The Dynamic Role of Jumonji C Domain Containing Protein 6 in Placental Development and Disease

Sruthi Alahari

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Physiology University of Toronto

Sruthi Alahari

Doctor of Philosophy

Department of Physiology University of Toronto

2017

Abstract

Perturbations in oxygen sensing are a defining feature of placental-associated pathologies such as preeclampsia, a serious disorder of pregnancy. Preeclamptic placentae have markedly elevated levels of Hypoxia Inducible Factor 1α (HIF1A), a master regulator of oxygen homeostasis.

Mounting evidence implicates a family of Fe2+ and oxygen-dependent Jumonji C domain containing enzymes (JMJDs) as mediators of the epigenetic code and hypoxic gene expression.

While several JMJDs are induced in hypoxia, their role in pregnancy remains unclear. The goal of this study was to characterize JMJD6 function in the placenta in physiological and pathological conditions, and unravel its regulatory relationship with von Hippel Lindau tumour suppressor (VHL), a key executor of the cellular hypoxic response. JMJD6 expression inversely correlated with changes in oxygen tension during placental development, while JMJD6 protein and mRNA were significantly elevated in low oxygen and in early-onset preeclamptic (E-PE) placentae. In vitro demethylation assays revealed that optimal JMJD6-dependent demethylation of its histone targets, H3R2me2s and H4R3me2s, occurred in normoxia, and this was impaired in

E-PE placentae due to a hypoxia-iron imbalance. In cytotrophoblast cells, JMJD6 is a positive

ii regulator of VHL gene expression in normoxia. Accordingly, JMJD6 histone targets in E-PE placentae showed marked reductions in their association with VHL promoter regions.

Independent of VHL gene regulation, JMJD6 also controlled VHL protein stability through lysyl hydroxylation and promoting its SUMO1-dependent SUMOylation. Importantly, the Jumonji C catalytic domain was found to be indispensable in executing both functions of JMJD6. In summary, these data signify a novel function for JMJD6 as an oxygen sensor in the human placenta, exerting a dual role in regulating VHL gene and protein. Uncovering epigenetic oxygen sensing mechanisms controlling HIF1A is crucial for defining the unique molecular signature of preeclampsia, which may ultimately translate to molecular-based diagnosis and therapy.

iii

Acknowledgments

First and foremost, I want to express my sincere gratitude to my supervisor, Dr. Isabella

Caniggia, who has been both a professional and personal inspiration. She has guided me throughout the ups and downs of this journey and prepared me for a career in academia. I will always fondly look back on our long chats and shared excitement over new ideas.

I would also like to acknowledge past and present members of the Caniggia lab who have made this journey that much smoother. Thank you to Sarah, Julia, Jon, Liane, Leo, Julien, Brandon and

Abby for all the friendship, laughs and profound discussions on life and science. It was a pleasure working with you all. Special thanks to Andrea Tagliaferro for being a great friend, counsellor and constant support system.

Thank you to my friends and mentors on the 6th floor of the Lunenfeld-Tanenbaum Research

Institute, who have always provided a helping hand, some of who have been on this journey with me.

I am grateful to the members of my supervisory committee: Dr. Theodore Brown, Dr. Daniel

Drucker and Dr. Jaques Belik. I appreciate your invaluable feedback and encouragement throughout.

Special thanks to Dr. Martin Post for his critical insights and appraisal of my research.

Last but not the least, this work is also a reflection of the unwavering support of my family.

Thank you to my loving husband, who has stood by me through thick and thin and encouraged me to do what I love. I am incredibly grateful to my wonderful parents who taught me valuable lessons in life, and my sister for always being there for me. They have worked selflessly to give me a better life and their love and guidance have made me the person I am today.

Contributors

The following people have contributed to the collection of material and generation of data reported in this thesis:

Research Centre for Women’s and Infant’s Health (RCWIH) BioBank at Mount Sinai Hospital

(Toronto, Canada) for supplying first trimester, normal and pathological human placental tissues and explants.

Chapter 3: The data reported in this chapter are part of a manuscript submission to the journal

PLOS Genetics. Dr. Isabella Caniggia and Dr. Jing Xu performed the experiments in Figure 3.1.

Dr. Alessandro Rolfo performed the Western blotting for CP in preeclamptic placentae and sera, reported in Figure 3.5. Dr. Julia Garcia performed the experiments on VHL DNA methylation, reported in Figure 3.7.

Chapter 4: The work presented in this chapter is part of a published manuscript in the journal,

Endocrinology, in the form: Alahari, S., M. Post, and I. Caniggia, Jumonji Domain Containing

Protein 6: A Novel Oxygen Sensor in the Human Placenta. Endocrinology, 2015. 156(8): p.

3012-25. Official permission was obtained from the journal. Dr. Alessandro Rolfo performed anti-sense oligonucleotide knockdown of HIF1A in placental villous explants, reported in Figure

4.4B (right panel).

The work presented in this thesis was supported by a Canadian Institute of Health Research

(CIHR) grant held by Dr. Isabella Caniggia. I am a recipient of an Ontario Student Opportunity

Trust Fund (OSOTF) Award provided by Mount Sinai Hospital, and a Queen Elizabeth II

Graduate Scholarships in Science & Technology (QEII-GSST) award.

Table of Contents

Acknowledgments ...... iv

Contributors ...... v

Table of Contents ...... vi

List of Tables ...... x

List of Figures ...... xi

Abbreviations ...... xiv

1.1 Introduction ...... 1

1.2 Mechanisms of Oxygen Sensing ...... 1

1.2.1 Acute oxygen sensing responses by chemoreceptors ...... 2

1.2.2 Chronic oxygen sensing responses by hypoxia-inducible factors ...... 5

1.2.3 The von-Hippel Lindau Tumour Suppressor (VHL) ...... 10

1.2.4 Hypoxia and the Epigenome ...... 18

1.3 Epigenetic Regulation by the Jumonji C Family of Proteins ...... 19

1.3.1 Histone Modifications and the Epigenetic Code ...... 20

1.3.2 Jumonji Domain Containing Family of Proteins ...... 26

1.3.3 JmjC Domain Containing Protein 6 ...... 31

1.4 Oxygen Sensing in the Placenta ...... 36

1.4.1 Early placental development ...... 37

1.4.2 Oxygen changes in the developing placenta ...... 40

1.4.3 Oxygen sensing machinery in the developing placenta ...... 42

1.4.4 Placental pathologies characterized by disrupted oxygen sensing ...... 43

1.4.5 Oxygen changes in preeclampsia ...... 45

1.4.6 Epigenetics in the Placenta ...... 48

1.5 RATIONALE, HYPOTHESIS, OBJECTIVES ...... 51

2 Materials and Methods ...... 53

2.1 Placental Tissue and Sera from Human Subjects ...... 53

2.2 Mouse Strains...... 55

2.3 Primary Trophoblast Cell Isolation ...... 55

2.4 Villous Explant Culture and antisense knockdown ...... 57

2.5 Human Cell Lines and Culture Conditions ...... 58

2.5.1 Pharmacological Treatments ...... 59

2.6 Iron Assay ...... 60

2.7 Antibodies ...... 60

2.8 Western Blotting ...... 61

2.9 Immunoprecipitation ...... 62

2.10 Immunohistochemistry and Immunofluorescence ...... 63

2.11 siRNA Transfections ...... 64

2.12 Plasmid Constructs and Transfections ...... 65

2.13 RNA Isolation and Quantitative PCR ...... 66

2.14 Histone Isolations and ‘In vitro Demethylation’ Reactions ...... 67

2.15 Chromatin Immunoprecipitation ...... 69

2.16 Bisulfite Treatment, Cloning and Sequencing ...... 69

2.17 Statistical Analyses ...... 70

3 JMJD6-mediated histone demethylation contributes to epigenetic regulation of VHL in the human placenta ...... 71

Rationale ...... 71

3.1 Introduction ...... 72

3.2 Results ...... 74

3.2.1 VHL protein and gene expression are altered in early-onset preeclampsia ...... 74

vii

3.2.2 The Jumonji C domain of JMJD6 regulates VHL gene in an oxygen- dependent manner ...... 75

3.2.3 JMJD6 demethylates H3R2me2s and H4R3me2s in the human placenta in an oxygen-dependent manner ...... 81

3.2.4 JMJD6-mediated histone demethylation is compromised in preeclamptic placentae ...... 84

3.2.5 VHL gene is subject to modification by JMJD6-dependent histone arginine demethylation ...... 90

3.2.6 VHL DNA methylation is altered in preeclamptic placenta ...... 94

3.2.7 JMJD6 histone demethylase function and VHL expression are disrupted in a murine model of pharmacological hypoxia during pregnancy ...... 98

3.2.8 Inhibition of Jumonji histone demethylation during pregnancy disrupts placental architecture ...... 104

3.1 Discussion...... 106

3.1.1 JMJD6 exhibits oxygen-dependent histone arginine demethylation in the human placenta ...... 106

3.1.2 VHL is subject to dual epigenetic regulation via histone modifications and DNA methylation ...... 107

3.1.3 VHL mRNA and protein are downregulated in severe early-onset preeclampsia and a murine model of pharmacological molecular hypoxia ...... 109

