bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1

2 A transgenic line that reports CSF1R protein expression provides a definitive marker for

3 the mouse mononuclear phagocyte system.

4

5 Kathleen Grabert2*, Anuj Sehgal1*, Katharine M. Irvine1*, Evi Wollscheid-Lengeling2, Derya

6 D. Ozdemir2, Jennifer Stables1, Garry A. Luke3, Martin D. Ryan3, Antony Adamson4, Neil E.

7 Humphreys4, Cheyenne J. Sandrock1, Rocio Rojo5, Veera A. Verkasalo6, Werner Mueller4,

8 Peter Hohenstein2, Allison R. Pettit1, Clare Pridans*6 and David A. Hume*#1.

9

10 1. Mater Research Institute-University of Queensland, Translational Research Institute,

11 Woolloongabba, Brisbane, Qld 4102, Australia

12 2. The Roslin Institute, University of Edinburgh, Easter Bush, Midlothian EH259RG, Scotland, UK.

13 3. School of Biology, University of St Andrews, North Haugh, St Andrews, Scotland, UK

14 4. Faculty of Biology, Medicine & Health, School of Biological Sciences, Manchester, M13 9PT,

15 UK

16 5. Tecnologico de Monterrey, Escuela de Medicina y Ciencias de la Salud, C.P. 64710, Monterrey,

17 N.L., Mexico

18 6. University of Edinburgh Centre for Inflammation Research, Little France, Edinburgh EH16 4TJ,

19 UK

20 # Corresponding author: [email protected]

21

22

23

1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

24 Abstract

25 The proliferation, differentiation and survival of cells of the mononuclear phagocyte system (MPS,

26 progenitors, monocytes, macrophages and classical dendritic cells) is controlled by signals from the

27 macrophage colony-stimulating factor receptor (CSF1R). Cells of the MPS lineage have been

28 identified using numerous surface markers and transgenic reporters but none is both universal and

29 lineage-restricted. Here we report the development and characterization of a novel CSF1R reporter

30 mouse. A Fusion Red (FRed) cassette was inserted in-frame with the C-terminus of CSF1R,

31 separated by a T2A-cleavable linker. The insertion had no effect of CSF1R expression or function.

32 CSF1R-FRed was expressed in monocytes and macrophages and absent from granulocytes and

33 lymphocytes. In bone marrow, CSF1R-FRed was absent in lineage-negative hematopoietic stem

34 cells (HSC), arguing against a direct role for CSF1R in myeloid lineage commitment. It was highly-

35 expressed in marrow monocytes and common myeloid progenitors (CMP) but significantly lower

36 in granulocyte-macrophage progenitors (GMP). In sections of bone marrow, CSF1R-FRed was also

37 detected in osteoclasts, CD169+ resident macrophages and, consistent with previous mRNA

38 analysis, in megakaryocytes. In lymphoid tissues, CSF1R-FRed highlighted diverse MPS

39 populations including classical dendritic cells. Whole mount imaging of non-lymphoid tissues in

40 mice with combined CSF1R-FRed/Csf1r-EGFP confirmed the restriction of CSF1R expression to

41 MPS cells. The two markers highlight the remarkable abundance and regular distribution of tissue

42 MPS cells including novel macrophage populations within tendon and skeletal muscle and

43 underlying the mesothelial/serosal/capsular surfaces of every major organ. The CSF1R-FRed mouse

44 provides a novel reporter with exquisite specificity for cells of the MPS.

45 Key words: macrophage, dendritic cell, markers, imaging, CSF1R, progenitors, myelopoiesis.

46

47

48

2 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

49 Introduction

50 The proliferation, differentiation and survival of most tissue macrophages depends upon

51 signals from the macrophage colony-stimulating factor receptor (CSF1R). Homozygous

52 recessive mutations in the receptor in mice, rats and humans lead to loss of tissue macrophages

53 and osteoclasts and pleiotropic developmental abnormalities in many organs systems

54 (reviewed in (1)). Csf1r mRNa is expressed by all resident tissue macrophages (2). The

55 transcriptional regulation of the Csf1r gene has been studied extensively as a model of

56 macrophage differentiation (3). Deletion of a conserved enhancer in the first intron (Fms

57 intronic regulatory element, FIRE) leads to selective loss of Csf1r expression in tissue

58 macrophage populations including microglia in the brain (4). Transgenic reporters containing

59 FIRE have been generated in mice (5, 6) rats (7), chickens (8, 9) and sheep (10) and in each

60 species highlight the location and abundance of macrophage populations in every organ.

61 However, there are caveats to the utility and interpretation of these Csf1r reporters. Firstly,

62 based upon the phenotype of the Csf1rFIRE/FIRE mice, we identified regulatory elements

63 outside of the transgene construct, so that the absence of reporter gene detection in particular

64 cells may be difficult to interpret (4). In the chick, we found that Kupffer cells expressed Csf1r

65 mRNA and protein but did not express the Csf1r-mApple reporter transgene (11). Conversely,

66 mouse and human granulocytes express Csf1r mRNA but do not translate the protein (12) and

67 the Csf1r promoter also has detectable activity in B lymphocytes, which share expression of

68 the transcriptional regulator PU.1 (13, 14). Accordingly, the Csf1r reporter transgenes in

69 mouse, rat and chicken were detectable in both granulocytes and B cells. In many tissues this

70 is not a major issue; the macrophages have a characteristic location and stellate morphology

71 (15, 16). But in lymphoid tissues, and mucosal surfaces and inflammatory sites, it would be

72 desirable to separate these cell types.

3 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

73 There have been a number of reports on expression of CSF1R in non-hematopoietic cells

74 including neurons and neuronal progenitors in the brain and epithelial cells in the gut and

75 kidney (17-19). In each case, the conclusion depends upon immunolocalization with poorly-

76 characterized polyclonal antibodies or conditional reporter transgenes and was not supported

77 by subsequent analyses (1). In the brain, the mouse Csf1r-EGFP reporter transgene and the

78 protein detected by anti-CD115 antibody were expressed exclusively in microglia (20, 21). A

79 further argument against functional expression of CSF1R in non-hematopoietic cells follows

80 from the complete rescue of the pleiotropic impacts of Csf1r knockouts in mice (22) by

81 postnatal adoptive transfer of wild-type bone marrow (BM) cells.

82 By contrast to surface markers such as F4/80, CD11b/c, CD163, CD68, CD169, CD64, CD206,

83 CX3CR1, LYVE1 and MHCII, which are expressed independently by subsets of tissue MPS

84 cells (2, 15), CSF1R is a potential universal marker for cells of the mononuclear phagocyte

85 system (MPS). There are available monoclonal antibodies against mouse CSF1R protein

86 (CD115). Two different antibodies have been described that block CSF1 binding to the mouse

87 receptor and can deplete tissue macrophages (23, 24). Anti-CD115 antibodies can detect cell

88 surface expression on at least some myeloid progenitors in the BM (25) and on isolated blood

89 monocytes (6) and can compete for binding of labelled CSF1 protein to tissue macrophages in

90 vivo (5). However, CSF1R protein is not readily detected on most tissue macrophages by

91 immunohistochemistry using monoclonal anti-CD115. The lack of detection is most likely a

92 consequence of competition with endogenous ligand (the available antibodies compete for

93 CSF1 binding) and the down-regulation of the receptor from the cell surface by ligand. CSF1

94 is internalized by receptor-mediated endocytosis and both receptor and ligand are degraded

95 (26). Accordingly, signaling requires continuous synthesis of new receptors. The surface

96 receptor is also subject to rapid proteolytic cleavage in response to signals that activate

97 macrophages (27, 28) and it is likely cleaved from the surface directly or indirectly during

4 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

98 tissue disaggregation to isolate macrophages. All cell isolation procedures lead to activation of

99 inflammatory genes in macrophages (2).

100 Classical dendritic cells (cDC) were originally defined by their unique ability to present antigen

101 to naïve T cells. Class II MHC+ migratory monocytes, monocyte-derived cells and subsets of

102 resident tissue macrophages also possess active antigen presentation activity (29-31). cDC and

103 monocytes share a committed progenitor in the BM that expresses CSF1R(32). cDC have been

104 classified separately from macrophages in different tissues and contexts based upon the lack of

105 certain surface markers, including CD64 (Fcgr1) and MERTK (33). One subset of mouse cDC,

106 termed cDC2, share many markers with monocytes and macrophages, including high

107 expression of Csf1r mRNA and of Csf1r reporter transgenes (5-7). cDC retain expression of

108 the growth factor receptor FLT3, co-expressed with CSF1R on progenitors (25) and lymphoid

109 tissue cDC are depleted in FLT3 or FT3L knockouts. However, CSF1R signaling can rescue

110 the impacts of Flt3 null mutation on lymphoid tissue cDC numbers (34) and CSF1 treatment

111 can expand their numbers in the spleen (35). By contrast, cDC2 in non-lymphoid tissues depend

112 upon CSF1R (36, 37) and all cells in non-lymphoid tissues expressing the Csf1r reporter

113 transgene were completely depleted by anti-CSF1R antibody (23). We were therefore

114 interested in whether DC defined by current markers express CSF1R protein.

115 In this study, we aimed to overcome the rapid turnover of surface CSF1R and ectopic

116 expression in promoter-based transgenics by integrating a reporter gene into the mouse Csf1r

117 locus. Knock-in reporters, for example in the Cx3Cr1(38) and Ccr2 loci (39) have been widely-

118 utilized in the study of macrophage biology, but in each case the endogenous gene is knocked

119 out. Although heterozygous mutation of Csf1r has no overt phenotypic impact in mouse, rat or

120 human, there is no dosage compensation (1). Given the central role of CSF1R in macrophage

121 homeostasis, a knock-out insertion is undesirable. One alternative is to insert a cassette

122 including an internal ribosome re-entry site (IRES) downstream of the stop codon. This

5 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

123 approach was used to generate a Ms4a3 locus reporter, that tags cells derived from myeloid

124 progenitors and apparently separated monocyte-derived cells from cDC in tissues (40). To

125 target microglia, Ruan et al (41) inserted a tdTomato reporter with a cleavable peptide linker

126 between the coding sequence and 3’UTR of the Tmem119 locus. Masuda et al. (42) inserted

127 the same reporter into the Hexb locus. Here we took a similar approach and inserted a Fusion-

128 Red (FRed) cassette with cleavable linker in-frame into the 3’ end of the mouse Csf1r locus.

129 Analysis of this novel line confirms that CSF1R protein expression is restricted to macrophages

130 and their progenitors and provides a universal functional marker for cells of the MPS lineage.

131 Imaging of this reporter gene provides a unique picture of the extent of the MPS in tissues.

132

6 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

133 Results

134 Development and validation of a strategy to generate a translational CSF1R reporter.

135 To overcome the limitations of the current Csf1r reporter transgenes we aimed to generate a

136 transgene that would accurately mirror protein expression. The ideal outcome would place a

137 reporter cassette in-frame with the CSF1R protein to generate a fusion protein that would mark

138 the plasma membrane and allow analysis of intracellular trafficking. We previously expressed

139 functional CSF1R from several species in transfected cells with a V5-His C terminal tag (43,

140 44) and anticipated that it could be possible to create a CSF1R-red fluorescent protein (RFP)

141 fusion. To enable double imaging with EGFP reporter lines we chose Fusion Red (FRed). This

142 protein has been tested as a fusion partner in multiple applications and has the additional

143 advantage of being resistant to photobleaching (45). A CSF1R-FRed fusion allele was

144 generated by CRISPR-mediated recombination in embryonic stem cells (ESC) and expression

145 was analyzed in ESC-derived macrophages (ESDM) as described previously (4). We

146 confirmed the successful targeting of one allele in ESC, which did not prevent the generation

147 of ESDM. However, there was no detectable FRed expression. As an alternative, we tested the

148 insertion of a cleavable linker. For this purpose, we used the T2A peptide also used in the recent

149 targeting of Hexb (42). T2A was originally identified in picornavirus (46) and enables the

150 generation of multiple protein from a single viral mRNA. 2A oligopeptides mediate ribosomal

151 skipping which appears as “self-cleavage” with stoichiometric expression of two or more

152 translation products. Self-cleaving peptide linkers have been used in multicistronic vectors in

153 vitro (47) and in vivo (48, 49). FRed was absent from transfected ESC but was detected in

154 ESDM by flow cytometry and direct imaging (not shown). On this basis we proceeded to

155 generate CSF1R-FRed mice as outlined in Figure 1.

156

7 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

157 Insertion of the FRed cassette does not compromise CSF1R expression or macrophage

158 differentiation.

159 The Csf1r knockout on the C57Bl/6 background is severely compromised and few

160 homozygotes survive to weaning (21). By contrast, the CSF1R-FRed mice were healthy and

161 fertile, and there was no apparent effect on postnatal growth or any overt phenotype in

162 homozygotes. We first confirmed that the FRed reporter was expressed in macrophages and

163 their progenitors and correlated with CSF1R expression. Figure 2 compares expression of the

164 reporter and CSF1R (CD115) in BM cells from adult WT, heterozygous and homozygous

165 CSF1R-FRed mice. In fresh BM, FRed expression was restricted to CD115+ cells (Figure 2A).

166 with the exception of a minor population of hematopoietic progenitors analysed further below.

