.087 ns 20 0.669+0.03 1.13+0.09 0.000 Gli1 0 2.1626+0.2677 2.2727+0.2432 ns 5 1.4157+0.0818 1.3939+0.0789 ns 10 0.7644+0.0508 0.7158+0.0888 ns 15 0.6138+0.1084 0.8196+0.1397 ns 20 0.0735+0.0101 0.338+0.0575 0.000 Gli2 0 13.7688+1.4752 13.88+1.0989 ns 5 10.1314+0.8449 11.2978+0.9944 ns 10 4.7+0.4 3.2753+0.2045 ns 15 0.4973+0.0581 0.5036+0.0729 ns 20 0.076+0.0062 0.2942+0.0453 0.000 Gli3 0 1.3552+0.1823 1.8537+0.1088 ns 5 0.8464+0.0692 0.9345+0.0866 ns 10 0.3719+0.03 0.5237+0.0402 ns 15 0.2254+0.0145 0.4961+0.0939 0.000 20 0.0664+0.0026 0.5096+0.0633 0.000 Ift140 0 3.53+0.424 1.69+0.114 0.000 5 4.45+0.171 1.81+0.197 0.000 10 3.55+0.197 0.973+0.089 0.000 15 2.28+0.09 0.6973+0.0608 0.000 20 1.7+0.098 0.638+0.083 0.000 InhbA 0 0.0362+0.0033 0.0408+0.004 ns 5 0.0977+0.0088 0.0633+0.0142 ns 10 0.2809+0.0171 0.3164+0.016 ns 15 0.079+0.0124 0.3307+0.0632 0.000 20 0.0246+0.0027 0.7632+0.1063 0.000 Lef1 0 3.8131+0.4157 5.155+0.4021 ns 5 3.7452+0.4552 4.5487+0.5383 ns 10 1.2973+0.1519 1.4419+0.0875 ns 15 0.5368+0.0545 0.6086+0.0079 ns 20 0.1155+0.0071 0.4356+0.0398 0.000 Rhou 0 0.287+0.0178 0.3508+0.0194 ns 5 0.2393+0.0141 0.2219+0.0166 ns 10 0.1418+0.0149 0.1607+0.0174 ns 15 0.102+0.0169 0.3345+0.015 0.000 20 0.0572+0.0042 0.522+0.0767 0.000 Wnt7a 0 0.0705+0.0142 0.0816+0.0054 ns 5 0.1486+0.0135 0.2232+0.0322 ns 10 0.0964+0.0137 0.2312+0.0473 0.033 15 0.115+0.0203 0.8766+0.1017 0.000 20 0.0224+0.004 1.1869+0.2674 0.000 Wnt10a 0 0.0831+0.0043 0.0853+0.0101 ns 5 0.2152+0.0283 0.2059+0.0395 ns 10 0.7466+0.0583 0.6111+0.0973 ns 15 0.6383+0.0566 0.8001+0.0553 ns 20 0.0992+0.0084 0.8463+0.1262 0.000 Supplemental Table 3: Post-hoc pair wise comparisons of gene expression statistics

P values for all pairwise comparisons of gene expression data are shown. Post-hoc testing of individual data pairs was done using the Tukey HSD test. Each cell depicts the p value for the relevant pairwise gene expression mean comparison, as identified by column and row headers.

Axin2 Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.999 1.000 0.511 0.000 1.000 0.999 0.878 0.677 0.155 Control p5 0.999 --- 1.000 0.044 0.000 1.000 1.000 0.349 0.161 0.007 Control p10 1.000 1.000 --- 0.322 0.000 1.000 1.000 0.767 0.521 0.077 Control p15 0.511 0.044 0.322 --- 0.000 0.180 0.087 1.000 1.000 0.994 Control p20 0.000 0.000 0.000 0.000 --- 0.000 0.000 0.000 0.000 0.000 Mutant p0 1.000 1.000 1.000 0.180 0.000 --- 1.000 0.575 0.341 0.039 Mutant p5 0.999 1.000 1.000 0.087 0.000 1.000 --- 0.421 0.218 0.016 Mutant p10 0.878 0.349 0.767 1.000 0.000 0.575 0.421 --- 1.000 0.983 Mutant p15 0.677 0.161 0.521 1.000 0.000 0.341 0.218 1.000 --- 0.999 Mutant p20 0.155 0.007 0.077 0.994 0.000 0.039 0.016 0.983 0.999 ---