3.1.4 Hypoxia-iron imbalance impairs JMJD6 function in human and murine models of hypoxia during pregnancy ...... 110

4 The Jumonji C domain containing protein 6 is a novel oxygen sensor in the human placenta ...... 114

4.1 Introduction ...... 116

4.2 Results ...... 118

4.2.1 JMJD6 spatial and temporal placental expression in vivo ...... 118

4.2.2 JMJD6 is elevated in severe early-onset preeclamptic placentae ...... 121

4.2.3 JMJD6 is induced in low oxygen and oxidative stress and is a target of HIF1A 124

4.2.4 JMJD6 mediates HIF1A stability through its actions on pVHL in normoxia .....129

viii

4.3 Discussion...... 144

4.3.1 JMJD6 is regulated by changes in oxygen tension in the human placenta ...... 144

4.3.2 JMJD6 is a novel regulator of pVHL stability in the human placenta...... 145

4.3.3 JMJD6 is significantly elevated in severe early-onset preeclampsia ...... 146

5 Overall Conclusions ...... 149

6 Limitations of the study ...... 155

6.1 Limitations of mouse models ...... 155

7 Future Directions ...... 156

7.1 Role of other JMJD family members in shaping placental development ...... 156

7.2 Generate a placenta-specific Jmjd6-/- murine model ...... 158

7.3 Does JMJD6-dependent histone demethylation affect HIF1A gene transcription? ...... 159

7.4 Is VHL subject to cross-talk between DNA methylation and histone modifications? .....162

7.5 Statement of Conclusion ...... 163

Appendix ...... 164

References ...... 166

List of Tables

TABLE 2.1 – CLINICAL PARAMETERS OF PATIENT POPULATION…..………………..54

TABLE 2.2 – PRIMERS EMPLOYED IN ChIP AND VHL DNA METHYLATION STUDIES………………………………………………………………………………………...67

List of Figures

FIGURE 1.1 – THE CANONICAL CELLULAR OXYGEN SENSING PATHWAY………….8

FIGURE 1.2 – THE VON-HIPPEL LINDAU TUMOUR SUPPRESSOR AND ITS MYRIAD FUNCTIONS……………………………………………………………………………………15

FIGURE 1.3 – THE HISTONE CODE, AS EXECUTED BY EPIGENETIC WRITERS, READERS AND ERASERS………………………………………………………………….…22

FIGURE 1.4 – DOMAIN STRUCTURES OF JUMONJI DEMETHYLASES AND THEIR HISTONE TARGETS………………………………………………………..………………….30

FIGURE 1.5 – DOMAIN STRUCTURES OF THE DIOXYGENASES, JMJD6 AND FIH1 INDICATING SITES OF HOMOLOGY WITHIN THE RESPECTIVE JUMONJI C CATALYTIC DOMAINS…………………………………………………………………..…...32

FIGURE 1.6 – OXYGEN CHANGES IN THE DEVELOPING PLACENTA………………...38

FIGURE 3.1 – ELEVATED HIF1A IN E-PE CAN BE ATTRIBUTED TO IMPAIRED VHL EXPRESSION AND FUNCTION…………………………………………..………...... ………77

FIGURE 3.2 – THE JUMONJI C DOMAIN OF JMJD6 IS RESPONSIBLE FOR REGULATING VHL GENE IN NORMOXIC CONDITIONS………………………….….....79

FIGURE 3.3 – JMJD6 DEMETHYLATES H3R2ME2S AND H4R3ME2S HISTONE MARKS IN AN OXYGEN-DEPENDENT MANNER IN BULK HISTONES …………………...…..…82

FIGURE 3.4 – JMJD6 HISTONE DEMETHYLASE ACTIVITY IS IMPAIRED IN PREECLAMPTIC PLACENTAE...... 86

FIGURE 3.5 – EXCESS FE2+ PARTIALLY RESCUES JMJD6-MEDIATED DEMETHYLATION OF ITS HISTONE TARGETS IN PREECLAMPSIA………..…….……88

FIGURE 3.6 – VHL IS SUBJECT TO CHANGES IN JMJD6-MEDIATED HISTONE ARGININE DEMETHYLATION……………………………………….………………..…..…92

FIGURE 3.7 – REDUCED VHL IN PREECLAMPSIA IS IN PART DUE TO ALTERED VHL DNA METHYLATION FAVORING E2F4-MEDIATED TRANSCRIPTIONAL REPRESSION…………………………………………………………………………………...96

FIGURE 3.8 – PLACENTAL VHL IS DYSREGULATED IN A MURINE MODEL OF PHARMACOLOGICAL HYPOXIA…………………………………………...……………...100

FIGURE 3.9– JMJD6 HISTONE DEMETHYLASE ACTIVITY IS DISRUPTED IN THE MURINE PLACENTA UPON FG-4592 TREATMENT. …………………………..………...102

FIGURE 3.10 – INHIBITION OF JUMONJI HISTONE DEMETHYLATION DISRUPTS PLACENTAL ARCHITECTURE………………………………………………….……...... …105

FIGURE 3.11 – PUTATIVE MODEL OF EPIGENETIC REPRESSION OF VHL GENE IN PREECLAMPSIA……………………………………………………………..………..……...113

FIGURE 4.1 – JMJD6 PROTEIN ABUNDANCE DURING EARLY PLACENTAL DEVELOPMENT…………………………………………………………………………....…119

FIGURE 4.2 – JMJD6 IS ELEVATED IN EARLY-ONSET PREECLAMPTIC PLACENTAE………………………………………………………………………….…….…122

FIGURE 4.3 – JMJD6 IS ELEVATED IN CONDITIONS OF LOW OXYGEN AND OXIDATIVE STRESS IN VITRO………………………………………….…………….…….125

FIGURE 4.4 – JMJD6 IS A PUTATIVE TRANSCRIPTIONAL TARGET OF HIF1A……..128

FIGURE 4.5 – JMJD6 IS A NEGATIVE REGULATOR OF HIF1A…………………….…..130

FIGURE 4.6 – JMJD6 IS A POSITIVE REGULATOR OF pVHL STABILITY…………….132

xii

FIGURE 4.7 – JMJD6 ASSOCIATES WITH pVHL IN AN OXYGEN-DEPENDENT MANNER………………………………………………………………………………….…...135

FIGURE 4.8 – JMJD6 IS A PUTATIVE pVHL LYSYL HYDROXYLASE………………...138

FIGURE 4.9 – JMJD6 ASSOCIATION TO pVHL IS DISRUPTED UPON MUTATION OF SPECIFIC LYSINE RESIDUES...... 140

FIGURE 4.10 – JMJD6 PROMOTES pVHL STABILITY VIA SUMO1-DEPENDENT SUMOYLATION……………………………………………………………...……………….142

FIGURE 4.11 – PUTATIVE MODEL OF JMJD6-MEDIATED pVHL AND HIF1A REGULATION IN NORMOXIA…………………………………………….……………...…148

FIGURE 5.1 – PUTATIVE MODEL OF JMJD6 DUAL REGULATION OF VHL GENE AND PROTEIN IN PREECLAMPSIA……………………………………………..………………..151

FIGURE 5.2 – MAPPING OF JMJD2A PROTEIN IN JEG3 CELLS AND EARLY-ONSET PREECLAMPTIC PLACENTAE……………………………………………..……………….157

FIGURE 5.3 – DEMETHYLATION OF H4R3ME2S DECREASED ITS ASSOCIATION WITH HIF1A…………………………………………………………………………………..161

xiii

Abbreviations

5–AZA – 5 - Azacytidine

α–KG – α-ketoglutarate oC – degree Celsius

ACOG – The American Congress of Obstetricians and Gynecologists

ACTB – Beta-actin

AMC – Age matched Control

B23 – nucleolar phosphoprotein B23 bHLH – Basic helix-loop-helix

BSA – Bovine Serum Albumin ccRCC – Clear Cell Renal Cell Carcinoma

ChIP – Chromatin Immunoprecipitation

CP – Ceruloplasmin

CpG – Cytosine – phosphate – Guanine

CT – Cytotrophoblast

CUL2 – Cullin 2

DAB – Diaminobenzidine tetraaminobiphenyl

DAPI – 4',6 Diamidino-2-phenylindole

DEPC – Diethyl Pyrocarbonate

DFO – Desferroxamine dH2O – distilled water

DMEM – Dulbecco’s Modified Essential Medium

DMSO – Dimethyl Sulfoxide

DNA – Deoxyribonucleic Acid

xiv

E2F4 – E2F transcription factor 4

EMEM – Eagle's Minimal Essential Medium

E-PE – Early-onset Preeclampsia

ECM – Extracellular Matrix

EtOH – Ethanol

EV – Empty Vector

EVT – Extravillous Trophoblast

FBS – Fetal Bovine Serum

FIH1 – Factor-Inhibiting HIF1

Fe2+ – Ferrous iron

Fe3+– Ferric iron

GAPDH – Glyceraldehyde 3-phosphate Dehydrogenase h – Hours

H2O2 – Hydrogen Peroxide

H3R2me2s – Histone 3, arginine 2 symmetric dimethylated

H4R3me2s – Histone 4, arginine 3 symmetric dimethylated

HEK 293 – Human Embryonic Kidney cells 293

HIF1A – Hypoxia-inducible factor 1 alpha

HIF1B – Hypoxia-inducible factor 1 beta hCG – Human Chorionic Gonadotropin

HIF-1 – Hypoxia-Inducible Factor-1

HIF1A – HIF1 α-subunit

HRE – Hypoxia Response Element

HRP – Horseradish Peroxidase

IF – Immunofluorescence

IUGR – Intra Uterine Growth Restriction

JmjC – Jumonji C

JMJD6 – JmjC domain containing protein 6

L-PE – Late-onset Preeclampsia

µg – Microgram

µl – Microlitre

Mg132 – Carbobenzoxy-Leu-Leu-leucinal mg – Milligram mL – Millilitre mM – Millimolar mm Hg – Millimeters of Mercury min – Minutes mRNA – Messenger Ribonucleic Acid

NH4Cl – Ammonium Chloride

O2 – Molecular Oxygen pO2 – Partial Pressure of oxygen

PCR – Polymerase Chain Reaction

PE – Preeclampsia

PFA – Paraformaldehyde

PHD (1-3) –Prolyl Hydroxylase Domain (1-3) pO2 – Partial Pressure of Oxygen

PTC – Pre-term Control pVHL – von Hippel-Lindau tumour suppressor protein qPCR – Quantitative Polymerase Chain Reaction