167 In homozygotes, FRed was increased proportionate to gene dose as expected but CD115

168 expression was unaffected (Figure 2B/C). To confirm that the FRed insertion did not impact

169 CSF1R function, we cultured BM from WT, heterozygous and homozygous CSF1R-FRed

170 mice in CSF1 to generate BM-derived macrophages (BMDM). The yield of BMDM was

171 unaffected by the insertion. The FRed reporter was expressed homogeneously in BMDM from

172 heterozygous mice and around 2-fold higher in the homozygotes (Figure 2D). Unless

173 otherwise stated, all analysis in this study was carried out on CSF1R-FRed heterozygotes but

174 for some applications a homozygote might have greater utility.

175 Previous studies reported that Csf1r mRNA is first detectable is early mouse myeloid

176 precursors on which surface CSF1R was not detectable (50). CSF1R is expressed on the surface

177 of committed macrophage-dendritic (MDP) and monocyte progenitors (25). The question of

178 CSF1R expression by progenitors is key to the issue of whether CSF1 is instructive or selective

179 in lineage commitment. It has been suggested that CSF1 instructs lineage fate in HSC by

180 inducing the key transcriptional regulator PU.1 (51, 52). This proposal is difficult to reconcile

181 with the fact that Csf1r promoter activity is stringently dependent upon PU.1 (14) and with

8 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

182 analysis of progenitors by scRNA-seq (53), which associated Csf1r mRNA with committed

183 progenitors. CSF1R-FRed provides a unique marker to address this question. Aside from stem

184 cell and committed progenitors, BM contains monocytes and multiple distinct resident

185 macrophage populations (54). The results of flow cytometry on isolated BM cells are

186 summarized in Figure 3. Consistent with Csf1r mRNA expression data (50, 53), CSF1R-FRed

187 expression was not detected in HSC or MPP and present only within a small subset of Lin-

188 CD48+ and Lin-cKit+Sca1- progenitors (Figure 3A). Committed progenitors (CLP, CMP, GMP

189 and MEP) were separated based upon surface markers according to the hierarchical model of

190 Akashi et al. (55). No FRed expression was detected in CLP (Figure 3B). Surprisingly,

191 although the two populations were uniformly-positive, the CSF1R-FRed signal was

192 considerably higher in CMP than in GMP. Signal was also detected in MEP.

193 In flow cytometry analysis of lineage+ cells in BM suspensions, CSF1R-FRed was restricted

194 to Ly6Chi, CD115+ monocytes (Figure 3C). By contrast to Csf1r reporter transgenes,

195 granulocytes, that express Csf1r mRNA at high levels but do not express surface CD115 or

196 CSF1R protein detectable by Western blot (12), were CSF1R-FRedneg. Similarly, B cells did

197 not express CSF1R-FRed, indicating that CSF1R protein regulation is controlled by elements

198 outside the core Csf1r promoter and enhancer (5).

199 Resident macrophage subpopulations in BM associated with hematopoietic islands, as well as

200 osteomacs lining bone surfaces, express Siglec1 (CD169) as well as F4/80 (56) and bone-

201 resorbing osteoclasts are also CSF1R-dependent (7). Not all of these mature myeloid cells can

202 be reliably isolated using bone marrow flushing and anatomical location is needed for accurate

203 identification. To complement the flow cytometry, we stained sections of bone marrow using

204 anti-RFP antibody, CD169 and F4/80 (Figure 3D). CSF1R-FRed was detected in all F4/80+

205 and CD169+ cells forming the centre of hematopoietic islands and lining the surface of bone

206 (osteomacs) (57) and was also detected in multinucleated osteoclasts which are F4/80-. We

9 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

207 (unpublished) and others (58) have noted that Csf1r reporter transgenes are also expressed by

208 megakaryocytes and their CD41+ progenitors in adult mouse BM, but expression of CSF1R

209 protein has not been reported. The sections of BM show clear expression of CSF1R-FRed in

210 the majority of megakaryocytes in situ.

211 Peripheral blood contains two populations of blood monocytes, distinguished by the level of

212 expression of Ly6C. This is a differentiation series dependent upon CSF1R signalling. Both

213 populations clearly express Csf1r mRNA and bind anti-CD115 (23, 59), albeit at relatively low

214 levels by comparison to resident tissue macrophages (2). The Ly6Clo population had somewhat

215 higher expression of the Csf1r-EGFP transgene (23) but the two populations were not

216 distinguished by Csf1r-mApple (5). Figure 4A shows the profile of expression of CSF1R-Fred

217 in blood leukocytes. As observed in BM, there was no detectable expression of the FRed

218 reporter in lymphocytes or granulocytes whereas both monocyte populations were clearly

219 positive with expression marginally higher in the Ly6Clo population.

220 In the peritoneal cavity, the major F4/80Hi/CD115+ and minor F4/80Int/CD115+ macrophage

221 populations expressed similar levels of FRed; whereas low FRed expression was observed in

222 F4/80Int/CD115-ve cells (Figure 4B). The resident peritoneal macrophage population is very

223 sensitive to anti-CSF1R treatment (23) and was selectively depleted in a Csf1r hypomorphic

224 mutant (4). However, as in BM, homozygosity for the CSF1R-FRed allele did not affect

225 peritoneal macrophage abundance or labelling with F4/80/CD115 and the reporter expression

226 was approximately 2-fold higher in homozygotes compared to heterozygotes (Figure 4B).

227 Mononuclear phagocyte populations of lymphoid tissues.

228 The spleen contains multiple resident macrophage and dendritic cells populations in the red

229 pulp, the marginal zone (MZ), T cell areas and B cell areas (60). There is also a population of

230 undifferentiated monocytes that can be recruited to inflammatory sites (61). Lymph nodes (LN)

231 likewise contain multiple functional MPS subpopulations in the subcapsular sinus, medullary

10 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

232 sinus, medullary cords, T cell areas and germinal centres (62, 63). Many of these populations

233 lack expression of surface markers such as F4/80 and are susceptible to fragmentation during

234 tissue disaggregation (62). Figures 5A-F shows co-localization of myeloid (CD169, CD68,

235 F4/80) and lymphoid (B220, CD3) markers in section of spleen and lymph node. In the spleen,

236 there was a complete overlap with F4/80 in the red pulp. In the MZ, CD169+ metallophils

237 expressed CSF1R-Fred, as did a separate stellate population of F4/80- macrophages, the outer

238 MZ macrophages (64). Expression was excluded from B220 and CD3-positive lymphocytes.

239 Multi-lineage flow cytometry analysis of disaggregated spleen cells confirmed the expression

240 of CSF1R-FRed in Ly6Chi monocytes and exclusion from non-MPS populations (Figure 5D).

241 Isolated CD11chi/F4/80lo presumptive cDC were positive but heterogeneous for detectable

242 CSF1R-FRed; consistent with detection of cells with varying levels of the reporter in the

243 stellate interdigitating cells within the T cell areas of spleen (Figure 5B). The CSF1R-FRedlo

244 cells within T cell areas were positive for CD68 (Figure 5B).

245 Like MZ metallophils in the spleen, the majority of subcapsular sinus macrophages (SSM) in

246 LN express CD169 and lack F4/80 (63), although there is also an F4/80+ population on the LN

247 surface (65). SSM depend upon CSF1 produced locally (63). There was almost complete

248 overlap between CSF1R-FRed and CD169 in the subcapsular region, whereas F4/80 was

249 detected on only a subset of cells. CSF1R-FRed was detected on the dense population of

250 F4/80hi, CD169+ macrophages that populate the medullary sinuses (65) and was also detectable

251 on the network of F4/80-/CD169- interdigitating cells (66) found throughout T cell areas of the

252 LN. These may include the population of T zone macrophages described by Baratin et al. (67)

253 as well as cDC. In spleen and LN there were few positive cells in B cell areas and there was

254 no apparent reactivity in the so-called tingible body macrophages.

255 The intestinal wall contains multiple macrophage and DC notably the CD169hi populations

256 surrounding the crypts. All of the lamina propria populations are acutely depleted by anti-

11 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

257 CSF1R antibody, with consequent impacts on epithelial differentiation (68). Figure S1 shows

258 CSF1R-FRed expression in the small intestine. Expression was coincident with F4/80 in the

259 stellate populations of the lamina propria, but expression of FRed also provided a unique

260 marker for the abundant CSF1-dependent phagocyte population underlying the dome

261 epithelium of the Peyer’s patch which lacks expression of markers such as F4/80, CD169,

262 CD206 and CD64(69).

263 CSF1R-FRed expression in known and novel resident tissue MPS cells

264 Csf1r reporter transgenes identified an extensive network of presumptive resident macrophages

265 in every organ in the body (5, 6). Figure 6 shows representative confocal images of multiple

266 tissues from the adult CSF1R-FRed mouse highlighting the dense network of stellate interstitial

267 cells. Direct whole mount imaging of fresh tissues without fixation highlights the full extent

268 of the network of MPS cells. Detection of CSF1R-FRed provides improved visualisation of

269 less-studied macrophage populations, including the extensive network of macrophages in

270 skeletal and smooth muscle, and those of the uterus and cervix, stomach, adrenal gland, Islets

271 of Langerhans, ovary, pancreas, brown fat and thymus.

272 As a multi-copy transgene, the Csf1r-EGFP reporter is considerably brighter than CSF1R-

273 FRed. As discussed in the introduction, it has the disadvantage of expression in granulocytes

274 and B cells, but it still has significant utility for live imaging. To determine the overlap between

275 the two reporters, we crossed the CSF1R-FRed and Csf1r-EGFP lines. Recent studies have

276 identified populations of CSF1R-dependent mononuclear phagocytes underlying the liver

277 capsule and distinct from Kupffer cells (70, 71). These cells were implicated in defence against

278 infiltration of the liver by pathogens in the peritoneal cavity. The liver capsular macrophages

279 were detected using the expression of a Cd207-EGFP reporter transgene, a marker shared with

280 Langerhans cells of the skin. The Cd207-EGFP reporter transgene was not detected in the

281 capsule of other organs leading to the conclusion that the presence of these cells is unique to

12 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

282 the liver (71). A confocal Z series inwards from the liver surface confirmed the detection of

283 these cells with Csf1r-EGFP and CSF1R-FRed and the transition from the sub-capsular

284 population to classical Kupffer cells (Movie S1).

285 A similar series for the brain cortex (Movie S2) highlights the abundant macrophage

286 population of the dura mater and leptomeninges(72) and the transition to the underlying

287 network of microglia. Luo et al. (73) reported the expression of Csf1r in neurons and claimed

288 that systemic CSF1 treatment could ameliorate neuronal injury by direct signalling. Contrary

289 to that report, expression of the Csf1r-EGFP transgene is entirely restricted to microglia and

290 brain-associated macrophages (20, 21). However, there is the formal possibility that the Csf1r-

291 EGFP reporter construct lacks elements required for expression in neurons. Figure S2 shows

292 that CSF1R-FRed expression was not detectable in neurons in the dentate gyrus of the

293 hippocampus, even in CSF1R-FRed +/+ mice with additional amplification provided by anti-

294 RFP antibody.

295 The population of surface-associated or subcapsular macrophages was not restricted to the

296 liver. The CSF1R reporter transgenes enable confocal imaging of the surface of every major

297 organ of the body and reveal that surface-associated macrophages are a universal feature. The

298 relative density and stellate morphology of surface-associated macrophages is remarkably

299 consistent. In each case, a confocal Z series from the outer surface reveals transitions in

300 morphology and location of the underlying resident tissue macrophages. Movies S3-S17 show

301 Z series for the two reporters through the depth of a selection of organs including the liver,

302 lung, heart, brain, kidney, large intestine, periosteum, skeletal muscle, abdominal wall,

303 epididymis, vas deferens adrenal and bladder. There was a complete overlap with the GFP and

304 FRed reporter. Separate static and merged images of each reporter in selected tissues are shown

305 in Figure S3. In each case, the Z series highlights the way in which the polarity of the

306 macrophage spreading changes in various layers to align with the orientation of surface

13 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

307 connective tissues/serosa/mesothelial layers, underlying muscle fibres, connective tissues and

308 other structures.

309 To confirm the macrophage-restricted expression and utility for the isolation of other

310 macrophage populations, we used conventional disaggregation procedures to isolate cells from

311 liver, lung and brain and characterised the populations by Flow Cytometry (Figure 7). In each

312 organ, expression was excluded from both lymphocytes and CD45- populations. In the liver,

313 there is a complete overlap between CSF1R-FRed and F4/80 labelling of sinusoidal Kupffer

314 cells (Figure S4). In isolated cells, the expression of CSF1R-Fred increased progressively from

315 monocytes to mature TIM4+ Kupffer cells (Figure 7A) consistent with gene expression

316 analysis of this progression (74). In the lung, CSF1R-FRed was expressed by interstitial

317 monocyte and macrophage populations (Figure 7C). The expression in alveolar macrophages

318 (F4/80int/CD11blo) analysed by Flow Cytometry is obscured by very high autofluorescence and

319 the relatively low Csf1r mRNA (2). Autofluorescence is less of an issue in confocal imaging.

