ISOLATION AND CHARACTERIZATION OF NONSTARTER LACTOBACILLUS SPP. IN SWISS CHEESE AND ASSESSMENT OF THEIR ROLE ON SWISS CHEESE QUALITY
DISSERTATION
Presented in Partial Fulfillment of the Requirements for the Degree
Doctor of Philosophy in the Graduate School of
The Ohio State University
By
Nurdan A. Kocaoglu-Vurma, M.S.
*****
The Ohio State University 2005
Dissertation Committee:
Dr. W. James Harper, Adviser Approved by
Dr. Polly D. Courtney
Dr. Mike Mangino ______Adviser Dr. Ahmed E. Yousef Food Science and Nutrition Graduate Program
ABSTRACT
Nonstarter Lactobacillus strains affect the quality of many cheese varieties.
Though the use of Lactobacillus casei as an adjunct culture is common for Swiss-type
cheese manufactured in Switzerland, few published reports exist on adjunct use and none
exist for adjunct use in U.S.-manufactured Swiss cheese. High quality Swiss cheeses
vary in sensory, chemical, microbiological, and physical characteristics. Determining the
compositional characteristics of commercial Swiss cheeses will establish the typical
range for each characteristic in cheeses intended for the American market and will
complement descriptive sensory and consumer preference studies.
The objectives of this study were to isolate and identify nonstarter Lactobacillus
strains in high quality commercial Swiss cheeses, to investigate citrate metabolism
among nonstarter lactobacilli, to study the effect of nonstarter Lactobacillus strains as
adjunct cultures on Swiss cheese characteristics, and to determine chemical,
microbiological, and physical characteristics of commercial Swiss-type cheeses.
Lactobacilli were selected from six domestic and two European Swiss cheeses
with selective medium and the strains from each cheese were genetically typed and
speciated. Qualitative and quantitative citrate utilization assays were performed on each
strain. The total number of Lactobacillus cells ranged from 4.8 × 104 to 7.1 × 107 CFU/g cheese. Strains belonging to L. casei, L. rhamnosus, and L. fermentum species were most
ii frequently encountered. Lactobacillus casei strains predominated in the cheeses originating in Switzerland; whereas, the domestic cheeses contained a wider variety of
Lactobacillus species, including different strains of L. casei, L. rhamnosus , L. gasseri, L. delbrüeckii, and L. fermentum. Citrate differential medium was valuable in rapid assessment of citrate utilization of lactobacilli. On this medium, L. helveticus, L. gasseri, and L. delbrüeckii strains did not metabolize citrate, while, L. casei, L. fermentum, and L. rhamnosus strains utilized citrate. Percent relative growth in modified MRS broth with glucose or citrate confirmed that L. delbrüeckii and L. helveticus strains cannot metabolize citrate as the sole carbon source. Among the other strains tested, L. casei strains were strong citrate utilizers followed by L. rhamnosus, L. fermentum, and L. gasseri strains. A putative citP gene fragment from one citrate-utilizing L. casei strain was amplified, cloned, and sequenced. Distribution of the putative citP gene in Swiss cheese nonstarter lactobacilli was determined by Southern hybridization using amplified fragment as a probe. Eight out of 22 strains tested had sequence homology to the probe.
Twelve cheeses were manufactured using a commercial starter combination and three previously isolated nonstarter Lactobacillus strains, L. casei A26, L. casei B21, and
L. rhamnosus H2. Cheeses were analyzed during ripening for microbial and chemical composition. The use of adjunct cultures diminished high variability in total
Lactobacillus counts in cheeses manufactured without adjunct addition. Lactobacillus casei strains were able to utilize all citrate present in cheese before the end of the warm room ripening phase. There were no significant differences among cheeses in regards to protein, fat, moisture, and salt contents. The pH of the mature cheeses ranged from 5.4 to
5.5, and free amino acid concentration ranged from 5 to 7 mmol/kg cheese. Lactic, iii acetic, and propionic acid levels of cheeses were not significantly different. Based on electronic nose and descriptive sensory results, cheeses made with adjunct L. casei strain
A26 were more similar to control cheese in development of certain flavor attributes.
Fifteen cheeses (4 U.S.-manufactured baby Swiss, 10 U.S.-manufactured Swiss, and one European Emmental) were analyzed for characteristics including protein, fat, moisture, salt, pH, short chain free fatty acids, and total free amino acids. Lactobacillus spp., Streptococcus thermophilus, and Propionibacterium spp. were enumerated.
Physical characteristics such as hardness, springiness, and meltability were assessed. An electronic nose was used to evaluate the volatile flavor compounds. The values for compositional characteristics ranged from 22.9 to 26.3% for protein, 46.3 to 55.1% for fat in dry matter, 36.4 to 41.8% for moisture, and 0.7 to 3.4% for salt in moisture. The pH values ranged from 5.37 to 5.80 and the free amino acid levels ranged from 2.32 to 10.48 mmol/kg. The Emmental cheese had the highest acetic acid and propionic acid levels.
Bacterial counts varied widely: 5 to 8 log CFU/g Lactobacillus spp., 3 to 8 log CFU/g S. thermophilus, and 4 to 8 log CFU/g Propionibacterium spp. The cheeses with higher numbers of Propionibacterium spp. had higher propionic acid levels. Baby Swiss cheeses were softer, on average, than the Swiss cheeses. Meltability, measured by melted diameter, ranged from 18 to 40 mm. The Emmental cheese had the lowest meltability.
The electronic nose evaluation differentiated the cheeses into three groups, with the baby
Swiss cheeses grouping together.
Understanding the occurrence, types, and metabolic capabilities of nonstarter
Lactobacillus in Swiss cheese will allow further studies of their role in cheese ripening and their effect on Propionibacterium fermentation. Characterization of nonstarter iv strains from high quality cheeses may lead to new adjunct cultures specific for Swiss cheese. Chemical, microbiological, and physical characterization of Swiss cheeses, combined with sensory evaluation results may allow manufacturers to predict the acceptability of their cheese.
v
Dedicated to Mustafa, Arın Ozan, and my parents for their unconditional love, support, and inspiration
vi
ACKNOWLEDGMENTS
I would like to thank my adviser Dr. Polly D. Courtney for her excellent guidance
and support throughout my graduate studies at the Ohio State University. She is an
excellent professor, a perfect adviser, and a wonderful person. I am grateful for the
opportunity to learn from her.
I would like to express my sincere gratitude to Dr. J.W. Harper, my primary
adviser, since October 2004, for providing me the opportunity to work in an outstanding
research environment.
I would like to thank Dr. Ahmed E. Yousef and Dr. Mike Mangino for their
helpful guidance.
Throughout this study, I received exceptional collaboration from a number of
people. I want to thank Cheryl Wick for sharing her expertise in cheese making and
analyses; Gary Wenneker, for his exceptional technical support and assistance in pilot
scale cheese production; Dr. Seyhun Yurdugul, Dr. Nurcan Koca, and Dr. Josephine Kuo
for their contributions in compositional analyses of commercial cheese samples; and Dr.
MaryAnne Drake, for conducting the descriptive sensory analysis at North Carolina State
University.
I would also like to thank all the members of our laboratory group; Julie Jenkins,
Olga Anggraeni, Patcharee Limpatsian, Hyun Chung, Rory McCarthy, Corunda Pruitt, vii Jennifer Kaiser, Chris Wolf, and Dr. Karen Fligner. My deep appreciation extends to
Maria Ruhlman and Joy Waite for their suggestions and friendship.
I would particularly like to thank my husband Mustafa, simply, for everything.
Thanks for always being there for me. Cheese-making and growth curve experiments
wouldn’t be as enjoyable without your help, support, and presence.
I would like to thank my parents, Nuran and Hakkı Kocaoglu, and my brothers
Tayfun Kocaoglu and Dr. Argun Kocaoglu for their unconditional love, support, and
inspiration.
I also would like to thank Swiss Cheese Consortium, the Center for Innovative
Food Technology, and the OARDC Research Enhancement Competitive Grants Program for their financial support.
viii VITA
July 2, 1973………………………..……………...... Born – Istanbul, Turkey
July, 1995 ….……………………………………….B.Eng. Food Engineering Istanbul Technical University Istanbul, Turkey
1995 – 1996………………………………………....Technical Sales Engineer Hemel S.A. Istanbul, Turkey
1996 – 1999…………………………………………M.S. Food Science University of California, Davis
1999 – 2000…………………………………………Product Manager Hemakim Ltd. Istanbul, Turkey
2000 – 2001...... Teaching/Research Associate Istanbul Technical University Istanbul, Turkey
2001 – present…………………..………...... Graduate Research Associate The Ohio State University Columbus, Ohio
FIELDS OF STUDY
Major Field: Food Science and Nutrition
ix TABLE OF CONTENTS
Page
Abstract...... ii
Dedication...... vi
Acknowledgments...... vii
Vita...... ix
List of Tables ...... xiii
List of Figures...... xiv
Chapters:
1. Literature Review...... 1
Swiss cheese quality parameters ...... 1 Swiss cheese manufacture...... 5 Autolysis of starter bacteria ...... 7 Nonstarter bacteria...... 8 Molecular methods for identification of Lactobacillus ...... 13 Citrate levels in milk and cheese ...... 15 Citrate metabolism of lactobacilli...... 15 References...... 18
2. Isolation, characterization, and citrate utilization of nonstarter Lactobacillus in Swiss cheese...... 23
Abstract...... 23 Introduction...... 24 Materials and methods ...... 27 Results and discussion...... 32 References...... 39
x 3. Effect of adjunct Lactobacillus strains on the characteristics of Swiss cheese manufactured using the low cooking temperature required for kosher-certified whey...... 47
Abstract...... 47 Introduction...... 48 Materials and methods ...... 50 Results and discussion...... 58 References...... 65
4. Chemical, microbiological, and physical characteristics of commercial Swiss-type cheeses...... 82
Abstract...... 82 Introduction...... 83 Materials and methods ...... 85 Results and discussion...... 90 References...... 95
Bibliography ...... 104
xi LIST OF TABLES
Table Page
2.1. Number and species of Lactobacillus strains found in each cheese ...... 43
2.2. Growth of selected Lactobacillus isolates on citrate differential medium and percent relative growth rates on mMRS...... 44
2.3. Maximum specific growth rate (µmax) and time to reach µmax for lactobacilli strains in basal media containing 30 mM glucose or citrate...... 45
3.1. Colony and zone colors of starter Lactobacillus helveticus LH32 and adjunct strains L. casei A26, L. casei B21, and L. rhamnosus H2 on esculin cellobiose agar (ECA), citrate differential medium (CDM), and BCP-Gluconate agar, after 24-hour incubation at 37°C...... 69
3.2. Sensory language for Swiss cheese...... 70
3.3. Percent of total lactobacilli identical to adjunct culture added determined using the colony and zone colors on esculin cellobiose agar (ECA), citrate differential medium (CDM), and BCP-Gluconate agar, after 24-hour incubation at 37°C...... 71
3.4. Chemical composition of cheeses...... 72
3.5. Descriptive sensory analysis. Mean scores of 15-Point universal intensity scale...... 73
4.1. Bacterial cell numbers in fifteen Swiss-type cheese...... 97
4.2. Chemical characteristics of fifteen Swiss-type cheeses...... 98
4.3. pH of fifteen Swiss-type cheeses ...... 99
4.4. Physical characteristics of fifteen Swiss-type cheeses...... 100
xiii LIST OF FIGURES
Figure Page
2.1. Dendrogram indicating similarities among Lactobacillus strains based on pulsed field gel electrophoresis of SmaI- and ApaI-digested genomic DNA...... 46
3.1. Changes in population of Lactobacillus spp. (●), Streptococcus thermophilus ( ), and Propionibacterium spp. () during ripening in Swiss cheese manufactured with adjunct strain L. casei A26...... 74
3.2. Changes in population of Lactobacillus spp. (●), Streptococcus thermophilus ( ), and Propionibacterium spp. () during ripening in Swiss cheese manufactured with adjunct strain L. casei B21...... 75
3.3. Changes in population of Lactobacillus spp. (●), Streptococcus thermophilus ( ), and Propionibacterium spp. () during ripening in Swiss cheese manufactured with adjunct strain L. rhamnosus H2 ...... 76
3.4. Changes in population of Lactobacillus spp. (●), Streptococcus thermophilus ( ), and Propionibacterium spp. () during ripening in Swiss cheese manufactured without adjunct strain (control)...... 77
3.5. Changes in pH of cheeses during ripening ...... 78
3.6. Changes in free amino acid concentration during ripening ...... 79
3.7. Changes in organic acid composition ...... 80
3.8. Changes in abundance of mass numbers 73, 85, 86, and 87 during ripening...... 81
4.1. Free amino acids content of fifteen Swiss-type cheeses...... 101
4.2. Short chain free fatty acids content of fifteen Swiss-type cheeses ...... 102
4.3. Principal component analysis plot of electronic nose evaluation of cheeses...... 103
xiv
CHAPTER 1
LITERATURE REVIEW
Swiss cheese and quality parameters
Swiss cheese is a hard cheese produced and consumed in many countries (Pillonel
et al., 2002). The origin of Swiss cheese is Canton Bern, in the Emme valley of
Switzerland. The first domestic Swiss cheese production occurred in New Glarus,
Wisconsin more than a century ago. In the year 1939, a total of 43 million pounds were
manufactured (Wilster, 1980). This number increased to 254 million pounds in 2002.
Today, Ohio is the leading Swiss cheese producer in the U.S., with production of 37% of
all Swiss cheeses manufactured in U.S. (www.nass.usda.gov, 2003).
Swiss-type cheeses include Emmental, Baby Swiss, Jarlsberg, Comté, Beaufort,
Bergkäse, Aplkäse, and Gruyère among many others. The common property pertaining
to all these cheese types is the presence of eyes or holes produced as a result of CO2 production from lactate fermentation by propionibacteria. Gouda cheese is not considered Swiss-type cheese because CO2 is produced from citrate fermentation (Noël et
al., 1999).
Swiss cheese production involves two major microbial fermentations. First is
lactic acid fermentation by thermophilic starter cultures composed of Streptococcus
1 thermophilus and Lactobacillus helveticus or L. delbrüeckii. Streptococcus thermophilus grows first and produces L-lactic acid from lactose by fermenting glucose. Streptococcus thermophilus does not ferment galactose. Lactobacillus helveticus grows next and contributes D- and L-lactate formation by fermenting galactose and residual lactose. The second, is propionic acid fermentation, lactate formed as a result of primary lactic acid fermentation is converted to propionic acid, acetate, and CO2 by propionibacteria (Steffen et al., 1987). The most commonly used starter culture is Propionibacterium freudenreichii subsp. shermanii. While propionic acid and other organic acids give Swiss cheese its characteristic flavor, the CO2 produced is responsible of eye formation
(Mocquot, 1979).
Swiss-type cheeses are classified as cheeses with eyes, there are several cheeses with naturally occurring eyes, however, only the Emmental and rindless block are considered Swiss cheese (Grappin et al., 1999). Though the Swiss-type cheeses produced in Europe and the U.S. are similar, several differences exist in the processing of the cheeses:
1) Starter culture and ripening time
In the U.S. L. helveticus is used instead of L. delbrüeckii supsp. bulgaricus
that is used in Europe. Lactobacillus helveticus has a higher proteolytic
capacity allowing for faster ripening. In Europe, the cheeses are ripened for 6
months to 1 year total, whereas in the U.S. 3-4 months ripening time is used.
2) Adjunct cultures
Lactobacillus casei is often used as an adjunct culture in Swiss-type cheeses
made in Switzerland. This practice is not common in the U.S.
2 3) Cooking temperature
Recently, it was mandated that for Kosher certification of whey products
derived from Swiss cheesemaking, the curds and the whey must be cooked at
<120°F. Thus, many U.S. Swiss cheese companies have lowered their cooking
temperature from the traditional 125°F. European Swiss cheese makers
continue to use the higher temperature.
Though similar cheese products are obtained, these differences in processing
parameters change the microflora and the dynamics of cheese ripening. Thus, results
reported for European-produced cheeses are not necessarily applicable to U.S.-produced
cheeses.
According to United States Standards for Grades of Swiss Cheese, Emmentaler
Cheese (Effective February 22, 2001) §58.2570, Swiss cheese is cheese made by the
Swiss process or by any other procedure which produces a finished cheese having the
same physical and chemical properties as cheese produced by the Swiss process. It is
prepared from milk and has holes, or eyes, developed throughout the cheese by
microbiological activity. It contains no more than 41% of moisture and its solids contain
not less than 43% of milk fat. It is not less than 60 days old and conforms to the
provisions of 21 CFR 133.195, “Cheese and Related Cheese Products,” Food and Drug
Administration.
There are 3 U.S. grades: U.S. Grade A, U.S. Grade B, U.S. Grade C based on
rating the flavor, body, eyes and texture, finish and appearance, and color quality factors.
The final U.S. grade is established on the basis of lowest rating of any one of the quality factors. U.S. Grade A Swiss cheese has the following characteristics:
3 -Flavor: pleasing and desirable characteristic Swiss cheese flavor, consistent with
the age of the cheese, and free from undesirable flavors
-Body: uniform, firm, and smooth
-Eyes and Texture: should be properly set and should possess well-developed
round or slightly oval-shaped eyes, relatively uniform in size and distribution. The
3 13 majority of eyes should be /8 to /16 inch in diameter. The cheese may possess the following characteristics to a very slight degree: dull, rough, and shell; and the following texture characteristics to a very slight degree: checks, picks, and streuble.
-Finish and Appearance: rindless blocks of Swiss cheese should be reasonably
uniform in size and well shaped. The wrapper or covering should adequately and
securely envelop the cheese, be neat, unbroken, and fully protect the surface of the cheese, but may be slightly wrinkled. The surface of the cheese may exhibit mold to a slight degree. There should be no indication that mold has penetrated into the interior of
the cheese.
-Color: natural, attractive, and uniform. The cheese should be white to light yellow in color.
Descriptors for evaluating flavor, body, eyes and texture, finish and appearance, and color of the cheeses are listed and defined in these standards
(www.ams.usda.gov/standards/swiss_revised.pdf, 2001). Typical chemical composition of good quality commercial Swiss cheese is 32-33% fat, 37-38% moisture, 27-28% protein, and final pH of 5.4-5.5, 1-1.5% salt-in-moisture (Kosikowski and Mistry, 1997;
White, 2002).
4 Swiss cheese manufacture
The manufacturing procedure starts with milk treatment. First the milk is pasteurized and standardized. Eventhough raw milk utilization is very common in cheeses produced in Switzerland, Swiss-type cheeses are mainly produced from
pasteurized milk. Milk composition is generally adjusted to a desired protein to fat ratio
in order to control the fat-in-dry matter of the cheese and to achieve uniformity in cheese
production, composition, and quality. Standardization is commonly accomplished by
separating the milk into cream and skim milk, and recombining cream and skim milk to
obtain desired protein to fat ratio. Another method for milk standardization involves the
addition of nonfat milk solids. Next, thermophilic lactic starter cultures are added at the
setting temperature (33-37°C) and the milk is allowed to ripen upto 20 minutes or until
the pH is in the 6.5-6.7 range (Gilles et al., 1983). Rennet addition, is followed by
cutting the curd into small cubes about the size of rice or wheat grains (Kosikowski and
Mistry, 1989). Cooking temperature of the whey and curd mixture is important. In Swiss
cheese manufacture, the curd and the whey are cooked at high temperatures (50-56°C).
Thermophilic starter cultures survive the high cooking temperatures and continue to be
metabolically active during following stages of cheese-making. Cooking at high
temperature helps the expulsion of the whey and results in high level of calcium in the
cheese. The rate of reaching the target temperature is also critical, a rapid cooking rate
would prevent whey removal from the curd. In addition, cooking temperature has an
effect of proteolysis, first by inducing the formation of active plasmin from inactive
plasminogen and then by inactivating the rennet. High cooking temperatures combined
with the other hurdles including antimicrobial systems of milk, antagonistic effect of
5 starter cultures, pH, and lactic acid also help restrict the survival of pathogenic bacteria
(Kerjean et al., 2001). Water addition at the end of cooking is a common practice to reduce firmness and increase elasticity of the cheese. Water addition dilutes lactose in whey and curd mixture resulting in lower lactic acid content in cheese, accelerated propionic acid fermentation and eye formation, increased and more stable elasticity, and improved storage stability (Jaros et al. 1997). Postworking or stirring at cooking temperature continues until the whey pH drops to 6.3-6.5 (Kosikowski and Mistry, 1989).
When postwork is complete, about one third of the whey is pumped into pressings vat, and subsequently, the remaining whey and curd are transferred to the vat. The curds are pressed under whey with gradual increase in pressing weight, whey is drained, and the curd is pressed overnight at 25-40°C. The inhibited acid production resumes during overnight pressing and decreases the pH of the fresh cheese down to 5.2-5.5. The cheese formed is brine salted and stored in pre-cool/pre-ripening room at 1-7°C for upto 2 weeks. Salt content of Swiss-type cheeses ranges from 0.4 to 4.5% in moisture phase, depending on the variety and the origin of the cheese (Anggraeni, 2004). Salt can affect mechanical properties and disturb eye formation, because of its effects on water mobility, mineral balance, water-protein-mineral interactions, enzyme activities, and bacterial growth (Noël, 1999). Factors affecting the final salt content of the cheese include brine concentration, salting time, temperature of curd and brine, cheese geometry, initial moisture content of the curd, and pH of curd and brine (Guinee, 2004). With the transfer of the cheese to warm room for ripening, propionic acid bacteria start to grow and ferment lactate and produce propionic acid, acetic acid, and CO2 (Reinbold, 1972; Noël et al., 1999). The temperature of the warm room and the elasticity of the cheese allow the
6 formation of eyes or holes in the cheese matrix as a result of CO2 production. Once the eyes are fully developed, the cheese is transferred to cold room storage for further ripening. Carbon dioxide production desirable during the “warm room” ripening phase is undesirable during the subsequent “cold room” storage where the cheese texture becomes more rigid.
The characteristics of eyes, flavor, body and texture and shelf-life of Swiss-type cheese results mainly as a combined effect of the quality of the milk, starter cultures, and different cheese making protocols (Gilles et al., 1983; Steffen et al., 1987).
Autolysis of starter bacteria
Casein proteolysis is a very important factor in cheese ripening. Because of low proteinase activity of propionibacteria, their growth is primarily dependent on hydrolysis of casein by starter bacteria. The peptidases of lactobacilli are mainly intracellular and
their release into the cheese matrix necessitates lysis of the cells (Lortal et al., 1997).