RCC – Renal Cell Carcinoma

xvi

RIPA – Radioimmunoprecipitation Assay

RNAi – RNA Interference siRNA – Small Interfering RNA

SDS-PAGE – Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis

SS – Scramble Sequence sec – Seconds

SEM – Standard Error of the Mean

SK – Syncytial Knot

SNP – Sodium Nitroprusside

ST – Syncytium/syncytiotrophoblast

SUMO1 – Small Ubiquitin-like Modifier 1

TC – Term Control

TBS – Tris Buffered Saline

TGFB – Transforming Growth Factor Beta

TS – Trophoblast Stem Cells (murine)

TUNEL – Terminal Deoxynucleotidyl Transferase-dUTP-Nick End Labeling

VEGF – Vascular Endothelial Growth Factor

VHL – von Hippel-Lindau tumour suppressor

VHLCBC – von Hippel Lindau-Cullin-Elongin Complex

Vol – Volume

Wks – Weeks

Wt – Weight

xvii

1.1 Introduction

Oxygen sensing is a fundamental cellular requirement for the maintenance of physiological homeostasis and ultimately, survival. In addition to its role in cell metabolism, oxygen is a critical determinant of early embryonic development. As such, the importance of oxygen sensing is exemplified in an organ such as the placenta, which acts as the fetus’s lifeline and ensures a successful pregnancy. A unique attribute of this organ is its ability to undergo striking changes in oxygen tension during the course of its development. Not surprisingly, the placenta has evolved precise molecular and cellular mechanisms to sense and regulate these changes in order to adapt accordingly. These mechanisms are primarily comprised of oxygen sensing enzymes that regulate hypoxia-inducible factors which in turn orchestrate adaptive changes in gene expression that maintain homeostasis. In addition, emerging literature also implicates oxygen as a powerful regulator of the cellular epigenome, by controlling key players involved in the histone code. The field was revolutionized by the discovery of a novel family of Jumonji C domain containing enzymes that are critically dependent on oxygen to execute their function as histone demethylases, with profound implications for gene transcription, chromatin remodelling, DNA repair and other higher-order processes under epigenetic control. Unravelling the interplay between hypoxia and epigenetic signaling will further knowledge not only on how cells primarily sense and respond to oxygen, but also on when these processes go awry.

1.2 Mechanisms of Oxygen Sensing

Maintaining a balance between oxygen demand and oxygen supply is a constant physiological requirement. Hence, to ensure adequate oxygen delivery, it is critical that cells and tissues have inbuilt mechanisms to sense even minute changes in oxygen, to respond and adapt accordingly.

Failure to do so results in ‘hypoxia’, referring to a deficiency in either oxygen supply or use by

1 tissues. Owing to the wide range of physiological pO2 (partial pressure of oxygen) values pertaining to different tissues, hypoxia is considered a relative term. This is well illustrated in the case of the human placenta, where oxygen tension varies dramatically as gestation proceeds. pO2 values prior to 10 weeks of gestation, when there is limited maternal blood flow, range from 15 –

20mm Hg [1]. With the opening of the intervillous space and perfusion with maternal blood between 10-12 weeks of gestation, pO2 values rise to 60 – 70 mm Hg and dictate trophoblast differentiation events that establish functional feto-maternal circulation [1]. In stark contrast, in a remarkably heterogeneous tissue such as the brain, pO2 values above 35 mmHg are indicative of physiological normoxia [2]. For the remainder of this thesis, pO2 values used in in vitro and in vivo studies that are below standard normoxic conditions for the cells in question will be referred to as hypoxia.

While a number of cellular and biological mechanisms contribute to restore oxygen homeostasis, broadly speaking, oxygen sensing and the ensuing adaptive responses occur at two levels: acute responses mediated by oxygen-sensitive ion channels versus chronic responses mediated by the oxygen-dependent molecular machinery that controls gene transcription [3, 4].

What defines an oxygen sensor? Decades of research indicates that the primary requirement is the ability to detect changes in oxygen tension and either directly, or indirectly modulate the activity of a downstream effector that elicits a functional response [5]. With this under consideration, the following sections will provide a cursory review of models of oxygen sensors, with a focus on the molecular machinery that orchestrates chronic physiological responses to hypoxia.

1.2.1 Acute oxygen sensing responses by chemoreceptors

Acute adaptive responses to hypoxia, typically executed within seconds to minutes, are implemented by O2-sensitive ion channels that modulate the secretory activity of the cells they

2 reside in. These channels are found in specialized chemoreceptor organs that first detect changes in blood pO2 levels. The list includes the glomus cells of the carotid body, neuroepithelial bodies of the lungs, vascular smooth muscle, airway and peripheral chemoreceptors, which in concert tune the respiratory and cardiovascular systems to increase ventilation and improve O2 delivery

[6].

Among the specialized oxygen-sensitive tissues, much work has highlighted the role of the carotid body as the first line of defense in adapting to hypoxia. The carotid body is made of functional units called glomeruli, which in turn are comprised of Type-I neuron-like glomus cells, surrounded by Type-II stem-like cells. Importantly, glomus cells contain voltage- dependent Na+, Ca2+, and K+ channels, which are inhibited upon detection of a fall in arterial

2+ pO2[7]. This in turn results in depolarization of the glomus cell, permitting Ca entry, affecting the secretion of neurotransmitters and activating the afferent sinus nerve fibers. Since the glomus cells of the carotid body maintain several synaptic connections to sensory afferent nerves,

“sensing” of changes in blood pO2 levels enables rapid transmission of the hypoxic signal to the respiratory center [3]. Interestingly, hypoxia has been shown to directly impact on Ca2+ channels in myocytes in either a stimulatory or inhibitory manner, depending on the type of blood vessel [8]. Furthermore, studies have shown that decreased oxygen availability elicits vasoconstriction of feto-placental arteries in response to hypoxia, mediated by inhibition of voltage-dependent potassium channels [9] [10]. This mechanism is believed to be an adaptive response to the physiologically low oxygen experienced by the early placenta, to maximize oxygen delivery to the fetus.

Mitochondria and ROS as oxygen sensors

Mitochondrial function is inextricably linked to cellular oxygen availability, thereby placing these powerhouse organelles at the forefront of oxygen sensing. Changes in pO2 are immediately detected by the mitochondria due to the critical requirement for O2 in the mitochondrial

3 respiratory electron transport chain [11]. This is comprised of a series of enzyme complexes located along the inner mitochondrial membrane, participating in redox reactions and generating adenosine triphosphate (ATP) via oxidative phosphorylation. Importantly, O2 is the final acceptor of electrons in the chain, where it is reduced to H2O. Studies performed in hepatocytes exposed to prolonged, but not acute hypoxia revealed that cytochrome c oxidase, resident in complex IV of the mitochondrial electron transport chain, may be involved in mitochondrial oxygen sensing [12]. This complex represents the key site of oxygen utilization along the respiratory chain and its redox state is intimately linked to oxygen concentration. That is, cytochrome c oxidase is oxidized upon increase in oxygen, while its oxidation is reduced at lower oxygen levels [13]. Moreover, hypoxia has been shown to reduce the maximum rate of oxygen consumption (Vmax) by this complex, impacting on the mitochondrial redox state.

How is this information transduced within the cell? The key candidate for mitochondrial oxygen sensing is through the production of reactive oxygen species (ROS) due to incomplete reduction of O2 [11]. While a small portion of O2 consumed by the mitochondria yields ROS in a physiological context, oxygen availability is a major determinant of superoxide generation due to increased electron transfer and reduced Vmax of cytochrome c oxidase [14]. This results in the

– production of intermediates such as the superoxide anion radical (O2 •), hydrogen peroxide

(H2O2), and the hydroxy radical (OH•). Other studies have provided confirmation in their model systems that cellular hypoxia induces mitochondrial ROS and oxidative stress, which in turn can elicit a number of cellular responses by acting as a second messenger [15].

In contrast, other groups showed that ROS generation does not always correlate with changes in

O2 concentrations [16]. The lack of consensus on the role of mitochondrial ROS led some groups to propose the NADPH oxidase, a plasma membrane-bound enzyme, as another potential oxygen sensor [17]. In neutrophils, NADPH oxidase has been found to utilize NADPH as substrate to generate superoxide anions by transferring electrons from NADPH to oxygen [17].

Mechanistically, this relatively simple model dictates that electron transfer by NADPH oxidase is altered in hypoxia, whereby there is decreased production of ROS (superoxide anions) upon reduced O2 availability [17].

Hemeproteins as oxygen sensors

Another strong candidate for a molecular oxygen sensor are hemeproteins, which are metalloproteins containing a ‘prosthetic’ heme group. Hemoglobin, which is the primary O2- binding protein in the body is the top candidate to function as an oxygen sensor [18]. According to the current theory of heme-based oxygen sensors, the O2-dependent signal is transduced as follows:

The hemeprotein typically contains an N-terminal O2 binding/sensing domain along with globin, while the C-terminal contains an enzymatic domain. Binding of, or alternatively, dissociation of

O2 from the hemeprotein results in an allosteric conformational change in the entire complex.

This in turn is transmitted as a signal to the C-terminal catalytic domain to execute downstream actions [18]. For instance, the C-terminal domain may contain histidine kinase activity, which in certain bacterial species, is required for oxygen-dependent regulation of respiratory gene transcription [19]. Other candidates for oxygen sensing heme proteins include myoglobin, which has a similar structure to hemoglobin, and monooxygenases such as cytochrome P450 and heme oxygenase [18]. While the complexities of hemeprotein-mediated signalling have not been fully unraveled, their contribution to oxygen sensing remains vital for cellular homeostasis.

1.2.2 Chronic oxygen sensing responses by hypoxia-inducible factors

Chronic responses to hypoxia are typically executed within a timespan of minutes to hours following detection of the stimulus. They are predominantly executed by the hypoxia-inducible family of transcription factors that function as master regulators of the hypoxic gene expression

5 program [20]. Discovery of hypoxia-inducible factors (HIF1A, HIF2A and HIF3A) essentially revolutionized the field of molecular oxygen sensing and greatly enhanced our understanding of both physiological and pathological processes characterized by aberrant oxygen sensing. Given that the work reported in this thesis is centered on HIF1A, the following sections will be limited to description of this factor.