320 We confirmed expression in bronchial and alveolar populations and in interstitial and

321 subcapsular cells in situ (Figure 7B). In the brain, CSF1R-FRed was detected in both

322 microglia (CD45lo, CD11bhi) and brain-associated macrophages (CD45hi, CD11blo) (Figure

323 7D) and consistent with Figure S2 was absent from CD45- cells.

324

14 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

325 Discussion

326 We have described the generation and characterization of a novel CSF1R reporter mouse line.

327 The Csf1r promoter region including the conserved FIRE element has been used to drive

328 reporter transgenes and to direct expression of constitutive and tamoxifen-inducible cre-

329 recombinase and the macrophage Fas-induced Apoptosis (MaFIA) transgene for conditional

330 macrophage ablation (3). These applications have been compromised by the expression of

331 Csf1r mRNA and/or Csf1r promoter-driven transgenes in other hematopoietic cells and the

332 potential for ectopic expression in multicopy transgenes. Many other myeloid promoters and

333 target loci (e.g. Adgre1, Ccr2, Cd68, Cd169, Cd11c, Cd11b, Clec9a, Cx3cr1, Flt3, LysM,

334 Ms4a3, Tmem119, Zbtb46) have been used to drive myeloid-restricted expression of reporters,

335 cre-recombinase, diphtheria toxin receptor or other genes of interest. However, none of these

336 alternatives is expressed universally and exclusively at the mRNA or protein level in all cells

337 of the MPS (2). The CSF1R-FRed reporter mouse overcomes the confounding issues,

338 providing a specific and robust MPS reporter for a large range of technical applications.

339 One future application of the Csf1r-FRed allele lies in study of the transcriptional regulation

340 of the Csf1r locus. Deletion of the FIRE enhancer within intron 2 of Csf1r led to the loss of

341 expression in monocytes and various tissue macrophages, including microglia, whereas other

342 macrophage populations were unaffected. These impacts could only be assessed in

343 homozygous mutant mice by the loss of the affected cell population (4). Several candidate

344 enhancers other than FIRE have been identified in the Csf1r locus (4). Their role may be

345 assessed by targeted deletion in CSF1R-FRed mice and analysis of expression of the mutated

346 allele on a heterozygous Csf1r WT background.

347 From a purely technical viewpoint, the outcome establishes the feasibility of inserting any

348 desired expression cassette (e.g. other reporters, gene of interest, Cre, DTR) into the mouse

349 Csf1r locus to achieve MPS-restricted expression without disrupting expression or function of

15 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

350 CSF1R protein. We have bred the Csf1r-FRed allele to homozygosity and there is no detectable

351 impact on viability, growth, monocyte-macrophage abundance, surface markers (e.g. F4/80)

352 or the expression of CSF1R on the cell surface (Figure 3). Accordingly, for many applications

353 CSF1R-FRed can be maintained as a homozygous line and conveniently crossed to other

354 reporters (as exemplified by the cross to the Csf1r-EGFP reporter). We note also that the FRed

355 reporter is expressed in macrophages of homozygotes at around twice the level in

356 heterozygotes increasing the signal and allowing convenient breeding (Figures 3, 5). It is not

357 self-evident that this would be the case, since the expression of Csf1r mRNA is regulated by

358 CSF1R signals and the expression from the two alleles might be coordinated (75). The

359 reciprocal observation is that in heterozygous Csf1r knockout mice and rats, there is no dosage

360 compensation and both Csf1r mRNA and protein are reduced by 50% on monocytes and

361 macrophages (1). It appears therefore that Csf1r alleles are regulated independently of each

362 other.

363 The expression of CSF1R-FRed in BM accords with other evidence that Csf1r mRNA is absent

364 from HSC and induced during lineage commitment downstream of expression of lineage-

365 specific transcription factors (50, 53). The large majority of lineage-negative, CD115+ cells in

366 BM are in cell cycle (25). The lack of detectable CSF1R-FRed in HSC is not compatible with

367 the proposal that CSF1 acts directly on HSC to instruct myeloid lineage commitment via

368 induction of PU.1 (52). These studies relied on detection of Csf1r in HSC by qRT-PCR and

369 did not detect the CSF1R protein. The reported effects of CSF1 on PU.1 expression in isolated

370 HSC were small and significant numbers of PU.1-expressing cells arose spontaneously even

371 in the absence of added CSF1. Accordingly, we favour a selective model of CSF1 action.

372 Interestingly, although CSF1 administration can induce a substantial monocytosis, CSF1R

373 signaling is not absolutely required for monocyte production. Anti-CSF1R antibody treatment

374 of mice depleted tissue macrophages but had no effect on the blood monocyte count (23, 24)

16 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

375 and mutation of the Csf1r FIRE enhancer ablated expression in BM and blood monocytes

376 without impacting abundance or phenotype of these cells (4). CSF1R-FRed was more highly-

377 expressed and somewhat heterogeneous within CMP compared to GMP as defined using CD32

378 as a marker (55). Several recent studies question the hierarchical model of myelopoiesis in

379 which CMP give rise to GMP. They indicate that CD115hi monocyte-DC progenitors (MDP)

380 (32) and committed monocyte progenitors (25) may both reside within the CMP fraction of

381 BM ((76) and references therein). Conversely, Kwok et al. (77) dissected the GMP populations

382 to reveal a predominance of CD115lo committed neutrophil progenitors consistent with low

383 expression of CSF1R-FRed in this fraction (Figure 3B) and the fact that granulocyte express

384 Csf1r mRNA but do not translate the protein (12).

385 One novel finding in the BM was the expression of CSF1R in megakaryocytes (Figure 3D).

386 Expression profiling of mouse megakaryocyte differentiation in vitro revealed high expression

387 of Csf1r mRNA which declined in the most mature population (78). This conclusion is

388 consistent with detection of CSF1R-FRed in the MEP population (Figure 3C). The functional

389 importance of CSF1/CSF1R in megakaryocyte biology is unknown. In humans, CSF1R is

390 commonly deleted in 5q- syndrome, which is associated with thrombocytopenia (79) but

391 homozygous mutation in CSF1R in rats or humans had no impact on platelet count (80, 81).

392 Conversely, in humans, mice and pigs, CSF1 administration causes a rapid fall in platelet count

393 (82-85). In mice, this drop resolved with a significant overshoot, even with continued CSF1

394 treatment, associated with alterations in megakaryocyte ploidy (83). CSF1-induced

395 thrombocytopenia was attributed to reduced circulating half-life; the possibility that CSF1

396 might also drive the rebound was not excluded.

397 Classical DC in spleen, LN and also in Peyer’s patches form a dense network of interdigitating

398 cells within the T cell areas (66). The Csf1r-EGFP transgene was expressed by interdigitating

399 cells in spleen and LN T cells areas and by CD11chi DC isolated from spleen and lymph node

17 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

400 and surface CD115 was detected on a subset of these cells (35). The level of Csf1r mRNA also

401 distinguishes CD8+ (cDC1) and CD8- DC isolated from spleen (BioGPS.org, Immgen.org) and

402 cDC1 (XCR1+, CD103+) from cDC2 (CD11b+) in multiple large RNA-seq datasets (2), with

403 relatively higher expression by cDC2. CSF1R-FRed was detected at varying levels in isolated

404 CD11chi spleen DC and may provide a subset marker (Figure 6). Given the extensive

405 ramification of the interdigitating cells within T cell areas, it is likely that they are under-

406 represented in populations obtained by enzymic disaggregation. The expression of CSF1R-

407 FRed is consistent with evidence that cDC in lymphoid tissues can be regulated by CSF1R

408 signals (34, 35).

409 Other macrophage populations in spleen and LN that have not been isolated by tissue

410 disaggregation include those of the MZ and subcapsular sinus (SCS). We co-localised CSF1R-

411 FRed with F4/80 (which is excluded from the marginal zone and T cell areas) and CD169

412 (expressed by both MZ and SCS macrophages) (Figure 5). CSF1R-FRed was detected in red

413 pulp (F4/80hi) and marginal zone (CD169+, F4/80-) macrophages. Unexpectedly, CSF1R-FRed

414 was undetectable in the large tingible-body macrophages in germinal centres which do express

415 Csf1r-EGFP but are CSF1R-independent (23). These cells express CD68 and MERTK, which

416 is required for apoptotic B cell uptake (86). Unlike follicular DC they are BM-derived (87) but

417 they also lack other myeloid markers including IBA1 and F4/80 (88, 89).

418 Flow cytometry analysis and imaging of multiple tissues confirms that, like Csf1r mRNA,

419 CSF1R-FRed is expressed throughout the MPS. By contrast to previous reports (73, 90, 91)

420 we found no evidence of CSF1R protein expression in brain neuronal cells or epithelial cell

421 populations in intestine or kidney. Accordingly, the numerous pleotropic impacts of CSF1R

422 mutations and kinase inhibitors in humans and experimental animals can be attributed entirely

423 to indirect consequences of MPS cell deficiency (reviewed in (1).

18 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

424 In non-lymphoid tissues, there was a complete overlap of CSF1R-FRed with Csf1r-EGFP,

425 supporting the utility of this transgenic marker (Figure S3). Not surprisingly, as a multi-copy

426 transgene the signal from Csf1r-EGFP is generally much brighter than CSF1R-FRed, but the

427 signal intensities are not perfectly correlated. There are cells in several of the tissues analyzed

428 that appear more red than green, perhaps reflecting the fact that the transgenic reporter does

429 not contain all the Csf1r regulatory elements (4). Both transgenes viewed in unfixed fresh

430 tissues highlight the full extent of the MPS network in every tissue. Csf1r mRNA is readily

431 detected in total mRNA from all the organs shown at levels around 10% of that detected in

432 BMDM (92) so the density of these cells is not surprising. Within tissues, CSF1R-FRed+/Csf1r-

433 EGFP+ cells appear spread on surfaces such as epithelial and endothelial basement membranes

434 and muscle and connective tissue fibres. Both reporters highlighted the so-called tenophages

435 recently identified in tendon (93). The localization of CSF1R-FRed/Csf1r-EGFP confirmed the

436 existence of surface-associated macrophages underlying the serosa and spread in the plane of

437 the capsule in every major organ. They include the heterogeneous population of macrophages

438 associated with the dura mater of the brain, previously characterized using CX3R1, MHCII,

439 CD169, IBA1 and CD11c (72) and recently isolated and profiled as a distinct population from

440 microglia (94). Conversely, the dense subcapsular macrophage population of the lung was not

441 recognized or characterized in studies of interstitial macrophage heterogeneity (95). These

442 surface-associated macrophage populations present in every organ were identified in the

443 original studies of the localization of the F4/80 antigen (reviewed in (15)) but are not readily

444 visualized in cross section. It remains to be determined whether they have organ-specific innate

445 immune or homeostatic functions or share phenotypes with the cells identified in the liver (70,

446 71).

447 One location where the abundance of resident macrophages has been under-appreciated is

448 muscle. The macrophages of the smooth muscle of the intestinal muscularis have been

19 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

449 attributed functions in interactions with enteric neurons and the control of peristalsis and gut

450 motility (96). Whole mount imaging of these cells with the CSF1R-FRed and Csf1r-EGFP

451 reporter reveals their abundance within the myenteric plexus, the way in which they spread

452 along the muscle fibres, and change polarity between the longitudinal and circular muscle

453 layers. The same transitions are evident in layers of smooth muscle in large intestine,

454 abdominal wall, diaphragm, uterus/cervix, vas deferens and bladder as well as cardiac muscle

455 (Figures 6A, 6E, 6L, 6M; Movies S4, S8, S9, S12, S17). By contrast, there is very limited

456 literature on macrophages in skeletal muscle, where CSF1R-FRed-positive cells are at least as

457 abundant as in smooth muscle, with the same regular spacing along the muscle fibres (see

458 Figures 6R-T; Movie S7). Previous studies using immunohistochemical markers (CD11b,

459 F4/80, CD45) identified abundant resident macrophage-like populations in the epimysium and

460 perimysium (the external muscle envelope), but rarely detected positive cells in the

461 endomysium (the thin layer between muscle fibres) (97). We suggest this is a reflection of their

462 extensive spreading, and detection further compromised by fixation (which causes the

463 macrophages to contract) and sectioning (which tears them from the muscle fibres). Standard

464 methods of tissue disaggregation yield very few macrophage-like cells from undamaged

465 muscle. The resident tissue macrophages in muscle are well-positioned to interact with satellite

466 cells and the neuromuscular junctions and to contribute similar regulatory, homeostatic and

467 remodelling functions to resident macrophages identified in the heart and vascular smooth

468 muscle (98-100) that were also readily visualized with CSF1R-FRed and Csf1r-EGFP.

469 The locations occupied by tissue macrophages have been referred to as niches or territories.

470 The concepts differ depending on whether the precise location is physically defined (a niche)

471 or macrophages define their own territory by mutual repulsion (16, 101). The regular spacing

472 in every location (Figure 6) supports the territory concept. The two concepts are compatible if

473 a niche exists on a macroscopic scale (e.g. a particular surface) and macrophages determine

20 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

474 their density within the niche. Almost universal expression of semaphorins and their receptors

475 (known regulators of cell motility) (2) in isolated tissue macrophages from all organs provides

476 at least one possible mechanism for communication between resident macrophages.