Lysis rate has been shown to have a direct effect on proteolysis rate. In Cheddar cheese, autolysis accelerates the rate of cheese ripening (Hannon et al., 2003). A relationship between rate of starter autolysis and the level of lipolysis was shown during Cheddar
cheese ripening (Collins et al., 2003). In Swiss cheese, autolysis of starter lactobacilli
starts at the end of pressing (Valence et al., 1998).
Autolysis is a consequence of hydrolysis of cell wall by the effect of autolysins.
Autolysin is a hydrolase that degrades the peptidoglycan of the producing strain (Kang et al., 2003). The rate and the extent of this enzymatic reaction is dependent on physical and biochemical parameters which may act on the enzyme or the substrate. The strain
7 type and the physiological state of the cells affect the rate and the extent of autolysis.
Strain dependence of L. helveticus and propionibacteria autolysis is well studied, however, limited data is available for autolysis of other lactobacilli (Lortal et al., 1997).
Recently, Kang et al. (2003) detected an 80 kDa intracellular peptidoglycan hydrolase in
L. delbrueckii subsp. bulgaricus, one of two autolysins previously shown to be present in
L. bulgaricus cell walls.
Valence et al. (2000) studied, in Swiss cheese, the autolysis of 2 L. helveticus strains, LH1 and LH77, showing different autolyis rate in buffer solution. Comparison of
LH1 and LH77 autolysis in buffered solutions indicated greater autolysis for LH77. In
Swiss cheese a more extensive lysis of LH1 was demonstrated compared to LH77. The decrease in viability was similar indicating that LH77 was not lysed but dead or not culturable (Valence et al., 2000). The methods employed to study autolysis include quantification of released intracellular components such as DNA and enzymes (lactate dehydrogenase and dipeptidase) and monitoring decrease in culture turbidity (Lortal et al., 1997).
Nonstarter bacteria
Nonstarter bacteria are those bacteria found in large numbers in cheese, but that were not added intentionally as part of the starter cultures. Their presence can affect the cheese flavor and appearance positively or negatively, or have no effect.
In Swiss cheese manufacture S. thermophilus and L. helveticus are used as the thermophilic starter cultures. Streptococcus thermophilus is the primary acid producer during cheesemaking, L. helveticus is used as a secondary acid producer, it helps control
8 the pH of the cheese, contributes to proteolysis and flavor formation during ripening. In
Swiss cheese, plasmin and rennet are responsible for initial hydrolysis of caseins. Large peptides produced by proteinases such as cathepsin, and plasmin are subsequently degraded to smaller peptides and free amino acids by the enzymes from starter and nonstarter microflora. Thermophilic lactic acid bacteria give essential active peptidases such as aminopeptidases and carboxypeptidases by means of early lysis during temperate
(pre-cool) room ripening, and release of intracellular peptidases active during warm room ripening (Gagnaire et al., 2001a).
In Swiss-type cheeses, three flora follow one another during ripening. These are thermophilic lactic starters, propionibacteria, and nonstarter lactic acid bacteria (Gagnaire et al., 2001b). Proteolysis and development of texture and flavor are affected by the changes in microflora.
Nonstarter lactic acid bacteria are adventitious bacteria that gain entry to cheese primarily during manufacture via cheese milk and cheese-making equipment. The numbers of nonstarter lactobacilli increase as the cheese ripens, they usually consist of a
mixture of different lactobacilli species predominantly constituted of species L. casei, L.
plantarum, and L. brevis. This increase in nonstarter numbers corresponds to positive or
negative flavor and texture attributes. In many studies, addition of lactobacilli as adjunct
results in better quality scores.
In small scale experimental Swiss cheese, Valence et al. (2000), studied the
viability of starter and during ripening. Nonstarter lactic acid bacteria not detectable at
the beginning of ripening did not exceed 106 CFU/g at any time. In another study,
majority of the lactobacilli isolated from hard Swiss-type cheese were facultatively
9 heterofermentative, and the levels ranged between the detection limit at the beginning of cheese making and 108 CFU/g of ripened cheese (Jimeno et al., 1995).
Grappin et al. (1999) evaluated change in microbial population in Comté cheese during ripening. Authors have observed a rapid decrease in thermophilic lactic acid bacteria, and an increase in the numbers of facultatively heterofermentative lactobacilli.
After one month of ripening, lactobacilli population was dominated by facultatively heterofermentative lactobacilli, namely, L. paracasei subsp. paracasei, and L. rhamnosus, as well as obligately heterofermentative lactobacilli L. fermentum.
Nonstarter microorganisms, particularly facultatively heterofermentative lactobacilli induce higher proteolysis (Grappin et al., 1999).
The interaction between lactobacilli and propionibacteria is also very important.
Growth of Propionibacterium freudenreichii is required for the characteristic eye formation and flavor development in Swiss cheese. Increased proteolysis during ripening and intense propionic acid fermentation may cause formation of splits and checks
(Grappin et al., 1993; Jimeno et al. 1995; Noël et al. 1999). Certain L. casei and L. rhamnosus strains isolated from different cheese types in Switzerland were proven to inhibit the growth of P. freudenreichii when added as supplemental cultures during
Emmentaler cheese production (Jimeno et al., 1995). The cheeses made with added L. casei and L. rhamnosus had reduced opening. Inhibition of P. freudenreichii was related to metabolic end products of these cultures as a result of citrate utilization (Jimeno et al.,
1995).
Facultatively heterofermentative lactobacilli, L. paracasei subsp. paracasei, and
L. rhamnosus had an inhibitory effect on the growth of P. freudenreichii in Emmental
10 cheese, the effect was most likely to be related to diacetyl, acetate, and formate production by lactobacilli (Grappin et al., 1999).
When glucose is limited, L. casei is known to convert glucose to acetate, formate, and ethanol as well as to lactate (predominantly). D-lactate levels also increase as a result of glucose limitation (Liu, 2003). Propionibacteria preferentially utilizes L-lactate over D-lactate.
Piveteau et al. (1995) studied the interactions between lactic and propionic acid bacteria. All 14 strains of lactic acid bacteria tested stimulated the growth of all 4 propionic acid bacteria tested. The degree of stimulation varied among different lactic acid bacteria (Piveteau et al., 1995).
Formation of splits have been attributed to several parameters such as type of starter and nonstarter propionibacteria, cheese elasticity, and starter or nonstarter lactic
acid bacteria metabolite stimulation of propionibacteria (White et al., 2003).
Occurrence of nonstarter lactobacilli in Cheddar cheese has been well studied.
Starter cultures used for Cheddar cheese manufacture belong to the genus Lactococcus.
Nonstarter lactobacilli which gain entry to cheese during via cheese milk or during
cheesemaking, multiply during ripening and reach 106-108 CFU/g in the mature cheese.
In Irish Cheddar nonstarter lactic acid bacteria are mainly mesophilic lactobacilli such as
L. casei, L. plantarum, and L. curvatus (Lynch et al., 1997). In New Zealand Cheddar, L rhamnosus and L. paracasei are more commonly found. Their composition in cheeses varies between factories and days of manufacture (Crow et al., 2001).
Isolated nonstarter lactobacilli have been used as adjunct cultures in cheese manufacture. Studies on experimental cheeses containing adjunct lactobacilli show
11 improved flavor intensity and acceptability and higher levels of free amino acids when
compared to control cheeses (Lynch et al., 1997). However, their effect could be
positive, negative, or neutral depending on the strains that predominate and their roles
during ripening (Crow et al., 2001). In some cases, racemization of L-lactate to D-lactate
by certain nonstarter lactic acid bacteria may result in calcium lactate crystal defect, slits
in Cheddar have also been attributed to heterofermentative lactobacilli (Crow et al., 2001;
Kieronczyk et al., 2003; Swearingen et al., 2001).
To determine the effect of thermophilic lactobacilli in sugar fermentation, Turner et al. (1983) made Swiss cheese with L. helveticus, L. bulgaricus, and no Lactobacillus as a part of starter culture. Nonstarter lactic acid bacteria reached to levels in excess of 106
CFU/g. The pH was always higher than 5.4 and the cheeses had a tough texture.
Numerous good round eyes were formed, however, many splits were also present (Turner
et al., 1983).
To have high concentrations of desirable nonstarter lactobacilli in cheese throughout ripening provides balanced flavor reactions and due to competition, and
minimize the possible effects of undesirable adventitious nonstarter lactic acid bacteria
(Crow et al., 2001). Addition of nonstarter bacteria can also affect the proteolysis in
cheese. Comparison of experimental cheeses made with highly proteolytic starters and
starters with weak proteolytic activity demonstrated that presence of high concentration
of free amino acids inhibit the growth of propionibacteria whose development seem to be
much more dependent of peptides rather than free amino acids (Baer, 1995).
Facultatively heterofermentative nonstarter lactic acid bacteria are used in the
Swiss artisanal cheese industry to slow down propionic acid fermentation. In
12 Switzerland, a mixed culture composed of 3 L. casei strains from to the culture collection
of Swiss Dairy Research Station, FAM Leebefeld, is generally sold to prevent late
fermentation in Emmentaler cheeses or to enhance eye formation in semi-hard cheeses
with no propionic acid fermentation. The inhibition mechanism is not yet clarified; however it is attributed to the inhibitory effect of excess formate and acetate on propionibacteria. Sensory analysis show slightly poorer quality of cheeses made with addition of mixed L. casei culture, possibly due to higher acetate levels (Frohlich-Wyder,
2002).
Though the use of L.casei as an adjunct culture is common for Swiss-type cheese manufactured in Switzerland, few published reports exist on adjunct use and none exist for adjunct use in U.S.-manufactured Swiss.
Molecular methods for identification of Lactobacillus
The genus Lactobacillus is one of the most important genera of lactic acid bacteria. Today, “unofficially”, there are more than 80 species in genus Lactobacillus.
Of these species about 19 are associated with dairy products (Coeuret et al., 2003).
Conventional methods based on cell morphology and biochemical tests employed for typing of lactobacilli are not always completely reliable when strains show intermediate characteristics. With the development of molecular typing methods, there have been significant improvements in classification and identification of lactobacilli.
Review articles related to typing methods focusing on lactobacilli and dairy products have recently been published (Coeuret et al., 2003; Lick, 2003).
13 Analyses at the species level include protein fingerprinting, multilocus enzyme
electrophoresis, lipid profiling, DNA hybridization, DNA sequencing, polymerase chain
reaction (PCR), ribotyping, and PCR-restriction fragment length polymorphism (PCR-
RFLP).
Molecular typing at the strain level can be accomplished by using methods such
as restriction enzyme analysis (REA), randomly amplified polymorphic DNA/arbitrarily
primed (RAPD/AP)-PCR, repeated sequenced (REP)-PCR, enterobacterial repetitive
intergenic consensusus (ERIC)-PCR, amplified fragment length polymorphism (AFLP),
pulsed field gel electrophoresis (PFGE), plasmid profiling, phage-related DNA
polymorphism. PCR-differential gradient gel electrophoresis (DGGE), PCR-temperature
gradient gel electrophoresis (TGGE), and PCR-single strand conformation polymorphism
(SSCP) are culture independent methods that give a profile of the populations present in a
complex matrix.
Despite the presence of all these novel methodologies for isolation,
characterization, and identification of lactobacilli, a common criterion for the clear
differentiation of one biotype from another is still lacking. Achieving a complete result is
only possible by using a combination of different methods. Pulsed field gel
electrophoresis, based on restriction lengths polymorphisms and PCR sequence
comparison of 16S-23S intergenic spacer region are the most reliable methods for differentiation and identification of unknown Lactobacillus strains at the species level
(Lick, 2003; Tannock et al., 1999; Tilsala-Timisjarvi and Alatossava, 1997).
14 Citrate levels in milk and cheese
It is well documented that citrate levels in soluble and colloidal phases of milk, and its interaction with milk proteins affect the stability and some functional properties of dairy products (Izco et al., 2003). In general citric acid levels in milk vary between 8.2-
10 mM. In Cheddar cheese, depending on the starter culture used, citrate levels can vary between 0.1- 2% (wt/wt) during ripening of cheese (Fox and McSweeney, 1998; Izco et al., 2003). Citrate metabolism enhance the growth of lactococci in milk (Haddad et al.,
1997). Citrate, when not already metabolized by starters used in cheese manufacture can be utilized by certain nonstarter lactic acid bacteria, and affects quality parameters of the cheese (Palles et al., 1998).
In Swiss cheese, citrate is mostly metabolized by facultatively heterofermentative lactobacilli within the first 40 days of ripening. Approximately 9 mmol citrate/kg cheese is initially present. Nonstarter facultatively heterofermentative lactobacilli utilize 3 mmol/kg of citrate, and starter lactobacilli metabolize all available citrate to formate and acetate (Frohlich-Wyder, 2002).
Citrate metabolism of lactobacilli
Citrate metabolism of nonstarter lactobacilli may have a significant role during cheese ripening. There are important differences in citrate utilization among lactobacilli.
Various strains belonging to species L. rhamnosus, L. zeae, and L. plantarum can utilize citrate as the sole energy source, other strains can co-metabolize citrate with certain carbohydrates (De Figueroa et al., 2000).
15 Many lactic acid bacteria such as Lactococcus and Leuconostoc spp. metabolize citrate to CO2, acetate, acetoin, diacetyl, and 2,3-butanediol. Palles et al. (1998) studied citrate metabolism in L. casei and L. plantarum. The authors concluded that acetate and acetoin are the major products of citrate metabolism, and that these bacteria can utilize citrate in ripening cheese when other energy sources are exhausted (Palles et al., 1998).
Whitley and Marshall (1999) studied the utilization of citrate by L. amylovorus. This microorganism was unable to utilize citrate as the sole energy source, however, citrate could be metabolized in the presence of glucose and ribose; the presence of citrate in the medium in addition to glucose and ribose increased growth rate of the cells and increased acetate formation and gas production (Whitley and Marshall, 1999).
In Swiss cheese, lactate, the end product of lactose fermentation by starter bacteria are further catabolized by propionibacteria to propionate, acetate, and CO2 and in some cases by nonstarter lactic acid bacteria to acetate and CO2. The energy source for growth of nonstarters is not likely to be lactose since it is completely metabolized by starters early during cheesemaking process. Lactate metabolism by lactic acid bacteria affects flavor, texture, and appearance of cheese (Liu, 2003). Increased lactate production through citrate catabolism, and CO2 production during this process can potentially cause defective eye formation along with altered flavor and texture characteristics. On the other hand, these defects can be minimized if citrate fermenter cultures are used in Swiss cheese manufacture, and all citrate is utilized prior to warm room storage (Pius Felder, 2002,personal communication). Clearly, more testing is necessary to characterize the effect of citrate fermenter lactobacilli on Swiss cheese quality.
16 Citrate metabolism has been studied in several lactic acid bacteria including
Streptococcus, Lactococcus, and Leuconostoc spp. (Kempler and McKay, 1980; Martin et al., 1999). Current knowledge, based on these studies, indicate that citrate uptake is mediated by citrate permease. Once transported into the cell by the action of citrate permease, citrate is broken down to oxaloacetate and acetate by the enzyme citrate lyase:
Citrate Æ acetate + oxaloacetate Æ CO2 + pyruvate Æ lactate
Pyruvate can also be catabolized to different compounds such as acetate, formate, acetaldehyde, ethanol, alanine, diacetyl, acetoin, 2,3-butanediol (Liu, 2003).
The regulation of expression of citP gene encoding citrate permease, has been extensively studied in Lactococcus and Leuconostoc spp. (Martin et al., 1999; Vaughan et al., 1995). Citrate transport is mediated by plasmid-encoded citrate permease P (CitP) in
Lactococcus lactis subsp. lactis biovar diacetylactis and is induced by acid stress (Garcia-
Quintans et al., 1998). The citP gene of Leuconostoc spp. is almost identical to that of
lactococci, and is located on a plasmid and induced by the presence of citrate in the
growth medium (Martin et al., 1999). Citrate transport studies in lactobacilli indicate that
citrate transport is inducible by citrate and in lactobacilli, citrate permease is not coded by
a plasmid (De Figueroa et al., 2000; Martin et al., 1999; Vaughan et al., 1995). At the
moment, the citP gene from Lactobacillus has not been characterized, and more studies
are needed to distinguish the effect(s) of citrate utilizing nonstarter lactobacilli.
17 REFERENCES
Anggreani, O. 2004. Effects of glycine betaine and proline on salt tolerance of Propionibacterium freudenreichii strains. M.S. Thesis. The Ohio State University, Columbus, Ohio
Baer, A. 1995. Influence of casein proteolysis by starter bacteria, rennet and plasmin on the growth of propionibacteria in swiss-type cheese. Lait 75: 391-400.
Baer, A., I. Ryba, J. Meyer, and U. Buetikofer. 1996. Micro-plate assay of free amino acids in swiss cheeses. Food Science & Technology (London) 29: 58-62.
Coeuret, V., S. Dubernet, M. Bernardeau, M. Gueguen, and J. P. Vernoux. 2003. Isolation, characterisation and identification of lactobacilli focusing mainly on cheeses and other dairy products. Lait 83: 269-306.
Collins, Y. F., P. L. McSweeney, and M. G. Wilkinson. 2003. Evidence of a relationship between autolysis of starter bacteria and lipolysis in cheddar cheese during ripening. Journal of Dairy Research 70: 105-113.
Crow, V., B. Curry, and M. Hayes. 2001. The ecology of non-starter lactic acid bacteria (nslab) and their use as adjuncts in new zealand cheddar. International Dairy Journal 11: 275-283.
De Figueroa, R. M., F. Alvarez, A. P. De Ruiz Holgado, G. Oliver, and F. Sesma. 2000. Citrate utilization by homo- and heterofermentative lactobacilli. Microbiological Research 154: 313-320.
Felder, P. 2002. Personal communication.
Fox, P. F., and P. L. H. McSweeney. 1998. Dairy chemistry and biochemistry.
Frohlich-Wyder, M.-T. 2002. Interactions between propionic acid bacteria and starter- /non-starter lactic acid bacteria in emmentaler cheese. Lebensmittelindustrie und Milchwirtschaft 123: 31-34.
Gagnaire, V., R. Boutrou, and J. Leonil. 2001a. How can the peptides produced from emmental cheese give some insights on the structural features of the paracasein matrix? International Dairy Journal 11: 449-454.
Gagnaire, V., D. Molle, M. Herrouin, and J. Leonil. 2001b. Peptides identified during emmental cheese ripening: Origin and proteolytic systems involved. Journal of Agricultural and Food Chemistry 49: 4402-4413.
18
Garcia-Quintans, N., C. Magni, D. de Mendoza, and P. Lopez. 1998. The citrate transport system of lactococcus lactis subsp. Lactis biovar diacetylactis is induced by acid stress. Applied and Environmental Microbiology 64: 850-857.
Gilles, J., K.W. Turner, and F.G. Martley. 1983. Swiss-type cheese 1. Manufacturing and sampling procedures. New Zealand Journal of Dairy Science 18:109-115.
Grappin, R., E. Beuvier, Y. Bouton, and S. Pochet. 1999. Advances in the biochemistry and microbiology of swiss-type cheeses. Lait 79: 3-22.
Guinee, T.P. 2004. Salting and the role of salt in cheese. International Journal of Dairy technology. 57: 99-109.
Haddad, S., I. Sodini, C. Monnet, E. Latrille, and G. Corrieu. 1997. Effect of citrate on growth of lactococcus lactis subsp. Lactis in milk. Applied Microbiology and Biotechnology 48: 236-241.
Hannon, J. A., M.G. Wilkinson, C.M. Delahunty, J.M. Wallace, P.A. Morrissey, and T.P. Beresford. 2003. Use of autolytic starter systems to accelerate the ripening of cheddar cheese. International Dairy Journal 13: 313-323.
Izco, J. M., M. Tormo, A. Harris, P. S. Tong, and R. Jimenez-Flores. 2003. Optimization and validation of a rapid method to determine citrate and inorganic phosphate in milk by capillary electrophoresis. Journal of Dairy Science 86: 86-95.
Jaros, D., W. Ginzinger, E. Tschager, H.K. Mayer, and H. Rohm. 1997. Effects of water addition on composition and fracture properties of Emmental cheese. Lait 77: 467- 477.
Kang, O. J., S. Laberge, and R. E. Simard. 2003. Detection and localization of a peptidoglycan hydrolase in lactobacillus delbrueckii subsp. Bulgaricus. Journal of Dairy Science 86: 96-104.
Kempler, G. M., and L. L. McKay. 1980. Improved medium for detection of citrate fermenting streptococcus lactis ssp diacetylactis. Applied and Environmental Microbiology 39: 926-927.
Kerjean, J.R., H.P. Bachmann, and T. Cogan. 2001. Technical note: Cooking temperature of whey and curd during Emmental cheese-making. Milchwissenschaft 56: 556.
Kieronczyk, A., S. Skeie, T. Langsrud, and M. Yvon. 2003. Cooperation between lactococcus lactis and nonstarter lactobacilli in the formation of cheese aroma from amino acids. Applied and Environmental Microbiology 69: 734-739.
19 Kosikowski, F. V., and V. V. Mistry. 1997. Cheese with eyes. In: F. V. Kosikowski and V. V. Mistry (eds.) Cheese and fermented milk foods No. 2. p 108-117, Westport, CT.
Lick, S. 2003. Review: Typing systems for lactobacilli. Milchwissenschaft 58: 256-260.
Liu, S. Q. 2003. Practical implications of lactate and pyruvate metabolism by lactic acid bacteria in food and beverage fermentations. International Journal of Food Microbiology 83: 115-131.
Lortal, S., R. Lemee, and F. Valence. 1997. Autolysis of thermophilic lactobacilli and dairy propionibacteria: A review. Lait 77: 133-150.
Lynch, C. M., P. L. H. McSweeney, P. F. Fox, T. M. Cogan, and F. D. Drinan. 1997. Contribution of starter lactococci and non-starter lactobacilli to proteolysis in cheddar cheese with a controlled microflora. Lait 77: 441-459.
Martin, M., M. A. Corrales, D. de Mendoza, P. Lopez, and C. Magni. 1999. Cloning and molecular characterization of the citrate utilization citmcdefgrp cluster of leuconostoc paramesenteroides. FEMS Microbiology Letters 174: 231-238.
Mocquot, G. 1979. Reviews of the progress of dairy science: Swiss-type cheese. Journal of Dairy Research 46: 133-160.
Noël, Y, P. Poyoval, A. Thierry, V. Gagnaire, and R. Grappin. 1999. Eye formation and Swiss-type cheeses. p.222-250. In B.A. Law (ed.), Technology of cheese making CRC Press, Boca Raton, FL.
Palles, T., T. Beresford, S. Condon, and T. M. Cogan. 1998. Citrate metabolism in lactobacillus casei and lactobacillus plantarum. Journal of Applied Microbiology 85: 147-154.