HIF1 is a basic helix-loop-helix (bHLH) transcription factor that primarily executes the cellular response to hypoxia [4, 21]. It was first identified as a nuclear factor that was upregulated in hypoxia and bound to response elements on the EPO (erythropoietin) gene promoter [4]. HIF1 has a wide range of transcriptional targets that mediate diverse cellular processes that equip the cell to adapt to hypoxia, enhancing tissue survival [22, 23]

The HIF1 protein is a heterodimer, composed of an inducibly expressed, highly regulated α subunits (HIF1A) and a constitutively active β subunit (HIF1B) [21]. The protein is comprised of

Per-Arnt-Sim (PAS) repeats, an N-terminal transactivation domain (N-TAD), a C-terminal transactivation domain (C-TAD) as well as a partly overlapping oxygen-dependent degradation domain (ODDD), through which HIF1 stability is tightly controlled [24]. Hypoxia-induced stabilization of HIF1A facilitates its binding to its dimerization partner, HIF1B, which is localized in the nucleus and remains relatively unaffected by oxygen levels [25]. Upon dimerization, the HIF1A-HIF1B complex, now collectively referred to as HIF1, binds to specific

DNA consensus sequences, termed hypoxia responsive elements (HREs) in the promoters of target genes to mediate transcription [20] (Figure 1.1). In the presence of molecular oxygen (i.e. cellular normoxia), HIF1A levels are maintained at low levels by continual targeting for degradation via the 26S proteasome. This process is primarily regulated by hydroxylation of two residues (Proline 402 and Proline 564) in the ODD of HIF1 by three prolyl hydroxylase domain proteins, designated PHD1, PHD2 and PHD3 [26]. These molecules require molecular oxygen to perform their enzymatic functions and are aptly termed dioxygenases [26, 27]. Hydroxylation at

6 the two proline residues on HIF1A promotes its interaction with the von-Hippel Lindau protein

(pVHL), a component of the E3 ubiquitin ligase that forms a multi-protein complex (VHLCBC) that subsequently targets HIF1A for proteasomal degradation [29].

Additionally, another dioxygenase termed factor inhibiting HIF1 (FIH1) hydroxylates an asparigine residue on HIF1A and regulates its transcriptional activity by inhibiting the association between HIF1A and its transcriptional co-activators, p300/Creb binding protein

(p300/CBP) [30] (Figure 1.1). It is important to note that although all three PHDs are capable of hydroxylating HIF1A in vitro, PHD2 has emerged as the primary regulator of HIF1A prolyl hydroxylation, while PHD1 is the least involved in this process [31]. Interestingly, the PHD3 enzyme itself is an established transcriptional target of HIF1A, providing evidence for a feedback loop of auto-regulation [32].

Adapted from Semenza (2004) [28]

Figure 1.1 – The canonical cellular oxygen sensing pathway.

HIF1A protein stability is predominantly regulated by the dioxygenase prolyl hydroxylase

(PHD) enzymes, namely PHD1, PHD2 and PHD3. These enzymes function as oxygen sensors that require molecular oxygen and α-KG as substrates and yielding succinate and carbon dioxide as products. Under normoxic conditions, PHD2 hydroxylates two proline residues (proline 402 and proline 564) in the ODDD of HIF1A, thereby promoting its association with von Hippel

Lindau tumour suppressor protein (pVHL) a component of the E3 ubiquitin ligase complex. This targets HIF1A for ubiquitination and rapid proteasomal degradation by the 26S proteasome. In hypoxia, PHD activity is inhibited due to lack of molecular oxygen and HIF1A is subsequently stabilized. HIF1A transcriptional activity on the other hand, is mediated by another dioxygenase enzyme termed factor inhibiting HIF-1 (FIH1). In normoxia, FIH1 is enzymatically active and hydroxylates an asparagine residue on the C-TAD of HIF1A. This in turn prevents the association between HIF1A and its transcriptional co-activators, p300/Creb binding protein

(p300/CBP), thereby leading to repression of HIF1A transcriptional activation. Similar to the

PHDs, FIH1 is inactive in hypoxia, allowing HIF1A to translocate to the nucleus, dimerize with its cognate partner, HIF1B and induce transcription of target genes.

1.2.3 The von-Hippel Lindau Tumour Suppressor (VHL)

Inactivating mutations in the von-Hippel Lindau tumour suppressor gene were first identified to be the basis of a rare, inherited cancer syndrome, aptly termed VHL disease [33]. The syndrome is characterized by both benign and malignant tumours that may manifest at any stage in life

[34]. These include clear cell renal cell carcinomas (ccRCC), hemangioblastomas (of the retina and central nervous systems), pheochromocytomas, and renal, pancreatic and epididymal fluid- filled cysts [35]. Notably, in 20% of cases, that are devoid of family history for the disease, ‘de novo’ mutations in VHL were detected, suggesting a potential contribution of epigenetic events such as genomic imprinting [36]. Based on this, clinical diagnosis of VHL disease is defined by the presence of either two of the afore-mentioned tumours (for instance, two pheochromocytomas, or a hemangioblastoma and pheochromocytoma) with no familial history of the disease, or, alternatively by the presence of one tumour combined with familial history

[37].

Pioneering studies have mapped the VHL gene to chromosome 3p25 and subsequently isolated it by positional cloning [33, 38]. VHL contains three exons, a 5’ and 3’ untranslated region (UTR), and is evolutionarily conserved [33]. Since its discovery, several groups have reported that patients with VHL disease contain existing germline mutations in a single VHL allele, with tumour progression occurring upon sporadic inactivating mutations in the second, wild-type allele [39]. Figure 1.2A illustrates the domain structure of the VHL gene and its resulting protein product, depicting the tumour suppressor region in the protein. In addition to missense mutations that are relatively well-characterized, deletions of either one or more VHL exons also accounts for a large portion of cases demonstrating VHL inactivation in this syndrome [40]. In addition to

VHL disease, inactivating mutations in VHL also underlie the pathogenesis of Chuvash polycythemia, an autosomal recessive disorder endemic to the Chuvash population of Russia

[41]. The pathology, also referred to as ‘congenital erythrocytosis’, is characterized by

10 homozygous germline mutations in exon 2 of VHL (598CT) in the gene, resulting in R200W mutation in the protein), resulting in disrupted oxygen sensing and abnormally elevated HIF1A levels [41, 42]. Based on the key finding that this VHL mutation markedly impaired pVHL-

HIF1A association and subsequent HIF1A ubiquitination, leading to enhanced HIF1A transcriptional activity in normoxia, Ang et al (2002) suggested that Chuvash polycythemia represents a true genetic disorder of oxygen sensing [42]. Importantly, they observed that the mutation had no impact on pVHL stability and directly affected its function as a HIF regulator by interfering with formation of a functional VHLCBC complex [42]. Taken together, these studies underscore the importance of studying the distinction between VHL gene regulation and pVHL activity, particularly in the context of oxygen sensing.

The VHL gene encodes two distinct isoforms of comparable functions: pVHL30 (a 213-amino acid, 30 kDa protein) and the shorter, pVHL19 (a 160-amino acid isoform 19 kDa protein) that arises from an alternate internal initiation codon [43, 44]. Both isoforms contain a large NH2- terminal β domain (spanning amino acids 63-154 and 193-204, and rich in β sheets) as well as a relatively small α domain (spanning amino acids 155-192) including a three α-helix cluster [45].

Since pVHL19 also encompasses the α and β domains of the full length protein, both isoforms retain tumour suppressor activity (Figure 1.2A) [45], and are largely equivalent in function.

Nevertheless, any differences in activity may not be fully apparent due to lack of information on the N-terminal of pVHL30 which contains a pentameric acidic repeat motif (of the form GxEEx)

[14]. Furthermore, evidence that pVHL30 resides primarily in the cytoplasm, while pVHL19 localizes to the nucleus, suggests that the functions of the isoforms may not be identical [44, 46].

Extensive biochemical analyses revealed that oxygen-dependent hydroxylation of proline 564 on the ODD of HIF1A provides a high degree of specificity and affinity for its binding to highly conserved residues in the β domain of pVHL [47]. Although tumour-derived missense mutations

11 have been charted to both the α and β domains of the protein [14, 48], it is perhaps not surprising that several tumour-derived missense mutations in VHL map at high frequencies to the corresponding exon of this particular region [48]. On the other hand, it is primarily the α domain of pVHL that associates with Elongin C and forms the ternary VHLCBC complex that is ultimately required for HIF1A binding and ubiquitin-mediated proteolysis [45]. Once again, the importance of the residues that mediate this binding are exemplified by the high frequency of

VHL missense mutations that map to this interface [48]. Given the implications of HIF signaling in tumour biology, understanding pVHL function in this setting is of immense clinical and biological significance.

Providing clues to the function of pVHL, Chung et al (2006) found that pVHL forms homodimeric complexes in vivo and that inactivating mutations in one partner can functionally rescue for a deficit resulting from dissimilar mutations in the other [49]. Moreover, dimerization of pVHL was unaffected by deletion of either the α or β domains, suggesting the involvement of multiple points along the protein in mediating this process. These findings support a model of tumourigenesis whereby mutations in one allele of VHL are often accompanied by similar mutations in the other allele, and are unable to functionally rescue each other’s deficits [49].

1.2.3.1 Regulation of VHL gene and protein

Work on the genetic and epigenetic regulation of VHL has predominantly been restricted to ccRCC, a pathology characterized by early inactivation of the gene. First evidence implicating VHL in renal cancer tumourigenesis stems from in vitro work in ccRCC cell lines that demonstrated somatic biallelic inactivation of VHL in the sporadic form of the disease [50, 51]. This was in contrast to germline-derived mutations found in tumours originating from VHL disease. Specifically, Gnarra et al (1994) showed that somatic mutations in exon 2 of VHL underlie the pathogenesis of sporadic renal carcinoma [51]. Additionally, a seminal study by

Herman et al (1994) revealed that hypermethylation of a cytosine-phospho-guanine (CpG) island in the 5' regulatory region of VHL led to its loss of expression in a small but significant proportion of renal carcinoma tumours [52]. Implying a true epigenetic effect, in the cases where the VHL promoter was silenced due to alterations in DNA methylation, no mutations were observed in the coding regions [52]. Since this initial discovery, further work has corroborated this and established epigenetic inactivation of VHL in both sporadic and germline RCC pathogenesis [53, 54]. Collectively, this work highlights the contribution of epigenetic events to VHL gene regulation and provides a strong platform to explore the other side of the epigenetic code, namely histone modifications.