477 In summary, we have produced a novel transgenic line that provides a specific and ubiquitous

478 marker for MPS cells and highlights their distribution in every organ of the body. Given the

479 abundance of these cells, it is not surprising that their depletion in CSF1R-deficient mice, rats

480 and humans has profound impacts on postnatal growth and development (1).

481

21 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

482 Materials and Methods

483 Generation of Csf1r-T2A-FusionRed mice

484 We used CRISPR-Cas9 to generate CSF1R C-terminally tagged with a T2A-FusionRed

485 reporter gene. The overall strategy is shown in Figure 1. Two sgRNA targeting the STOP

486 codon of Csf1r were selected using the Sanger WTSI website

487 (http://www.sanger.ac.uk/htgt/wge/). Guides present elsewhere in the genome with mismatch

488 (MM) of 0, 1 or 2 were discounted, MM3 were considered if predicted off targets were not

489 exonic. sgRNA sequences (aactaccagttctgctgaag-tgg and actaccagttctgctgaagt-ggg) were

490 purchased as crRNA oligos, which were annealed with tracrRNA (both oligos supplied IDT;

491 Coralville, USA) in sterile, RNase free injection buffer (TrisHCl 1 mM, pH 7.5, EDTA 0.1

492 mM). 2.5 µg crRNA was combined with 5 µg tracrRNA, heated to 95 °C, then allowed to

493 slowly cool to RT.

494 For the donor repair template we used the EASI-CRISPR long-ssDNA strategy (102) which

495 comprised the FusionRed gene with cleavable T2A linker flanked by 136 nt and 139 nt

496 homology arms. The lssDNA donor was generated using Biotinylated PCR from a dsDNA

497 template, followed by binding to Streptavidin beads and on-bead denaturation to remove the

498 bottom strand of DNA. The top, single stranded DNA was then cleaved off the column by

499 hybridizing a short oligo at the 5’ end to reform a KpnI restriction site and subjected to

500 restriction digestion.

501 For embryo microinjection the annealed sgRNA was complexed with Cas9 protein (New

502 England Biolabs) at RT for 10 min, before addition of long ssDNA donor (final concentrations;

503 sgRNA 20 ng/µL, Cas9 protein 20 ng/µL, lssDNA 10 ng/µL). CRISPR reagents were directly

504 microinjected into C57BL/6JOlaHsd zygote pronuclei using standard methods (103). Zygotes

505 were cultured overnight and the resulting 2 cell embryos surgically implanted into the oviduct

506 of day 0.5 post-coitum pseudopregnant mice. Potential founder mice were screened by PCR,

22 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

507 first using primers that flank the homology arms and sgRNA sites (Geno F2

508 ccaccccaggactatgctaa and Geno R2 ctagcactgtgagaacccca), a reaction which both amplifies the

509 WT band (394 bp), any InDels that result from NHEJ activity and larger products (1153 bp)

510 indicating HDR (Figure 1). Pups with a larger band were reserved, the band isolated and

511 amplified again using high fidelity Phusion polymerase (NEB), gel extracted and subcloned

512 into pCRblunt (Invitrogen). Colonies were mini-prepped and Sanger sequenced with M13

513 Forward and Reverse primers. Pups showed perfect sequence integration after alignment of

514 sequence traces to predicted knock-in sequence and bred with a WT C57BL/6JOlaHsd to

515 confirm germline transmission and establish the colony. The founders were subsequently

516 transferred to SPF facilities in Edinburgh and Brisbane by rederivation and crossed to the

517 C57BL/6JCrl background.

518 Tissue collection for imaging and disaggregation for flow cytometry analysis

519 Peripheral blood (100 µL) was routinely collected into EDTA tubes by cardiac puncture

520 following euthanasia. Blood was subjected to red blood cell lysis for 2 min in ACK lysis buffer

521 (150 mM NH4Cl, 10 mM KHCO3, 0.1 mM EDTA, pH 7.4) and resuspended in flow cytometry

522 (FC) buffer (PBS/2 % FBS) for staining. Peritoneal cells were recovered by lavage with 10 mL

523 PBS. Following lavage tissues of interest were removed for disaggregation and imaging.

524 Tissues for imaging were stored in PBS on ice and imaged within 2 h.

525 Liver and brain tissues for disaggregation were finely chopped in digestion solution containing

526 1 mg/mL Collagenase IV, 0.5 mg/mL Dispase (Worthington) 20 µg/mL DNAse1 (Roche) and

527 placed on ice until further processing (~1 g tissue/10 mL). Tissues in digestion solution were

528 placed on a rocking platform at 37°C for 45 min prior to mashing through a 70 µm filter

529 (Falcon). For liver and brain Percoll density gradient centrifugation was used to isolate the non-

530 parenchymal fraction, as previously described (4, 5). Cell isolation from BM, spleen and lymph

23 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

531 node (LN) was carried out as described (54). 5 X 106 cells were stained for flow cytometry

532 analysis and 1-2 x 106 cells were acquired for analysis.

533 Flow cytometry

534 Cell preparations were stained for 45 min on ice in 2.4.G2 hybridoma supernatant to block Fc

535 receptor binding. Myeloid populations were stained using antibody cocktails (54) comprising

536 combinations of CD45-BV421, F4/80-AF647, Cd11b-BV510, Cd115-BV605, Ly6G-BV785

537 or APC-Fire750, Tim4-PECy7, Ly6C-PB or BV785, B220-APCCy7 or BUV496, TER119-

538 BUV395 and CD3-PE-Cy5 (Biolegend). Hematopoietic stem and progenitor cells were stained

539 using a standard antibody cocktail comprising of Lineage-BV785 (CD3-, CD45R-, CD41-,

540 CD11b-, GR1- and TER119-biotin followed by streptavidin-BV785), cKIT-APC, SCA-1-PE-

541 Cy7, CD150-BV650, CD48-BV421 and CD115-BV605 (Biolegend). Myeloid and lymphoid

542 progenitors were stained for using an antibody cocktail comprising of Lineage-BV785 (CD3-,

543 CD45R-, CD11b-, GR1- and TER119-biotin followed by streptavidin-BV785), c-KIT-APC,

544 SCA-1-PE-Cy7, CD34-PerCP-Cy5.5, CD16/32-BV421, FLT3-APC-Cy7. Cells were washed

545 twice following staining and resuspended in FC buffer containing 7AAD (Life Technologies)

546 or FVS700 (BD Bioscience) for acquisition using a Cytoflex (Beckman Coulter) or Fortessa

547 (Becton Dickinson). Relevant single-color controls were used for compensation and unstained

548 and fluorescence-minus-one controls were used to confirm gating strategies. Flow cytometry

549 data were analyzed using FlowJo 10 (Tree Star). Live single cells were identified for

550 phenotypic analysis by excluding doublets (FSC-A > FSC-H), 7AAD+ or FVS700+ dead cells

551 and debris. Gating strategies for each of the analyses in this study are shown in Figures S5, S6

552 and S7.

553 Confocal microscopy and immunofluorescence.

554 All immunofluorescent images were acquired on the Olympus FV3000 microscope (Olympus

555 Corporation) and FLUOVIEW software (Olympus Corporation). To prepare tissues for

24 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

556 immunofluorescent staining: spleens, LN, livers and lungs were snap frozen in liquid nitrogen,

557 and bones were first fixed in 4% paraformaldehyde. Bones were then further decalcified in

558 14% EDTA over 3 weeks with several changes before sucrose saturation in 15-30% sucrose

559 gradient over 2 days. All tissues were then embedded in Optimal cutting temperature

560 compound (ProSciTech) and cut at 5 µm thickness. FusionRed in the bones was stained for

561 using Rabbit anti-RFP antibody (Abcam ab62341). Cell specific staining for macrophage

562 phenotypic markers was performed using a monoclonal Rat anti-F4/80 (Abcam) or directly

563 conjugated anti-CD169-AF488 or anti-CD68-AF647 (both Biolegend). B cells and T cells were

564 detected using anti-B220-AF488 (Biolegend) and anti-CD3-AF647 respectively (BD

565 Bioscience). Unconjugated primary antibodies were detected with fluorescently labeled

566 species appropriate secondary antibodies including Goat Anti-Rabbit IgG (H+L) Alexa Fluor

567 594 (ThermoFisher Scientific) and Goat Anti-Rat IgG (H+L)- Alexa Fluor 647 (ThermoFisher

568 Scientific). All sections of bone, spleen, LN, liver, lungs and brain images were acquired with

569 a 200x magnification objective using the multi-area tile scan function. For direct imaging of

570 wholemount tissues, tissues were left as undisturbed as possible for direct imaging through the

571 tissue surface. For tissues with reduced laser penetration (such as spleen or kidney) tissues were

572 trimmed to a relative thickness of 2 mm and imaged from the surface in. The Z-stack function

573 of the software was used to acquire a greater depth of field. For wholemount imaging of small

574 intestine, 1 mm pieces of small intestine were fixed for 1 h in BD Cytofix/Cytoperm buffer

575 before staining with a rat anti-F4/80 monoclonal (Abcam). Secondary staining was performed

576 using an anti-rat AF647 (ThermoFisher Scientific) and B cells were stained using anti-B220-

577 AF488 (Biolegend). CSF1R-FRed signal was acquired using the 561-diode laser and Csf1r-

578 EGFP or AF488 was acquired using the 488-diode laser both on the FV3000 main combiner

579 (FV31-MCOMB). For DAPI or AF647, signal was acquired using the 405- and 633-diode

580 lasers respectively on the FV3000 main combiner (FV31-MCOMB).

25 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

581

582 Acknowledgments

583 This work was supported by the Medical Research Council (MRC) UK grant MR/M019969/1

584 and by Australian National Health and Medical Research Council (NHMRC) grant

585 GNT1163981 to DAH. DAH receives core support from The Mater Foundation. RR was

586 supported by a doctoral scholarship (application number: 314413, file number: 218819)

587 granted by CONACyT Nuevo Leon—I2T2, Mexico. PH was supported by the biotechnology

588 and biological sciences research council (BBSRC) grant BB/P013732/1. DDO was supported

589 by MRC grant MR/M010341/1. We acknowledge support from the Microscopy and Cytometry

590 facilities of the Translational Research Institute (TRI). TRI is supported by the Australian

591 Government.

592

26 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

593 Legends to Figures

594 Figure 1. Design and generation of CSF1R-FRed transgene.

595 Panel A shows the schematic of the insertion of T2A-Fusion Red into the mouse Csf1r locus with the guides

596 and overall strategy as described in Materials and Methods. Panel B shows the location of the PCR primers

597 and Panel C the detection of 3 independent founders with the desired insertion which was sequence verified.

598 Figure 2. Expression of CSF1R-FRed in bone marrow (BM) and bone marrow-derived macrophages

599 (BMDM).

600 Panel A shows the relationship between CSF1R-FRed and surface CSF1R (CD115) on unfractionated BM

601 cells from adult mice in WT (C57Bl/6 control), heterozygous (FRed +/-) and homozygous FRed (+/+) mice.

602 Panel C shows histograms of the same profiles, with fill profile WT, dotted line (FRed +/-) and filled line

603 FRed (+/+). Note that the expression of the two markers is correlated and there is a right shift in FRed in the

604 homozygote. In Panel C, BMDM were grown from WT, FRed +/- and FRed +/+ BM cells as described in

605 Materials and methods. The cells were harvested after 7 days.

606 Figure 3. Expression of CSF1R-FRed in bone marrow.

607 Femoral bone marrow cells were harvested from adult wildtype and CSF1R-FRed +/- mice and analysed by

608 flow cytometry using the markers indicated and gating strategies shown in Figure S5 and Figure S6. Panel

609 A shows the defined stem cell populations, Panel B the committed progenitors and Panel C the mature

610 leukocytes. In each case, the grey profile is the non-transgenic control and the red profile is the CSF1R-

611 FRed mouse. The results are representative of three mice of each genotype. Panel D shows the localization

612 of CSF1R-FRed in femoral bone marrow. Bone was fixed and decalcified as described in Material and

613 Methods and stained for each of the markers shown. CSFR-FRed was detected using anti-RFP antibody.

614 The staining highlights expression of CSF1R-FRed in F4/80+/CD169+ resident macrophages within

615 hematopoietic islands and on the periosteal surface, and in megakaryocytes (MGK) and F4/80-/CD160-

616 osteoclasts (OC).

617 Figure 4. CSF1R-FRed expression in peripheral blood and peritoneal cavity leukocytes.

618 Panel A. Peripheral blood leukocytes were isolated from WT and CSF1R-FRed +/- mice and analysed by

619 Flow Cytometry using gating strategies shown in Figure S7. Red histogram show expression in the CSF1R-

27 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

620 FRed mice. Panel B. Peritoneal lavage cells were isolated from WT, FRed +/- and FRed +/+ and separated

621 into 4 populations based upon F4/80 and CD115 as shown. Note the increased expression in FRed +/+ mice.

622 Figure 5. CSF1R-FRed expression in spleen and lymph node.

623 Spleens and inguinal lymph nodes were harvested from adult wild-type and CSF1R-FRed +/- and fixed and

624 sectioned as described in Materials and Methods. Part of the spleen was disaggregated for Flow Cytometry.