Pillonel, L., R. Badertscher, U. Bütikofer, M. Casey, M. Dalla Torre, P. Lavanchy, J. Meyer, R. Tabacchi, and J. Bosset. 2002. Analytical methods for the determination of the geographic origin of emmentaler cheese. Main framework of the project; chemical, biochemical, microbiological, colour and sensory analyses. European Food Research and Technology 215: 260-267.
Piveteau, P. G., S. Condon, and T. M. Cogan. 1995. Interactions between lactic and propionic acid bacteria. Lait 75: 331-343.
Steffen, C., Flueckiger, E., Bosset, J.O. and M. Ruegg. 1987. Swiss-type varities. In: P. F. Fox (ed.) Cheese: Chemistry, physics and microbiology No. 2. p 93-120. Elsevier Applied Science Publisheres Ltd., New York.
20 Swearingen, P. A., D. J. O'Sullivan, and J. J. Warthesen. 2001. Isolation, characterization, and influence of native, nonstarter lactic acid bacteria on cheddar cheese quality. Journal of Dairy Science 84: 50-59.
Tannock, G. W., A. Tilsala-Timisjarvi, S. Rodtong, J. Ng, K. Munro, and T. Alatossava. 1999. Identification of lactobacillus isolates from the gastrointestinal tract, silage, and yoghurt by 16s-23s rrna gene intergenic spacer region sequence comparisons. Applied and Environmental Microbiology 65: 4264-4267.
Tilsala-Timisjarvi, A., and T. Alatossava. 1997. Development of oligonucleotide primers from the 16s-23s rrna intergenic sequences for identifying different dairy and probiotic lactic acid bacteria by pcr. International Journal of Food Microbiology 35: 49-56.
Turner, K. W., H. A. Morris, and F. G. Martley. 1983. Swiss-type cheese. Ii. The role of thermophilic lactobacilli in sugar fermentation. New Zealand Journal of Dairy Science and Technology 18: 117-124.
Valence, F., S.-M. Deutsch, R. Richoux, V. Gagnaire, and S. Lortal. 2000. Autolysis and related proteolysis in swiss cheese for two lactobacillus helveticus strains. Journal of Dairy Research 67: 261-271.
Valence, F., R. Richoux, A. Thierry, A. Palva, and S. Lortal. 1998. Autolysis of lactobacillus helveticus and propionibacterium freudenreichii in swiss cheeses: First evidence by using species-specific lysis markers. Journal of Dairy Research 65: 609- 620.
Vaughan, E. E., S. David, A. Harrington, C. Daly, G.F. Fitzgerald, and W.M. De Vos. 1995. Characterization of plasmid-encoded citrate permease (citp) genes from leuconostoc species reveals high sequence conservation with the lacotococcus lactis citp gene. Applied and Environmental Microbiology 61: 3172-3176.
White, S. R., J. R. Broadbent, C. J. Oberg, and D. J. McMahon. 2003. Effect of lactobacillus helveticus and propionibacterium freudenreichii ssp. shermanii combinations on propensity for split defect in swiss cheese. Journal of Dairy Science 86: 719-727.
Whitley, K., and V. M. Marshall. 1999. Heterofermentative metabolism of glucose and ribose and utilization of citrate by the smooth biotype of lactobacillus amylovorus ncfb 2745. Antonie van Leeuwenhoek 75: 217-223.
Wilster, G. H. 1980. Practical cheesemaking. Thirteenth ed. Oregon State University Book Stores Inc., Corvallis, OR.
21 www.ams.usda.gov/standards/swiss_revised.pdf. 2001. United states standards for grades of Swiss cheese, emmentaler cheese. United States Department of Agriculture, Agricultural Marketing Service, Dairy Programs.
22
CHAPTER 2
ISOLATION, CHARACTERIZATION, AND CITRATE UTILIZATION OF
NONSTARTER LACTOBACILLUS IN SWISS CHEESE
ABSTRACT
Nonstarter Lactobacillus strains affect the quality of many cheese varieties. The
ability of some nonstarter strains to metabolize citrate may reduce the occurrence of the
split defect in Swiss cheese. The objectives of this study were to isolate and identify nonstarter Lactobacillus strains in high quality commercial Swiss cheeses and to investigate citrate metabolism among nonstarter lactobacilli. Lactobacilli were selected from six domestic and two European Swiss cheeses with selective medium and the strains from each cheese were genetically typed and speciated. Qualitative and quantitative citrate utilization assays were performed on each strain. The total number of
Lactobacillus cells ranged from 4.8 × 104 to 7.1 × 107 CFU/g cheese. Strains belonging
to L. casei, L. rhamnosus, and L. fermentum species were most frequently encountered.
Lactobacillus casei strains predominated in the cheeses originating in Switzerland;
whereas, the domestic cheeses contained a wider variety of Lactobacillus species,
including different strains of L. casei, L. rhamnosus, L. gasseri, L. delbrüeckii, and L. 23 fermentum. Citrate differential medium was valuable in rapid assessment of citrate utilization of lactobacilli. On this medium, L. helveticus, L. gasseri, and L. delbrüeckii strains did not metabolize citrate, while, L. casei, L. fermentum, and L. rhamnosus strains utilized citrate. Percent relative growth in modified MRS broth with glucose or citrate confirmed that L. delbrüeckii and L. helveticus strains cannot metabolize citrate as the sole carbon source. Among the other strains tested, L. casei strains were strong citrate utilizers followed by L. rhamnosus, L. fermentum, and L. gasseri strains. A putative citP gene fragment from one citrate-utilizing L. casei strain was amplified, cloned, and sequenced. Distribution of the putative citP gene in Swiss cheese nonstarter lactobacilli was determined by Southern hybridization using amplified fragment as a probe. Eight out of 22 strains tested had sequence homology to the probe. Characterization of nonstarter strains from high quality cheeses may lead to new adjunct cultures specific for
Swiss cheese. Understanding the occurrence, types, and metabolic capabilities of nonstarter Lactobacillus in Swiss cheese will allow further studies of their role in cheese ripening and their effect on Propionibacterium fermentation.
INTRODUCTION
Swiss cheese production involves two major microbial fermentations. First is the lactic acid fermentation where over 90% of the lactose present in milk is converted to lactic acid. The second fermentation is the propionic acid fermentation. In this stage; the lactate formed from the primary lactic acid fermentation is converted to propionic acid, acetic acid, and CO2 by propionibacteria (Steffen et al., 1987). While propionic acid and
24 other organic acids give Swiss cheese its characteristic flavor, the CO2 produced is responsible for eye formation (Mocquot, 1979). Common Swiss cheese starter cultures are composed of Streptococcus thermophilus, Lactobacillus helveticus (or L. delbrüeckii), and Propionibacterium freudenreichii strains. The type of starter cultures used and presence of nonstarter bacteria are known to affect cheese flavor and quality (Martley and
Crow, 1996; Lawler et al., 2003).
Nonstarter lactic acid bacteria are adventitious bacteria that gain entry to cheese primarily during manufacture via cheese milk and cheese-making equipment, are found in large numbers in cheese, but that were not added intentionally as part of the starter cultures. The numbers of nonstarter lactobacilli increase as the cheese ripens, and their presence can affect the cheese flavor and appearance positively or negatively, or have no effect. Nonstarter bacteria found in cheeses usually consist of a mixture of Lactobacillus species predominantly L. casei, L. plantarum, and L. brevis strains (Banks and Williams,
2004; Weinrichter et al., 2001).
Conventional methods based on cell morphology and biochemical tests employed for typing of lactobacilli are not completely reliable when strains show intermediate characteristics. With the development of molecular typing methods, there have been significant improvements in classification and identification of lactobacilli. Review articles related to typing methods focusing on lactobacilli and dairy products have been published (Coeuret et al., 2003; Lick, 2003). Despite the presence of novel methodologies for isolation, characterization, and identification of lactobacilli, a common criterion for the clear differentiation of one biotype from another is still lacking.
Achieving a definitive result is only possible by using a combination of different
25 methods. Pulsed field gel electrophoresis, based on restriction fragment length
polymorphisms, and PCR sequence comparison of 16S-23S intergenic spacer region are
the most reliable methods for differentiation and identification of unknown Lactobacillus
strains at the species level (Lick, 2003; Tannock et al., 1999; Tilsala-Timisjarvi and
Alatossava, 1997).
Citrate is naturally found in milk and cheese. In general citrate levels in milk are
0.15-0.19% (wt/wt). In Cheddar cheese, depending on the starter culture used, citrate
levels can vary between 0.5-2% (wt/wt) during cheese ripening (Fox and McSweeney
1998; Izco et al., 2003). Citrate concentrations of 0.8-1.4% (wt/wt) were reported on
Emmental cheeses from Switzerland (Preininger et al, 1996).
Citrate, when not already metabolized by starter culture bacteria during cheese
production, can be utilized by certain nonstarter lactic acid bacteria during cheese
ripening. Citrate metabolism during cheese ripening may affect cheese quality parameters (Palles et al., 1998). In particular, citrate metabolism yields carbon dioxide gas, which can cause undesirable splits and cracks. Splits and cracks continue to be a problem to Swiss cheese manufacturers, resulting in downgrading of the cheese and lower economic returns to the company.
There are important differences in citrate utilization among lactobacilli. Various strains belonging to species L. rhamnosus, L. zeae, and L. plantarum can utilize citrate as the sole energy source, other strains can co-metabolize citrate with certain carbohydrates
(De Figueroa et al., 2000). The regulation of citP gene expression has been extensively studied in Lactococcus and Leuconostoc spp. (Vaughan et al., 1995; Martin et al., 1999).
26 Presently, the citP gene from Lactobacillus has not been characterized, and more studies are needed to fully study the effect(s) of citrate utilizing nonstarter lactobacilli.
The present study is the first report identifying and characterizing nonstarter lactobacilli from commercially manufactured U.S. and European Swiss cheeses.
Improved understanding of citrate metabolism of nonstarter lactobacilli will allow further studies on the role of citrate utilization as it relates to cheese quality.
MATERIALS AND METHODS
Cheese sampling and Lactobacillus enumeration
Six domestic Swiss cheeses were obtained from Ohio manufacturers and two
European Emmental cheeses were purchased at a local supermarket. The cheeses were coded (A-H) for confidentiality. A one-gram sample was aseptically removed from the interior of the cheese with a sterile cheese trier, diluted 10-fold in 2% sodium citrate and homogenized. Further decimal dilutions were prepared in peptone water, and dilutions were plated on Rogosa SL agar (Difco, Beckton, Dickinson, Sparks, MD), a selective medium for lactobacilli.
Lactobacillus strain differentiation and clustering
Eighty Lactobacillus colonies from each cheese were selected and genetically typed by pulse field gel electrophoresis (PFGE) to differentiate the strains. The bacterial
DNA was prepared for PFGE as described by Jenkins et al. (2002). Genomic DNA cut with restriction enzymes ApaI or SmaI were evaluated using following conditions: 1%
27 PFGE agarose gel, 0.5 x TBE buffer, 5 V cm-1 and 1-12 s switching time for 14 h,
followed by 0.5-2 s switching time for 3 h. The resulting band profiles were analyzed
using GelCompar, version 4.2 (Applied Maths, Kortrjik, Belgium). Comparisons
between the normalized PFGE band profiles were made using the Dice similarity
coefficient with 1% position tolerance and 0.5 % change towards the end of fingerprint.
The similarity matrices resulting from two enzyme digestions were compiled. The
compiled matrix was used for cluster analysis using the unweighted pair group method
with arithmetic average (UPGMA) clustering algorithm.
Lactobacillus species determination
The species of each strain was determined by amplifying the 16S-23S rRNA
intergenic spacer region of one representative isolate from each different PFGE banding
pattern. Primers that anneal to conserved regions of the 16S and 23S rRNA genes were
used as described by Tannock et al. (1999). Expand High Fidelity PCR System DNA
polymerase (Roche Applied Science, Indianapolis, IN) was used for PCR amplification.
PCR products were electrophoresed through a 1% agarose gel, stained in ethidium bromide solution, and visualized by UV transillumination. The smallest PCR product
(about 500 to 600 bp) was excised from the gel and purified using the QIAquick® Gel
Extraction Kit (Qiagen Inc., Valencia, CA) for direct sequencing. Purified DNA was sequenced using primer 16-1A (Tannock, 1999) at the Ohio State University Plant-
Microbe Genomics Center (Columbus, OH) using the BigDye Terminator Cycle
Sequencing chemistry and a 3700 DNA analyzer (Applied Biosystems, Foster City, CA).
The sequences of the intergenic spacer regions were compared to known sequences in
28 GenBank, and isolated strains were identified to species level when sequences were ≥
97.5% similar to sequences in the database using the BLASTN algorithm (Altschul et al.,
1990). Additional species confirmation of selected strains was done using API50CH test
(bioMérieux, Marcy l’Etoile, France).
Screening isolated nonstarter lactobacilli for citrate utilization
Stationary phase cultures (A600nm >1.0) were spot inoculated (2 µl) on citrate
differential medium agar plates (Kempler and McKay, 1980) and grown at 37°C anaerobically for 24 hours (Figure 2.2.). The differences in the shade of blue color formed in this medium has been stated to be due to differences in cells’ abilities to transport citrate (Kempler and McKay, 1980). Blue color formation indicates that citrate was depleted by the bacteria. White color indicates that no citrate was consumed.
To more quantitatively assess citrate utilization of these strains, growth with citrate or glucose as the sole carbon source was monitored using modified MRS broth lacking acetate, citrate, and beef extract and supplemented with 10 mM MgCl2 as
described by Jimeno et al. (1995). Glucose or citrate was added to a concentration of 30
mM. Bacterial growth was monitored during 24 h of anaerobic incubation at 37°C by
measuring absorbance at 600nm (Spectronic 20 Genesys, Spectronic Instruments,
Rochester, NY). Prior to inoculation, cultures grown overnight to stationary phase in
MRS broth were washed twice in sterile phosphate buffered saline (PBS, pH 7.0). To eliminate the effect of pH on growth, pH of basal modified MRS medium, and media
containing citrate or glucose was adjusted to 6.5. Measurements were normalized by
subtracting the values corresponding to growth observed on basal modified MRS medium
29 without a supplied energy source. The test strain was considered positive for citrate
utilization when absorbance obtained with citrate as the sole carbon source was at least
30% of the absorption value in media containing glucose as the sole carbon source at the
end of 24 h incubation (Weinrichter et al., 2001). The maximum specific growth rate
(µmax) and time to reach µmax were determined by modeling growth curves using the
Richards model (Dalgaard and Koutsoumanis, 2001).
Cloning the citrate permease (citP) gene from L. casei
One citrate-utilizing strain (L. casei A26) was selected and its genomic DNA was
isolated. Primers (NKC1: 5’AGTATTTTGGGAATGAACCG and NKC4:
5’GTCATTGAGATAACAGT) were designed using Primer Design software
(DNASTAR Inc., Madison, WI) based on the known citP sequences of Lactococcus and
Leuconostoc spp. (GenBank) and incomplete L. casei genome sequence (JGI; Joint
Genome Institute). The citP gene was amplified using a GeneAmp PCR System 2400
(PerkinElmer, Wellesley, MA) with the following program: preincubation at 94°C for 5
minutes; 30 repetitions of 94°C for 45 seconds, 60°C for 45 seconds, 72°C for 90 seconds
cycle; and incubation at 72°C for 10 minutes. The reaction mixture contained 5 µl of 10×
Taq Polymerase Buffer with MgCl2 (Roche), 250 µM of each dNTP, 1 Unit Taq
Polymerase (Roche), 2 µM of each primer in a final volume of 50 µl. The amplified band was separated by agarose gel electrophoresis and extracted from the gel using QIAquick gel extraction kit (Qiagen). The fragment was cloned into pGEM-T Easy vector
(Promega, Madison, WI). The insert-containing vectors were isolated using QIAprep
Spin Miniprep (Qiagen) and confirmed by restriction enzyme digestion followed by 30 agarose gel electrophoresis. The DNA sequence was determined using BigDye
Terminator Cycle Sequencing chemistry and a 3700 DNA analyzer (Applied Biosystems) in the Plant-Microbe Genomics Center at The Ohio State University (Columbus, OH) using the T7P primer. The obtained sequence (923 bp) was compared to those in public databases using the BLASTX algorithm (Altschul, 1990).
Southern Hybridization
Using the putative citP gene fragment as a probe, genomic DNA from all nonstarter Lactobacillus isolates were screened for the presence of the gene by Southern hybridization (Sambrook et al., 1989). Southern hybridization of genomic DNA was performed using the DIG nonradiocative nucleic acid labeling and detection system
(Roche Molecular Biochemicals, Indianapolis, IN). Genomic DNA from each strain was digested with EcoRI, separated on a 1% agarose gel, and transferred to a nylon membrane
(MagnaCharge, GE Osmonics Inc., Minnetonka, MN) as described by Sambrook et al.
(1989). Hybridization, washing, and detection were performed according to manufacturer’s specifications. The hybridization temperature was 40°C.
Statistical analysis
Differences in percent relative growth in citrate vs. glucose were analyzed statistically using SAS statistical software release 9.1 (SAS Institute Inc., Cary, NC). The independent variable was the strains (i.e., nonstarter Lactobacillus strains). Percent relative growth was calculated and used in the analysis as the dependent variable. The experiment was repeated on three days, this creates an occasion for possible minor
31 changes in experimental conditions (e.g., slight differences in initial cell population); therefore, a blocking factor was considered in the analysis. Data were analyzed using the general linear model (GLM) of SAS, according to the following statistical model:
Yij = µ + βi + Sj + εij
where Yij is the dependent variable, µ is the mean, βi is a blocking factor (i = 1, 2 or 3), Sj is the strain (j = 1, 2,…,30), and εij is the error term.
Growth rates of strains in citrate or glucose were calculated and the results were
analyzed using SAS statistical software release 9.1 (SAS Institute Inc., Cary, NC). Mean
values for µmax time to reach µmax were compared by one-way analysis of variance.
Tukey’s post-hoc test was used to analyze mean differences. Values with P<0.05 were considered to be significantly different.
RESULTS AND DISCUSSION
Cheese sampling and Lactobacillus enumeration
The total number of Lactobacillus cells ranged from 4.8 × 104 to 7.1 × 107 CFU/g cheese (Table 2.1). Both cheeses manufactured in Switzerland contain approximately 7 log CFU/g lactobacilli, whereas the domestic cheeses ranged from 4 to 7 log CFU/g lactobacilli. The differences in population may reflect differences in manufacturing practices. Swiss-type cheeses are classified as cheeses with eyes, there are several cheeses with naturally occurring eyes, however, only the Emmental and rindless block are considered Swiss cheese (Grappin et al., 1999). Though the Swiss-type cheeses produced in Europe and the U.S. are similar, several differences exist in the processing of
32 the cheeses. In the U.S., L. helveticus is used instead of L. delbrüeckii subsp. bulgaricus
that is used in Europe. In Europe, the cheeses are ripened for 6 months to 1 year total, whereas in the U.S., 3-4 months ripening time is used. Lactobacillus casei is often used as an adjunct culture in Swiss-type cheeses made in Switzerland. This practice is not common in the U.S. Recently, it was mandated that for kosher certification of whey products derived from Swiss cheesemaking, the curds and whey must be cooked at
<120°F (Gene Hong, 2002, personal communication). Thus, many U.S. Swiss cheese companies have lowered their cooking temperature from the traditional 125°F. European
Swiss cheese makers continue to use the higher temperature. Thus, results reported for
European-produced cheeses are not necessarily applicable to U.S.-produced cheeses.
Though similar cheese products are obtained, these differences in processing parameters change the microflora and the dynamics of cheese ripening. The difference in total counts can be attributed to possible differences in cooking temperature and ripening duration, as well as differences in initial starter culture ratio and nonstarter load.
Lactobacillus strain differentiation and clustering
A total of 640 colonies from 8 cheeses were screened by PFGE of SmaI and ApaI digestions of DNA. Twenty-two different strains were found. Cluster analysis indicated the presence of three groups with an overall similarity of 53.24% (Figure 2.1). The first group consisted of L. delbrüeckii and L. fermentum strains with 63.90% similarity. The second group contained L. casei and L. rhamnosus strains and one L. fermentum strain with 64.53% similarity. The third group is composed of a single L. gasseri strain.
33 Bouton et al. (2002) investigated the genotypic characteristics of selected L.
helveticus and L. delbrüeckii subsp. lactis strains isolated from Comté cheese. Genomic
DNA digestion was carried out with restriction endonucleases SgrAI and XhoI for L.
helveticus and L. delbrüeckii sp., respectively. An overall similarity of 10% was
observed among 22 strains. The similarity among the L. helveticus strains was approximately 50%.
Lortal et al. (1997) analyzed genomic DNAs of 22 strains of Lactobacillus helveticus of various geographical origins by PFGE with two endonucleases, SmaI and
SgrAI. The percentage of similarity varied between 26% and 100%. Somer et al. (2001) analyzed 65 isolates from stirred-curd Cheddar cheese using SmaI and ApaI digestion, and identified 14 distinct restriction enzyme digestion patterns.
A total of 24 strains compromised of species L. casei, L. rhamnosus, and L. zeae
were analyzed by PFGE using SfiI and NotI as restriction enzymes by Tynkkynen et al.
(1999). Out of 24 strains, 17 distinct genotypes were identified, cluster analysis was not
performed, yet PFGE was selected as the most discriminatory method compared to
ribotyping and RAPD analysis.
Lactobacillus species determination
Conventional identification methods of lactobacilli are based on carbohydrate
fermentation patterns, colony morphology, and Gram staining. Incorporation of
molecular techniques for strain identification resulted in changes and controversies in the
taxanomy. The rejection of L. paracasei and its inclusion into L. casei group has been
34 proposed therefore, in this study, the name L. casei was used for those strains that were previously identified as L. paracasei by others (Dicks et al.1996; Dellaglio et al., 2002).
Lactobacillus casei strains predominated in the cheeses originating in Switzerland
(Table 2.1). This result is expected because L. casei is often used as an adjunct culture in
Emmental cheeses made in Switzerland. This practice is not common in the U.S. The
cheeses from Ohio contained a wider variety of Lactobacillus species, including different
strains of L. casei, L. rhamnosus, L. gasseri, L. delbrüeckii, and L. fermentum. Multiple
strains were found in 5 of the 6 Ohio Swiss cheeses.
In small scale experimental Swiss cheese, Valence et al. (2000) studied the
viability of starter and nonstarter bacteria during ripening. Nonstarter lactic acid bacteria
were not detectable at the beginning of ripening. The nonstarter lactic acid bacteria
population did not exceed 106 CFU/g at any time.