Birc3 Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.591 0.135 0.985 1.000 0.999 0.879 0.468 0.000 0.000 Control p5 0.591 --- 0.979 0.985 0.314 0.152 1.000 1.000 0.000 0.000 Control p10 0.979 0.979 --- 0.525 0.051 0.020 0.918 1.000 0.000 0.000 Control p15 0.985 0.985 0.525 --- 0.879 0.677 1.000 0.918 0.000 0.000 Control p20 0.314 0.314 0.051 0.879 --- 1.000 0.653 0.253 0.000 0.000 Mutant p0 0.152 0.152 0.020 0.677 1.000 --- 0.425 0.132 0.000 0.000 Mutant p5 1.000 1.000 0.918 1.000 0.653 0.425 --- 0.998 0.000 0.000 Mutant p10 1.000 1.000 1.000 0.918 0.253 0.132 0.998 --- 0.000 0.000 Mutant p15 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 --- 0.023 Mutant p20 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.023 ---

C3 Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.547 0.976 0.932 0.999 0.981 1.000 0.994 0.000 0.000 Control p5 0.547 --- 0.997 0.998 0.960 0.045 0.918 0.996 0.000 0.000 Control p10 0.976 0.997 --- 1.000 1.000 0.395 1.000 1.000 0.000 0.000 Control p15 0.932 0.998 1.000 --- 1.000 0.234 1.000 1.000 0.000 0.000 Control p20 0.999 0.960 1.000 1.000 --- 0.697 1.000 1.000 0.000 0.000 Mutant p0 0.981 0.045 0.395 0.234 0.697 --- 0.710 0.591 0.000 0.000 Mutant p5 1.000 0.918 1.000 1.000 0.710 0.710 --- 1.000 0.000 0.000 Mutant p10 0.994 0.996 1.000 1.000 0.591 0.591 1.000 --- 0.000 0.000 Mutant p15 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 --- 0.342 Mutant p20 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.342 ---

cMYC Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.058 0.000 0.000 0.000 0.747 0.099 0.000 1.000 0.374 Control p5 0.058 --- 0.000 0.000 0.000 0.000 1.000 0.002 0.387 0.000 Control p10 0.000 0.000 --- 1.000 0.000 0.000 0.000 0.995 0.000 0.000 Control p15 0.000 0.000 1.000 --- 0.000 0.000 0.000 0.994 0.000 0.000 Control p20 0.000 0.000 0.000 0.000 --- 0.000 0.000 0.000 0.000 0.000 Mutant p0 0.747 0.000 0.000 0.000 0.000 --- 0.000 0.000 0.377 1.000 Mutant p5 0.099 0.000 0.000 0.000 0.000 0.000 --- 0.005 0.474 0.000 Mutant p10 0.000 1.000 0.995 0.994 0.000 0.000 0.005 --- 0.000 0.000 Mutant p15 1.000 0.387 0.000 0.000 0.000 0.377 0.000 0.000 --- 0.127 Mutant p20 0.374 0.000 0.000 0.000 0.000 1.000 0.000 0.000 0.127 ---