625 CSF1R-FRed was detected with anti-RFP antibody in combination with the markers indicated. Panel A and

626 insets highlight the expression of CSF1R-FRed in F4/80+ red pulp macrophages, F4/80-, CD169+ marginal

627 zone metallophils and F4/80-, CD169- marginal zone macrophages. Panel B highlights CSF1R-FRed+ cells

628 within T cell areas (excluded B220) and the overlaps with CD68. Panel C and inserts show the exclusion of

629 CSF1R-FRed from CD3+ T cells and B220+ B cells in the red pulp but the potential for interactions amongst

630 the 3 cell types. Panel D shows representative FACS profiles for WT and CSF1R-FRed spleen (red

631 histograms) separated based upon the gating strategy in Figure S7.

632 Panel E shows identifies CSF1R-FRed expression in CD169-, F4/80- interdigitating cells in T cell areas (nset

633 (i)), CD169+, F4/80- subcapsular sinus macrophages (inset (ii)), and CD169+, F4/80+ medullary sinus

634 macrophages in the lymph node. Colocalisation in Panel F with B220 and CD68 further highlights

635 interdigitating cells in T cell areas (inset (i)) and intimate interaction with B cells in the medullary

636 cords/sinuses (insets (ii) and (iii)).

637 Figure 6. Imaging of macrophages in adult organs using CSF1R-Fred

638 Tissues were removed from adult CSF1R-FRed +/- mice and placed on ice in PBS. They were imaged

639 directly within 2-3 hours using the Olympus FV3000 microscope. Images show maximum intensity

640 projections of the tissues indicated. Many of these tissues can also be visualized as Z series in

641 Supplementary movies S1-S20. Scale bar is 100m.

642 Figure 7. Expression of CSF1R-FRed in liver, lung and brain.

643 Leukocytes were isolated from liver (A), lung (C) and brain (D) following tissue disaggregation as described

644 in Materials and Methods and analysed by Flow Cytometry for expression of the indicated markers. The

645 gating strategies are shown in Figure S7. Note in Panel (C) that alveolar macrophages have high levels of

646 autofluorescence which may obscure a FRed signal. To confirm expression in lung macrophage populations,

28 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

647 Panel B shows localization of CSF1R-FRed in unfixed sections lung. Inserts highlight four CSF1R-FRed+

648 populations distinguished by location and morphology. Scale bars

649 Supplementary Materials

650 Figure S1. Colocalization of CSF1R-Fred and markers of macrophages, B cells and T cells in small

651 intestine and Peyer’s patch.

652 Figure S2. Colocalization of CSF1R-FRed and neuronal markers (NeuN, Tubulin 3) in hippocampus

653 Figure S3. Comparative localization of EGFP and FRed in CSF1R-FRed/Csf1r-EGFP mice.

654 Figure S4. Colocalization of CSF1R-FRed and F4/80 in liver.

655 Figure S5. Gating strategies for Flow Cytometry analysis of stem and multipotent progenitors in bone

656 marrow

657 Figure S6. Gating strategies for Flow Cytometry analysis of committed progenitors in bone marrow.

658 Figure S7. Gating strategies for Flow Cytometry analysis of blood, peritoneum, spleen, liver, lung and

659 brain.

660 Supplementary movie descriptions.

661 All movies are Z series of fresh tissue from CSF1R-FRed x Csf1r-EGFP mice without fixation.

662 Each movie involves 1m steps from the surface and the depth is shown.

663 Movie S1. Liver. Shows the transition from ramified subcapsular macrophage populations

664 spread in the plane of the surface (0-25m) to underlying Kupffer cells.

665 Movie S2. Brain cortex. Shows the transition from meningeal macrophages spread in the

666 plane of the surface (0-15m) to underlying microglia (15-37m). Includes 3D reconstruction

667 of microglial processes

668 Movie S3. Heart. Shows transition from epicardial macrophage populations spread in the

669 plane of the surface (0-20m) to macrophages spread along muscle fibres in the myocardium.

670 Movie S4. Colon. Shows transition from macrophages spread on the serosal surface (0-35m)

671 to macrophages spread long longitudinal and circular muscle fibres (35-70m) to macrophages

672 surrounding villi in the submucosa and mucosa.

29 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

673 Movie S5. Lung. Shows transition from subcapsular macrophages on the pleural surface (0-

674 20m) to underlying alveolar and interstitial macrophage populations.

675 Movie S6. Kidney. Shows transition from subcapsular macrophages spread in the plane of the

676 surface to underlying interstitial macrophages surrounding tubules in the cortex (note that there

677 is red autofluorescence in the tubules).

678 Movie S7. Skeletal muscle (zygomaticus major). Oblique series distinct morphologies of

679 macrophages of the epimysium and transition to elongated macrophages spread along muscle

680 fibres.

681 Movie S8. Abdominal wall-peritoneal side. Shows change in polarisation of macrophage

682 populations aligned with changes in muscle fibre orientation.

683 Move S9. Abdominal wall-skin side. Shows change in polarisation of macrophage

684 populations aligned with changes in muscle fibre orientation.

685 Movie S10. Tendon (zygomaticus major). Shows transition from macrophages on the surface

686 to tendon macrophages spread longitudinally along connective tissue fibres.

687 Movie S11. Pleural wall-ribs. Shows macrophages aligned along intercostal muscle fibres

688 and transition (10-45m) to dense periosteal macrophage population on the surface of ribs.

689 Movie S12. Bladder-detrusor muscle. Shows macrophages spread longitudinally along

690 muscle fibres at all depths (note muscle is spontaneously contracting).

691 Movie S13. Adrenal gland. Shows transition from subcapsular macrophages to populations

692 of the zona glomerulosa. Note the tissue surface is not flat and subcapsular populations are

693 progressively visualized on the edge of the field.

694 Movie S14. Eye. Sclera and choroid. Shows transition from the sclera (0-25m) to the

695 choroid layers of the eye. Note that the tissue is not flat and scleral populations are

696 progressively visualized on the edge of the field.

30 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

697 Movie S15. Seminal vesicle. Shows the transition from a subcapsular macrophage population

698 (0-20m) through a fibromuscular layer to an underlying glandular structure region (45m-

699 80m) where macrophages outline the surface of glands and ducts.

700 Movie S16. Epididymis. Shows the transition from a subcapsular macrophage population (0-

701 20m) to dense interstitial macrophage populations aligned with the surface of seminiferous

702 tubules.

703 Movie S17. Van deferens. Shows the transition from a serosal/subcapsular macrophage

704 populations of the outer layer (0-20m) to populations aligned with the middle (longitudinal)

705 muscle layer (20-40m) and then at right angles, to the circular muscle layer (note muscle is

706 spontaneously contracting).

707 708 709

31 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

710 References 711 712 1. Hume, D. A., M. Caruso, M. Ferrari-Cestari, K. M. Summers, C. Pridans, and K. M. 713 Irvine. 2020. Phenotypic impacts of CSF1R deficiencies in humans and model 714 organisms. J Leukoc Biol 107: 205-219. 715 2. Summers, K. M., S. J. Bush, and Hume, D.A. 2020. Transcriptional network analysis 716 of transcriptomic diversity in resident tissue macrophages and dendritic cells in the 717 mouse mononuclear phagocyte system. bioRxiv. 718 https://doi.org/10.1101/2020.03.24.002816 719 3. Rojo, R., C. Pridans, D. Langlais, and D. A. Hume. 2017. Transcriptional mechanisms 720 that control expression of the macrophage colony-stimulating factor receptor locus. 721 Clin Sci (Lond) 131: 2161-2182. 722 4. Rojo, R., A. Raper, D. D. Ozdemir, L. Lefevre, K. Grabert, E. Wollscheid-Lengeling, 723 B. Bradford, M. Caruso, I. Gazova, A. Sanchez, Z. M. Lisowski, J. Alves, I. Molina- 724 Gonzalez, H. Davtyan, R. J. Lodge, J. D. Glover, R. Wallace, D. A. D. Munro, E. David, 725 I. Amit, V. E. Miron, J. Priller, S. J. Jenkins, G. E. Hardingham, M. Blurton-Jones, N. 726 A. Mabbott, K. M. Summers, P. Hohenstein, D. A. Hume, and C. Pridans. 2019. 727 Deletion of a Csf1r enhancer selectively impacts CSF1R expression and development 728 of tissue macrophage populations. Nat Commun 10: 3215. 729 5. Hawley, C. A., R. Rojo, A. Raper, K. A. Sauter, Z. M. Lisowski, K. Grabert, C. C. Bain, 730 G. M. Davis, P. A. Louwe, M. C. Ostrowski, D. A. Hume, C. Pridans, and S. J. Jenkins. 731 2018. Csf1r-mApple Transgene Expression and Ligand Binding In Vivo Reveal 732 Dynamics of CSF1R Expression within the Mononuclear Phagocyte System. J 733 Immunol 200: 2209-2223. 734 6. Sasmono, R. T., D. Oceandy, J. W. Pollard, W. Tong, P. Pavli, B. J. Wainwright, M. 735 C. Ostrowski, S. R. Himes, and D. A. Hume. 2003. A macrophage colony-stimulating 736 factor receptor-green fluorescent protein transgene is expressed throughout the 737 mononuclear phagocyte system of the mouse. Blood 101: 1155-1163. 738 7. Irvine, K. M., M. Caruso, M. F. Cestari, G. M. Davis, S. Keshvari, A. Sehgal, C. 739 Pridans, and D. A. Hume. 2020. Analysis of the impact of CSF-1 administration in adult 740 rats using a novel Csf1r-mApple reporter gene. J Leukoc Biol 107: 221-235. 741 8. Balic, A., C. Chintoan-Uta, P. Vohra, K. M. Sutton, R. L. Cassady-Cain, T. Hu, D. S. 742 Donaldson, M. P. Stevens, N. A. Mabbott, D. A. Hume, H. M. Sang, and L. Vervelde. 743 2019. Antigen Sampling CSF1R-Expressing Epithelial Cells Are the Functional 744 Equivalents of Mammalian M Cells in the Avian Follicle-Associated Epithelium. Front 745 Immunol 10: 2495. 746 9. Balic, A., C. Garcia-Morales, L. Vervelde, H. Gilhooley, A. Sherman, V. Garceau, M. 747 W. Gutowska, D. W. Burt, P. Kaiser, D. A. Hume, and H. M. Sang. 2014. Visualisation 748 of chicken macrophages using transgenic reporter genes: insights into the development 749 of the avian macrophage lineage. Development 141: 3255-3265. 750 10. Pridans, C., G. M. Davis, K. A. Sauter, Z. M. Lisowski, Y. Corripio-Miyar, A. Raper, 751 L. Lefevre, R. Young, M. E. McCulloch, S. Lillico, E. Milne, B. Whitelaw, and D. A. 752 Hume. 2016. A Csf1r-EGFP Transgene Provides a Novel Marker for Monocyte Subsets 753 in Sheep. J Immunol 197: 2297-2305. 754 11. Hu, T., Z. Wu, S. J. Bush, L. Freem, L. Vervelde, K. M. Summers, D. A. Hume, A. 755 Balic, and P. Kaiser. 2019. Characterization of Subpopulations of Chicken 756 Mononuclear Phagocytes That Express TIM4 and CSF1R. J Immunol 202: 1186-1199. 757 12. Sasmono, R. T., A. Ehrnsperger, S. L. Cronau, T. Ravasi, R. Kandane, M. J. Hickey, 758 A. D. Cook, S. R. Himes, J. A. Hamilton, and D. A. Hume. 2007. Mouse neutrophilic 759 granulocytes express mRNA encoding the macrophage colony-stimulating factor