In another study, the majority of the lactobacilli isolated from hard Swiss-type
cheese were facultatively heterofermentative, and their levels ranged between the
detection limit at the beginning of cheese making and 108 CFU/g of ripened cheese
(Jimeno et al., 1995).
Grappin et al. (1999) evaluated change in microbial population in Comté cheese
during ripening. Authors observed a rapid decrease in thermophilic lactic acid bacteria,
and an increase in the numbers of facultatively heterofermentative lactobacilli. After one
month of ripening, lactobacilli population was dominated by facultatively
heterofermentative lactobacilli, namely, L. paracasei subsp. paracasei, and L. rhamnosus
as well as obligately heterofermentative lactobacilli L. fermentum.
35 Occurrence of nonstarter lactobacilli in Cheddar cheese has been well studied.
Starter cultures used for Cheddar cheese manufacture belong to the genus Lactococcus.
Nonstarter lactobacilli multiply during ripening and reach 106-108 CFU/g in the mature
cheese. In Irish Cheddar nonstarter lactic acid bacteria are mainly mesophilic lactobacilli such as L. casei, L. plantarum, and L. curvatus (Lynch et al., 1997). In New Zealand
Cheddar, L rhamnosus, and L. paracasei are more commonly found. Their composition in cheeses varies between factories and days of manufacture (Crow et al., 2001).
Screening isolated nonstarter lactobacilli for citrate utilization
There are important differences in citrate utilization among lactobacilli. Table
2.2. shows the citrate utilization ability of 22 lactobacilli strains qualitatively evaluated
on Citrate Differential medium (CDM). All L. fermentum, L. rhamnosus, and L. casei
strains other than B21, formed blue colonies on CDM, L. gasseri, and L. delbrüeckii
strains did not utilize citrate on CDM.
The effect of citrate on growth rate and percent relative growth on modified MRS
medium containing either citrate or glucose was evaluated. The absorbance at 600 nm
increased on citrate containing modified MRS broth compared with basal media for L.
rhamnosus strains C1, H1, H2, H26, and H63, L. fermentum F85, and all L. casei strains
other than B21 (Table 2.2).
Palles et al. (1998) studied citrate metabolism in L. casei and L. plantarum, acetate and acetoin were the major products of citrate metabolism, and citrate was utilized in ripening cheese when other energy sources are exhausted. In another study, L. amylovorus was unable to utilize citrate as the sole energy source; however, citrate could
36 be metabolized in the presence of glucose and ribose. Furthermore, the presence of citrate in the medium along with glucose and ribose increased growth rate of the cells and increased acetate and gas production (Whitley and Marshall, 1999). Various strains belonging to species L. rhamnosus, L. zeae, and L. plantarum can utilize citrate as the sole energy source, other strains can co-metabolize citrate with certain carbohydrates (De
Figueroa et al., 2000). In a recent study involving several Lactobacillus spp. including,
L. plantarum, L. zeae, L. rhamnosus, and L. casei ATCC 334, the latter metabolized citrate as a sole carbon source in the presence of lactate (Dudley and Steele, 2005).
The maximum specific growth rates in modified MRS medium with glucose were similar for all strains except for L. helveticus L701 and L. gasseri E9 which had significantly lower growth rates and longer time to reach the maximum specific growth rate (Table 2.3). Lactobacillus delbrüeckii C2 differed from other strains with a very high µmax and also required a longer time to reach µmax. The maximum specific growth rates in modified MRS medium containing citrate ranged from 0.07 to 0.22 h-1, and time to reach µmax ranged from 21 to 33 h. All strains with a detectable µmax belonged to L. casei or L. rhamnosus species. Lactobacillus casei B21 was the only L. casei strain that was unable to grow in this medium, this strain was negative for citrate utilization in
CDM. All strains with a specific growth rate in this medium were identified as citrate utilizers by other methods.
Cloning the citrate permease (citP) gene from L. casei
Citrate permease mediates internalization of citrate in Lactococcus and
Leuconostoc species. The citP gene sequences from Lactococcus, Leuconostoc, and
37 Weissella species are highly homologous with > 98% identity (Drider et al., 2004). The
genomic DNA of L. casei A26 was amplified using primers designed based on known
citP gene sequences mentioned above. The sequence of a 923 bp PCR fragment aligned
with several citrate carrier proteins, permeases, and symporters. The sequence was 99%
identical to a “predicted” sodium/citrate symporter of L. casei ATCC 334, 90% identical
to citrate carrier proteins of Enterococcus faecalis, and 90% identical to malate
permeases of Streptococcus spp. The identity of the sequence to citrate permeases of
Weissella paramesenteroides, Lactococcus lactis, and Leuconostoc mesenteroides was
55-57%.
Southern Hybridization
Out of 22 strains of nonstarter lactobacilli screened in this study 8 strains showed
a positive hybridization to the putative citP fragment (Table 2.2). The positive
hybridization result indicates the detection of a sequence similar to citP fragment amplified from L. casei in other strains tested. A negative hybridization is not indicative of the lack of a citrate permease in the strains tested, but dissimilarity to citP sequence of
L. casei A26. Further studies are necessary to fully understand the interrelation of citrate permeases and citrate utilization of these strains in culture media and cheese matrices.
In conclusion, the total number of Lactobacillus cells ranged from 4.8 × 104 to 7.1
× 107 CFU/g cheese. Strains belonging to L. casei, L. rhamnosus, and L. fermentum species were most frequently encountered. Lactobacillus casei strains predominated in the cheeses originating in Switzerland; whereas, the domestic cheeses contained a wider variety of Lactobacillus species, including different strains of L. casei, L. rhamnosus, L. 38 gasseri, L. delbrüeckii, and L. fermentum. Among the strains tested, L. casei strains were strong citrate utilizers followed by L. rhamnosus, L. fermentum, and L. gasseri strains. A putative citP gene fragment from one citrate-utilizing L. casei strain was amplified, cloned, and sequenced. Understanding the occurrence, types, and metabolic capabilities of nonstarter Lactobacillus in Swiss cheese will allow further studies of their role in cheese ripening and their effect on Propionibacterium fermentation.
REFERENCES
Altschul, S.F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403-410.
Banks, J.M. and A.G. Williams. 2004. The role of nonstarter lactic acid bacteria in Cheddar cheese ripening. International Journal of Dairy Technology 57: 145-152.
Bouton, Y, P. Guyot, E. Beuvier, P. Tailliez and R. Grappin. 2002. Use of PCR-based methods and PFGE for typing and monitoring homofermentative lactobacilli during Comté cheese ripening. International Journal of Food Microbiology 76: 27-38.
Coeuret, V., S. Dubernet, M. Bernardeau, M. Gueguen, and J. P. Vernoux. 2003. Isolation, characterisation and identification of lactobacilli focusing mainly on cheeses and other dairy products. Lait 83: 269-306.
Crow, V., B. Curry, and M. Hayes. 2001. The ecology of non-starter lactic acid bacteria (nslab) and their use as adjuncts in New Zealand cheddar. International Dairy Journal 11: 275-283.
Dalgaard, P. and K. Koutsoumanis. 2001. Comparison of maximum specific growth rates and lag times estimated from absorbance and viable count data by different mathematical models.J Microbiol Methods. 2001 Jan;43(3):183-196.
De Figueroa, R. M., F. Alvarez, A. P. De Ruiz Holgado, G. Oliver, and F. Sesma. 2000. Citrate utilization by homo- and heterofermentative lactobacilli. Microbiological Research 154: 313-320.
39
Dellaglio F, G.E. Felis and S. Torriani. 2002. The status of the species Lactobacillus casei (Orla-Jensen 1916) Hansel and Lessel 1971 and Lactobacillus paracasei Collins et al. 1989. Request for an opinion. International Journal of Systematic and Evolutionary Microbiology 52: 285-287.
Dicks, L.M.T., E.M. Du Plessis, F. Dellaglio, and E. Lauder. 1996. Reclassification of Lactobacillus casei subsp. casei ATCC 393 and Lactobacillus rhamnosus ATCC 15820 as Lactobacillus zeae nom. rev. Designation of ATCC 334 as the Neotype of L. casei subsp. casei, and Rejection of the Name Lactobacillus paracasei. International Journal of Systematic Bacteriology 46: 337-340.
Drider, D., S. Bekal, and H. Prévost. 2004. Genetic organization and expression of citrate permease in lactic acid bacteria. Genetics and Molecular Research 3: 273-281
Dudley E.G., and J.L. Steele. 2005. Succinate production and citrate catabolism by Cheddar cheese nonstarter lactobacilli. Journal of Applied Microbiology 98: 14-23.
Fox, P. F., and P. L. H. McSweeney. 1998. Dairy chemistry and biochemistry.
Garcia-Quintans, N., C. Magni, D. de Mendoza, and P. Lopez. 1998. The citrate transport system of Lactococcus lactis subsp. lactis biovar diacetylactis is induced by acid stress. Applied and Environmental Microbiology 64: 850-857.
Grappin, R., E. Beuvier, Y. Bouton, and S. Pochet. 1999. Advances in the biochemistry and microbiology of swiss-type cheeses. Lait 79: 3-22.
Haddad, S., I. Sodini, C. Monnet, E. Latrille, and G. Corrieu. 1997. Effect of citrate on growth of Lactococcus lactis subsp. lactis in milk. Applied Microbiology and Biotechnology 48: 236-241.
Hong, G. 2002. Personal communication.
Izco, J. M., M. Tormo, A. Harris, P. S. Tong, and R. Jimenez-Flores. 2003. Optimization and validation of a rapid method to determine citrate and inorganic phosphate in milk by capillary electrophoresis. Journal of Dairy Science 86: 86-95.
Jenkins, J.K., J. W. Harper, and P.D. Courtney. 2002. Genetic diversity in Swiss cheese starter cultures assessed by pulsed field gel electrophoresis and arbitrarily primed PCR. Letters in Applied Microbiology 35: 423-427.
Jimeno, J., M. J. Lazaro, and H. Sollberger. 1995. Antagonistic interactions between propionic acid bacteria and non-starter lactic acid bacteria. Lait 75: 401-413.
40 Kempler, G. M., and L. L. McKay. 1980. Improved medium for detection of citrate fermenting Streptococcus lactis ssp. diacetylactis. Applied and Environmental Microbiology 39: 926-927.
Lawler, J.B., C.M.Delahunty, M.G. Wilkinson, and J. Sheehan. 2003. Swiss-type and SwissCheddar hybrid-type cheeses: effects of manufacture on sensory character and relationships between the sensory attributes and volatile compounds and gross compositional constituents. International Journal of Dairy Technology. 56: 39-50.
Lick, S. 2003. Review: Typing systems for lactobacilli. Milchwissenschaft 58: 256-260.
Liu, S. Q. 2003. Practical implications of lactate and pyruvate metabolism by lactic acid bacteria in food and beverage fermentations. International Journal of Food Microbiology 83: 115-131.
Lortal, S. A. Roualt, S. Guezenec and M. Gautier. 1997. Lactobacillus helveticus: strain typing and genome size stimation by pulsed field gel electrophoresis. Current Microbiology 34: 180-185.
Lynch, C. M., P. L. H. McSweeney, P. F. Fox, T. M. Cogan, and F. D. Drinan. 1997. Contribution of starter lactococci and non-starter lactobacilli to proteolysis in cheddar cheese with a controlled microflora. Lait 77: 441-459.
Martin, M., M. A. Corrales, D. de Mendoza, P. Lopez, and C. Magni. 1999. Cloning and molecular characterization of the citrate utilization citmcdefgrp cluster of Leuconostoc paramesenteroides. FEMS Microbiology Letters 174: 231-238.
Martley, F.G., and V.L. Crow. 1996. Open texture in cheese: The contributions of gas production by microorganisms and cheese manufacturing practices. Journal of Dairy Research 63: 489-507.
Mocquot, G. 1979. Reviews of the progress of dairy science: Swiss-type cheese. Journal of Dairy Research 46: 133-160.
Palles, T., T. Beresford, S. Condon, and T. M. Cogan. 1998. Citrate metabolism in Lactobacillus casei and Lactobacillus plantarum. Journal of Applied Microbiology 85: 147-154.
Preininger, M., R. Warmle, and W. Grosh. 1996. Identification of the character impact flavour compounds of Swiss cheese by sensory studies of models. Zeitschrift-fuer- Lebensmittel-Untersuchung-und-Forschung. 202: 30-34.
Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. In Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
41 Somers, E.B., M.E. Johnson, and A.C.L. Wong. 2001. Biofilm formationand contamination of cheese by nonstarter lactic acid bacteria in the dairy environment. Journal of Dairy Science 84: 1926-1936.
Steffen, C., Flueckiger, E., Bosset, J.O. and M. Ruegg. 1987. Swiss-type varities. In: P. F. Fox (ed.) Cheese: Chemistry, physics and microbiology No. 2. p 93-120. Elsevier Applied Science Publisheres Ltd., New York.
Tannock, G. W., A. Tilsala-Timisjarvi, S. Rodtong, J. Ng, K. Munro, and T. Alatossava. 1999. Identification of lactobacillus isolates from the gastrointestinal tract, silage, and yoghurt by 16s-23s rrna gene intergenic spacer region sequence comparisons. Applied and Environmental Microbiology 65: 4264-4267.
Tilsala-Timisjarvi, A., and T. Alatossava. 1997. Development of oligonucleotide primers from the 16s-23s rrna intergenic sequences for identifying different dairy and probiotic lactic acid bacteria by pcr. International Journal of Food Microbiology 35: 49-56.
Tynkkynen, S, R. Satokari,M. Saarela, T. Mattila-Sandholm and M. Saxelin. 1999. Comparison of ribotyping, randomly amplified polymorphic DNA analysis, and pulsed-field gel electrophoresis in typing of Lactobacillus rhamnosus and L. casei strains.
Valence, F., S.-M. Deutsch, R. Richoux, V. Gagnaire, and S. Lortal. 2000. Autolysis and related proteolysis in swiss cheese for two lactobacillus helveticus strains. Journal of Dairy Research 67: 261-271.
Vaughan, E. E., S. David, A. Harrington, C. Daly, G. F. Fitzgerald, and W. M. De Vos. 1996. Characterization of plasmid-encoded citrate permease (citP) genes from Leuconostoc species reveals high sequence homology conservation with the Lactococcus lactis citP gene. Appl. Environ. Microbiol. 61:3172-3176.
Whitley, K., and V. M. Marshall. 1999. Heterofermentative metabolism of glucose and ribose and utilization of citrate by the smooth biotype of Lactobacillus amylovorus NCFB 2745. Antonie van Leeuwenhoek 75: 217-223.
42
Total Lactobacillus Cheese Origin Strains* Species (CFU/g)
A Switzerland 1.2x107 A2 L. casei A3 L. casei A26 L. casei A34 L. casei
B Ohio 5.3x106 B4 L. fermentum B15 L. fermentum ** B21 L. casei B72 L. fermentum
C Ohio 7.1x107 C1 L. rhamnosus C2 L. delbrüeckii C34 L. delbrüeckii
D Ohio 9.8x105 D56 L. rhamnosus
E Ohio 4.8x104 E3 L. delbrüeckii E9 L. gasseri
F Ohio 2.6x104 F1 L. delbrüeckii F44 L. delbrüeckii F85 L. fermentum
G Switzerland 1.6x107 G2 L. casei
H Ohio 1.9x107 H1 L. rhamnosus H2 L. rhamnosus H26 L. rhamnosus H63 L. rhamnosus *Strains in bold font indicate the most numerous strain in the given cheese. **NGRI 0510 Identified as L. fermentum with API50 CH test
Table 2.1. Number and species of Lactobacillus strains found in each cheese.
43
Citrate Differential Hybridization Relative Microorganisms Medium with citP probe Growth (%) L. casei A2 + + 0.45 ± 0.03 L. casei A3 + + 0.51 ± 0.09 L. casei A26 + + 0.57 ± 0.05 L. casei A34 + + 0.46 ± 0.00 L. fermentum B4 + - 0.20 ± 0.01 L. fermentum B15 + - 0.16 ± 0.02 L. casei B21 - + 0.20 ± 0.00 L. fermentum B72 + - 0.20 ± 0.01 L .rhamnosus C1 + - 0.30 ± 0.03 L. delbrüeckii C2 - - 0.27 ± 0.10 L. delbrüeckii C34 - - 0.20 ± 0.01 L. rhamnosus D56 + - 0.28 ± 0.01 L. delbrüeckii E3 - - 0.15 ± 0.01 L. gasseri E9 - - 0.14 ± 0.00 L. delbrüeckii F1 - - 0.15 ± 0.01 L. delbrüeckii F44 - - 0.13 ± 0.01 L. fermentum F85 + - 0.31 ± 0.10 L. casei G2 + + 0.35 ± 0.04 L. rhamnosus H1 + + 0.31 ± 0.09 L. rhamnosus H2 + - 0.39 ± 0.05 L. rhamnosus H26 + + 0.30 ± 0.07 L. rhamnosus H63 + - 0.38 ± 0.03 L. casei L861 ND* ND 0.36 ± 0.01 L. casei L828 ND ND 0.20 ± 0.04 L. zeae ATCC 393 ND ND 0.49 ± 0.12 L. casei L900 ND ND 0.23 ± 0.01 L. casei L789 ND ND 0.22 ± 0.06 L. helveticus L701 ND ND 0.13 ± 0.01 * Not determined
Table 2.2. Growth of selected Lactobacillus isolates on citrate differential medium, hybridization with citP gene probe, and percent relative growth rates on modified MRS.
44
Maximum specific growth Time to reach µ (h) rate µ (h-1) max Microorganisms max Glucose Citrate Glucose Citrate
L. casei A2 0.90 ± 0.02bcd 0.09 ± 0.01c 5.74 ± 0.34b 21.18 ± 1.18e L. casei A3 0.78 ± 0.11bcd 0.18 ± 0.01ab 5.26 ± 0.16d 25.19 ± 1.30bcde L. casei A26 0.83 ± 0.08bcd 0.22 ± 0.02a 6.53 ± 0.77d 23.92 ± 0.78cde L. casei A34 0.90 ± 0.07bcd 0.09 ± 0.00c 5.42 ± 0.34d 21.08 ± 1.02e L. fermentum B4 0.77 ± 0.02bcd --* 10.92 ± 0.43bcd -- L. fermentum B15 0.92 ± 0.12bcd -- 5.56 ± 0.31d -- L. casei B21 0.88 ± 0.06bcd -- 8.08 ± 0.28bcd -- L. fermentum B72 0.88 ± 0.22bcd -- 5.93 ± 1.41d -- L .rhamnosus C1 0.87 ± 0.12bcd 0.08 ± 0.00c 6.48 ± 066d 30.15 ± 2.51abc L. delbrüeckii C2 2.46 ± 0.18a -- 28.64± 3.65a -- L. delbrüeckii C34 1.11 ± 0.29b -- 5.31 ± 0.47d -- L. rhamnosus D56 0.93 ± 0.05bcd 0.10 ± 0.01c 7.03 ± 0.20cd 32.66 ± 0.19ab L. delbrüeckii E3 1.22 ± 0.22b -- 4.04 ± 1.18d -- L. gasseri E9 0.34 ± 0.09cd -- 14.73 ± 1.89bc -- L. delbrüeckii F1 0.61 ± 0.10bcd -- 5.95 ± 1.35d -- L. delbrüeckii F44 0.87 ± 0.13bcd -- 5.92 ± 0.48d -- L. fermentum F85 0.83 ± 0.07bcd -- 11.02 ± 0.91bcd -- L. casei G2 1.01 ± 0.08bc 0.12 ± 0.02bc 6.78 ± 0.28d 29.54 ± 1.79abcd L. rhamnosus H1 1.20 ± 0.09b 0.12 ± 0.02bc 6.35 ± 0.48d 31.57 ± 2.63abc L. rhamnosus H2 0.88 ± 0.14bcd 0.07 ± 0.01c 6.21 ± 0.79d 25.99 ± 1.85abcde L. rhamnosus H26 1.01 ± 0.06bc 0.07 ± 0.01c 6.82 ± 0.33d 31.95 ± 2.01ab L. rhamnosus H63 0.66 ± 0.04bcd 0.09 ± 0.01c 8.24 ± 0.64bcd 21.78 ± 1.40ed L. casei L861 0.91 ± 0.12bcd 0.07 ± 0.01c 5.33 ± 0.13d 31.84 ± 1.08ab L. casei L828 0.95 ± 0.22bc -- 11.47± 1.82bcd -- L. zeae ATCC 393 0.98 ± 0.02bc 0.08 ± 0.03c 10.18 ± 3.54bcd 27.06 ± 3.53abcde L. casei L900 0.70 ± 0.11bcd -- 8.65 ± 0.64bcd -- L. casei L789 0.99 ± 0.29bc -- 11.60 ± 3.19bcd -- L. helveticus L701 0.22 ± 0.04d -- 15.81 ± 2.62b -- Means in the same column with the same letter are not significantly different (P≥0.05) * Growth not detected
Table 2.3. Maximum specific growth rate (µmax) and time to reach µmax for lactobacilli strains in basal media containing 30mM glucose or citrate.
45
SmaI ApaI
50 60 70 80 100 90 C2 L. delbrüeckii F1 L. delbrüeckii F44 L. delbrüeckii E3 L. delbrüeckii F85 L. fermentum C34 L. delbrüeckii B15 L. fermentum B4 L .fermentum A2 L. casei A34 L. casei A3 L .casei A26 L. casei G2 L .casei B21 L. casei B72 L. fermentum C1 L .rhamnosus D56 L. rhamnosus H1 L. rhamnosus H2 L. rhamnosus H63 L. rhamnosus H26 L. rhamnosus E9 L. gasseri
Figure 2.1. Dendrogram indicating similarities among Lactobacillus strains based on pulsed field gel electrophoresis of SmaI- and ApaI-digested genomic DNA.
46
CHAPTER 3
EFFECT OF ADJUNCT LACTOBACILLUS STRAINS ON THE
CHARACTERISTICS OF SWISS CHEESE MANUFACTURED USING
THE LOW COOKING TEMPERATURE REQUIRED FOR KOSHER-
CERTIFIED WHEY
ABSTRACT
Though the use of Lactobacillus casei as an adjunct culture is common for Swiss-
type cheese manufactured in Switzerland, few published reports exist on adjunct use and
none exist for adjunct use in U.S.-manufactured Swiss cheese. Our objective was to
study the effect of nonstarter Lactobacillus strains as adjunct cultures on Swiss cheese
characteristics. Selected nonstarter Lactobacillus strains isolated from commercial
cheeses were utilized as adjunct cultures for cheese manufacture. Twelve cheeses were manufactured using a commercial starter combination and three previously isolated nonstarter Lactobacillus strains, L. casei A26, L. casei B21, and L. rhamnosus H2.