Despite its involvement in a multitude of cellular processes, it is surprising that the knowledge on factors regulating VHL protein (referred to as pVHL) stability and function is limited. So far, an E2-endemic pemphigus foliaceus (EPF) ubiquitin carrier protein (UCP) has been shown to associate with endogenous pVHL and mediate its ubiquitination and subsequent proteasomal degradation [55, 56]. Importantly, UCP-mediated pVHL degradation impacted on pVHL-HIF signalling and led to stabilization of HIF1A and HIF2A and associated transcriptional activation [56]. Similarly, the SOCS (Suppressor of Cytokine Signaling) domain containing BC-box proteins, Gam1, SOCS1, and SOCS3 promoted the ubiquitin-mediated degradation of pVHL and by extension, stabilized HIF1A in vitro [57]. Studies revealed that tumour-derived missense mutations in the Elongin-binding domain of pVHL disrupt its protein stability, suggesting that pVHL stably exists as part of the VHLCBC E3 ubiquitin ligase complex, and that it is rapidly targeted for proteasomal degradation when its binding to Elongins is disrupted [58].

Post-translational modifications (PTM) of pVHL have substantial impact on its stability and function. Covalent modification of pVHL by the ubiquitin-like protein, NEDD8 (Neural

Precursor Cell Expressed, Developmentally Down-Regulated 8), is a requirement for its subsequent binding to and deposition of fibronectin, constituting a key step in extracellular

13 matrix assembly [59]. On the other hand, pVHL has also been shown to be targeted by an ubiquitination-like modification called SUMOylation, resulting in increased stability and nuclear redistribution [60, 61]. pVHL30 has also been shown to be phosphorylated at serines 33, 38 and

43 by the serine/threonine kinase, casein kinase 2 (CK2), leading to its proteasomal degradation

[62]. This interaction uniquely had an impact not only on HIF1A degradation, but also on function of another tumour suppressor, p53 and deposition of the extracellular matrix protein, fibronectin [62]. In line with this, a recent study by German et al (2016) showed that CK2- mediated phosphorylation of pVHL is necessary for its cleavage at tyrosine 23 in the N-terminus, and ultimately its stability [63]. This study also suggested that initial cleavage of pVHL by the enzyme, chymotrypsin C may account for the often-detected multiple bands of pVHL30 by hypoxia Western blotting [63].

Interestingly, Mohan & Burk (2003) found that loss of cell-to-cell contact also promotes pVHL degradation in 786-O cells, a renal cancer cell line [64]. The authors established that the region of pVHL spanning amino acids 172 to 213 is a ‘cell-density dependent region’ (CDDR) that protects pVHL from proteasomal degradation and also impacts on its synthesis to some extent.

Hence, this study underscores the importance of taking cell confluency into consideration while studying pVHL regulation.

Adapted from Stebbins et al (1999) [45]

Figure 1.2– The von-Hippel Lindau tumour suppressor and its myriad functions

Figure 1.2 – The von-Hippel Lindau tumour suppressor and its myriad functions.

(A)Top panel: Schematic of VHL gene structure depicting its 5’ untranslated region (UTR; spanning nucleotides 1-213), three exons (nucleotides 214-553, 554-676 and 677-855 respectively) and 3’ untranslated region (nucleotides 856-4400). Bottom panel: Schematic of the translated protein product of full length pVHL30 depicting an N-terminal “GxEEx” acidic repeat motif (spanning amino acids 14-53), a β domain (amino acids 63-154 and 193-204), and a α domain (amino acids 155-192). The entire region corresponding to Exon 2 of VHL is responsible for nuclear export of the protein and also lies within the β domain. The tumour suppression domain on the other hand spans both the α and β domains, but lacks the acidic repeat motif.

Importantly, both pVHL isoforms exhibit tumour suppression activity (B) HIF-dependent and independent functions of pVHL, converging on its role in placental development.

1.2.3.2 HIF-dependent and independent functions of VHL

In addition to tumour suppression, pVHL has been implicated in an array of cellular processes.

To begin with, it is critical for embryonic development, as evident from mice lacking pVHL

(Vhl-/-) that display lethality between 10.5 to 12.5 days of gestation (E10.5 to E12.5) primarily due to disruption of placental angiogenesis and vasculogenesis [65]. Coincident with a critical time period for murine placental development, homozygous loss of Vhl resulted in placental lesions between 9.5 to 10.5 days of gestation. Histological analysis revealed a lack of syncytiotrophoblast formation and marked impairments in blood vessel formation within the labyrinthine layer that is responsible for feto-maternal nutrient and gas exchange in the mouse placenta. pVHL loss in the trophoblasts and mesoderm was thought to be the underlying cause for placental failure [65]. Despite these striking findings implicating VHL in normal placentation, it is however, unclear whether the placental failure in Vhl-/- mice primarily stems from its canonical function as a master regulator of the cellular hypoxic response. For instance, although VHL is a known negative regulator of VEGF in renal cell carcinomas [66], placentae in

Vhl-/- mice demonstrated a profound loss of VEGF, corresponding to the lack of angiogenesis.

This suggests that placental regulation of VEGF may constitute a HIF or oxygen-independent function of VHL. The following is a brief description of the salient functions of pVHL attributed to its roles that are dependent on and independent of HIF regulation (summarized in Figure

1.2B):

HIF-dependent functions of pVHL remain intimately linked to cellular oxygen status and tuning of the hypoxic transcriptional program. Given that HIF activates a multitude of adaptive genes, it is not surprising that these genes are truly, though indirectly, under the control of pVHL. Representing a central HIF-dependent function, VHL has been shown to negatively regulate the expression of vascular endothelial growth factor (VEGF), a key controller of angiogenesis [67]. Other outstanding HIF-related processes controlled by VHL include repression of transforming growth factor β 1(TGFB1) mRNA and protein [68] and down-

17 regulation of several factors involved in epithelial-mesenchymal transitions (EMT) [69] in a variety of cell lines. In the realm of metabolism, pVHL, via HIF1A signalling, is implicated in the control of glucose-stimulated insulin secretion by pancreatic β cells and maintenance of glucose homeostasis [70].

Several HIF-independent functions of pVHL have emerged over the past decade. Work on various fronts has shown that VHL loss in kidney cells results in a loss of primary cilia, related to its ability to stabilize and orient microtubules by cooperating with glycogen synthase kinase

(GSK)-3β [71]. Further corroborating its tumour suppressor function, particularly in the kidney,

VHL has emerged as an important regulator of the cell cycle through its actions on cyclin dependent kinases [72]. pVHL impacts on apoptosis by mediating the protein stability and transcriptional activity of p53 in an oxygen and HIF-independent manner [73]. As well, in line with its role as an important mediator of placental vascularity, pVHL has also been shown to interact with the matrix glycoprotein, fibronectin, to mediate endothelial cell extracellular matrix assembly and deposition [74, 75]. Remarkably, despite several components of the ECM being direct HIF transcriptional targets, VHL-dependent regulation of fibronectin deposition remains a

HIF-independent function. While some of the afore-mentioned roles of pVHL are well established, there is a lack of consensus on whether each function is strictly independent of HIF1 signalling. Hence, it remains to be seen if these divergent activities, in concert, contribute to embryonic, and in particular, placental development.

1.2.4 Hypoxia and the Epigenome

While efforts have aimed to understand the canonical oxygen sensing mechanisms involving hypoxia-inducible transcription factors, over the past decade, there is an emerging concept of oxygen-directed higher-order chromatin regulation. Owing to the interest in the role of environmental stimuli in modulating the cellular epigenome, oxygen has recently emerged as a

18 dominant regulator of the epigenetic code. Despite major advances in our knowledge on oxygen- dependent control of gene transcription, its relationship with chromatin is not as well-described.

Key epigenetic processes influenced by hypoxia include DNA methylation, ATP-dependent chromatin remodelling complexes, and histone post-translational modifications [76]. Evidence of hypoxia-chromatin cross talk is highlighted by regulation of the SWI/SNF (Switch/Sucrose Non-

Fermentable) ATP-dependent chromatin remodelling complex by oxygen. Studies have shown that hypoxia/HIF1 signalling engages certain members of this complex to the enhancer regions of the erythropoietin (EPO) gene, a major HIF1 target. This recruitment in turn is necessary for complete activation of the EPO gene in hypoxia [77]. This seminal study revealed gene-specific modulation of a HIF-target directly via chromatin remodelling proteins.

DNA methylation is a dynamic epigenetic modification that is executed by DNA methyltransferase enzymes (DNMTs). Direct evidence of a role for oxygen comes from studies that found that hypoxia inhibits the function of DNMT1, especially in the context of tumour cells

[78]. Moreover, DNA hypermethylation of HIF1 transcriptional target genes, BNIP3, CA9, and

PHD3 inhibits the association of HIF1 to the HREs of their promoter regions [79-81]. Another major step forward in understanding the epigenetic response to hypoxia is the discovery of the

Jumonji C domain containing histone demethylases that are induced by hypoxia and can influence oxygen-chromatin interactions. The following sections will detail the role of this unique family of enzymes in mediating the epigenetic code.