32 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

760 receptor (CSF-1R) as well as many other macrophage-specific transcripts and can 761 transdifferentiate into macrophages in vitro in response to CSF-1. J Leukoc Biol 82: 762 111-123. 763 13. Ross, I. L., T. L. Dunn, X. Yue, S. Roy, C. J. Barnett, and D. A. Hume. 1994. 764 Comparison of the expression and function of the transcription factor PU.1 (Spi-1 765 proto-oncogene) between murine macrophages and B lymphocytes. Oncogene 9: 121- 766 132. 767 14. Ross, I. L., X. Yue, M. C. Ostrowski, and D. A. Hume. 1998. Interaction between PU.1 768 and another Ets family transcription factor promotes macrophage-specific Basal 769 transcription initiation. J Biol Chem 273: 6662-6669. 770 15. Hume, D. A. 2008. Differentiation and heterogeneity in the mononuclear phagocyte 771 system. Mucosal Immunol 1: 432-441. 772 16. Hume, D. A., K. M. Irvine, and C. Pridans. 2018. The Mononuclear Phagocyte System: 773 The Relationship between Monocytes and Macrophages. Trends Immunol. 40:98-112 774 17. Chitu, V., S. Gokhan, S. Nandi, M. F. Mehler, and E. R. Stanley. 2016. Emerging Roles 775 for CSF-1 Receptor and its Ligands in the Nervous System. Trends Neurosci 39: 378- 776 393. 777 18. Chitu, V., and E. R. Stanley. 2017. Regulation of Embryonic and Postnatal 778 Development by the CSF-1 Receptor. Curr Top Dev Biol 123: 229-275. 779 19. Nandi, S., S. Gokhan, X. M. Dai, S. Wei, G. Enikolopov, H. Lin, M. F. Mehler, and E. 780 R. Stanley. 2012. The CSF-1 receptor ligands IL-34 and CSF-1 exhibit distinct 781 developmental brain expression patterns and regulate neural progenitor cell 782 maintenance and maturation. Dev Biol 367: 100-113. 783 20. De Lucia, C., A. Rinchon, A. Olmos-Alonso, K. Riecken, B. Fehse, D. Boche, V. H. 784 Perry, and D. Gomez-Nicola. 2016. Microglia regulate hippocampal neurogenesis 785 during chronic neurodegeneration. Brain Behav Immun 55: 179-190. 786 21. Erblich, B., L. Zhu, A. M. Etgen, K. Dobrenis, and J. W. Pollard. 2011. Absence of 787 colony stimulation factor-1 receptor results in loss of microglia, disrupted brain 788 development and olfactory deficits. PLoS One 6: e26317. 789 22. Bennett, F. C., M. L. Bennett, F. Yaqoob, S. B. Mulinyawe, G. A. Grant, M. Hayden 790 Gephart, E. D. Plowey, and B. A. Barres. 2018. A Combination of Ontogeny and CNS 791 Environment Establishes Microglial Identity. Neuron 98: 1170-1183 e1178. 792 23. MacDonald, K. P., J. S. Palmer, S. Cronau, E. Seppanen, S. Olver, N. C. Raffelt, R. 793 Kuns, A. R. Pettit, A. Clouston, B. Wainwright, D. Branstetter, J. Smith, R. J. Paxton, 794 D. P. Cerretti, L. Bonham, G. R. Hill, and D. A. Hume. 2010. An antibody against the 795 colony-stimulating factor 1 receptor depletes the resident subset of monocytes and 796 tissue- and tumor-associated macrophages but does not inhibit inflammation. Blood 797 116: 3955-3963. 798 24. Sudo, T., S. Nishikawa, M. Ogawa, H. Kataoka, N. Ohno, A. Izawa, S. Hayashi, and S. 799 Nishikawa. 1995. Functional hierarchy of c-kit and c-fms in intramarrow production of 800 CFU-M. Oncogene 11: 2469-2476. 801 25. Hettinger, J., D. M. Richards, J. Hansson, M. M. Barra, A. C. Joschko, J. Krijgsveld, 802 and M. Feuerer. 2013. Origin of monocytes and macrophages in a committed 803 progenitor. Nat Immunol 14: 821-830. 804 26. Stanley, E. R., and V. Chitu. 2014. CSF-1 receptor signaling in myeloid cells. Cold 805 Spring Harb Perspect Biol 6:a021857 806 27. Sester, D. P., S. J. Beasley, M. J. Sweet, L. F. Fowles, S. L. Cronau, K. J. Stacey, and 807 D. A. Hume. 1999. Bacterial/CpG DNA down-modulates colony stimulating factor-1 808 receptor surface expression on murine bone marrow-derived macrophages with 809 concomitant growth arrest and factor-independent survival. J Immunol 163: 6541-6550.

33 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

810 28. Sester, D. P., A. Trieu, K. Brion, K. Schroder, T. Ravasi, J. A. Robinson, R. C. 811 McDonald, V. Ripoll, C. A. Wells, H. Suzuki, Y. Hayashizaki, K. J. Stacey, D. A. 812 Hume, and M. J. Sweet. 2005. LPS regulates a set of genes in primary murine 813 macrophages by antagonising CSF-1 action. Immunobiology 210: 97-107. 814 29. Anderson, D. A., 3rd, and K. M. Murphy. 2019. Models of dendritic cell development 815 correlate ontogeny with function. Adv Immunol 143: 99-119. 816 30. Guilliams, M., F. Ginhoux, C. Jakubzick, S. H. Naik, N. Onai, B. U. Schraml, E. 817 Segura, R. Tussiwand, and S. Yona. 2014. Dendritic cells, monocytes and 818 macrophages: a unified nomenclature based on ontogeny. Nat Rev Immunol 14: 571- 819 578. 820 31. Merad, M., P. Sathe, J. Helft, J. Miller, and A. Mortha. 2013. The dendritic cell lineage: 821 ontogeny and function of dendritic cells and their subsets in the steady state and the 822 inflamed setting. Annu Rev Immunol 31: 563-604. 823 32. Auffray, C., D. K. Fogg, E. Narni-Mancinelli, B. Senechal, C. Trouillet, N. Saederup, 824 J. Leemput, K. Bigot, L. Campisi, M. Abitbol, T. Molina, I. Charo, D. A. Hume, A. 825 Cumano, G. Lauvau, and F. Geissmann. 2009. CX3CR1+ CD115+ CD135+ common 826 macrophage/DC precursors and the role of CX3CR1 in their response to inflammation. 827 J Exp Med 206: 595-606. 828 33. Gautier, E. L., T. Shay, J. Miller, M. Greter, C. Jakubzick, S. Ivanov, J. Helft, A. Chow, 829 K. G. Elpek, S. Gordonov, A. R. Mazloom, A. Ma'ayan, W. J. Chua, T. H. Hansen, S. 830 J. Turley, M. Merad, G. J. Randolph, and C. Immunological Genome. 2012. Gene- 831 expression profiles and transcriptional regulatory pathways that underlie the identity 832 and diversity of mouse tissue macrophages. Nat Immunol 13: 1118-1128. 833 34. Durai, V., P. Bagadia, C. G. Briseno, D. J. Theisen, A. Iwata, J. T. t. Davidson, M. 834 Gargaro, D. H. Fremont, T. L. Murphy, and K. M. Murphy. 2018. Altered 835 compensatory cytokine signaling underlies the discrepancy between Flt3(-/-) and 836 Flt3l(-/-) mice. J Exp Med 215: 1417-1435. 837 35. MacDonald, K. P., V. Rowe, H. M. Bofinger, R. Thomas, T. Sasmono, D. A. Hume, 838 and G. R. Hill. 2005. The colony-stimulating factor 1 receptor is expressed on dendritic 839 cells during differentiation and regulates their expansion. J Immunol 175: 1399-1405. 840 36. Ginhoux, F., K. Liu, J. Helft, M. Bogunovic, M. Greter, D. Hashimoto, J. Price, N. Yin, 841 J. Bromberg, S. A. Lira, E. R. Stanley, M. Nussenzweig, and M. Merad. 2009. The 842 origin and development of nonlymphoid tissue CD103+ DCs. J Exp Med 206: 3115- 843 3130. 844 37. Ginhoux, F., F. Tacke, V. Angeli, M. Bogunovic, M. Loubeau, X. M. Dai, E. R. Stanley, 845 G. J. Randolph, and M. Merad. 2006. Langerhans cells arise from monocytes in vivo. 846 Nat Immunol 7: 265-273. 847 38. Jung, S., J. Aliberti, P. Graemmel, M. J. Sunshine, G. W. Kreutzberg, A. Sher, and D. 848 R. Littman. 2000. Analysis of fractalkine receptor CX(3)CR1 function by targeted 849 deletion and green fluorescent protein reporter gene insertion. Mol Cell Biol 20: 4106- 850 4114. 851 39. Saederup, N., A. E. Cardona, K. Croft, M. Mizutani, A. C. Cotleur, C. L. Tsou, R. M. 852 Ransohoff, and I. F. Charo. 2010. Selective chemokine receptor usage by central 853 nervous system myeloid cells in CCR2-red fluorescent protein knock-in mice. PLoS 854 One 5: e13693. 855 40. Liu, Z., Y. Gu, S. Chakarov, C. Bleriot, I. Kwok, X. Chen, A. Shin, W. Huang, R. J. 856 Dress, C. A. Dutertre, A. Schlitzer, J. Chen, L. G. Ng, H. Wang, Z. Liu, B. Su, and F. 857 Ginhoux. 2019. Fate Mapping via Ms4a3-Expression History Traces Monocyte- 858 Derived Cells. Cell 178: 1509-1525 e1519.

34 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

859 41. Ruan, C., L. Sun, A. Kroshilina, L. Beckers, P. De Jager, E. M. Bradshaw, S. A. Hasson, 860 G. Yang, and W. Elyaman. 2020. A novel Tmem119-tdTomato reporter mouse model 861 for studying microglia in the central nervous system. Brain Behav Immun 83: 180-191. 862 42. Masuda, T., L. Amann, R. Sankowski, O. Staszewski, M. Lenz, D. E. P, N. Snaidero, 863 M. J. Costa Jordao, C. Bottcher, K. Kierdorf, S. Jung, J. Priller, T. Misgeld, A. Vlachos, 864 M. M. Luehmann, K. P. Knobeloch, and M. Prinz. 2020. Novel Hexb-based tools for 865 studying microglia in the CNS. Nat Immunol. 21:802-815 866 43. Gow, D. J., V. Garceau, C. Pridans, A. G. Gow, K. E. Simpson, D. Gunn-Moore, and 867 D. A. Hume. 2013. Cloning and expression of feline colony stimulating factor receptor 868 (CSF-1R) and analysis of the species specificity of stimulation by colony stimulating 869 factor-1 (CSF-1) and interleukin-34 (IL-34). Cytokine 61: 630-638. 870 44. Pridans, C., K. A. Sauter, K. Baer, H. Kissel, and D. A. Hume. 2013. CSF1R mutations 871 in hereditary diffuse leukoencephalopathy with spheroids are loss of function. Sci Rep 872 3: 3013. 873 45. Shemiakina, II, G. V. Ermakova, P. J. Cranfill, M. A. Baird, R. A. Evans, E. A. 874 Souslova, D. B. Staroverov, A. Y. Gorokhovatsky, E. V. Putintseva, T. V. 875 Gorodnicheva, T. V. Chepurnykh, L. Strukova, S. Lukyanov, A. G. Zaraisky, M. W. 876 Davidson, D. M. Chudakov, and D. Shcherbo. 2012. A monomeric red fluorescent 877 protein with low cytotoxicity. Nat Commun 3: 1204. 878 46. Ryan, M. D., A. M. King, and G. P. Thomas. 1991. Cleavage of foot-and-mouth disease 879 virus polyprotein is mediated by residues located within a 19 amino acid sequence. J 880 Gen Virol 72 ( Pt 11): 2727-2732. 881 47. Luke, G. A., and M. D. Ryan. 2018. Using the 2A Protein Coexpression System: 882 Multicistronic 2A Vectors Expressing Gene(s) of Interest and Reporter Proteins. 883 Methods Mol Biol 1755: 31-48. 884 48. Lange, A., M. Gegg, I. Burtscher, D. Bengel, E. Kremmer, and H. Lickert. 2012. 885 Fltp(T2AiCre): a new knock-in mouse line for conditional gene targeting in distinct 886 mono- and multiciliated tissues. Differentiation 83: S105-113. 887 49. Szymczak, A. L., C. J. Workman, Y. Wang, K. M. Vignali, S. Dilioglou, E. F. Vanin, 888 and D. A. Vignali. 2004. Correction of multi-gene deficiency in vivo using a single 889 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol 22: 589-594. 890 50. Tagoh, H., R. Himes, D. Clarke, P. J. Leenen, A. D. Riggs, D. Hume, and C. Bonifer. 891 2002. Transcription factor complex formation and chromatin fine structure alterations 892 at the murine c-fms (CSF-1 receptor) locus during maturation of myeloid precursor 893 cells. Genes Dev 16: 1721-1737. 894 51. Kandalla, P. K., S. Sarrazin, K. Molawi, C. Berruyer, D. Redelberger, A. Favel, C. 895 Bordi, S. de Bentzmann, and M. H. Sieweke. 2016. M-CSF improves protection against 896 bacterial and fungal infections after hematopoietic stem/progenitor cell transplantation. 897 J Exp Med 213: 2269-2279. 898 52. Mossadegh-Keller, N., S. Sarrazin, P. K. Kandalla, L. Espinosa, E. R. Stanley, S. L. 899 Nutt, J. Moore, and M. H. Sieweke. 2013. M-CSF instructs myeloid lineage fate in 900 single haematopoietic stem cells. Nature 497: 239-243. 901 53. Giladi, A., F. Paul, Y. Herzog, Y. Lubling, A. Weiner, I. Yofe, D. Jaitin, N. Cabezas- 902 Wallscheid, R. Dress, F. Ginhoux, A. Trumpp, A. Tanay, and I. Amit. 2018. Single- 903 cell characterization of haematopoietic progenitors and their trajectories in homeostasis 904 and perturbed haematopoiesis. Nat Cell Biol 20: 836-846. 905 54. Kaur, S., L. J. Raggatt, S. M. Millard, A. C. Wu, L. Batoon, R. N. Jacobsen, I. G. 906 Winkler, K. P. MacDonald, A. C. Perkins, D. A. Hume, J. P. Levesque, and A. R. Pettit. 907 2018. Self-repopulating recipient bone marrow resident macrophages promote long- 908 term hematopoietic stem cell engraftment. Blood 132: 735-749.