Cheeses were analyzed during ripening for microbial and chemical composition. The use of adjunct cultures diminished high variability in total Lactobacillus counts in cheeses
manufactured without adjunct addition. Lactobacillus casei strains were able to utilize 47 all citrate present in cheese before the end of the warm room ripening phase. There were
no significant differences among cheeses in regards to protein, fat, moisture, and salt
contents. The pH of the mature cheeses ranged from 5.4 to 5.5, and free amino acid
concentration ranged from 5 to 7 mmol/kg cheese. Lactic, acetic, and propionic acid
levels of cheeses were not significantly different. By the end of warm room, citric acid
was depleted in cheeses manufactured with adjunct L. casei strains. Based on electronic nose and descriptive sensory results, cheeses made with adjunct L. casei strain A26 were more similar to control cheese in development of certain flavor attributes.
INTRODUCTION
Nonstarter lactobacilli have been used as adjunct cultures in cheese manufacture.
Studies on experimental cheeses containing adjunct lactobacilli show improved flavor
intensity and acceptability and higher levels of free amino acids when compared to
control cheeses (Lynch et al., 1997). However, their effect can be positive, negative, or
neutral depending on the strains that predominate and their roles during ripening (Crow et
al., 2001; Kieronczyk et al., 2003; Swearingen et al., 2001). High concentrations of
desirable nonstarter lactobacilli in cheese throughout ripening provides balanced flavor
reactions and minimize the possible effects of undesirable adventitious nonstarter lactic
acid bacteria (Crow et al., 2001).
The interaction between lactobacilli and propionibacteria is also very important.
Growth of Propionibacterium freudenreichii is required for the characteristic eye formation and flavor development in Swiss cheese. Increased proteolysis during ripening
48 and intense propionic acid fermentation may cause formation of splits and checks
(Grappin et al., 1993; Jimeno et al. 1995; Noël et al. 1999). Certain L. casei and L. rhamnosus strains isolated from different cheese types in Switzerland were proven to inhibit the growth of P. freudenreichii when added as supplemental cultures during
Emmentaler cheese production (Jimeno et al., 1995). Addition of nonstarter bacteria can affect the proteolysis in cheese. Comparison of experimental cheeses made with highly proteolytic starters and starters with weak proteolytic activity demonstrated that presence of high concentration of free amino acids inhibits the growth of propionibacteria (Baer,
1995). This inhibition may reduce the undesirable splits and cracks that can form later in ripening due to late gas production by propionibacteria.
Facultatively heterofermentative nonstarter lactic acid bacteria are used in the
Swiss artisanal cheese industry to slow down propionic acid fermentation. In
Switzerland, a mixed culture composed of 3 L. casei strains from to the culture collection of Swiss Dairy Research Station, FAM Leebefeld, is generally sold to prevent late fermentation in Emmentaler cheeses. The inhibition mechanism is not yet clarified; however it is attributed to the inhibitory effect of excess formate and acetate on propionibacteria. Sensory analysis shows slightly poorer quality of cheeses made with addition of mixed L. casei culture, possibly due to higher acetate levels (Frohlich-Wyder,
2002).
Though the use of L. casei as an adjunct culture is common for Swiss-type cheese manufactured in Switzerland, few published reports exist on adjunct use in Swiss cheese and none exist for adjunct use in U.S.-manufactured Swiss. Traditional Swiss cheese making involves cooking the curds in the whey at 123-137°F (Reinbold, 1972). Using
49 the “kosher make procedure”, cooking temperatures must be ≤120°F to allow for kosher-
certification of whey products derived from cheesemaking. This alteration in cooking temperature causes changes in the final cheese quality, such as rapid acid development
during cheese making, increased split defects and high moisture (Gene Hong, 2002,
personal communication; Bob Ramseyer, 2002., personal communication).
Adjunct culture addition has potential to reduce vat to vat variability within the
same manufacturing facility, and would allow the cheesemaker to control to some extent
the effect of nonstarter cultures on cheese quality.
The objective of this study was to examine the effect of adjunct Lactobacillus
strains on microbial, chemical, and sensory characteristics of Swiss cheese manufactured
using the “kosher make procedure”.
MATERIALS AND METHODS
Bacterial strains
Streptococcus thermophilus S787, L. helveticus L701, and P. freudenreichii
subsp. shermani P728 cultures (Chr. Hansen Inc., Milwaukee, WI) were used as direct-
vat-set starter cultures. Adjunct cultures were selected from 22 nonstarter lactobacilli
previously isolated (see Chapter 2) based on their citrate utilization properties in broth
and on agar plates. Lactobacillus casei A26, isolated from Swiss Emmental, utilizes
citrate well. Lactobacillus casei B21 and L. rhamnosus H2 were both isolated from
U.S.-manufactured Swiss cheeses, and utilized little or no citrate.
50 Nonstarter Lactobacillus cultures were grown overnight (18h) to stationary phase in Lactobacillus MRS broth (Criterion, Hardy Diagnostics, Santa Maria, Ca) washed twice in phosphate-buffered saline, and resuspended in sterile water immediately prior to inoculation into the cheese milk. Cultures were inoculated at approximately 103 CFU/ml milk to achieve >105 CFU/g cheese before brining (Pius Felder, 2002, personal communication).
Cheese manufacture
Twelve cheeses were manufactured in pilot plant scale using 200L capacity cheese vats (C.van’t Riet Dairy and Process Equipment, Aarlanderveen, The
Netherlands) using the rindless block procedure modified to simulate the kosher make procedure (Kosikowski and Mistry 1997; Reinbold, 1972). The pilot-scale kosher make procedure was developed in consultation with two Swiss cheese companies that use this procedure commercially. Milk (100L) purchased from the Ohio State University Dairy
Farm (Columbus, OH) was standardized to 1:1 true protein to fat ratio and pasteurized in the vat by holding at 63°C for 30 minutes. Prior to inoculation with starter cultures, the milk temperature was reduced to 34.4°C with gentle to moderate stirring. Nonstarter
Lactobacillus cultures were added at approximately 103 CFU/ml milk. Starters were added according to culture supplier’s recommendations. Inoculated milk was ripened for
20 minutes and set with 8 g of coagulant Chy-max extra (Chr. Hansen Inc.) diluted in 40 ml of sterile water. After 25-30 min, the curd was cut slowly to fine curd size and heated to 47.5°C for about 30 minutes, and then held at 47.5°C with gentle agitation until the target pH value (6.45-6.55) was reached. The whey and the curd were pumped to
51 perforated stainless steel vessels dressed with disposable cheese cloth. The whey was
drained by gradually adding weight (up to 20 kg) to create about 2 kg pressure per kg
cheese (Gene Hong, 2002, personal communication). The cheese was pressed for 18 h at
37°C or until the pH decreased to approximately 5.25. A sample was taken from the
center for pH and microbiological analysis. Subsequently, the cheese was divided into 4
equal size blocks and placed into brine solution (23% salt, 0.001% CaCl2, pH 5.4, 4-7°C) for 4 h. One of the four blocks was removed at each sampling time. After brining, the blocks were vacuum packaged to exclude air and to prevent the formation of a rind through contact with air during ripening and placed at 4-7°C for 6 days to allow for salt equilibration throughout the block. Following the pre-cooling, blocks were placed into plastic molds and stored in the “warm room” (21-22°C) for eye development. After 24 days in the warm room, cheeses were transferred to cold storage at 4-7°C for 2-6 months for ripening.
In addition to standard cleaning and chemical sanitizing, all cheese making equipment (milk cans, cheese vats, stirrers, knives, cheese cloth, and pressing tables) was steam sterilized prior to each cheese making session to minimize environmental contamination and carry over of adjunct strains from day to day. Brine solution was prepared as a large batch and divided into 4 containers. Each container was designated for use with one adjunct treatment or control to avoid carry over of adjunct strains in the brine.
52 Cheese sampling
Samples were taken at day 1 (before brining), day 6 (end of pre-cool), day 30 (end
of warm room), and at days 60 and 90 for microbial and chemical analyses.
Compositional analyses were performed only on mature cheeses (day 60). For
microbiological analysis and pH measurements a core sample was taken from the center
of cheese block. For all other analyses, samples were taken from one of the 4 blocks
resulted from each cheese, finely shredded and mixed to obtain uniformity. For
descriptive sensory analysis, 90 day cheeses were vacuum packaged after removing one
quarter of it for other analyses, and stored in cold room for approximately five months.
Microbiological analyses
Total lactobacilli and total bacterial counts were determined in cheese milk after
pasteurization using Rogosa SL agar (Difco, Becton, Dickinson, and Co., Sparks, MD)
and Plate Count Agar (Difco), respectively. Amount of adjunct strain and starter cultures
were also enumerated by taking milk samples after culture addition.
To monitor starter population in cheeses, a 1 g cheese sample aseptically removed
from the center of cheese block was placed in 9 ml 2% sodium citrate solution and
stomached at high speed for 2 minutes (Seward Stomacher Biomaster 80, Seward Co.,
Norfolk, UK). Subsequent ten-fold serial dilutions were prepared in 0.1% peptone water
(Difco). Total lactobacilli were enumerated on Rogosa SL agar (Difco) incubated anaerobically for 2 days at 37°C. Streptococcus thermophilus was enumerated on M17
agar (Difco) containing 0.5% lactose and 0.15% lithium chloride incubated for 2 days at
53 42°C, and propionibacteria were enumerated on lithium glycerol agar (Madec et. al.,
1996) incubated anaerobically for 7 days at 30°C.
To monitor the adjunct culture population in cheeses during storage, one hundred
colonies were randomly selected from Rogosa SL plates at each sampling time and inoculated on citrate differential medium (CDM; Kempler and McKay, 1980), BCP-
gluconate agar (Jenkins, 2005) and esculin cellobiose agar (ECA; Hunger, 1986). Each adjunct culture utilized in cheese manufacture shows a distinct colony appareance on
these media. Presence of a colony color pattern indiscernible from that of the adjunct
culture suggests the cultures tested are the adjunct cultures added and not the
contaminating nonstarter lactobacilli. Colony colors of starter and adjunct Lactobacillus
strains on each media are listed in Table 3.1.
Compositional analyses
Protein and fat contents were determined using near infrared spectroscopy (Near
Infrared Analyzer KJT270, Kett US, Villa Park, CA) calibrated using conventional
methods as follows: The protein content was determined using Kjeldahl method; nitrogen content was measured in a Kjeldahl analyzer, Tecator Kjeltec Auto Sampler
system 1035 (Tecator AB, Hoganas, Sweden) and a protein conversion factor of 6.38 was
used to calculate protein content of cheese samples. The Babcock method was used for
fat content determination (Marshall, 1992). Moisture content was measured using the
using a vacuum oven as described in AOAC method 926.08 (AOAC, 1987).
Salt content was determined potentiometrically with a silver electrode
54 using the Chloride Analyzer 926 (Nelson Jameson, Marshfield, WI). pH was measured using the quinhydrone-gold electrode method (Marshall, 1992). Free amino acid content was determined with the Cd-ninhydrin reagent in a microtiter plate assay using L-leucine as the standard (Folkerstma and Fox, 1992; Baer et al., 1996).
Organic acids were determined by HPLC (Agilent 1100, Agilent Technologies,
Palo Alto, CA) using an Aminex HPX-87H Column (Biorad, Hercules, CA) with a multiple wavelength detector. Eight milliliters of grade S acetonitrile (Fisher) and 0.2 ml
1N H2SO4 were added to 1 g grated cheese sample, and mixed for 20 minutes in a rotary mixer. Cheese homogenates were then centrifuged at 8000 rpm for 20 minutes, and the supernatant was filtered through a MFS-13 filter. The volume of sample injected was 20
µl. The mobile phase was 10 mN H2SO4, prepared by diluting HPLC-grade H2SO4
(Fisher Scientific) with HPLC-grade water (Fisher Scientific) and then filtered through
0.2 µm membrane filter (Nalgene Nunc International, Rochester, NY). The flow rate of the mobile phase was 0.6 ml/min and the column temperature was constant at 65°C.
Lactic, citric, and acetic acids were detected at 210 nm. Acetoin and propionic acids co- eluted at this wavelength, therefore, a wavelength of 290 nm was used to detect acetoin separately and calculate propionic acid area. Concentrations of individual organic acids were quantified using peak areas of standard curves.
Electronic nose
Instrumental differentiation of cheese aroma was conducted using an Agilent
Technologies Chem Sensor 4400, equipped with a headspace autosampler unit (HP
7649), and mass selective detector (MSD 9753) as a sensor operated in the negative
55 ionization mode, with methane as the ionizing gas. Shredded cheese samples (3 g) from
days 1, 6, 30, 60, and 90 were placed in 20 ml headspace vials and capped with a Teflon-
faced silicon rubber cap. Triplicate samples were randomly placed in the autosampler,
each vial was equilibrated at 60°C for 30 minutes. The head space volatiles where then
transferred to the GC equipped with a capillary column. Helium was used as the carrier
gas at a pressure of 40 psi. One microliter of head space was introduced in a pulsed
splitless mode, at 75 psi, 250°C. The column was set to 220°C for 6 minutes. A purge
time of 1.5 minutes was used between samples.
Descriptive sensory analysis
Swiss cheeses were cut into one-inch cubes for descriptive sensory analysis. The
cheeses were placed into 4-oz. soufflé cups with lids labeled with three-digit codes. The cheeses were tempered to 10°C and were served at this temperature. Descriptive analysis was conducted at North Carolina State University and used a 15 point universal intensity scale with the SpectrumTM method (Meilgaard et al., 1999; Drake and Civille, 2003) and
a cheese flavor sensory language modified for Swiss cheese (Drake et al., 2001) (Table
3.2). A trained descriptive sensory panel (n=8) with over 150 hours of experience each
with descriptive analysis of cheese flavor evaluated the cheeses. Consistent with
SpectrumTM descriptive analysis training, panelists were presented with reference
solutions of sweet, sour, salty, and bitter tastes to learn to consistently use the universal
intensity scale (Meilgaard et al., 1999; Drake and Civille, 2003). Following consistent
use of the Spectrum TM scale with basic tastes, panelists learned to identify and scale
flavor descriptors using the same intensity scale through presentation and discussion of
56 flavor definitions, references (Table 3.2) and a wide array of cheeses. Discussion and
evaluation of a wide array of cheeses (Swiss and other cheeses) was also conducted
during training to enable panelists to consistently differentiate and replicate samples.
Analysis of data collected from training sessions confirmed that panel results were
consistent and that terms were not redundant, consistent with previous use of the
developed language (Drake et al., 2001). Each replication of each cheese treatment was
evaluated monadically in duplicate in a randomized balanced block design. Evaluations
were conducted individually in an enclosed room dedicated to sensory analysis and free
from external aromas, noise, and distractions. Panelists were instructed to expectorate
samples after evaluation. Spring water was available to each panelist for palate
cleansing.
Experimental design and statistical analysis
The experimental design was a truncated Latin square. Data were analyzed using
the mixed model “PROC MIXED” of SAS software (Version 9.1. SAS Institute Inc.,
Cary, NC), according to the following statistical model:
Yijk = µ + βi + Vj + Sk + εijk
where Yijk is the dependent variable, µ is the mean, βi is the random effect of blocks (i =
1, 2 , 3, 4, 5, 6), Vj is the random effect of vats (j = 1, 2), Sk is the effect of strain (j = 1, 2,
3, 4), and εijk is the error term. Comparison of mean differences were analyzed using
Tukey test (P<0.05).
57 Sensory data was analyzed using general linear model “PROC GLM” of SAS
software. Comparison of means were performed using Fisher’s least significant
difference (LSD) test (P<0.05).
RESULTS AND DISCUSSION
Effect of adjunct cultures on microbial composition
Changes in population of Lactobacillus spp., S. thermophilus, and
Propionibacterium spp. during ripening in Swiss cheese manufactured with and without adjunct Lactobacillus sp. were determined (Figures 3.1, 3.2, 3.3., and 3.4). In all cases, the pasteurized cheese milk contained fewer than 101 CFU/ml (detection limit) of
Lactobacillus spp., and total plate counts were at or below 102 CFU/ml. The initial
inoculum level for all starters was between 4-5 log CFU/ml.
Propionibacterium spp. counts followed the same pattern in all cheeses. There
was an approximately 4-log increase during warm room incubation (day 6 to day 30), up
to 8 log CFU/g cheese and the numbers were stable from thereon. In general, the
Propionibacterium inoculation levels vary from 103 to 106 CFU/ml milk.
Propionibacteria grow in Swiss cheese during ripening in the warm room and reach populations as high as 5 x109 CFU/g cheese (Noël, et al., 1999). Autolysis of
Propionibacteria is generally late and limited (Valence et al 1998). Although the
difference in propionibacteria counts at day 90 was not distinguishable, a slight tendency
in increase of propionibacteria levels was observed in all cheeses, with the exception of
the cheeses produced with adjunct L. casei strain A26 where there was no apparent
58 change in population. Most nonstarter lactic acid bacteria do not affect propionibacteria
levels in cheese, although some strains of L. casei and L. plantarum reduce the propionic acid levels at the end of ripening by 13-38% (Martley and Crow, 1996; Bachmann et al.,
1997). The influence of Lactobacillus spp. on propionibacteria growth is likely to be less important than the influence of technological parameters such as pH and salt in cheeses
(Noël, 1999). Before brining, there was approximately 1 log difference in S. thermophilus levels between the control cheese (no adjunct) and cheeses manufactured
with adjunct strains. In the control cheese and when L. casei B21 was utilized as adjunct
culture, S. thermophilus counts decreased during warm room incubation. On the other
hand, when L. casei A26 and L. rhamnosus H2 strains were used as adjunct culture, S.
thermophilus counts did not start decreasing until after warm room incubation. The use
of adjunct cultures decreased the high variation in S. thermophilus counts observed in
control cheeses (Figure 3.4).
Lactobacillus spp. growth pattern was similar in all cheeses manufactured with an
adjunct strain. In general, an initial growth occurred in first day of cheese making, and
the cell population increased from 104 CFU/ml milk to 107-108 CFU/g cheese before
brining. The population remained constant throughout ripening or (as in the case of adjunct A26) increased to 108-109 CFU/g cheese by the end of warm room storage and
remained constant throughout ripening. However, in control cheeses, the rapid increase
in Lactobacillus spp. population before brining was followed by a decline in cell
population during warm room storage, the population decreased to 105-106 CFU/g cheese
by the end of 90-day ripening (Figures 3.1, 3.2, 3.3, and 3.4).
59 Turner et al. (1983) made Swiss cheese with L. helveticus, L. bulgaricus, and no
Lactobacillus as a part of starter culture. Nonstarter lactic acid bacteria reached to levels greater than 106 CFU/g cheese. In cheeses manufactured with an adjunct Lactobacillus
spp., the total lactobacilli population was dominated by the adjunct strain (Table 3.3).
Potential benefits of adjunct cultures include predictable fermentation pattern, desired flavor/aroma development, consistency in cheese manufacture, and quality. In fact, select L. casei and L. rhamnosus strains are used in Switzerland to limit the secondary fermentation (Jimeno et al, 1995).
Effect of adjunct cultures on cheese composition
Protein, fat, moisture, and salt in moisture contents of the experimental cheeses were determined (Table 3.4). There were no significant differences (P≥0.05) among the cheeses manufactured with or without adjunct strains in regards to protein, fat, moisture, and salt in moisture contents. Protein, fat, and moisture contents of the cheeses were comparable to those of commercial cheese samples (see Chapter 4). Salt in moisture content was higher than commercial cheese samples. Commercial cheeses are
manufactured in larger size and require longer time in brine and in pre-cooling stage to
attain the salt equilibrium. As the salt penetrates from the outside and progressively
reaches the center of the cheese, a maximum salt gradient of 4-5 fold from the periphery
to the center is common (Mocquot, 1979). French Emmental cheeses contain 0.4-0.7%
salt (0.7-1.2% salt in moisture based on 40% moisture) on average, however, salt
distribution is not even and salt levels reach up to 1.8% (3% SMP) in the rind (Noël,
1999). In U.S. Swiss cheeses with 0.8-3% salt in moisture content are manufactured,
60 however, most manufacturers currently target no higher than 1.0% salt in moisture levels
(Gene Hong, 2002, personal communication). The salt concentration in the moisture
phase of three U.S.-produced and four European-produced Swiss-style cheeses ranged
from 0.54 to 1.83% and from 0.86 to 4.52% in U.S.- and European produced cheeses, respectively (Anggreani, 2004). Salt in moisture content is very important in Swiss cheese manufacture. Salt can affect mechanical properties and disturb eye formation because of its effects on water mobility, mineral balance, water-protein-mineral interactions, enzyme activities, and bacterial growth (Noël, 1999).
Change in cheese pH during ripening was monitored using quinhydrone-gold electrode method. The pH of one day cheese ranged from 5.15 to 5.29 and was in the
target pH range of 5.2-5.3. The day-1 cheese pH is important because of its effects on
the structural state of protein before brining and cooling, eye formation is promoted
between pH 5.15-5.45, and CO2 production increases with pH (Lawrence et al. 1987).
By the end of 90-day ripening, pH values increased up to 5.4-5.5 (Figure 3.5). Lowest
increase in pH was observed in control cheeses.
Total free amino acid concentrations of the cheeses increased 5 to 7-fold from the
beginning of warm room until the end of 90-day ripening (Figure 3.6). Up to 60-day
ripening, cheeses manufactured with adjunct strain L. casei A26 followed a similar free amino acid development pattern with the control cheeses. In the same way, cheeses made with adjunct strains L. casei B21 and L. rhamnosus H2 followed a similar pattern. Initial free amino acid concentrations of the cheeses were the same. At the end of 60 days cheese made with adjunct L. rhamnosus H2 had the lowest free amino acid concentration.
Between day 60 and 90, free amino acid concentrations of cheeses made with adjunct L.
61 casei strain B21 followed an increasing trend, whereas concentrations in control cheeses
and cheeses made with adjunct strains L. casei A26 and L. rhamnosus H2 remained
unchanged.
The concentrations of free amino acids in 60 day ripened cheeses were comparable to free amino acid levels in commercial Swiss cheeses (Chapter 4). A higher increase in free amino acid concentration would be expected in cold room ripening because thermophilic lactic acid bacteria release their active peptidase pool at this stage.
(Steffen et al. 1996; Gagnaire et al. 1998). Instead, free amino acid concentrations increases at greatest rate during warm room ripening. This could be related to decrease in starter Lactobacillus sp. population.
Organic acid contents of cheeses were determined at each time point (Figure 3.7).