CTGF Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.970 1.000 0.428 0.718 1.000 0.986 0.997 0.002 0.000 Control p5 0.970 --- 1.000 0.007 0.057 0.921 1.000 0.546 0.000 0.000 Control p10 1.000 1.000 --- 0.075 0.258 0.997 1.000 0.874 0.000 0.000 Control p15 0.428 0.007 0.075 --- 1.000 0.567 0.023 0.973 0.214 0.000 Control p20 0.718 0.057 0.258 1.000 --- 0.825 0.113 0.997 0.242 0.000 Mutant p0 1.000 0.921 0.997 0.567 0.825 --- 0.959 1.000 0.004 0.000 Mutant p5 0.986 1.000 1.000 0.023 0.113 0.959 --- 0.666 0.000 0.000 Mutant p10 0.997 0.546 0.874 0.973 0.997 1.000 0.666 --- 0.046 0.000 Mutant p15 0.002 0.000 0.000 0.214 0.242 0.004 0.000 0.046 --- 0.026 Mutant p20 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.026 --- Ctnnb1 Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 1.000 0.414 0.000 0.000 1.000 0.998 0.046 0.973 0.311 Control p5 1.000 --- 0.256 0.000 0.000 1.000 0.995 0.005 0.951 0.173 Control p10 0.414 0.256 --- 0.280 0.000 0.266 0.876 0.811 0.994 1.000 Control p15 0.000 0.000 0.280 --- 0.005 0.000 0.004 1.000 0.051 0.391 Control p20 0.000 0.000 0.000 0.005 --- 0.000 0.000 0.009 0.000 0.000 Mutant p0 1.000 1.000 0.266 0.000 0.000 --- 0.985 0.008 0.916 0.189 Mutant p5 0.998 0.995 0.876 0.004 0.000 0.985 --- 0.090 1.000 0.786 Mutant p10 0.016 0.005 0.811 1.000 0.000 0.008 0.090 --- 0.334 0.888 Mutant p15 0.973 0.951 0.994 0.051 0.000 0.916 1.000 0.334 --- 0.981 Mutant p20 0.311 0.173 1.000 0.391 0.000 0.189 0.786 0.888 0.981 ---

Gli1 Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.195 0.000 0.000 0.000 1.000 0.305 0.000 0.000 0.000 Control p5 0.195 --- 0.005 0.000 0.000 0.284 1.000 0.003 0.024 0.000 Control p10 0.000 0.005 --- 0.699 0.000 0.000 0.011 1.000 1.000 0.000 Control p15 0.000 0.000 0.699 --- 0.000 0.000 0.000 0.981 0.726 0.003 Control p20 0.000 0.000 0.000 0.000 --- 0.000 0.000 0.000 0.000 0.000 Mutant p0 1.000 0.284 0.000 0.000 0.000 --- 0.411 0.000 0.000 0.000 Mutant p5 0.000 1.000 0.011 0.000 0.000 0.411 --- 0.000 0.041 0.000 Mutant p10 0.000 0.003 1.000 0.981 0.000 0.000 0.006 --- 1.000 0.001 Mutant p15 0.000 0.024 1.000 0.726 0.000 0.000 0.041 0.006 --- 0.000 Mutant p20 0.000 0.000 0.000 0.003 0.000 0.000 0.000 1.000 0.000 ---

Gli2 Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.415 0.000 0.000 0.000 1.000 0.936 0.000 0.000 0.000 Control p5 0.415 --- 0.000 0.000 0.000 0.341 0.997 0.000 0.000 0.000 Control p10 0.000 0.000 --- 0.000 0.000 0.000 0.000 0.372 0.000 0.000 Control p15 0.000 0.000 0.000 --- 0.000 0.000 0.000 0.000 1.000 0.002 Control p20 0.000 0.000 0.000 0.000 --- 0.000 0.000 0.000 0.000 0.000 Mutant p0 1.000 0.341 0.000 0.000 0.000 --- 0.899 0.000 0.000 0.000 Mutant p5 0.936 0.997 0.000 0.000 0.000 0.899 --- 0.000 0.000 0.000 Mutant p10 0.000 0.000 0.372 0.000 0.000 0.000 0.000 --- 0.000 0.000 Mutant p15 0.000 0.000 0.000 1.000 0.000 0.000 0.000 0.000 --- 0.016 Mutant p20 0.000 0.000 0.000 0.002 0.000 0.000 0.000 0.000 0.016 ---