1.3 Epigenetic Regulation by the Jumonji C Family of Proteins

The widely-held notion that chromatin is organized in a static manner is increasingly being challenged with the discovery of chromatin remodelling and histone modifying enzymes. In the spotlight is a novel family of histone demethylase enzymes containing the Jumonji C (JmjC)

19 catalytic domain that require molecular oxygen to execute their function [82]. The following sections will detail epigenetic control of gene expression and the emergence of JmjC domain containing proteins as higher-order regulators of the cellular epigenome by virtue of their functional dependence on oxygen.

1.3.1 Histone Modifications and the Epigenetic Code

Eukaryotic genetic information is precisely and exquisitely organized in the form of DNA wrapped around histone proteins, forming the building blocks of chromatin. Histones are highly alkaline proteins that complement the negatively charged, acidic DNA. Histones H3, H4, H2A and H2B are classified as core histones and exist as dimers, whereas histone H1 acts as a link between nucleosomal units [83]. While the information encoded by DNA is dependent on its nucleotide sequence, the N terminal tail domains of histones are subject to a multitude of

‘epigenetic’ modifications that can profoundly influence both histone-histone and histone-DNA interactions [84]. Covalent modification of histones is a fundamental biological process involving the post-translational alteration of histone tails, allowing for dynamic control of the epigenetic processes. These functionally unique modifications include acetylation, methylation, phosphorylation, SUMOylation, ubiquitinylation, propionylation, butyrylation, formylation, citrullination, proline isomerization, ADP ribosylation and a more recent discovery called crotonylation [84, 85].

How do histone modifications affect the underlying chromatin? Strahl & Allis (2000) originally proposed that the immense variety of post-translational modifications allows for the existence of a “histone code” that encodes for a set of instructions that are either “written”, “erased” or

“read” by other proteins [84] (Figure 1.3). In terms of outcomes, histone modifications are thought to impact on either the physical structure of chromatin or, alternatively, on the interaction of chromatin with chromatin-modifying factors [86].

Impact of histone modifications on the physical structure of chromatin

Chromatin in eukaryotes exists in two physical states: euchromatin and heterochromatin. Euchromatin comprises ~ 92% of the genome and consists of loosely packed, active DNA that is accessible for transcription. Heterochromatin is comprised of dense, tightly packed DNA that is generally inaccessible for transcription. Hence, euchromatin and heterochromatin are associated with gene activation and silencing respectively [86]. Histone modifications such as acetylation (which occurs at numerous residues on histones 3 and 4) have been shown to reduce the charge on histone tails, thereby altering histone-DNA interactions and overall chromatin architecture. In turn, this facilitates transcription factors, enzyme complexes and other regulatory machinery to access the now-unravelled DNA to initiate gene activation or repression. For instance, histone acetylation is particularly enriched at the promoters and enhancers of actively transcribed genes and is therefore associated with a euchromatin-like state [87]. Similarly, phosphorylation is also known to impact on chromatin conformation by altering the charge on histones. Case in point is phosphorylation at H3S10 (histone 3, serine 10) during mitosis, which is associated with chromatin condensation [88].

Impact of histone modifications on the interaction with chromatin-associated factors

Modifications of histone tails can affect the accessibility of chromatin for the recognition and recruitment of chromatin-associated proteins to specific sites through various domains. Among these, the best characterized domains that recognize methylation include chromodomains that are important for chromatin modification, tudor domains that facilitate molecular complex assembly and plant homeodomains (PHD). Histone acetylation is “read” by bromodomains, while 14-3-3 proteins recognize phosphorylation [89-91]. Numerous studies have elucidated the downstream consequences of these events. This is well illustrated by trimethylation of histone 3 at lysine 9 (H3K9me3), a mark that is typically associated with general transcriptional repression. Bannister et al (2001) elegantly demonstrated that the heterochromatin-associated protein 1 (HP1) recognizes and binds to H3K9me3 via its chromodomain, and that this interaction is critical for its gene silencing activity [92].

Adapted from Kouzarides (2007)[86]

Figure 1.3– The histone code, as executed by epigenetic writers, readers and erasers.

Figure 1.3 – The histone code, as executed by epigenetic writers, readers and erasers.

Schematic representation of the core histones (Histones H2A, H2B, H3 and H4) and their N- terminal tails. Post-translational modifications of targeted amino acid residues, such as lysines and serines, is executed by epigenetic “writers”. The best-characterized enzymes in this category include histone acetyltransferases (HATs), histone methyltransferases (HMTs) and protein arginine methyltransferases (PRMTs) (top panel). These distinct marks are subsequently recognized by epigenetic “readers” using specialized domains (bottom panel). Typically, methylated histone marks are recognized by the PHD finger domain and chromodomain, while acetylated histones are recognized by the bromodomain. This is illustrated by the chromatin remodelling protein, Chromodomain-helicase-DNA-binding protein 1 (CHD1), which contains chromodomains that identify and facilitate the selective binding of this factor to the H3K4me mark, in turn promoting a more open chromatin conformation. Likewise, the bromodomain in

RSC4, a member of a chromatin remodelling complex, is required for its binding to acetylated

K14 of histone H3 (H3K14ac), impacting on target gene transcription. Recent discovery of

“eraser” proteins highlighted the dynamism in histone modifications (top panel). These are comprised of specialized enzymes, some of which belong to the Jumonji C domain family of proteins, that directly revert histone acetylation (termed histone deacetylases; HDACs) and methylation (termed histone demethylases; HDMs) marks at targeted residues. For instance, demethylation of the repressive H3K27me3 mark is associated with an open chromatin conformation.

1.3.1.1 Histone Methylation and Demethylation

Among the plethora of histone post-translational modifications, histone methylation and acetylation remain the most intensely investigated. For the sake of brevity, this thesis will focus on histone methylation and the antagonistic process of histone demethylation in the context of

Jumonji C domain containing proteins.

Histone methylation can occur on three types of residues: lysines, arginines and histidines.

However, it mostly occurs on lysine and arginine side chains, generating unique configurations in terms of the number and alignment (symmetric versus asymmetric) of methyl groups [93-96].

As such, the precise residue and degree of methylation determines transcriptional outcomes.

Despite the complexity of these events, the general consensus is that trimethylation of histone 3 at lysine 4 (H3K4me3) is a hallmark of actively transcribing genes, while trimethylation of histone 3 at lysine 27 (H3K27me3) is associated with repressive transcription [97, 98]. Similarly, monomethylated lysine 4 of histone 3 (H3K4me1) is fairly reliably enriched in the transcriptional enhancers of active genes [99].

Under the umbrella of histone modifications, arginine methylation is relatively widespread; however, to date, it remains an under-studied area. Nevertheless, exciting new work has highlighted the role of this mark in a multitude of cellular processes such as transcription, cell growth, chromatin remodelling, DNA repair and so on [100]. Arginine methylation occurs on guanidine groups on the N terminals tails on histones H2A, H3 and H4 [100]. In contrast to lysine methylation, histone arginine methylation produces additional configurations of dimethylation. This includes the symmetrical (whereby the two methyl groups are on two different nitrogens of the guanidine group) and asymmetrical (the two methyl groups are situated on the same nitrogen atom of the guanidine group) conformations [100].

Enzymes that catalyze histone methylation

Histone methylation is executed by specialized enzymes termed histone methyltransferases.

Suppressor of Variegation 3-9 Homolog 1 (SUV39H1), the first identified histone lysine methyltransferase (HKMT) and others have been shown to execute their enzymatic activity either dependent on or independent of the evolutionarily conserved Su(var)3-9 and 'Enhancer of zeste' (SET) catalytic domain [101]. Reflecting the multitude of histone lysine methylation marks, different HKMTs mediate the transfer of a variable number of methyl groups (either one, two or three) from S-Adenosyl methionine onto the target histone residue [102]. Similarly, histone arginine methylation is catalyzed by protein arginine N-methyltransferases (PRMTs, ranging from 1-9), that are also specific to the residue and degree of methylation [100]. PRMTs also catalyze the transfer of methyl groups from S-Adenosyl methionine to a nitrogen belonging to a guanidine group of arginine [100].

Enzymes that reverse histone methylation

Until the groundbreaking discovery of histone demethylase enzymes, histone methylation was thought to be an irreversible process [103]. Not surprisingly, this revolutionized the field of epigenetics, enhancing our understanding of how the methyl-lysine signal is normally transduced. Consequently, reversibility of histone methylation provides an immense amount of regulatory control over biological processes that were initially believed to be stable. For example, demethylation of the H3K9me3 mark during mitotic cell division can reverse the state of gene silencing that is normally associated with this modification [92]. In line with this, ablation of Utx-1, a H3K27me3 demethylase and mammalian homologue of KDM6A (Lysine- specific demethylase 6A), prolonged the life-span in Caenorhabditis elegans [104]. On the other hand, discovery of reversibility of the histone methyl marks mean that recruitment of chromatin effector molecules (or “readers”) are also dynamically altered to impact on gene activity. In the case of the activating H3K4me3 mark, the transcriptionally repressive nucleosome remodelling

25 and deacetylase (NuRD) complex is prevented from associating with histone 3 [105]. As one may anticipate, enhanced demethylation of this specific mark (as executed by the JmjC protein,

KDM5C) is likely to result in increased binding of the NuRD complex and transcriptional repression.

Based on their target specificity and mechanism of action, histone demethylases are classified into two groups: the lysine specific demethylases and the Jumonji domain containing demethylases [82, 103]. Upcoming sections will elaborate on both groups of enzymes.