Citric acid concentrations of cheeses manufactured with L. casei strains as adjunct cultures were lower than other cheeses at day 1 and citric acid was depleted by the end of warm room. Depletion of citric acid by the end of warm room incubation is desirable to minimize late fermentation by lactic acid bacteria during cold room storage during which citrate can be consumed by nonstarter lactic acid bacteria with formation of diacetyl and
CO2 (Jimeno et al., 1995). Even though initial citrate levels in milk were not quantified,
the lower citric acid concentration at day 1 can be explained by citrate utilization by
adjunct L. casei strains. The cheeses made with adjunct L. rhamnosus strain and the
control cheeses contained 10-15 mg citrate/100g cheese at the end of warm room and
during 90-day ripening. Decrease in lactic acid and increase in acetic acid concentrations
followed similar patterns in all cheeses during cheese ripening. Even though no
significant differences in propionic acid concentrations were observed at day 90, cheeses
62 differed in propionic acid levels at day 60. The cheeses made with L. casei A26 had the
lowest propionic acid level (2.42 mg/g) followed by L. casei B21 (3.33 mg/g), and L.
rhamnosus H2 (3.84 mg/g). Average organic acid concentrations for 60 day old good
quality Emmental cheeses are 500-800 mg propionate and 200-400 mg acetate/100g
cheese. In a variety of Swiss-type cheeses, 293-656 mg propionic acid, and 202-413
mg/100g acetic acid concentrations are reported (Noël, 1999). In general, a
propionic:acetic molar ratio of 2 is expected. At day 60, all cheeses combined, acetic
acid and propionic acid concentrations were 143 and 339 mg/100g cheese, respectively,
with a molar ratio approaching the theoretical value of 2:1.
Electronic nose
The formation of aroma in cheese is a complex process and influenced to a great
extent by cheese microflora (Marilley et al., 2004). Electronic nose is a promising alternative for rapid discrimination of cheeses based on volatile/aroma compounds.
Electronic nose based on mass spectrometry has been used to effectively differentiate different process cheeses, and Emmental cheeses from various European countries
(Pillonel et al., 2003). This method has also been successfully used to discriminate between lactic acid bacteria at the strain level (Marilley et al., 2004).
Changes in abundance of four mass units 73, 85, 86, and 87 believed to be
important in Swiss cheeses differentiation are presented in Figure 3.8. Tentative
identification of compounds for each units are propionic acid for mass 73, diacetyl for
mass 85, valeraldehyde/isovaleraldehyde for mass 86, and butyric/isobutyric acid for
mass 87 (Drake et al., 2003; Marilley et al., 2004). Control cheese and cheeses
63 manufactured with adjunct strain L. casei A26 were not significantly different for the abundance of the four mass units and followed the same pattern throughout ripening.
There was no significant difference in propionic acid (mass 73) abundance among the cheeses. Cheeses made with adjunct strain L. rhamnosus H2 had more diacetyl, butyric/isobutyric acid, and valeraldehyde/isovaleraldehyde then the other cheeses.
Descriptive sensory analysis
Treatment means for the 18 flavor attributes utilized for descriptive sensory analysis are shown in Table 3.5. There were no significant differences in dried fruit, bitter, salty, and prickle flavors among the cheeses.
There were significant differences in the intensities of young undeveloped flavors
(Drake et al., 2003), cooked and whey between the control cheeses and the cheeses made with adjunct strain A26. Higher diacetyl flavor perception would be expected in cheeses made with adjuncts that can utilize citrate since citrate is considered main diacetyl precursor (Jimeno, 1995). However, no significant differences were detected among the control cheese and cheeses made with adjunct L. casei strains. Even though citrate is considered main diacetyl precursor, and P. freudenreichii subsp shermanii metabolizes citrate partly, diacetyl and acetoin were not detected by NMR-imaging on cheeses made using this strain in starter culture (Deborde, 1998). Cheeses made with adjunct strains did not differ significantly from the control cheese in terms of free fatty acid/butyric acid flavor. This is an expected result, because, propionibacteria are more influential on lipolysis, and no significant differences should be observed in free fatty acid tones
(Perreard and Chamba, 2002). Nutty flavor is an important characteristic of Swiss type
64 cheeses. Cheeses made with adjunct cultures were less nutty than the control cheese.
Cheese manufactured with adjunct strain L. casei A26 had a higher nutty note than the other cheeses manufactured with adjuncts. The cheeses made with adjunct strain L. casei
A26 had more fresh fruit flavor compared to other cheeses. In agreement with electronic
nose results, the cheeses made with adjunct strain L. rhamnosus H2 had more diacetyl
flavor.
In conclusion, selected nonstarter Lactobacillus strains isolated from commercial
cheeses were utilized as adjunct cultures for cheese manufacture. Citric acid
concentrations of cheeses manufactured with adjunct L. casei strains were depleted by the
end of the warm room ripening phase. Propionic acid leves were lower in cheeses made
with adjunct L. casei strains. Control cheeses had lower pH during ripening. There were
no significant differences among cheeses in regards to protein, fat, moisture, and salt
contents. However, sensory properties were affected. Cheeses made with adjunct
cultures had lower scores for nutty flavor.
REFERENCES
AOAC, 1987. Official methods of analysis. 16th ed. AOAC International, Gaithersburg, MD, Method 926.08, sec 33.7.03.
Baer, A. 1995. Influence of casein proteolysis by starter bacteria, rennet and plasmin on the growth of propionibacteria in swiss-type cheese. Lait 75: 391-400.
Baer, A., I. Ryba, J. Meyer, and U. Buetikofer. 1996. Micro-plate assay of free amino acids in swiss cheeses. Food Science & Technology (London) 29: 58-62.
65 Bachmann, H.P., U. Butikofer, R.Badertscher, M. Dallatorre, P. Lavanchy, U. Buhler- Moor, B. Nick, J. Jimeno, R. warmke, W. Grosch, R. Sieber, and J.O. Bosset. 1997. Ripening of Emmental cheese wrapped in foil with and without addition of Lactobacillus casei subsp casei: microbial, chemical, rheological and sensorial investigations. Lebensmittel- Wissenschaft und Technologie 30: 417-428.
Crow, V., B. Curry, and M. Hayes. 2001. The ecology of non-starter lactic acid bacteria (nslab) and their use as adjuncts in New Zealand cheddar. International Dairy Journal 11: 275-283.
Deborde, C., D.B. Rolin, A. Bondon, J.D. de Certaines and P. Boyoval. 1998. In vivo nuclear resonance study of citrate metabolism in Propionibacterium freudenreichii subsp. shermanii. Journal of Dairy Science 65: 504-514.
Drake, M.A., S.C. McIngvale, P.D. Gerard, K.R. Cadwallader, and G.V. Civille. 2001. Development of a descriptive language for cheddar cheese. Journal of Food Science 66: 1422-1427.
Drake, M.A. and Civille, G.V. 2003. Flavor lexicons. Comprehensive Reviews in Food Science 2: 33-40.
Drake, M.A., P.D. Gerard, J.P. Kleinheinz, and W.J. Harper. 2003. Appplication of an electronic nose to correlate with descriptive sensory analysis of aged Cheddar cheese. Lebensmittel- Wissenschaft und Technologie 36: 13-20.
Felder, P. 2002. Personal communication.
Folkertsma, B. and P.F. Fox. 1992. Use of Cd-ninhydrin reagent to assess proteolysis in cheese during ripening. Journal of Dairy Research 59: 217-224.
Frohlich-Wyder, M.-T. 2002. Interactions between propionic acid bacteria and starter- /non-starter lactic acid bacteria in emmentaler cheese. Lebensmittelindustrie und Milchwirtschaft 123: 31-34.
Gagnaire, V., D. Molle, M. Herrouin, and J. Leonil. 2001b. Peptides identified during emmental cheese ripening: Origin and proteolytic systems involved. Journal of Agricultural and Food Chemistry 49: 4402-4413.
Grappin, R., E. Beuvier, Y. Boulton, and S. Pochet. 1999. Advances in the biochemistry and microbiology of Swiss-type cheeses. Lait 79: 93-104.
Hong, G. 2002. Personal communication.
Hunger, W. 1986. Äsculin-Cellobiose-Agar für Isolierung und Keimzahlbestimmung von Lactobacillus acidophilus. Milchwissenschaft 41: 5: 283-285.
66
Jenkins, J.K. 2005. Gluconate metabolism in Lactobacillus and its role in persistence in the human intestine. Ph.D. dissertation. The Ohio Satte university, Columbus, Ohio.
Jimeno, J., M. J. Lazaro, and H. Sollberger. 1995. Antagonistic interactions between propionic acid bacteria and non-starter lactic acid bacteria. Lait 75: 401-413.
Kempler, G. M., and L. L. McKay. 1980. Improved medium for detection of citrate fermenting streptococcus lactis ssp diacetylactis. Applied and Environmental Microbiology 39: 926-927.
Kosikowski, F. V., and V. V. Mistry. 1997. Cheese with eyes. In: F. V. Kosikowski and V. V. Mistry (eds.) Cheese and fermented milk foods No. 2. p 108-117, Westport, CT.
Kieronczyk, A., S. Skeie, T. Langsrud, and M. Yvon. 2003. Cooperation between lactococcus lactis and nonstarter lactobacilli in the formation of cheese aroma from amino acids. Applied and Environmental Microbiology 69: 734-739.
Lawrence, R.C., L.K> Creamer, anfd J. Gilles. 1987. Texture development during cheese ripening. Journal of Dairy Science 70: 1748-1760.
Lynch, C. M., P. L. H. McSweeney, P. F. Fox, T. M. Cogan, and F. D. Drinan. 1997. Contribution of starter lactococci and non-starter lactobacilli to proteolysis in cheddar cheese with a controlled microflora. Lait 77: 441-459.
Madec, M-N, A. Rauault, J.L. Maubois, and A. Thierry. 1996. Selective medium containing lithium and a polyol or antibiotic for counting propionibacteria. Official Gazette of the United States Patent and Trademark Office Patents 1192 (2): 1226.
Marilley, L., S. Ampuero, T. Zesiger, and M.G.Casey. 2004. Screening of aroma- producing lactic acid bacteria with an electronic nose. International Dairy Journal. 14: 849-856.
Marshall, R.T.(ed). 1992. Standard methods for the examination of dairy products. 16th ed. American Public Health Association, Washington, D.C.
Martley, F.G. and V.L. Crow. 1996. Open texture in cheese: the contributions of gas production by microorganisms and cheese manufacturing process. Journal of Dairy Research 63: 489-507.
Meilgaard, M.M, G.V. Civille, and B.T. Carr (ed.). 1999. Descriptive analysis t techniques, p. 161-171. In Sensory Evaluation Techniques, 3nd ed. CRC Press, Boca Raton, FL
67 Mocquot, G. 1979. Reviews of the progress of dairy science: Swiss-type cheese. Journal of Dairy Research 46: 133-160.
Noël, Y, P. Poyoval, A. Thierry, V. Gagnaire, and R. Grappin. 1999. Eye formation and Swiss-type cheeses. p.222-250. In B.A. Law (ed.), Technology of cheese making CRC Press, Boca Raton, FL.
Perreard, E., and J.F. Chamba. 2002. Contribution of propionic acid bacteria to lipolysis of Emmental cheese. Lait 82: 33-44.
Pillonel, L. S., R. Ampiero, R. Tabacchi and J.O. Bosset. 2003. Analytical methods for the determination of the geographic origin of Emmental cheese: volatile compounds by GC/MS-FID and electronic nose. European Food Research and Technology 216: 179-183.
Ramsayer, B. 2002. Personal communication.
Reinbold, G.W. 1972. Swiss Cheese Varieties. Pfizer Inc., New York, NY.
Swearingen, P. A., D. J. O'Sullivan, and J. J. Warthesen. 2001. Isolation, characterization, and influence of native, nonstarter lactic acid bacteria on cheddar cheese quality. Journal of Dairy Science 84: 50-59.
Turner, K. W., H. A. Morris, and F. G. Martley. 1983. Swiss-type cheese. Ii. The role of thermophilic lactobacilli in sugar fermentation. New Zealand Journal of Dairy Science and Technology 18: 117-124.
Valence, F., R. Richoux, A. Thierry, A. Palva, and S. Lortal. 1998. Autolysis of Lactobacillus helveticus and Propionibacterium freudenreichii in Swiss cheeses: First evidence by using species-specific lysis markers. Journal of Dairy Research 65: 609- 620.
68
Colony/Zone Color Strains ECA CDM BCP-Gluconate LH32 Light brown/no zone White Clear Bright yellow /yellow A26 Brown/grey zone Dark blue zone B21 Yellow/green zone White to light blue Cream, no zone White with light blue H2 Brown/green zone Light yellow, no zone center
Table 3.1. Colony and zone colors of starter Lactobacillus helveticus LH32 and adjunct strains L. casei A26, L. casei B21, and L. rhamnosus H2 on esculin cellobiose agar (ECA), citrate differential medium (CDM), and BCP-Gluconate agar, after 24-hour incubation at 37°C.
69 Descriptor Definition Reference skim milk heated to 85oC for Cooked/milky Aromatics associated with cooked milk 30 min Aromatics associated with Cheddar cheese Whey fresh Cheddar whey whey Diacetyl Aromatic associated with diacetyl Diacetyl fresh coconut meat, Milkfat Aromatics associated with milkfat heavy cream, δdodecalactone Distilled white vinegar, Vinegar Aromatics associated with vinegar acetic acid Aromatics associated with dried fruits, Dried fruit Dried apricot half specifically peaches and apricots Fresh pineapple, ethyl Fruity (fresh) Aromatics associated with different fruits hexanoate Aromatics associated with cooked eggs, think Sulfur/eggy Hardboiled egg, mashed Cheddar cheese sulfur Sulfur/cabbage/ Aromatics associated with cooked cabbage Boiled cabbage, dimethyl brothy and other vegetables trisulfide Free fatty Aromatics associated with butyric acid Butyric acid acid/butyric acid lightly toasted unsalted The nut-like aromatic associated with nuts, unsalted cashew Nutty different nuts nuts, unsalted wheat\ thins Sweaty Aromatic associated with human sweat Hexanoic acid Aromas associated with barns and Cowy/phenolic Stock trailers, indicative of animal Bandaids, p-cresol, phenol sweat and waste Sour Fundamental taste sensation elicited by acids citric acid (0.08 % in water) Fundamental taste sensation elicited by Bitter caffeine (0.08% in water) various compounds sodium chloride (0.5 % in Salty Fundamental taste sensation elicited by salts water) Sweet Fundamental taste sensation elicited by sugars sucrose (5 % in water) Chemical feeling factor elicited by certain Umami MSG (1 % in water) peptides and nucleotides Chemical feeling factor of which the Prickle sensation of carbonation on the Soda water tongue is typical Chemical feeling factor elicited by metallic Metallic Aluminum foil objects in the mouth
Table 3.2. Sensory language for Swiss cheese.
70 Mean ± standard error Days L .casei A26 L. casei B21 L. rhamnosus H2 1 14 ± 4 1 ± 0.5 25 ± 10 6 33 ± 4 5 ± 2.5 52 ± 17 30 100 ± 0 69 ± 27 82 ± 9 60 100 ± 0 98 ± 1 82 ± 9 90 100 ± 0 100 ± 0 100 ± 0
Table 3.3. Percent of total lactobacilli identical to adjunct culture added determined using the colony and zone colors on esculin cellobiose agar (ECA), citrate differential medium (CDM), and BCP-Gluconate agar, after 24-hour incubation at 37°C.
71
Mean ± standard error Cheeses Salt in Protein (%) Fat (%) Moisture (%) Moisture (%) A26 27.84 ± 1.24a 30.97 ± 0.39a 38.89 ± 0.37a 2.29 ± 0.03a B21 30.51 ± 2.01a 29.07 ± 0.46a 38.37 ± 0.31a 2.16 ± 0.10a H2 29.68 ± 2.28a 30.63 ± 1.79a 38.57 ± 0.19a 2.11 ± 0.07a Control 28.11 ± 0.61a 31.08 ± 1.47a 39.68 ± 0.93a 2.18 ± 0.06a Means in the same column with the same letter are not significantly different (P<0.05)
Table 3.4. Chemical composition of cheeses.
72
Cheese Descriptor A26 B21 H2 Control Cooked/milky 1.8b 2.1a 2.0a 2.1a Whey 1.9a 1.3b 1.3b 1.0c Diacetyl 0.0b 0.1b 0.3a 0.0b Milkfat 2.1c 2.3b 2.2bc 2.5a Vinegar 1.8a 1.4c 1.6bc 1.6ab Dried fruit 1.4a 1.3a 1.2a 1.2a Fruity (fresh) 0.3a 0.1b 0.0b 0.0b Sulfur/eggy 0.6a 0.4a 0.5a 0.6a Sulfur/cabbage/ brothy 2.4b 2.3b 2.4b 2.8a Free fatty acid/butyric acid 0.4ab 0.3b 0.4a 0.4ab Nutty 0.7b 0.3c 0.4c 1.3a Sweaty 1.2b 1.4a 1.1b 1.6a Sour 1.7a 1.3b 1.4b 1.3b Bitter 0.4a 0.4a 0.3a 0.4a Salty 0.3a 0.3a 0.4a 0.4a Sweet 3.3b 3.5ab 3.3b 3.5a Umami 2.9ab 3.0a 2.8b 2.9ab Prickle 0.4a 0.3a 0.3a 0.4a Means in the same row with the same letter are not significantly different (P<0.05)
Table 3.5. Descriptive sensory analysis. Mean scores of 15-Point universal intensity scale.
73 10
9
8
7
6 Log CFU/g cheese 5
4
3 0 1 6 30 60 90 Ripening time (days)
Figure 3.1. Changes in population of Lactobacillus spp. (●), Streptococcus thermophilus ( ), and Propionibacterium spp. () during ripening in Swiss cheese manufactured with adjunct strain L. casei A26.
74 10
9
8
7
6 Log CFU/g cheese 5
4
3 0 1 6 30 60 90 Ripening time (days)
Figure 3.2. Changes in population of Lactobacillus spp. (●), Streptococcus thermophilus ( ), and Propionibacterium spp. () during ripening in Swiss cheese manufactured with adjunct strain L. casei B21.
75 10
9
8
7
6 Log CFU/g cheese 5
4
3 016306090 Days
Figure 3.3. Changes in population of Lactobacillus spp. (●), Streptococcus thermophilus ( ), and Propionibacterium spp. () during ripening in Swiss cheese manufactured with adjunct strain L. rhamnosus H2.
76 10
9
8
7
6 Log CFU/g cheese Log CFU/g 5
4
3 0 1 6 306090 Ripening time (days)
Figure 3.4. Changes in population of Lactobacillus spp. (●), Streptococcus thermophilus ( ), and Propionibacterium spp. () during ripening in Swiss cheese manufactured without adjunct strain (control).
77 5.6
5.5
5.4 pH
5.3
Control A26 5.2 B21 H2
5.1 1 6 30 60 90 Ripening time (days)
Figure 3.5. Changes in pH of cheeses during ripening.
78 8
7
6
5
4
3 Control 2 A26
mmol free amino acids/kg free amino cheese mmol B21 1 H2
0 1 6 30 60 90
Ripening time (days)
Figure 3.6. Changes in free amino acid concentration during ripening.
79 0.30 14
0.25 12
10 0.20 8 0.15 6 0.10 4 0.05 2 mg citric acid/g cheese mg mg lactic acid/g cheese mg
0.00 0
1 6 30 60 90 1 6 30 60 90 Ripening time (days) Control Ripening time (days) A26 B21 H2
2.0 5
4 1.5
3 1.0
2
0.5 1
mg acetic acid/g cheese mg 0.0
mg propionicmg acid/g cheese 0
1 6 30 60 90 1 6 30 60 90 Ripening time (days) Ripening time (days)
Figure 3.7. Changes in organic acid composition.
80 Mass 73 Mass 85
350x103 140x103
300x103 120x103
250x103 100x103
200x103 80x103
150x103 60x103
100x103 40x103
50x103 20x103
0 0 1 6 30 60 90 1 6 30 60 90 Control A26 B21 H2 Abundance Mass 87 Mass 86
60x103 500x103
50x103 400x103
40x103 300x103
30x103
200x103 20x103
100x103 10x103
0 0 1 6 30 60 90 1 6 30 60 90 Ripening time (days)
Figure 3.8. Changes in abundance of mass numbers 73, 85, 86, and 87 during ripening.
81
CHAPTER 4
CHEMICAL, MICROBIOLOGICAL, AND PHYSICAL
CHARACTERISTICS OF COMMERCIAL SWISS-TYPE CHEESES
ABSTRACT
High quality Swiss cheeses vary in sensory, chemical, microbiological, and physical characteristics. Determining the compositional characteristics of commercial
Swiss cheeses will establish the typical range for each characteristic in cheeses intended for the American market and will complement descriptive sensory and consumer preference studies. The objective was to determine chemical, microbiological, and physical characteristics of commercial Swiss-type cheeses. Fifteen cheeses (4 U.S.- manufactured baby Swiss, 10 U.S.-manufactured Swiss, and one European Emmental) were analyzed for characteristics including protein, fat, moisture, salt, pH, short chain free fatty acids, and total free amino acids. Lactobacillus spp., Streptococcus thermophilus, and Propionibacterium spp. were enumerated. Physical characteristics such as hardness, springiness, and meltability were assessed. An electronic nose was used to evaluate the volatile flavor compounds. The values for compositional characteristics ranged from 22.9 to 26.3% for protein, 46.3 to 55.1% for fat in dry matter,
82 36.4 to 41.8% for moisture, and 0.7 to 3.4% for salt in moisture. The pH values ranged from 5.37 to 5.80, and the free amino acid levels ranged from 2.32 to 10.48 mmol/kg.
The Emmental cheese had the highest acetic acid and propionic acid levels. Bacterial counts varied widely: 5 to 8 log CFU/g Lactobacillus spp., 3 to 8 log CFU/g S. thermophilus, and 4 to 8 log CFU/g Propionibacterium spp. The cheeses with higher numbers of Propionibacterium spp. had higher propionic acid levels. Baby Swiss cheeses were softer, on average, than the Swiss cheeses. Meltability, measured by melted diameter, ranged from 18 to 40 mm. The Emmental cheese had the lowest meltability.
The electronic nose evaluation differentiated the cheeses into three groups, with the baby
Swiss cheeses grouping together. Chemical, microbiological, and physical characterization of Swiss cheeses, combined with sensory evaluation results may allow manufacturers to predict the acceptability of their cheese.
INTRODUCTION
Chemical, microbiological, and physical characteristics of cheeses are determining factors in overall quality and sensorial acceptability of cheeses.