Gli3 Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.032 0.000 0.000 0.000 0.208 0.292 0.000 0.000 0.000 Control p5 0.032 --- 0.000 0.000 0.000 0.000 0.998 0.019 0.169 0.001 Control p10 0.000 0.000 --- 0.003 0.000 0.000 0.000 0.321 0.055 0.467 Control p15 0.000 0.000 0.003 --- 0.000 0.000 0.000 0.000 0.000 0.000 Control p20 0.000 0.000 0.000 0.000 --- 0.000 0.000 0.000 0.000 0.000 Mutant p0 0.208 0.000 0.000 0.000 0.000 --- 0.000 0.000 0.000 0.000 Mutant p5 0.292 0.998 0.000 0.000 0.000 0.000 --- 0.005 0.052 0.000 Mutant p10 0.000 0.019 0.321 0.000 0.000 0.000 0.005 --- 0.999 0.000 Mutant p15 0.000 0.169 0.055 0.000 0.000 0.000 0.052 0.999 --- 1.000 Mutant p20 0.000 0.001 0.467 0.000 0.000 0.000 0.000 1.000 0.962 0.962

Ift140 Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.279 1.000 0.015 0.000 0.000 0.000 0.000 0.000 0.000 Control p5 0.279 --- 0.462 0.000 0.000 0.000 0.000 0.000 0.000 0.000 Control p10 1.000 0.462 --- 0.002 0.000 0.000 0.000 0.000 0.000 0.000 Control p15 0.015 0.000 0.002 --- 0.148 0.125 0.292 0.000 0.000 0.000 Control p20 0.000 0.000 0.000 0.148 --- 1.000 1.000 0.001 0.000 0.000 Mutant p0 0.000 0.000 0.000 0.125 1.000 --- 1.000 0.001 0.000 0.000 Mutant p5 0.000 0.000 0.000 0.292 1.000 1.000 --- 0.000 0.000 0.000 Mutant p10 0.000 0.000 0.000 0.000 0.001 0.001 0.000 --- 0.260 0.018 Mutant p15 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.250 --- 0.996 Mutant p20 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.018 0.996 ---

InhbA Group Control p0 Control p5 0.000 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.297 0.000 0.758 0.966 1.000 0.942 0.000 0.000 0.000 Control p5 0.297 --- 0.001 0.998 0.010 0.742 0.983 0.001 0.000 0.000 Control p10 0.000 0.001 --- 0.000 0.000 0.000 0.000 1.000 0.998 0.065 Control p15 0.758 0.998 0.000 --- 0.076 0.987 1.000 0.000 0.000 0.000 Control p20 0.966 0.010 0.000 0.076 --- 0.702 0.242 0.000 0.000 0.000 Mutant p0 1.000 0.742 0.000 0.987 0.702 --- 1.000 0.000 0.000 0.000 Mutant p5 0.942 0.983 0.000 1.000 0.242 1.000 --- 0.000 0.000 0.000 Mutant p10 0.000 0.001 1.000 0.000 0.000 0.000 0.000 --- 1.000 0.269 Mutant p15 0.000 0.000 0.998 0.000 0.000 0.000 0.000 1.000 --- 0.525 Mutant p20 0.000 0.000 0.065 0.000 0.000 0.000 0.000 0.269 0.525 ---

Lef1 Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 1.000 0.000 0.000 0.000 0.553 0.989 0.000 0.000 0.000 Control p5 1.000 --- 0.000 0.000 0.000 0.242 0.905 0.000 0.000 0.000 Control p10 0.000 0.000 --- 0.000 0.000 0.000 0.000 0.997 0.001 0.000 Control p15 0.000 0.000 0.000 --- 0.000 0.000 0.000 0.000 0.986 0.858 Control p20 0.000 0.000 0.000 0.000 --- 0.000 0.000 0.000 0.000 0.000 Mutant p0 0.553 0.242 0.000 0.000 0.000 --- 0.980 0.000 0.000 0.000 Mutant p5 0.989 0.905 0.000 0.000 0.000 0.980 --- 0.000 0.000 0.000 Mutant p10 0.000 0.000 0.997 0.000 0.000 0.000 0.000 --- 0.000 0.000 Mutant p15 0.000 0.000 0.001 0.986 0.000 0.000 0.000 0.000 --- 0.390 Mutant p20 0.000 0.000 0.000 0.858 0.000 0.000 0.000 0.000 0.390 ---