35 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

909 55. Akashi, K., D. Traver, T. Miyamoto, and I. L. Weissman. 2000. A clonogenic common 910 myeloid progenitor that gives rise to all myeloid lineages. Nature 404: 193-197. 911 56. Kaur, S., L. J. Raggatt, L. Batoon, D. A. Hume, J. P. Levesque, and A. R. Pettit. 2017. 912 Role of bone marrow macrophages in controlling homeostasis and repair in bone and 913 bone marrow niches. Semin Cell Dev Biol 61: 12-21. 914 57. Chang, M. K., L. J. Raggatt, K. A. Alexander, J. S. Kuliwaba, N. L. Fazzalari, K. 915 Schroder, E. R. Maylin, V. M. Ripoll, D. A. Hume, and A. R. Pettit. 2008. Osteal tissue 916 macrophages are intercalated throughout human and mouse bone lining tissues and 917 regulate osteoblast function in vitro and in vivo. J Immunol 181: 1232-1244. 918 58. Cortegano, I., N. Serrano, C. Ruiz, M. Rodriguez, C. Prado, M. Alia, A. Hidalgo, E. 919 Cano, B. de Andres, and M. L. Gaspar. 2019. CD45 expression discriminates waves of 920 embryonic megakaryocytes in the mouse. Haematologica 104: 1853-1865. 921 59. Mildner, A., J. Schonheit, A. Giladi, E. David, D. Lara-Astiaso, E. Lorenzo-Vivas, F. 922 Paul, L. Chappell-Maor, J. Priller, A. Leutz, I. Amit, and S. Jung. 2017. Genomic 923 Characterization of Murine Monocytes Reveals C/EBPbeta Transcription Factor 924 Dependence of Ly6C(-) Cells. Immunity 46: 849-862 e847. 925 60. Gordon, S., and P. R. Taylor. 2005. Monocyte and macrophage heterogeneity. Nat Rev 926 Immunol 5: 953-964. 927 61. Swirski, F. K., M. Nahrendorf, M. Etzrodt, M. Wildgruber, V. Cortez-Retamozo, P. 928 Panizzi, J. L. Figueiredo, R. H. Kohler, A. Chudnovskiy, P. Waterman, E. Aikawa, T. 929 R. Mempel, P. Libby, R. Weissleder, and M. J. Pittet. 2009. Identification of splenic 930 reservoir monocytes and their deployment to inflammatory sites. Science 325: 612-616. 931 62. Gray, E. E., and J. G. Cyster. 2012. Lymph node macrophages. J Innate Immun 4: 424- 932 436. 933 63. Mondor, I., M. Baratin, M. Lagueyrie, L. Saro, S. Henri, R. Gentek, D. Suerinck, W. 934 Kastenmuller, J. X. Jiang, and M. Bajenoff. 2019. Lymphatic Endothelial Cells Are 935 Essential Components of the Subcapsular Sinus Macrophage Niche. Immunity 50: 936 1453-1466 e1454. 937 64. Gordon, S., A. Pluddemann, and S. Mukhopadhyay. 2014. Sinusoidal immunity: 938 macrophages at the lymphohematopoietic interface. Cold Spring Harb Perspect Biol 7: 939 a016378. 940 65. Hume, D. A., A. P. Robinson, G. G. MacPherson, and S. Gordon. 1983. The 941 mononuclear phagocyte system of the mouse defined by immunohistochemical 942 localization of antigen F4/80. Relationship between macrophages, Langerhans cells, 943 reticular cells, and dendritic cells in lymphoid and hematopoietic organs. J Exp Med 944 158: 1522-1536. 945 66. Dudziak, D., A. O. Kamphorst, G. F. Heidkamp, V. R. Buchholz, C. Trumpfheller, S. 946 Yamazaki, C. Cheong, K. Liu, H. W. Lee, C. G. Park, R. M. Steinman, and M. C. 947 Nussenzweig. 2007. Differential antigen processing by dendritic cell subsets in vivo. 948 Science 315: 107-111. 949 67. Baratin, M., L. Simon, A. Jorquera, C. Ghigo, D. Dembele, J. Nowak, R. Gentek, S. 950 Wienert, F. Klauschen, B. Malissen, M. Dalod, and M. Bajenoff. 2017. T Cell Zone 951 Resident Macrophages Silently Dispose of Apoptotic Cells in the Lymph Node. 952 Immunity 47: 349-362 e345. 953 68. Sehgal, A., D. S. Donaldson, C. Pridans, K. A. Sauter, D. A. Hume, and N. A. Mabbott. 954 2018. The role of CSF1R-dependent macrophages in control of the intestinal stem-cell 955 niche. Nat Commun 9: 1272. 956 69. Wagner, C., J. Bonnardel, C. Da Silva, L. Martens, J. P. Gorvel, and H. Lelouard. 2018. 957 Some news from the unknown soldier, the Peyer's patch macrophage. Cell Immunol 958 330: 159-167.

36 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

959 70. David, B. A., R. M. Rezende, M. M. Antunes, M. M. Santos, M. A. Freitas Lopes, A. 960 B. Diniz, R. V. Sousa Pereira, S. C. Marchesi, D. M. Alvarenga, B. N. Nakagaki, A. M. 961 Araujo, D. S. Dos Reis, R. M. Rocha, P. E. Marques, W. Y. Lee, J. Deniset, P. X. Liew, 962 S. Rubino, L. Cox, V. Pinho, T. M. Cunha, G. R. Fernandes, A. G. Oliveira, M. M. 963 Teixeira, P. Kubes, and G. B. Menezes. 2016. Combination of Mass Cytometry and 964 Imaging Analysis Reveals Origin, Location, and Functional Repopulation of Liver 965 Myeloid Cells in Mice. Gastroenterology 151: 1176-1191. 966 71. Sierro, F., M. Evrard, S. Rizzetto, M. Melino, A. J. Mitchell, M. Florido, L. Beattie, S. 967 B. Walters, S. S. Tay, B. Lu, L. E. Holz, B. Roediger, Y. C. Wong, A. Warren, W. 968 Ritchie, C. McGuffog, W. Weninger, D. G. Le Couteur, F. Ginhoux, W. J. Britton, W. 969 R. Heath, B. M. Saunders, G. W. McCaughan, F. Luciani, K. P. A. MacDonald, L. G. 970 Ng, D. G. Bowen, and P. Bertolino. 2017. A Liver Capsular Network of Monocyte- 971 Derived Macrophages Restricts Hepatic Dissemination of Intraperitoneal Bacteria by 972 Neutrophil Recruitment. Immunity 47: 374-388 e376. 973 72. Chinnery, H. R., M. J. Ruitenberg, and P. G. McMenamin. 2010. Novel characterization 974 of monocyte-derived cell populations in the meninges and choroid plexus and their rates 975 of replenishment in bone marrow chimeric mice. J Neuropathol Exp Neurol 69: 896- 976 909. 977 73. Luo, J., F. Elwood, M. Britschgi, S. Villeda, H. Zhang, Z. Ding, L. Zhu, H. Alabsi, R. 978 Getachew, R. Narasimhan, R. Wabl, N. Fainberg, M. L. James, G. Wong, J. Relton, S. 979 S. Gambhir, J. W. Pollard, and T. Wyss-Coray. 2013. Colony-stimulating factor 1 980 receptor (CSF1R) signaling in injured neurons facilitates protection and survival. J Exp 981 Med 210: 157-172. 982 74. Sakai, M., T. D. Troutman, J. S. Seidman, Z. Ouyang, N. J. Spann, Y. Abe, K. M. Ego, 983 C. M. Bruni, Z. Deng, J. C. M. Schlachetzki, A. Nott, H. Bennett, J. Chang, B. T. Vu, 984 M. P. Pasillas, V. M. Link, L. Texari, S. Heinz, B. M. Thompson, J. G. McDonald, F. 985 Geissmann, and C. K. Glass. 2019. Liver-Derived Signals Sequentially Reprogram 986 Myeloid Enhancers to Initiate and Maintain Kupffer Cell Identity. Immunity 51: 655- 987 670 e658. 988 75. Yue, X., P. Favot, T. L. Dunn, A. I. Cassady, and D. A. Hume. 1993. Expression of 989 mRNA encoding the macrophage colony-stimulating factor receptor (c-fms) is 990 controlled by a constitutive promoter and tissue-specific transcription elongation. Mol 991 Cell Biol 13: 3191-3201. 992 76. Yanez, A., S. G. Coetzee, A. Olsson, D. E. Muench, B. P. Berman, D. J. Hazelett, N. 993 Salomonis, H. L. Grimes, and H. S. Goodridge. 2017. Granulocyte-Monocyte 994 Progenitors and Monocyte-Dendritic Cell Progenitors Independently Produce 995 Functionally Distinct Monocytes. Immunity 47: 890-902 e894. 996 77. Kwok I, Becht E, Xia Y, Ng M, Teh YC, Tan L, Evrard M, Li JLY, Tran HTN, Tan Y, 997 Liu D, Mishra A, Liong KH, Leong K, Zhang Y, Olsson A, Mantri CK, Shyamsunder 998 P, Liu Z, Piot C, Dutertre CA, Cheng H, Bari S, Ang N, Biswas SK, Koeffler HP, Tey 999 HL, Larbi A, Su IH, Lee B, St John A, Chan JKY, Hwang WYK, Chen J, Salomonis 1000 N, Chong SZ, Grimes HL, Liu B, Hidalgo A, Newell EW, Cheng T, Ginhoux F, and N. 1001 LG. 2020. Combinatorial Single-Cell Analyses of Granulocyte-Monocyte Progenitor 1002 Heterogeneity Reveals an Early Uni-potent Neutrophil Progenitor. Immunity: S1074- 1003 7613(1020)30235-30231. 1004 78. Chen, Z., M. Hu, and R. A. Shivdasani. 2007. Expression analysis of primary mouse 1005 megakaryocyte differentiation and its application in identifying stage-specific 1006 molecular markers and a novel transcriptional target of NF-E2. Blood 109: 1451-1459.

37 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1007 79. Lehmann, S., J. O'Kelly, S. Raynaud, S. E. Funk, E. H. Sage, and H. P. Koeffler. 2007. 1008 Common deleted genes in the 5q- syndrome: thrombocytopenia and reduced erythroid 1009 colony formation in SPARC null mice. Leukemia 21: 1931-1936. 1010 80. Pridans, C., A. Raper, G. M. Davis, J. Alves, K. A. Sauter, L. Lefevre, T. Regan, S. 1011 Meek, L. Sutherland, A. J. Thomson, S. Clohisey, S. J. Bush, R. Rojo, Z. M. Lisowski, 1012 R. Wallace, K. Grabert, K. R. Upton, Y. T. Tsai, D. Brown, L. B. Smith, K. M. 1013 Summers, N. A. Mabbott, P. Piccardo, M. T. Cheeseman, T. Burdon, and D. A. Hume. 1014 2018. Pleiotropic Impacts of Macrophage and Microglial Deficiency on Development 1015 in Rats with Targeted Mutation of the Csf1r Locus. J Immunol 201: 2683-2699. 1016 81. Guo, L., D. R. Bertola, A. Takanohashi, A. Saito, Y. Segawa, T. Yokota, S. Ishibashi, 1017 Y. Nishida, G. L. Yamamoto, J. Franco, R. S. Honjo, C. A. Kim, C. M. Musso, M. 1018 Timmons, A. Pizzino, R. J. Taft, B. Lajoie, M. A. Knight, K. H. Fischbeck, A. B. 1019 Singleton, C. R. Ferreira, Z. Wang, L. Yan, J. Y. Garbern, P. O. Simsek-Kiper, H. 1020 Ohashi, P. G. Robey, A. Boyde, N. Matsumoto, N. Miyake, J. Spranger, R. Schiffmann, 1021 A. Vanderver, G. Nishimura, M. Passos-Bueno, C. Simons, K. Ishikawa, and S. 1022 Ikegawa. 2019. Bi-allelic CSF1R Mutations Cause Skeletal Dysplasia of 1023 Dysosteosclerosis-Pyle Disease Spectrum and Degenerative Encephalopathy with 1024 Brain Malformation. Am J Hum Genet 104: 925-935. 1025 82. Gow, D. J., K. A. Sauter, C. Pridans, L. Moffat, A. Sehgal, B. M. Stutchfield, S. Raza, 1026 P. M. Beard, Y. T. Tsai, G. Bainbridge, P. L. Boner, G. Fici, D. Garcia-Tapia, R. A. 1027 Martin, T. Oliphant, J. A. Shelly, R. Tiwari, T. L. Wilson, L. B. Smith, N. A. Mabbott, 1028 and D. A. Hume. 2014. Characterisation of a novel Fc conjugate of macrophage colony- 1029 stimulating factor. Mol Ther 22: 1580-1592. 1030 83. Baker, G. R., and J. Levin. 1998. Transient thrombocytopenia produced by 1031 administration of macrophage colony-stimulating factor: investigations of the 1032 mechanism. Blood 91: 89-99. 1033 84. Jakubowski, A. A., D. F. Bajorin, M. A. Templeton, P. B. Chapman, B. V. Cody, H. 1034 Thaler, Y. Tao, D. A. Filippa, L. Williams, M. L. Sherman, M. B. Garnick, and A. N. 1035 Houghton. 1996. Phase I study of continuous-infusion recombinant macrophage 1036 colony-stimulating factor in patients with metastatic melanoma. Clin Cancer Res 2: 1037 295-302. 1038 85. Sauter, K. A., L. A. Waddell, Z. M. Lisowski, R. Young, L. Lefevre, G. M. Davis, S. 1039 M. Clohisey, M. McCulloch, E. Magowan, N. A. Mabbott, K. M. Summers, and D. A. 1040 Hume. 2016. Macrophage colony-stimulating factor (CSF1) controls monocyte 1041 production and maturation and the steady-state size of the liver in pigs. Am J Physiol 1042 Gastrointest Liver Physiol 311: G533-547. 1043 86. Rahman, Z. S., W. H. Shao, T. N. Khan, Y. Zhen, and P. L. Cohen. 2010. Impaired 1044 apoptotic cell clearance in the germinal center by Mer-deficient tingible body 1045 macrophages leads to enhanced antibody-forming cell and germinal center responses. 1046 J Immunol 185: 5859-5868. 1047 87. Kranich, J., N. J. Krautler, E. Heinen, M. Polymenidou, C. Bridel, A. Schildknecht, C. 1048 Huber, M. H. Kosco-Vilbois, R. Zinkernagel, G. Miele, and A. Aguzzi. 2008. Follicular 1049 dendritic cells control engulfment of apoptotic bodies by secreting Mfge8. J Exp Med 1050 205: 1293-1302. 1051 88. Kohler, C. 2007. Allograft inflammatory factor-1/Ionized calcium-binding adapter 1052 molecule 1 is specifically expressed by most subpopulations of macrophages and 1053 spermatids in testis. Cell Tissue Res 330: 291-302. 1054 89. Kraal, G., M. Rep, and M. Janse. 1987. Macrophages in T and B cell compartments and 1055 other tissue macrophages recognized by monoclonal antibody MOMA-2. An 1056 immunohistochemical study. Scand J Immunol 26: 653-661.