Establishment of a relationship between instrumental analytical measurement tools with descriptive sensory and consumer preference studies will enable cheese manufacturers to predict the potential acceptability of their products.
Swiss-type cheeses are classified as cheeses with eyes. There are several cheeses with naturally occurring eyes, however, only the Emmental and rindless block are considered Swiss cheese (Grappin et al., 1999). Though the Swiss-type cheeses produced
83 in Europe and the U.S. are similar, several differences exist in the processing of the
cheeses:
1) Starter culture and ripening time
In the U.S., L. helveticus is used instead of L. delbrüeckii supsp. bulgaricus
that is used in Europe. Lactobacillus helveticus has a higher proteolytic
capacity allowing for faster ripening. In Europe, the cheeses are ripened for 6
months to 1 year total, whereas in the U.S. 2-4 months ripening time is
typical.
2) Adjunct cultures
Lactobacillus casei is often used as an adjunct culture in Swiss-type cheeses
made in Switzerland. This practice is not common in the U.S.
3) Cooking temperature
Recently, it was mandated that for kosher certification of whey products
derived from Swiss cheesemaking, the curds and whey must be cooked at
<120°F. Thus, many U.S. Swiss cheese companies have lowered their
cooking temperature from the traditional 125°F. European Swiss cheese
makers continue to use the higher temperature.
Though similar cheese products are obtained, these differences in processing parameters change the microflora and the dynamics of cheese ripening. Thus, results reported for European-produced cheeses are not necessarily applicable to U.S.-produced cheeses. The characteristics of eyes, flavor, body and texture and shelf-life of Swiss-type cheese result mainly from the combined effect of the starter cultures, the quality of the milk and different cheese making protocols (Steffen et al., 1987).
84 Baby Swiss is a semi hard cheese, similar to regular Swiss cheese in terms of
presence of eyes. Baby Swiss cheese has a milder flavor and smaller eyes. Its curd is
cooked for less time and the cheese is ripened for less time. In baby Swiss manufacture a mesophilic lactic acid bacterium, Lactococcus lactis subsp. cremoris or Lactococcus
lactis subsp. lactis biovar. diacetylactis is used in lieu of or in addition to thermophilic starters used in regular Swiss cheese manufacture. As a consequence, baby Swiss cheese has a buttery flavor due to higher diacetyl production by the starter bacteria, it is also nutty in flavor like regular Swiss cheese.
Our objective was to investigate microbial, chemical, and physical characteristics of commercial Swiss-type cheeses.
MATERIALS AND METHODS
Cheese
Members of the Swiss Cheese Consortium were asked to donate Swiss and baby
Swiss cheeses to the study. Cheese factories were located in Ohio. Cheeses were to be
ready for sale and of high quality. One Emmental cheese was also acquired from an
importer. Cheeses were immediately analyzed for bacterial counts and pH, stored at 4 or
-40°C and were analyzed within 1 week to 4 months of receipt, depending on the
analysis.
85 Microbiological analyses
Total Lactobacillus spp., S. thermophilus, and Propionibacterium spp. were enumerated in fifteen cheeses. A 1 g cheese sample aseptically removed from the center of cheese block was placed in 9 ml 2% sodium citrate (Fisher Scientific, Fair Lawn, NJ) solution and stomached at high speed for 2 minutes (Seward Stomacher Biomaster 80,
Seward Co., Norfolk, UK). Subsequent ten-fold serial dilutions were prepared in sterile
0.1% peptone water (Difco). Total lactobacilli were enumerated on Rogosa SL agar
(Difco, Beckton, Dickinson, Sparks, MD) incubated for 2 days at 37°C in an anaerobe chamber (Forma Scientific, Inc., NF, Denbury, CT) purged with 5.0 % carbon dioxide,
10% hydrogen, 85 % nitrogen gas mixture, S. thermophilus on M17 agar (Difco) containing 0.5% lactose and 0.15% lithium chloride (Fisher Scientific Co., Pittsburgh,
PA) agar incubated for 2 days at 42°C, and propionibacteria were enumerated on Lithium
Glycerol Agar (LGA; Madec et. al., 1996) incubated anaerobically for 7 days at 30°C.
Compositional analyses
The protein content was determined in duplicate using the Kjeldahl method. A
0.75 g sample was weighed on a nitrogen free weighing paper (Fisher) and transferred into a digestion tube. Two catalyst tablets (Kjeltabs, Fisher) and 25 ml of concentrated sulfuric acid (Fisher) were added to each tube. The tubes were slowly heated up to
218°C and held at the temperature for 70 minutes in a Tecator 2020 digestor (Perstop
Analytical, Inc., Silver Spring, ML). Upon completion of digestion, the tubes were cooled and approximately 50 ml of distilled water were added. The nitrogen content was determined using a Kjeldahl analyzer, Tecator Kjeltech Auto Sampler system 1035
86 (Tecator AB, Hoganas, Sweden). A protein conversion factor of 6.38 was used to calculate the protein content of cheese samples. The fat content was determined in duplicate using the Babcock method described in Standard Methods for the Examination of Dairy Products (Marshall, 1992).
The moisture was determined in duplicate using a vacuum oven as described in
AOAC method 926.08 (AOAC, 1987). Briefly, a 3 g shredded cheese sample was dried at 100°C in a vacuum oven (Isotemp Vacuum Oven Model 281; Fisher) at <100 mmHg for 5 h in a disposable aluminum dish (Fisher). Cheese samples were weighed before and after drying using an analytical balance (AB54-S, Mettler Toledo, Toledo, OH).
Salt content was determined in triplicate using the chloride analyzer 926 (Nelson
Jameson Inc., Marshfield, WI). Five-gram grated cheese sample was homogenized in
98.1 ml deionized water for 45 seconds using a hand blender (Braun, Boston, MA). The homogenate was filtered through #1 Whatman paper (Whatman International Ltd.,
England) and analyzed according to the manufacturer’s instructions.
Percent ash content of the samples was determined in duplicate as described in
Standard Methods for the Examination of Dairy products (Marshall, 1992). A 1g of cheese sample was weighed into porcelain crucible, dried in an oven at 100°C for 1 h, placed on a hot plate and charred until no smoke was generated. A muffle furnace set at
525°C was used to ash the sample overnight. The crucible was then cooled in a desiccator and weighed to calculate % ash of the sample.
The pH was measured in triplicate using an Oakton pH6 Acorn Series pH meter with a spear tip electrode (Corning spear gel combo, Corning, NY). The pH of the same
87 cheese samples were also measured, after 4 months of storage at -40°C, using the
quinhydrone-gold electrode method (Marshall, 1992).
Free amino acid content was measured in duplicate using the Cd-ninhydrin assay
(Folkerstma and Fox, 1992). Leucine was used to construct the standard curves. A microtiter plate reader (Spectronic 20 Genesys, Spectronic Instruments, Rochester, NY) was used for absorption reading at 490 nm (Baer et al., 1996).
Water soluble free fatty acids were extracted from cheese samples in duplicate according to the method described by Kleinheinz and Harper (1997) with a modification in overnight storage temperature of acidified supernatant from 4°C to -18°C. A Hewlett-
Packard (HP) 6890 GC (Agilent Technologies, Inc., Wilmington, DE) equipped with a flame ionization detector (FID) was used. Separation was performed on a 25m x 0.32 mm capillary column (HP-FFAP). Helium was used as the carrier gas with a velocity of
44.8 cm/s. The injection port and FID temperatures were 220°C and 270°C, respectively.
Following sample transfer, the oven temperature was maintained at 110°C for 1 min and then heated at 10°C/min to 230°C. Chromatograms were integrated using HP
Chemstation data analysis software. The multiple point internal standard (3-metyl acetic
acid) method was used for the quantification of water soluble volatile free fatty acids.
Pure standards at different concentrations were used to generate a calibration curve and the internal response factor of each fatty acid was determined. Free fatty acid concentrations are calculated as mg in 100 g cheese.
Instrumental differentiation of cheese aroma was conducted using an Agilent
Technologies Chem Sensor 4400, equipped with a headspace autosampler unit (HP
7649), and mass selective detector (MSD 9753) as a sensor operated in the negative
88 ionization mode, with methane as the ionizing gas. Shredded cheese samples (3 g) from days 1, 6, 30, 60, and 90 were placed in 20 ml headspace vials and capped with a Teflon- faced silicon rubber cap. Triplicate samples were randomly placed in the autosampler, each vial was equilibrated at 60°C for 30 min. The head space volatiles where then transferred to the GC equipped with a capillary column. Helium was used as the carrier gas at a pressure of 40 psi. One microliter of head space was introduced in a pulsed splitless mode, at 75 psi, 250°C. The column was set to 220°C for 6 min. A purge time of 1.5 min was used between samples.
Physical characteristics
Texture profile analyses were performed using the double compression test with an Instron Series 5000, (Instron Corporation, Canton, MA). Prior to sampling and analysis, cheese samples were equilibrated to room temperature for 1 h. Three cylindrical segments (20 mm high and 13.5 mm in diameter) were removed with a cork borer. Samples were compressed to 50% of their original height at a compression speed of 2mm/s. Hardness, the force necessary to produce a given deformation (kgf), and springiness, the extent of sample deformation after the deforming force is removed (mm) were evaluated using the Instron Merlin software (Instron Corporation, Canton, MA).
Meltability
The meltability of cheeses was measured in triplicate using a modified Schreiber test (Kosikowski, 1997). Cheese cylinders (20mm x 13.5mm) equilibrated to room
89 temperature for 1h were placed in a 150°C oven for 5 minutes. The diameters of each
cylinder from two locations were measured.
Statistical analysis
Data were analyzed using the general linear model (PROC GLM) of SAS
statistical package (Version 9.1. SAS Institute Inc., Cary, NC), according to the following
statistical model:
Yij = µ + Ci + εij
where Yij is the dependent variable (response) , µ is the mean, Cj is the variable (cheese)
2 (i = 1, 2, ….,15), and εij is the error term, assuming that εij ~N(0, σe ). Comparison of
means were assessed using Tukey’s test.
RESULTS AND DISCUSSION
Microbiological analyses
Total Lactobacillus spp., S. thermophilus, and Propionibacterium spp. were enumerated in fifteen cheeses (Table 4.1). For all fifteen cheeses, log CFU/g cheese values ranged between 5.4 and 8.3 for lactobacilli, 3.5 and 8.3 for S. thermophilus, and
between 4.6 and 8.8 for propionibacteria. Baby Swiss and European Emmental cheese
samples had lower lactobacilli counts compared to U.S. Swiss cheeses. Log CFU/g
cheese values varied widely among fifteen cheeses tested. European Emmental cheese
had the lowest S. thermophilus count. U.S. Swiss cheeses had lower S. thermophilus
levels (4.5 to 6.6) compared to baby Swiss (5.1 to 8.3) cheeses. Propionibacteria levels 90 were more balanced among the samples with the exception of cheese S10 which had lower propionibacteria counts compared to other cheeses.
In general, Lactobacillus spp. are not used as starter cultures in baby Swiss manufacture therefore, lower lactobacilli counts in baby Swiss cheeses is expected. High levels of lactobacilli counts are reported in other hard cheeses where lactobacilli were not used as starters (Turner, 1983; Lynch et al., 1997; Swearingen et al., 2001 et al., 2001).
On the other hand, Lactobacillus strains, L. helveticus and/or L. delbrüeckii, are used as starter cultures in Emmental and Swiss cheese manufacture, therefore, higher
Lactobacillus spp. counts are expected. Slightly lower lactobacilli levels found in
European Emmental could be associated with the longer ripening time. Similarly, very low levels of S. thermophilus in this cheese may be due to the longer ripening time and bacterial cell death during ripening. The variability in these numbers can also be related to the growth, lysis, and survival characteristics of starter strains used by different manufacturers as well as compositional properties of the cheeses.
Compositional analyses
The gross chemical composition of cheeses is summarized in Tale 4.2. There were no significant differences among cheeses in protein content (P≥0.05). Protein levels ranged from 22.89 to 26.46%. Fat contents of the cheeses samples were similar and ranged from 28.50 to 34.25%. Significant differences (P<0.05) in fat content were observed among cheeses S10, S12, and B4. There were no significant differences in fat contents between European Emmental and U.S. Swiss cheeses, and no significant difference among baby Swiss cheeses tested. On average baby Swiss cheeses had higher
91 moisture content (36.60-41.83%) than Swiss/Emmental cheeses (36.42-39.59%). There
were no significant differences among cheeses B3 through S15, whereas cheeses B1 and
B2 separated from the majority of this group with higher moisture content. All Swiss cheeses tested conform to U.S. standards for grades of Swiss cheese, Emmentaler cheese criteria where the maximum acceptable moisture content is limited to 40%
(www.ams.usda.gov/standards/swiss_revised.pdf. 2001). The values for % salt in moisture ranged from 0.70 (U.S. Swiss) to 3.40 (baby Swiss). Baby Swiss cheeses had higher % salt in moisture levels than other cheeses tested. Cheese S8 had the highest salt content among the Swiss cheeses tested. Its salt content was not significantly different from that of cheese B4 which had the lowest salt content among the baby Swiss cheeses tested. There were no significant differences among cheeses in protein and ash contents.
The pH values of cheeses were measured using two different methods. The pH values
measured using the spear tip pH electrode ranged from 5.37 to 5.80, and the pH values measured using the quinhydrone/gold electrode method ranged from 5.40 to 5.82 (Table
4.3). However, the effect of measurement method was significant (P<0.05). Results
obtained with spear tip electrode indicated that the pH of the European Emmental cheese was significantly higher than others (P<0.05). Cheeses B4 and S10 had the lowest pH values, 5.37 and 5.46, respectively, and were separated from the other cheeses which grouped together with pH values ranging from 5.52 to 5.74.
Baby Swiss cheeses were softer, on average, than the Swiss cheeses. Meltability, measured by melted diameter, ranged from 18 to 40 mm. The Emmental cheese had the lowest meltability (Table 4.4).
92 Free amino acid content of cheeses is indicative of the extent of proteolysis in cheese. Milk, rennet, starter, and nonstarter proteolytic enzyme systems contribute to total proteolytic activity in cheese (Martley and Crow, 1996). Free amino acids can be utilized by nonstarter bacteria or propionibacteria and serve as potential substrate for secondary fermentation and defects due to CO2 production. Among the cheeses analyzed, cheeses B2 and S6 had the higher concentrations free amino acids, and two baby Swiss varieties, cheese B1 and B4 had the lowest free amino acid concentration
(Figure 4.1). Baby Swiss cheese are ripened for shorter periods, therefore a lower free amino acid concentration is expected. As expected, the cheeses with lower free amino acid contents had lower pH values, cheeses with higher free amino acid content had higher pH values, in general. Theoretically, a propionic:acetic acid molar ratio of 2 is expected from fermentation of lactate by propionibacteria. In cheeses B1, B2, E5, S8, and S13 propionic:acetic molar ratio was in the vicinity of 2:1, for all other cheeses the ratio was significantly lower (Figure 4.2). Nonstarter bacteria may have a role in affecting this ratio either by increasing acetic acid levels or by decreasing fermentation of lactate by propionibacteria to propionic acid. In general, a more balanced flavor composition is expected from cheeses with a molar propionic:acetic acid ratio of approximately 2:1.
Electronic nose
The cheese samples separated into three groups with the baby Swiss cheeses grouping together. Reference compounds were used to determine the chemical nature of the masses that differentiated the samples. These compounds are indicated in Figure 4.3.
93 Cheeses E5, S8, and S13 were differentiated from the other cheeses with 2-butanol and propionic acid. Cheeses B1, B2, B3, B4, S6, S9, and S10 were differentiated by a combination of acetic acid, diacetyl and acetaldehyde; and cheeses S7, S11, S12, S14, and S15 were differentiated from the other groups by isobutyric and butyric acids.
Several other compounds were also related to differentiation, but these compounds have not been identified yet.
Electronic nose is a promising alternative for rapid discrimination of cheeses
based on volatile/aroma compounds. Electronic nose based on mass spectrometry has
been use to effectively differentiate different process cheeses, and Emmental cheeses
from various European countries (Pillonel et al., 2003).
These results complement descriptive sensory and comsumer preference studies.
Descriptive sensory analysis differentiated these cheeses by 17 of the 21 attributes specified. These attributes were used to determine what characteristics impact the liking.
Dairy and prickle attributes were positively correlated with liking, wheras cooked and cabbage flavor were negatively correlated with liking. Baby Swiss cheeses B1, B3, B4, and Swiss cheese S6 had high intensities of dairy notes and grouped together. Samples
S9, and S12 were characterized by nutty flavor (Rachel Liggett, 2005, personal
communication). Further analysis of all data combined is necessary to fully understand
the possible correlation between compositional characteristics and specific sensory
descriptors and comsumer liking by one segment of the population.
94 REFERENCES
Anggreani, O. 2004. Effects of glycine betaine and proline on salt tolerance of Propionibacterium freudenreichii strains. M.S. Thesis. The Ohio State University, Columbus, Ohio
AOAC, 1987. Official methods of analysis. 16th ed. AOAC International, Gaithersburg, MD, Method 926.08, sec 33.7.03.
Baer, A., I. Ryba, J. Meyer, and U. Buetikofer. 1996. Micro-plate assay of free amino acids in swiss cheeses. Food Science & Technology (London) 29: 58-62.
Folkertsma, B., and P. F. Fox. 1992. Use of the Cd-ninhydrin reagent to assess proteolysis in cheese during ripening. Journal of Dairy Reserach 59: 217–224.
Grappin, R., E. Beuvier, Y. Bouton, and S. Pochet. 1999. Advances in the biochemistry and microbiology of swiss-type cheeses. Lait 79: 3-22.
Kleinheinz, J.E. and J.W. Harper. 1997. Lower molecular weight free fatty acids in full fat and low fat Swiss cheese. Milchwissenscaft. 82: 622-625.
Kosikowski, F. V., and V. V. Mistry. 1997. Cheese with eyes. In: F. V. Kosikowski and V. V. Mistry (eds.) Cheese and fermented milk foods No. 2. p 108-117, Westport, CT.
Liggett, R. 2005. Personal communication.
Lynch, C. M., P. L. H. McSweeney, P. F. Fox, T. M. Cogan, and F. D. Drinan. 1997. Contribution of starter lactococci and non-starter lactobacilli to proteolysis in cheddar cheese with a controlled microflora. Lait 77: 441-459.
Marshall, R.T.(ed). 1992. Standard methods for the examination of dairy products. 16th ed. American Public Health Association, Washington, D.C.
Martley, F.G. and V.L. Crow. 1996. Open texture in cheese: the contributions of gas production by microorganisms and cheese manufacturing process. Journal of Dairy Research 63: 489-507.
Steffen, C., Flueckiger, E., Bosset, J.O. and M. Ruegg. 1987. Swiss-type varities. In: P. F. Fox (ed.) Cheese: Chemistry, physics and microbiology No. 2. p 93-120. Elsevier Applied Science Publisheres Ltd., New York.
95 Swearingen, P. A., D. J. O'Sullivan, and J. J. Warthesen. 2001. Isolation, characterization, and influence of native, nonstarter lactic acid bacteria on cheddar cheese quality. Journal of Dairy Science 84: 50-59.
Turner, K. W., H. A. Morris, and F. G. Martley. 1983. Swiss-type cheese. II. The role of thermophilic lactobacilli in sugar fermentation. New Zealand Journal of Dairy Science and Technology 18: 117-124. www.ams.usda.gov/standards/swiss_revised.pdf. 2001. United states standards for grades of swiss cheese, emmentaler cheese. United States Department of Agriculture, Agricultural Marketing Service, Dairy Programs.
96
CFU/g cheese Cheese Lactobacillus spp. S. thermophilus Propionibacterium spp. B1 1.04 x 106 1.06 x 108 5.10 x 108 B2 2.30 x 105 1.30 x 105 4.60 x 108 B3 7.20 x 106 2.50 x 106 1.25 x 105 B4 1.54 x 107 1.92 x 108 6.20 x 106 E5 1.66 x 106 3.00 x 103 3.60 x 108 S6 5.00 x 107 7.80 x 105 4.20 x 107 S7 1.92 x 108 3.00 x 104 2.71 x 107 S8 2.59 x 107 2.60 x 105 4.30 x 108 S9 2.48 x 107 2.00 x 105 3.70 x 107 S10 2.66 x 107 1.00 x 105 4.00 x 104 S11 2.69 x 107 5.00 x 105 1.09 x 108 S12 1.32 x 108 3.50 x 106 8.00 x 107 S13 2.47 x 107 2.00 x 106 6.20 x 108 S14 4.20 x 107 3.70 x 106 2.08 x 108 S15 1.94 x 108 3.20 x 106 2.72 x 108
Table 4.1. Bacterial cell numbers in fifteen Swiss-type cheese.
97
Mean ± standard error Cheese Protein (%) Fat (%) Moisture (%) Salt (%) Ash (%) B1 24.17 ± 0.59a 31.94 ± 0.8ab 41.83 ± 0.09a 2.78 ± 0.17b 3.70 ± 0.20a B2 25.48 ± 0.25a 29.81 ± 2.31ab 41.45 ± 0.39ab 3.41 ± 0.04a 3.70 ± 0.00a B3 25.11 ± 0.04a 29.94 ± 0.06ab 36.60 ± 0.12c 2.89 ± 0.22b 3.52 ± 0.08a B4 22.89 ± 0.91a 34.25 ± 0.25a 37.74 ± 0.10bc 1.93 ± 0.04c 3.23 ± 0.18a E5 26.07 ± 0.72a 30.79 ± 0.44ab 38.55 ± 0.14abc 0.96 ± 0.04ef 3.41 ± 0.29a S6 24.13 ± 0.64a 31.67 ± 1.48ab 36.96 ± 0.32c 1.22 ± 0.00de 2.80 ± 0.10a S7 25.75 ± 0.95a 30.88 ± 0.13ab 36.42 ± 0.24c 0.93 ± 0.04ef 3.11 ± 0.19a S8 23.73 ± 0.67a 32.00 ± 0.00ab 38.66 ± 0.04abc 1.78 ± 0.00c 2.94 ± 0.27a S9 26.09 ± 0.82a 31.13 ± 0.13ab 36.74 ± 0.50c 1.00 ± 0.00def 3.16 ± 0.34a S10 24.90 ± 1.27a 29.50 ± 0.50b 37.20 ± 0.08c 1.22 ± 0.00de 3.26 ± 0.14a S11 23.54 ± 1.09a 31.63 ± 0.63ab 38.40 ± 0.49abc 1.00 ± 0.00def 2.82 ± 0.02a S12 26.46 ± 0.15a 28.50 ± 0.50b 39.59 ± 2.23abc 0.70 ± 0.04f 3.50 ± 0.30a S13 26.00 ± 0.32a 30.00 ± 0.00ab 37.29 ± 0.10c 1.00 ± 0.00def 2.35 ± 0.35a S14 26.13 ± 0.01a 30.25 ± 0.00ab 36.66 ± 0.08c 0.93 ± 0.04ef 3.25 ± 0.05a S15 26.15 ± 0.08a 30.75 ± 0.25ab 36.44 ± 1.07c 1.37 ± 0.04d 2.90 ± 0.20a Means in the same column with the same letter are not significantly different (P≥0.05)
Table 4.2. Chemical characteristics of fifteen Swiss-type cheeses
98
Mean ± standard error Cheese pH pH Spear Tip Quinhydrone B1 5.58 ± 0.00ef 5.50 ± 0.01ghi B2 5.73 ± 0.02b 5.71 ± 0.01b B3 5.57 ± 0.01fg 5.57 ± 0.01def B4 5.37 ± 0.01i 5.40 ± 0.02j E5 5.80 ± 0.01a 5.49 ± 0.01ghi S6 5.58 ± 0.01ef 5.55 ± 0.01efg S7 5.63 ± 0.01de 5.53 ± 0.01efg S8 5.53 ± 0.01g 5.46 ± 0.01hi S9 5.54 ± 0.00fg 5.52 ± 0.00fgh S10 5.46 ± 0.00h 5.45 ± 0.00ij S11 5.74 ± 0.01b 5.51 ± 0.01fgh S12 5.57 ± 0.01fg 5.82 ± 0.03a S13 5.65 ± 0.01cd 5.62 ± 0.01cd S14 5.68 ± 0.00c 5.58 ± 0.01de S15 5.64 ± 0.02cd 5.67 ± 0.01bc Means in the same column with the same letter are not significantly different (P≥0.05)
Table 4.3. pH of fifteen Swiss-type cheeses.