1.3.2 Jumonji Domain Containing Family of Proteins

The name Jumonji is derived from the Japanese for “cruciform”, reflecting the appearance of the abnormal neural groove formation in mice lacking the “Jumonji” gene [106]. Using a novel gene trap method, Takeuchi et al (1995) aimed to uncover novel murine genes that were critical for development. Screening of mutants revealed a previously unidentified gene that appeared to be necessary for neural tube fusion and cerebellum development. Importantly, they found that, as early as embryonic day (E) 8.5 (which coincidentally, is a critical time period for murine chorioallantoic fusion and placental development [107]), a significant portion of homozygote mice lacking Jumonji exhibited neural tube defects around the midbrain region. All homozygotes were embryonic lethal between E10.5 and 15.5, suggesting that Jumonji is critical for proper mouse embryonic neural development [106]. In addition to cloning the first Jumonji gene and providing clues on its function, Takeuchi et al (1995) recognized that Jumonji is highly evolutionarily conserved among several vertebrates. Subsequent work has corroborated this, identifying the JmjC domain in numerous eukaryotic and prokaryotic proteins with diverse functions [108, 109]. Initial analysis of the JmjC domain revealed striking sequential similarities to members of the highly conserved Cupin family of metalloenzymes [110]. Structural matches between the two families exist at the level of the sequence, protein secondary structure and the presence of a zinc-ion in the catalytic site [108]. Despite these similarities, however, members of

26 the JmjC family may be distinguished by the frequent presence of DNA or chromatin binding domains, hinting at their role in higher order chromatin regulation and ultimately, the epigenetic code [108].

From a functional perspective, evidence for the catalytic ability of the JmjC domain comes from studies on the HIF1A hydroxylase, FIH1, which was found to execute its iron- and α-KG- dependent oxygenase activity through this domain [111]. Similar to the biochemical reactions catalyzed by the α-KG-dependent dioxygenases, the demethylation reaction proceeds via hydroxylation of the substrate methyl group, yielding formaldehyde, succinate and carbon dioxide in addition to the demethylated substrate [82]. On the other hand, Tsukada et al (2006) showed for the first time that the JmjC domain is absolutely essential for the execution of histone demethylase activity in Jumonji Histone Demethylase 1A (JHDM1A, also known as FBXL11)

[82]. Mutation of the highly conserved histidine 212 in the JmjC domain completely abrogated the histone demethylase activity of the enzyme, while complete deletion of the PHD domain,

CxxC-type zinc fingers or leucine-repeats in JHDM1A only partially impaired enzyme activity

[82]. Similarly, histidine 212 is also the primary iron (Fe2+)-binding site on FIH1, and is absolutely essential for the enzyme to execute its aspariginyl hydroxylase activity [111]. In addition, Tsukada et al (2006) found the enzymatic activity of the JmjC domain is also evolutionarily conserved [82]. Taken together, the afore-mentioned studies and others conclusively showed that the JmjC domain is the primary site of substrate-binding and execution of catalytic activity in members of the Jumonji family of proteins.

Another conserved Jumonji domain, namely the JmjN domain was initially found to frequently co-reside with the JmjC domain within the N terminus of Jmj family members [108, 109]. While there is strong consensus on the histone demethylase function of the JmjC domain, the precise involvement of the JmjN domain in modulating the activity of its host protein remains unclear.

There is some evidence that the JmjN domain is essential for the JmjC domain to elicit its

27 function. For instance, Quan et al (2011) posited that in yeast, the JmjN domain physically interacts with the JmjC domain to form a single structural unit that controls proteasomal degradation of the transcription factor, GIS1 [112]. Corroborating this, Huang et al (2010) also found that the JmjN domain of the histone demethylase, JMJD2A, interacted with its JmjC domain to impact on the histone demethylase activity of the enzyme in vivo [113]. Figure 1.4 depicts the domain structures of select members belonging to the JmjC containing family of histone demethylases.

Surprisingly, despite the recent attention they received, the Jumonji family of proteins was not the first identified enzymes with histone demethylase activity. Instead, it is an evolutionarily conserved transcriptional co-repressor called LSD1 (later classified as KDM1A), a lysine specific demethylase that preferentially removes mono- and dimethyl groups from lysine 4 of histone H3 (H3K4) [103]. Using a combination of in vitro demethylation assays, mass spectrometric and kinetic analyses, Shi et al (2004) showed that endogenous LSD1 exhibits in vivo histone demethylase activity through which it repressed target gene transcription [103]. In contrast to the JmjC proteins that require Fe2+ and α-KG as substrates, LSD1 is a flavin adenine dinucleotide (FAD) -dependent amine oxidase containing an N-terminal SWIRM (Swi3, Rsc, and Moira) substrate- binding domain within its catalytic core [114]. Moreover, while JmjC proteins produce a hydroxyl-methyllysine or alternatively, hydroxyl-methylarginine intermediate, LSD1 catalyzes an oxidation reaction that generates an imine intermediate with formaldehyde and unmodified lysines as products [115].

Recent work on hypoxia-epigenome cross-talk revealed that the JmjC members, JMJD1A and

JMJD2B are elevated in hypoxia at both the gene and protein levels, and that this was dependent on transcriptional induction by HIF1A [116]. Subsequent microarray studies confirmed this finding and demonstrated that several members of the JmjC family were in fact upregulated in hypoxia and that many of them were direct HIF1 transcriptional targets [117]. The authors

28 postulated that induction of these enzymes is an adaptive response to cellular hypoxia, enabling the cell to maintain “epigenetic homeostasis” [117]. Interestingly, the H3K9me3 demethylase,

JMJD2C has also been found to be intimately linked to the cellular hypoxic signalling pathway via epigenetic mechanisms [120]. Specifically, JMJD2C-mediated demethylation its histone target promotes the enhanced association of HIF1 to hypoxia-response elements in the promoters of its target genes such as BNIP3, LDHA, PDK1, and SLC2A1 [120]. Together, these studies emphasize the critical role of oxygen in modulating both global and local epigenetic events.

Adapted from Wolf et al (2007) [118] and Shmakova et al (2014)[119]

Figure 1.4 – Domain structures of Jumonji demethylases and their histone targets. Schematic representation of the domain structures of select members of the Jumonji C domain containing family of histone demethylases. The known histone targets are listed beside each structure. All four proteins depicted contain a conserved catalytic Jumonji C domain, while only

KDM4A and KDM5A contain an additional Jumonji N domain. Moreover, with the exception of

JMJD6, all three lysine demethylases contain additional regulatory domains, including the plant homeodomain and tudor domain that recognize specific histone modifications.

1.3.3 JmjC Domain Containing Protein 6

The Jumonji C domain containing protein 6 (JMJD6) has a curious origin. It was first erroneously identified as the phosphatidylserine receptor (PSR) that is resident on the cell- surface and responsible for recognition and clearance of apoptotic cells by phagocytes [121].

Subsequent work has refuted this finding and showed that PSR localized to the nucleus and shared striking homology with the JmjC domain of human FIH1 [122, 123] (Figure 1.5). PSR was christened as JMJD6, and the protein has begun to attract immense interest owing to its diverse roles in chromatin regulation and numerous other biological processes.

Analysis of the domain structure of human JMDJ6 protein provides important insights into its function. It contains a proportionally large JmjC domain (between Proline 141 to Arginine 305 residues), five independent nuclear localization signals (NLS), a putative adenine-thymine (AT) hook and a polyserine domain [123, 124]. Hahn et al (2008) identified a nuclear export signal

(NES), suggesting nuclear-cytoplasmic shuttling, as well as a putative SUMOylation site [124]

(Figure 1.5). Three different mouse and human JMJD6 splice variants have been identified, and they all share the JmjC domain; however, transcripts 2 and 3 of human JMJD6 are predicted to not contain the AT hook, the putative SUMOylation site, the NES or the polyserine domain

[124]. Although its significance has not been fully characterized, the AT hook typically functions as a DNA-binding motif, and may be critical for JMJD6 function. The Jumonji C domain is the site of oxygen-dependent catalytic activity, while the nuclear localization signals are both necessary and sufficient for nuclear residence. In contrast, in Hydra JMJD6, deletion of only the

C-terminal NLS significantly impaired JMJD6 nuclear localization, while deletion of the other two sequences had very little impact [122].

Adapted from Hahn et al (2007) [124]

Figure 1.5– Domain structures of the dioxygenases, JMJD6 and FIH1 indicating sites of homology within the respective Jumonji C catalytic domains. Both, JMJD6 and FIH1 contain a proportionally large Jumonji C catalytic domain, and share several conserved residues implicated in co-factor binding. This includes histidine (H) and aspartic acid (D) residues that bind to Fe2+, as well as glycine (G), lysine (K), valine (V), proline (P) and histidine (H) residues required for α-ketoglutarate binding. In addition to the JmjC domain, JMJD6 also contains both nuclear localization and export signals, a putative AT-hook for DNA binding, and a

SUMOylation site. FIH1 on the other hand, solely contains a JmjC domain that is central to its function.

JMJD6 has several unique attributes that set it apart from other histone demethylases of the Jmj family of proteins:

1. JMJD6 is critical for normal development

Akin to the first discovered Jumonji protein, JMJD6 is necessary for cellular differentiation and embryonic development. Analysis of the Jmjd6-/- mouse revealed an array of defects manifested at various stages in gestation [125-127]. Knockouts generated by multiple groups revealed that complete lethality occurred peri-natally due to cardiac malformations, while pronounced defects and death were evident around mid-gestation. Bose et al (2004) noted that there was growth retardation beginning at E12.5. Histological examination showed stunting of differentiation in the lungs, kidneys and intestines at E 16.5. A small percentage of the knockouts also displayed head abnormalities and brain hyperplasia [125]. Likewise, ocular and retinal defects were detected at E16.5, where in some cases, the mutants displayed either bilateral or unilateral anophthalmia. In contrast to the report by Li et al (2003), Bose et al (2004) found no involvement of JMJD6 in apoptotic cell clearance and phagocytosis, as was previously misinterpreted [125, 126]. Additionally, Kunisaki et al (2004) found that erythropoiesis and T- cell lymphopoeisis were impaired in their Jmjd6-/- mouse line.