RhoU Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.923 0.000 0.000 0.000 0.928 0.690 0.009 0.989 0.007 Control p5 0.923 --- 0.002 0.000 0.000 0.116 1.000 0.105 0.309 0.000 Control p10 0.000 0.002 --- 0.102 0.000 0.000 0.033 0.996 0.000 0.000 Control p15 0.000 0.000 0.102 --- 0.007 0.000 0.000 0.018 0.000 0.000 Control p20 0.000 0.000 0.000 0.007 --- 0.000 0.000 0.000 0.000 0.000 Mutant p0 0.928 0.006 0.000 0.000 0.000 --- 0.048 0.000 1.000 0.266 Mutant p5 0.690 1.000 0.033 0.000 0.000 0.048 --- 0.433 0.145 0.000 Mutant p10 0.009 0.105 0.996 0.018 0.000 0.000 0.433 --- 0.001 0.000 Mutant p15 0.989 0.309 0.000 0.000 0.000 1.000 0.145 0.001 --- 0.193 Mutant p20 0.007 0.000 0.000 0.000 0.000 0.266 0.000 0.000 0.193 ---

Wnt7a Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.012 0.904 0.473 0.001 0.995 0.000 0.001 0.000 0.000 Control p5 0.012 --- 0.386 0.705 0.000 0.179 0.699 0.849 0.000 0.000 Control p10 0.904 0.386 --- 1.000 0.000 1.000 0.010 0.033 0.000 0.000 Control p15 0.473 0.705 1.000 --- 0.000 0.977 0.026 0.082 0.000 0.000 Control p20 0.001 0.000 0.000 0.000 --- 0.000 0.000 0.000 0.000 0.000 Mutant p0 0.995 0.179 1.000 0.977 0.000 --- 0.003 0.013 0.000 0.000 Mutant p5 0.000 0.699 0.010 0.026 0.000 0.003 --- 1.000 0.000 0.000 Mutant p10 0.001 0.849 0.033 0.082 0.000 0.013 1.000 --- 0.000 0.000 Mutant p15 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 --- 0.998 Mutant p20 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.998 ---

Wnt10a Group Control p0 Control p5 Control p10 Control p15 Control p20 Mutant p0 Mutant p5 Mutant p10 Mutant p15 Mutant p20 Control p0 --- 0.000 0.000 0.000 0.996 1.000 0.001 0.000 0.000 0.000 Control p5 0.000 --- 0.000 0.000 0.001 0.000 1.000 0.000 0.000 0.000 Control p10 0.000 0.000 --- 0.989 0.000 0.000 0.000 0.950 1.000 1.000 Control p15 0.000 0.000 0.989 --- 0.000 0.000 0.000 1.000 0.936 0.941 Control p20 0.996 0.001 0.000 0.000 --- 0.995 0.021 0.000 0.000 0.000 Mutant p0 1.000 0.000 0.000 0.000 0.995 --- 0.001 0.000 0.000 0.000 Mutant p5 0.001 1.000 0.000 0.000 0.021 0.001 --- 0.000 0.000 0.000 Mutant p10 0.000 0.000 0.950 1.000 0.000 0.000 0.000 --- 0.858 0.865 Mutant p15 0.000 0.000 1.000 0.936 0.000 0.000 0.000 0.858 --- 1.000 Mutant p20 0.000 0.000 1.000 0.941 0.000 0.000 0.000 0.865 1.000 ---