99
Cheese Mean ± standard error Melted Diameter (mm) Hardness (mm) Springiness (mm) B1 32.67 ± 0.67cde 1.73 ± 0.12f 6.83 ± 0.39abc B2 24.17 ± 0.67g 2.28 ± 0.34ef 6.24 ± 0.22abcd B3 30.67 ± 0.88de 3.36 ± 0.39cdef 7.00 ± 0.26ab B4 32.83 ± 0.44cde 2.66 ± 0.40def 6.36 ± 0.56abcd E5 17.67 ± 0.44h 3.09 ± 0.32cdef 6.91 ± 0.46ab S6 26.33 ± 0.44fg 3.97 ± 0.43bcde 5.83 ± 0.17bcd S7 29.50 ± 0.29ef 2.64 ± 0.36def 6.78 ± 0.28abc S8 34.50 ± 1.32bcd 2.98 ± 0.41cdef 6.68 ± 0.10abcd S9 30.17 ± 1.01ef 4.63 ± 0.14abcd 5.17 ± 0.14d S10 31.33 ± 0.44cde 4.26 ± 0.48bcde 5.70 ± 0.16bcd S11 29.33 ± 0.17ef 3.59 ± 0.21cdef 5.51 ± 0.05bcd S12 38.33 ± 1.20ab 6.29 ± 0.22a 5.28 ± 0.26cd S13 37.33 ± 0.73ab 6.32 ± 0.47a 7.75 ± 0.06a S14 34.83 ± 1.45bc 5.69 ± 0.33ab 7.60 ± 0.48a S15 40.00 ± 0.29a 4.72 ± 0.73abc 6.67 ± 0.29abcd Means in the same column with the same letter are not significantly different (P≥0.05)
Table 4.4. Physical characteristics of fifteen Swiss-type cheeses.
100 14
12
10
8
6 mmol / kg cheese 4
2
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Cheese
Figure 4.1. Free amino acids content of fifteen Swiss-type cheeses. Error bars represent ± standard error, n = 3.
101 700
Acetic acid 600 Propionic acid Butyric acid
500
400
300 mg/100g cheese mg/100g 200
100
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Cheese
Figure 4.2. Short chain free fatty acids content of fifteen Swiss-type cheeses. Error bars represent ± standard error, n = 3.
102
Figure 4.3. Principal component analysis plot of electronic nose evaluation of cheeses.
103
BIBLIOGRAPHY
Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403-410.
Anggreani, O. 2004. Effects of glycine betaine and proline on salt tolerance of Propionibacterium freudenreichii strains. M.S. Thesis. The Ohio State University, Columbus, Ohio
AOAC, 1987. Official methods of analysis. 16th ed. AOAC International, Gaithersburg, MD, Method 926.08, sec 33.7.03.
Baer, A. 1995. Influence of casein proteolysis by starter bacteria, rennet and plasmin on the growth of propionibacteria in swiss-type cheese. Lait 75: 391-400.
Baer, A., I. Ryba, J. Meyer, and U. Buetikofer. 1996. Micro-plate assay of free amino acids in swiss cheeses. Food Science & Technology (London) 29: 58-62.
Bachmann, H.P., U. Butikofer, R.Badertscher, M. Dallatorre, P. Lavanchy, U. Buhler- Moor, B. Nick, J. Jimeno, R. warmke, W. Grosch, R. Sieber, and J.O. Bosset. 1997. Ripening of Emmental cheese wrapped in foil with and without addition of Lactobacillus casei subsp casei: microbial, chemical, rheological and sensorial investigations. Lebensmittel- Wissenschaft und Technologie 30: 417-428.
Banks, J.M. and A.G. Williams. 2004. The role of nonstarter lactic acid bacteria in Cheddar cheese ripening. International Journal of Dairy Technology 57: 145-152.
Bouton, Y, P. Guyot, E. Beuvier, P. Tailliez and R. Grappin. 2002. Use of PCR-based methods and PFGE for typing and monitoring homofermentative lactobacilli during Comté cheese ripening. International Journal of Food Microbiology 76: 27-38.
Coeuret, V., S. Dubernet, M. Bernardeau, M. Gueguen, and J. P. Vernoux. 2003. Isolation, characterisation and identification of lactobacilli focusing mainly on cheeses and other dairy products. Lait 83: 269-306.
Collins, Y. F., P. L. McSweeney, and M. G. Wilkinson. 2003. Evidence of a relationship between autolysis of starter bacteria and lipolysis in cheddar cheese during ripening. Journal of Dairy Research 70: 105-113.
104
Crow, V., B. Curry, and M. Hayes. 2001. The ecology of non-starter lactic acid bacteria (nslab) and their use as adjuncts in new zealand cheddar. International Dairy Journal 11: 275-283.
Dalgaard, P. and K. Koutsoumanis. 2001. Comparison of maximum specific growth rates and lag times estimated from absorbance and viable count data by different mathematical models.J Microbiol Methods. 2001 Jan;43(3):183-196.
Deborde, C., D.B. Rolin, A. Bondon, J.D. de Certaines and P. Boyoval. 1998. In vivo nuclear resonance study of citrate metabolism in Propionibacterium freudenreichii subsp. shermanii. Journal of Dairy Science 65: 504-514.
De Figueroa, R. M., F. Alvarez, A. P. De Ruiz Holgado, G. Oliver, and F. Sesma. 2000. Citrate utilization by homo- and heterofermentative lactobacilli. Microbiological Research 154: 313-320.
Dellaglio F, G.E. Felis and S. Torriani. 2002. The status of the species Lactobacillus casei (Orla-Jensen 1916) Hansel and Lessel 1971 and Lactobacillus paracasei Collins et al. 1989. Request for an opinion. International Journal of Systematic and Evolutionary Microbiology 52: 285-287.
Dicks, L.M.T., E.M. Du Plessis, F. Dellaglio, and E. Lauder. 1996. Reclassification of Lactobacillus casei subsp. casei ATCC 393 and Lactobacillus rhamnosus ATCC 15820 as Lactobacillus zeae nom. rev. Designation of ATCC 334 as the Neotype of L. casei subsp. casei, and Rejection of the Name Lactobacillus paracasei. International Journal of Systematic Bacteriology 46: 337-340.
Drake, M.A., S.C. McIngvale, P.D. Gerard, K.R. Cadwallader, and G.V. Civille. 2001. Development of a descriptive language for cheddar cheese. Journal of Food Science 66: 1422-1427.
Drake, M.A. and Civille, G.V. 2003. Flavor lexicons. Comprehensive Reviews in Food Science 2: 33-40.
Drake, M.A., P.D. Gerard, J.P. Kleinheinz, and W.J. Harper. 2003. Appplication of an electronic nose to correlate with descriptive sensory analysis of aged Cheddar cheese. Lebensmittel- Wissenschaft und Technologie 36: 13-20.
Drider, D., S. Bekal, and H. Prévost. 2004. Genetic organization and expression of citrate permease in lactic acid bacteria. Genetics and Molecular Research 3: 273-281
Dudley E.G., and J.L. Steele. 2005. Succinate production and citrate catabolism by Cheddar cheese nonstarter lactobacilli. Journal of Applied Microbiology 98: 14-23.
105 Felder, P. 2002. Personal communication.
Folkertsma, B. and P.F. Fox. 1992. Use of Cd-ninhydrin reagent to assess proteolysis in cheese during ripening. Journal of dairy Research 59: 217-224.
Fox, P. F., and P. L. H. McSweeney. 1998. Dairy chemistry and biochemistry.
Frohlich-Wyder, M.-T. 2002. Interactions between propionic acid bacteria and starter- /non-starter lactic acid bacteria in emmentaler cheese. Lebensmittelindustrie und Milchwirtschaft 123: 31-34.
Gagnaire, V., R. Boutrou, and J. Leonil. 2001a. How can the peptides produced from emmental cheese give some insights on the structural features of the paracasein matrix? International Dairy Journal 11: 449-454.
Gagnaire, V., D. Molle, M. Herrouin, and J. Leonil. 2001b. Peptides identified during emmental cheese ripening: Origin and proteolytic systems involved. Journal of Agricultural and Food Chemistry 49: 4402-4413.
Garcia-Quintans, N., C. Magni, D. de Mendoza, and P. Lopez. 1998. The citrate transport system of Lactococcus lactis subsp. lactis biovar diacetylactis is induced by acid stress. Applied and Environmental Microbiology 64: 850-857.
Gilles, J., K.W. Turner, and F.G. Martley. 1983. Swiss-type cheese 1. Manufacturing and sampling procedures. New Zealand Journal of Dairy Science 18:109-115.
Grappin, R., E. Beuvier, Y. Boulton, and S. Pochet. 1999. Advances in the biochemistry and microbiology of Swiss-type cheeses. Lait 79: 93-104.
Guinee, T.P. 2004. Salting and the role of salt in cheese. International Journal of Dairy technology. 57: 99-109.
Haddad, S., I. Sodini, C. Monnet, E. Latrille, and G. Corrieu. 1997. Effect of citrate on growth of Lactococcus lactis subsp. lactis in milk. Applied Microbiology and Biotechnology 48: 236-241.
Hannon, J. A. et al. 2003. Use of autolytic starter systems to accelerate the ripening of cheddar cheese. International Dairy Journal 13: 313-323.
Hong, G. 2002. Personal communication.
Hunger, W. 1986. Esculin cellobiose agar (ec agar) for the isolation and bacterial counting of Lactobacillus acidophilus. Milchwissenschaft 41: 283-285.
106 Izco, J. M., M. Tormo, A. Harris, P. S. Tong, and R. Jimenez-Flores. 2003. Optimization and validation of a rapid method to determine citrate and inorganic phosphate in milk by capillary electrophoresis. Journal of Dairy Science 86: 86-95.
Jaros, D., W. Ginzinger, E. Tschager, H.K. Mayer, and H. Rohm. 1997. Effects of water addition on composition and fracture properties of Emmental cheese. Lait 77: 467- 477.
Jenkins, J. K., W. J. Harper, and P. D. Courtney. 2002. Genetic diversity in swiss cheese starter cultures assessed by pulsed field gel electrophoresis and arbitrarily primed pcr. Letters in Applied Microbiology 35: 423-427.
Jimeno, J., M. J. Lazaro, and H. Sollberger. 1995. Antagonistic interactions between propionic acid bacteria and non-starter lactic acid bacteria. Lait 75: 401-413.
Jobin, M.-P., F. Delmas, D. Garmyn, C. Divies, and J. Guzzo. 1998. Characterization of small heat-shock proteins in lactic acid bacteria. Lait 78: 165-171.
Juillard, V., A. Guillot, D. Le Bars, and J. C. Gripon. 1998. Specificity of milk peptide utilization by lactococcus lactis. Applied and Environmental Microbiology 64: 1230- 1236.
Kang, O. J., S. Laberge, and R. E. Simard. 2003. Detection and localization of a peptidoglycan hydrolase in lactobacillus delbrueckii subsp. Bulgaricus. Journal of Dairy Science 86: 96-104.
Kempler, G. M., and L. L. McKay. 1980. Improved medium for detection of citrate fermenting streptococcus lactis ssp diacetylactis. Applied and Environmental Microbiology 39: 926-927.
Kerjean, J.R., H.P. Bachmann, and T. Cogan. 2001. Technical note: Cooking temperature of whey and curd during Emmental cheese-making. Milchwissenschaft 56: 556.
Kieronczyk, A., S. Skeie, T. Langsrud, and M. Yvon. 2003. Cooperation between lactococcus lactis and nonstarter lactobacilli in the formation of cheese aroma from amino acids. Applied and Environmental Microbiology 69: 734-739.
Kleinheinz, J.E. and J.W. Harper. 1997. Lower molecular weight free fatty acids in full fat and low fat Swiss cheese. Milchwissenscaft. 82: 622-625.
Kosikowski, F. V., and V. V. Mistry. 1997. Cheese with eyes. In: F. V. Kosikowski and V. V. Mistry (eds.) Cheese and fermented milk foods No. 2. p 108-117, Westport, CT.
107 Lawler, J.B., C.M.Delahunty, M.G. Wilkinson, and J. Sheehan. 2003. Swiss-type and SwissCheddar hybrid-type cheeses: effects of manufacture on sensory character and relationships between the sensory attributes and volatile compounds and gross compositional constituents. International Journal of Dairy Technology. 56: 39-50.
Lawrence, R.C., L.K. Creamer, and J. Gilles. 1987. Texture development during cheese ripening. Journal of Dairy Science 70: 1748-1760.
Lick, S. 2003. Review: Typing systems for lactobacilli. Milchwissenschaft 58: 256-260.
Liggett, R. 2005. Personal communication.
Liu, S. Q. 2003. Practical implications of lactate and pyruvate metabolism by lactic acid bacteria in food and beverage fermentations. International Journal of Food Microbiology 83: 115-131.
Lortal, S. A. Roualt, S. Guezenec and M. Gautier. 1997. Lactobacillus helveticus: strain typing and genome size stimation by pulsed field gel electrophoresis. Current Microbiology 34: 180-185.
Lortal, S., R. Lemee, and F. Valence. 1997. Autolysis of thermophilic lactobacilli and dairy propionibacteria: A review. Lait 77: 133-150.
Lynch, C. M., P. L. H. McSweeney, P. F. Fox, T. M. Cogan, and F. D. Drinan. 1997. Contribution of starter lactococci and non-starter lactobacilli to proteolysis in cheddar cheese with a controlled microflora. Lait 77: 441-459.
Madec, M-N, A. Rauault, J.L. Maubois, and A. Thierry. 1996. Selective medium containing lithium and a polyol or antibiotic for counting propionibacteria. Official Gazette of the United States Patent and Trademark Office Patents 1192 (2): 1226.
Marilley, L., S. Ampuero, T. Zesiger, and M.G.Casey. 2004. Screening of aroma- producing lactic acid bacteria with an electronic nose. International Dairy Journal. 14: 849-856.
Martin, M., M. A. Corrales, D. de Mendoza, P. Lopez, and C. Magni. 1999. Cloning and molecular characterization of the citrate utilization citmcdefgrp cluster of leuconostoc paramesenteroides. FEMS Microbiology Letters 174: 231-238.
Marshall, R.T.(ed). 1992. Standard methods for the examination of dairy products. 16th ed. American Public Health Association, Washington, D.C.
Martley, F.G. and V.L. Crow. 1996. Open texture in cheese: the contributions of gas production by microorganisms and cheese manufacturing process. Journal of Dairy Research 63: 489-507.
108 Meilgaard, M.M, G.V. Civille, and B.T. Carr (ed.). 1999. Descriptive analysis techniques, p. 161-171. In Sensory Evaluation Techniques, 3nd ed. CRC Press, Boca Raton, FL
Mocquot, G. 1979. Reviews of the progress of dairy science: Swiss-type cheese. Journal of Dairy Research 46: 133-160.
Noël, Y, P. Poyoval, A. Thierry, V. Gagnaire, and R. Grappin. 1999. Eye formation and Swiss-type cheeses. p.222-250. In B.A. Law (ed.), Technology of cheese making CRC Press, Boca Raton, FL.
Palles, T., T. Beresford, S. Condon, and T. M. Cogan. 1998. Citrate metabolism in Lactobacillus casei and Lactobacillus plantarum. Journal of Applied Microbiology 85: 147-154.
Perreard, E., and J.F. Chamba. 2002. Contribution of propionic acid bacteria to lipolysis of Emmental cheese. Lait 82: 33-44.
Pillonel, L., Badertscher, R., Butikofer, U., Casey, M., Dalla Torre, M., Lavanchy, P., Meyer, J., Tabacchi, R., J. O. Bosset. 2002. Analytical methods for the determination of the geographic origin of emmentaler cheese. Main framework of the project; chemical, biochemical, microbiological, colour and sensory analyses. European Food Research and Technology 215: 260-267.
Pillonel, L. S., R. Ampiero, R. Tabacchi and J.O. Bosset. 2003. Analytical methods for the determination of the geographic origin of Emmental cheese: volatile compounds by GC/MS-FID and electronic nose. European Food Research and Technology 216: 179-183.
Piveteau, P. G., S. Condon, and T. M. Cogan. 1995. Interactions between lactic and propionic acid bacteria. Lait 75: 331-343.
Prasad, J., P. McJarrow, and P. Gopal. 2003. Heat and osmotic stress responses of probiotic lactobacillus rhamnosus hn001 (dr20) in relation to viability after drying. Applied and Environmental Microbiology 69: 917-925.
Preininger, M., R. Warmle, and W. Grosh. 1996. Identification of the character impact flavour compounds of Swiss cheese by sensory studies of models. Zeitschrift-fuer- Lebensmittel-Untersuchung-und-Forschung. 202: 30-34.
Ramsayer, B. 2002. Personal communication.
Reinbold, G.W. 1972. Swiss Cheese Varieties. Pfizer Inc., New York, NY.
109 Russell, W. M., and T. R. Klaenhammer. 2001. Efficient system for directed integration into the lactobacillus acidophilus and lactobacillus gasseri chromosomes via homologous recombination. Applied and Environmental Microbiology 67: 4361- 4364.
Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. In Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
Shakeel ur, R., P. F. Fox, P. L. H. McSweeney, S. A. Madkor, and N. Y. Farkye. 2001. Alternatives to pilot plant experiments in cheese-ripening studies. International Journal of Dairy Technology 54: 121-126.
Somers, E.B., M.E. Johnson, and A.C.L. Wong. 2001. Biofilm formationand contamination of cheese by nonstarter lactic acid bacteria in the dairy environment. Journal of Dairy Science 84: 1926-1936.
Steffen, C., Flueckiger, E., Bosset, J.O. and M. Ruegg. 1987. Swiss-type varities. In: P. F. Fox (ed.) Cheese: Chemistry, physics and microbiology No. 2. p 93-120. Elsevier Applied Science Publisheres Ltd., New York.
Swearingen, P. A., D. J. O'Sullivan, and J. J. Warthesen. 2001. Isolation, characterization, and influence of native, nonstarter lactic acid bacteria on cheddar cheese quality. Journal of Dairy Science 84: 50-59.
Tannock, G. W. et al. 1999. Identification of lactobacillus isolates from the gastrointestinal tract, silage, and yoghurt by 16s-23s rrna gene intergenic spacer region sequence comparisons. Applied and Environmental Microbiology 65: 4264- 4267.
Terzaghi, B.E. and W.E. Sandine. 1975. Improved medium for lactic streptococci and their bacteriophages. Applied Microbiology 29: 807-813.
Tilsala-Timisjarvi, A., and T. Alatossava. 1997. Development of oligonucleotide primers from the 16s-23s rrna intergenic sequences for identifying different dairy and probiotic lactic acid bacteria by pcr. International Journal of Food Microbiology 35: 49-56.
Turner, K. W., H. A. Morris, and F. G. Martley. 1983. Swiss-type cheese. Ii. The role of thermophilic lactobacilli in sugar fermentation. New Zealand Journal of Dairy Science and Technology 18: 117-124.
Valence, F., S.-M. Deutsch, R. Richoux, V. Gagnaire, and S. Lortal. 2000. Autolysis and related proteolysis in swiss cheese for two lactobacillus helveticus strains. Journal of Dairy Research 67: 261-271.
110 Valence, F., R. Richoux, A. Thierry, A. Palva, and S. Lortal. 1998. Autolysis of lactobacillus helveticus and propionibacterium freudenreichii in swiss cheeses: First evidence by using species-specific lysis markers. Journal of Dairy Research 65: 609- 620.
Vaughan, E. E. et al. 1995. Characterization of plasmid-encoded citrate permease (citp) genes from Leuconostoc species reveals high sequence conservation with the Lactococcus lactis citp gene. Applied and Environmental Microbiology 61: 3172- 3176.
Weinrichter B, W. Luginbuhl, H. Rohm, and J. Jimeno. 2001. Diffrentiation of facultatively heterofermentative lactobacilli from plants, milk, and hard type cheeses by SDS-PAGE, RAPD, FTIR, energy source utilization and autolysis type. Lebensmittel-Wissenschaft und -Technologie 34: 556-566.
White, S. R., J. R. Broadbent, C. J. Oberg, and D. J. McMahon. 2003. Effect of lactobacillus helveticus and propionibacterium freudenreichii ssp. shermanii combinations on propensity for split defect in swiss cheese. Journal of Dairy Science 86: 719-727.
Whitley, K., and V. M. Marshall. 1999. Heterofermentative metabolism of glucose and ribose and utilization of citrate by the smooth biotype of Lactobacillus amylovorus NCFB 2745. Antonie van Leeuwenhoek 75: 217-223.
Wilster, G. H. 1980. Practical cheesemaking. Thirteenth ed. Oregon State University Book Stores Inc., Corvallis, OR. www.ams.usda.gov/standards/swiss_revised.pdf. 2001. United states standards for grades of swiss cheese, emmentaler cheese. United States Department of Agriculture, Agricultural Marketing Service, Dairy Programs. www.nass.usda.gov. 2003.
111