38 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1057 90. Akcora, D., D. Huynh, S. Lightowler, M. Germann, S. Robine, J. R. de May, J. W. 1058 Pollard, E. R. Stanley, J. Malaterre, and R. G. Ramsay. 2013. The CSF-1 receptor 1059 fashions the intestinal stem cell niche. Stem Cell Res 10: 203-212. 1060 91. Menke, J., Y. Iwata, W. A. Rabacal, R. Basu, Y. G. Yeung, B. D. Humphreys, T. Wada, 1061 A. Schwarting, E. R. Stanley, and V. R. Kelley. 2009. CSF-1 signals directly to renal 1062 tubular epithelial cells to mediate repair in mice. J Clin Invest 119: 2330-2342. 1063 92. Summers, K. M., and D. A. Hume. 2017. Identification of the macrophage-specific 1064 promoter signature in FANTOM5 mouse embryo developmental time course data. J 1065 Leukoc Biol 102: 1081-1092. 1066 93. Lehner, C., G. Spitzer, R. Gehwolf, A. Wagner, N. Weissenbacher, C. Deininger, K. 1067 Emmanuel, F. Wichlas, H. Tempfer, and A. Traweger. 2019. Tenophages: a novel 1068 macrophage-like tendon cell population expressing CX3CL1 and CX3CR1. Dis Model 1069 Mech 12. dmm041384 1070 94. Van Hove, H., L. Martens, I. Scheyltjens, K. De Vlaminck, A. R. Pombo Antunes, S. 1071 De Prijck, N. Vandamme, S. De Schepper, G. Van Isterdael, C. L. Scott, J. Aerts, G. 1072 Berx, G. E. Boeckxstaens, R. E. Vandenbroucke, L. Vereecke, D. Moechars, M. 1073 Guilliams, J. A. Van Ginderachter, Y. Saeys, and K. Movahedi. 2019. A single-cell 1074 atlas of mouse brain macrophages reveals unique transcriptional identities shaped by 1075 ontogeny and tissue environment. Nat Neurosci 22: 1021-1035. 1076 95. Schyns, J., Q. Bai, C. Ruscitti, C. Radermecker, S. De Schepper, S. Chakarov, F. Farnir, 1077 D. Pirottin, F. Ginhoux, G. Boeckxstaens, F. Bureau, and T. Marichal. 2019. Non- 1078 classical tissue monocytes and two functionally distinct populations of interstitial 1079 macrophages populate the mouse lung. Nat Commun 10: 3964. 1080 96. De Schepper, S., N. Stakenborg, G. Matteoli, S. Verheijden, and G. E. Boeckxstaens. 1081 2018. Muscularis macrophages: Key players in intestinal homeostasis and disease. Cell 1082 Immunol 330: 142-150. 1083 97. Brigitte, M., C. Schilte, A. Plonquet, Y. Baba-Amer, A. Henri, C. Charlier, S. 1084 Tajbakhsh, M. Albert, R. K. Gherardi, and F. Chretien. 2010. Muscle resident 1085 macrophages control the immune cell reaction in a mouse model of notexin-induced 1086 myoinjury. Arthritis Rheum 62: 268-279. 1087 98. Bajpai, G., C. Schneider, N. Wong, A. Bredemeyer, M. Hulsmans, M. Nahrendorf, S. 1088 Epelman, D. Kreisel, Y. Liu, A. Itoh, T. S. Shankar, C. H. Selzman, S. G. Drakos, and 1089 K. J. Lavine. 2018. The human heart contains distinct macrophage subsets with 1090 divergent origins and functions. Nat Med 24: 1234-1245. 1091 99. Hulsmans, M., S. Clauss, L. Xiao, A. D. Aguirre, K. R. King, A. Hanley, W. J. Hucker, 1092 E. M. Wulfers, G. Seemann, G. Courties, Y. Iwamoto, Y. Sun, A. J. Savol, H. B. Sager, 1093 K. J. Lavine, G. A. Fishbein, D. E. Capen, N. Da Silva, L. Miquerol, H. Wakimoto, C. 1094 E. Seidman, J. G. Seidman, R. I. Sadreyev, K. Naxerova, R. N. Mitchell, D. Brown, P. 1095 Libby, R. Weissleder, F. K. Swirski, P. Kohl, C. Vinegoni, D. J. Milan, P. T. Ellinor, 1096 and M. Nahrendorf. 2017. Macrophages Facilitate Electrical Conduction in the Heart. 1097 Cell 169: 510-522 e520. 1098 100. Lim, H. Y., S. Y. Lim, C. K. Tan, C. H. Thiam, C. C. Goh, D. Carbajo, S. H. S. Chew, 1099 P. See, S. Chakarov, X. N. Wang, L. H. Lim, L. A. Johnson, J. Lum, C. Y. Fong, A. 1100 Bongso, A. Biswas, C. Goh, M. Evrard, K. P. Yeo, R. Basu, J. K. Wang, Y. Tan, R. 1101 Jain, S. Tikoo, C. Choong, W. Weninger, M. Poidinger, R. E. Stanley, M. Collin, N. S. 1102 Tan, L. G. Ng, D. G. Jackson, F. Ginhoux, and V. Angeli. 2018. Hyaluronan Receptor 1103 LYVE-1-Expressing Macrophages Maintain Arterial Tone through Hyaluronan- 1104 Mediated Regulation of Smooth Muscle Cell Collagen. Immunity 49: 326-341 e327. 1105 101. Guilliams, M., G. R. Thierry, J. Bonnardel, and M. Bajenoff. 2020. Establishment and 1106 Maintenance of the Macrophage Niche. Immunity 52: 434-451.

39 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

1107 102. Quadros, R. M., H. Miura, D. W. Harms, H. Akatsuka, T. Sato, T. Aida, R. Redder, G. 1108 P. Richardson, Y. Inagaki, D. Sakai, S. M. Buckley, P. Seshacharyulu, S. K. Batra, M. 1109 A. Behlke, S. A. Zeiner, A. M. Jacobi, Y. Izu, W. B. Thoreson, L. D. Urness, S. L. 1110 Mansour, M. Ohtsuka, and C. B. Gurumurthy. 2017. Easi-CRISPR: a robust method 1111 for one-step generation of mice carrying conditional and insertion alleles using long 1112 ssDNA donors and CRISPR ribonucleoproteins. Genome Biol 18: 92. 1113 103. Demayo, J. L., J. Wang, D. Liang, R. Zhang, and F. J. Demayo. 2012. Genetically 1114 Engineered Mice by Pronuclear DNA microinjection. Curr Protoc Mouse Biol 2: 245- 1115 262. 1116

40 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

A B g415 g416 Geno F2 Geno R2 AACAACTACCAGTTCTGCTGAAGTGGGAGG |||||||||||||||||||||||||||||| TTGTTGATGGTCAAGACGACTTCACCCTCC FusionRed Csf1r STOP Ex22 3’ UTR H H

C lssDNA donor T2A-FusionRed

Ex22 3’ UTR Figure 1. bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Figure 2

A. Bone marrow (BM) cells WT FRed +/- FRed +/+ 10

10

10 CD115 AF488 CD115 0

0 10 10 10 0 10 10 10 0 10 10 10 CSF1R-FRed B. BM cells C. BMDM 100 100 WT 80 80 FRed +/- 60 60 FRed +/+ 40 40 Norm.Count 20 Norm.Count 20

0 10 10 10 0 10 10 10 10 10 10 10 CD115 AF488 CSF1R-FRed CSF1R-FRed bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

(A) (B)

Lin-CD48- CD150+HSC CLP

89.77% ± 4.22% Lin-CD48- CD150-MPP CMP

9.82% ± 2.44% 72.88% ± 8.22% Lin-CD48+ HPC GMP

16.27% ± 3.22% 68.12% ± 8.42%

Lin-cKit+ Sca1-CP MEP 3 3 4 3 3 4 -10 0 10 10 -10 0 10 10 CSF1R-FRed CSF1R-FRed

(C) (D) DAPI CSF1R-FRed CD169 F4/80

+ BV Ter119 (iii) Eryth. cells Bone

(iv) (i) B220+ (ii) Bone B cells

Muscle CD3+ (i) (ii) (iii) (iv) T cells Bone

Merge Bone Ly6G+ Granulocytes

CD11b+SSCHi CSF1R-FRed Eosinophil

6.56 % ± 1.33

Ly6CLoCD115- CD169 Neutrophils

84.55% ± 4.43%

Hi +

Ly6C CD115 F4/80 Monocytes 3 3 4 -10 0 10 10 (Resident) (MGK) (OC) (Periosteal) Figure 3 CSF1R-FRed bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Figure 4.

A. Peripheral blood B. Peritoneal cavity

10 Ly6CLow Monocytes 10 F4/80Hi/CD115+ 10

0 Ly6CHi Monocytes F4/80Int/CD115+ CD115 BV605 CD115

0 10 10 10 F4/80 AF647 Neutrophils F4/80Int/CD115Low

Eosinophils F4/80-ve WT FRed +/- 0 10 10 Lymphocytes FRed +/+ CSF1R-FRed

0 10 10 10 CSF1RFRed bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Spleen (A) Merge CD169 (D)

Ter119+ Erythroid Cells (C) CSF1R-FRed F4/80

B220+ B cells CD169 CSF1R-FRed F4/80

+ (B) Merge B220 CD3 T cells

Ly6G+ Granulocytes

CSF1R-FRed CD68 CD11b+SSCHi Eosinophil

B220 CD68 CSF1R-FRed B220 CD11c+F4/80Lo (C) Merge B220 Dendri�c cells

Ly6CLoCD115- Neutrophils

CSF1R-FRed CD3 Ly6CHiCD115+ Monocytes -10 3 0 10 3 10 4

B220 CD3 CSF1R-FRed B220 CSF1R-FRed Lymph node (E) Merge CD169 (F) Merge B220

i

ii CSF1R-FRed F4/80 i CSF1R-FRed CD68

iii iii ii CD68 CSF1R-FRed CD169 CSF1R-FRed F4/80 B220

Figure 5 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

(A) Pancrea�c islet (B) Aorta (C) Epidermis (D) Cerebral cortex

(E) Diaphragm (F) Adrenal gland (G) Adrenal gland (H) Gastric glands (capsule) (zona glomerulosa)

(I) Small intes�ne (SED) (J) Colon (K) Kidney (Cortex) (L) Cervix

(VLP)

(M) Uterus (N) Lung (inters��al) (O) Mesentery (P) Thymus

(alveloar)

(Q) Brown adipose (R) Skeletal muscle (S) Detrusor muscle (T) Trachea muscle �ssue

Figure 6 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.09.196402; this version posted July 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

(A) Liver (B) Lung (i) Capsular (ii) Inters��al

Tim4+ Macrophages (ii) (i) Tim4- Macrophages (iii) Alveolar (iv) Airway

Lo Ly6C (iii) Monocytes (iv) CSF1R-FRed DAPI

Ly6CHi Monocytes (C) Lung (D) Brain

Ly6G+ F4/80+ CD11bHi CD45Lo CD11bHi Neutrophils Macrophages Microglia

F4/80+ CD11bLo CD45Hi CD11bLo Eosinophils Alv. Macrophages BAM

Ly6G+ Non-myeloid Neutrophils CD45+ CD11b-ve 3 4 5 0 10 10 10 CSF1R-FRed F4/80- CD11b- CD45-ve 3 4 5 3 4 5 0 10 10 10 0 10 10 10 Figure 7 CSF1R-FRed CSF1R-FRed