2. JMJD6 is a protein arginine demethylase

The histone arginine demethylase function of JMJD6 has elicited much debate in the field of epigenetics. Using a series of in vitro and in vivo assays, Chang et al (2007) [128] elegantly demonstrated for the first time, that JMJD6 preferentially demethylates histone arginine residues. Using total bulk histones as well as synthetic histone peptides spanning the N-terminal regions of histones H3 and H4, and antibodies specific to a variety of methylated histone lysine and arginine residues, this study found that only WT recombinant JMJD6 enzyme (but not the mutant with disruptions in the iron-binding JmjC domain) removed methyl groups from

H3R2me2s and H4R3me2s residues. These findings were reiterated using Matrix-assisted laser desorption/ ionization–time-of-flight (MALDI-TOF) mass spectrometric (MS) analyses of the demethylated products revealed a peak shift corresponding to loss of single methyl groups. No evidence of histone lysine demethylation was observed. In support of this, Hahn et al (2010)

[129] tested mono-, di-, or tri-demethylation of several histone lysine targets (namely H3K4,

H3K9, H3K27, H3K36, and H4K20) and concluded that JMJD6 is unlikely to be involved in histone lysine demethylation, thus setting it apart from other members of the JmjC family which have all been identified as histone lysine demethylases. Despite these studies, there is no clear consensus on whether histone arginine demethylation represents the primary function of JMJD6.

Moreover, the precise dependence of this enzyme on oxygen to mediate its enzyme activity also remains to be established. Employing a similar strategy as Chang et al (2007), a recent study by

Walport et al (2016) [130] showed that besides JMJD6, the lysine demethylases, KDM4E and

KDM5C may also be involved in arginine demethylation of histones H3 and H4 at low levels.

However, considering that the afore-mentioned enzymes predominantly function as histone lysine demethylases, it remains to be seen if they play an important role in the physiological regulation of arginine demethylation.

JMJD6 and arginine demethylation of non-histone targets Interestingly, despite being recognized as an epigenetic regulator of histone modifications, recent studies have identified that JMJD6 also targets non-histone proteins for demethylation at arginine residues. These include estrogen receptor α (ERα) [131], the tumour necrosis factor receptor- associated factor 6 (TRAF6) [132], RNA helicase A [133], heat shock protein 70 (HSP70) [134] and the transcription factor PAX3 [135]. The diversity and significance of JMJD6 targets reflects its critical importance for early embryonic development, as evident from Jmjd6-/- mice. For instance, PAX3 is required for early muscle and neural development, and mice containing mutations in PAX3 exhibit defects in neural tube closure, not unlike the originally identified Jmj knockout mice [135].

3. JMJD6 is a protein lysyl hydroxylase

One of the first identified binding partners of JMJD6 is the RNA splicing factor, U2 small nuclear ribonucleoprotein (snRNP) auxiliary factor 65-kDa (U2AF35 and U2AF65) [136]. LC-

MS/MS and NMR studies revealed that JMJD6 executed lysine-specific hydroxylation of

U2AF65 at Lys15 and Lys276 residues [136]. This marked a novel function for JMJD6 as a specialized lysyl hydroxylase, in addition to the only known lysyl hydroxylases known to date, the PLOD enzymes (procollagen lysine, α-KG 5-dioxygenase). Other targets of JMJD6- mediated lysyl hydroxylation include the tumour suppressor, p53, which incidentally is also a target of pVHL [137].

An exciting discovery that juxtaposes JMJD6 function as a histone demethylase revealed that histone peptides themselves are direct targets of JMJD6-mediated lysyl hydroxylation in vitro and in vivo [138]. Highlighting the cross-talk between various histone post-translational modifications, this study also found that lysine hydroxylation of histone peptides inhibited N- acetylation and N-methylation respectively [138].

The involvement of JMJD6 in RNA splicing has been receiving recent attention. As previously mentioned, JMJD6 is a master regulator of alternative splicing through its regulation of U2AF65 protein. Moreover, in vitro studies in Hela cells revealed that the MGEA6 (meningioma- expressed antigen 6) gene is alternatively spliced upon JMJD6 knockdown [136]. Another study of found that JMJD6, via U2AF65, mediates the splicing of the VEGF receptor, FLT1, impacting on angiogenic sprouting in an in vitro endothelial cell line [139]. More recently, a study by Yi et al (2016) reported that the JmjC-domain mediated enzymatic activity of JMJD6 may not be necessary for its regulation of RNA splicing events, along with its binding partner, U2AF65

[140].

4. JMJD6 in cancer

Another active area of research involving JMJD6 is the field of cancer. Early evidence came from work done in breast cancer, whereby JMJD6 was found to have oncogenic properties and was highly associated with poor prognosis for the disease [141]. In vitro studies in breast cancer cell lines showed that JMJD6 promoted the transcription of genes involved in cell proliferation, while suppressing those involved in the TGFB-mediated signaling pathway [141]. These findings were corroborated by Poulard et al (2015) who reinstated JMJD6 controlled cell proliferation, invasion and migration in several breast cancer cell lines, and demonstrated that this was dependent on the function of its JmjC domain [142]. JMJD6 was also found to influence the progression of colon cancer through its interaction with the tumour suppressor, p53 [137].

Importantly, this study found that JMJD6-dependent lysyl hydroxylation of p53 represses its transcriptional activity and inhibits p53-mediated suppression of colon cell proliferation and tumour progression [143]. In summary, these studies implicate JMJD6 as a biomarker of tumourigenesis and potentially, cancer cell aggressiveness. Nevertheless, it remains to be seen if

JMJD6 truly remains functional in these circumstances, of if its elevated abundance is a hypoxia- dependent effect.

1.4 Oxygen Sensing in the Placenta

The placenta is a unique, transient organ of extraembryonic origin that lays the foundation for fetal development. It is a complex structure that juggles several responsibilities: Besides forming a physical barrier between mother and baby, the placenta mediates gaseous and macronutrient transfer to sustain the developing embryo, secretes critical hormones essential for pregnancy and acts as an immunological protectant [144]. Improper placental development underlies the pathogenesis of serious disorders of pregnancy, which in turn can have long-term consequences for both fetal and maternal health. It is therefore, of critical importance to elucidate the molecular

36 mechanisms that dictate both physiological and pathological placental development, and identify potential therapeutic targets. The following sections will briefly summarize how normal placentation proceeds, with an emphasis on oxygen sensing mechanisms, that when compromised, can lead to pregnancy complications.

1.4.1 Early placental development

Implantation of the blastocyst to the uterine wall heralds human placentation [144]. Trophoblast cells derived from the blastocyst differentiate into two distinct layers: an inner layer of highly proliferative mononucleated cytotrophoblasts that have stem-like properties, and an overlying layer of multinucleated syncytiotrophoblasts formed from cytotrophoblast fusion. It is the syncytiotrophoblast layer of chorionic villi that is in direct contact with maternal blood, and as such, performs functions of gaseous and nutrient exchange. In addition, syncytiotrophoblasts are specialized cells that secrete several pregnancy hormones, enzymes and growth factors that regulate placental and fetal development. Together, both trophoblastic layers, along with a mesenchymal core composed of connective tissue and fetal blood vessels comprise the functional unit of the placenta, known as the chorionic villus [145].

As gestation progresses, villous cytotrophoblast cells continuously proliferate and replenish the syncytium, as the chorionic villi form extensive branches that extend into the intervillous space.

These villi, bathed directly in maternal blood, make no physical contact with maternal tissue are referred to as ‘floating villi’. Concomitantly, a population of villous cytotrophoblasts detach from the basement membrane, break through the overlying syncytium and form extravillous trophoblast cell (EVT) columns that anchor the villus to the uterine decidua. As they journey towards the decidua, the EVTs become migratory and invasive [146]. The villi containing the cell columns as termed ‘anchoring villi’ and their formation establishes a physical link between the developing conceptus and the mother.

Adapted from Simon & Keith (2008) [147]

Figure 1.6– Oxygen changes in the developing placenta

Figure 1.6 – Oxygen changes in the developing placenta.

(A) Structure of the mature placenta depicting umbilical blood vessels (veins and arteries), chorionic villi, the intervillous space and an anchoring column (top panel). (B) Typical structure of an anchoring column containing three lineages of trophoblast cells: villous cytotrophoblasts and syncytiotrophoblasts on the fetal side of the placenta, and invasive extravillous trophoblasts on the maternal side (bottom panel). Oxygen plays an important role in early placental development. Prior to opening of the intervillous space (5-6 weeks of gestation), trophoblast cells remain proliferative and undifferentiated. Upon a rise in oxygen tension between 9-12 weeks of gestation, villous cytotrophoblasts differentiate into invasive and migratory extravillous trophoblasts that remodel the uterine decidua to establish functional maternal blood flow.

EVT invasion marks a momentous event in placentation. It is a complex process that involves a molecular and phenotypic switch in the expression of several cell-surface markers, adhesion molecules and receptors, governed by growth factors including those belonging to the TGFB super-family [15, 148]. Ultimately, EVT invasion facilitates vascular remodelling of uterine spiral arteries into large, high-velocity conduits with low resistance, enabling efficient uteroplacental circulation [149].

1.4.2 Oxygen changes in the developing placenta

Oxygen plays an extraordinary role in early placental development. Seminal work has conclusively demonstrated that the early conceptus develops in a relatively hypoxic environment

[150]. Rodesch et al (1992) investigated changes in placental pO2 during different gestational windows, namely 8-10 weeks and 12-13 weeks, in pregnant women referred for termination of pregnancy. Using polarographic oxygen electrodes that were introduced trans-vaginally through an umbilical artery catheter, the study showed for the first time that pO2 in the intervillous fluid

(indicative of placental villous pO2) significantly varied between the two time points.

Specifically, pO2 reported to range from 15-20 mm Hg (corresponding to ~ 2% O2) during 8-10 weeks, subsequently rising to 60-70 mm Hg (corresponding to ~ 8% O2) at 12-13 weeks. These findings were in stark contrast to measurements in the maternal endometrium, where pO2 levels remained relatively steady across the detection window [1]. Jaffe et al (1997) reviewed a multitude of studies involving Doppler imaging of uteroplacental blood flow, and concluded that prior to 10 weeks of gestation, blood flow is limited, and embryonic and trophoblastic tissues develop in relative hypoxia [151]. As well, syncytiotrophoblasts in villous explants obtained from early first trimester placentae survived in hypoxic conditions (2.5% O2) but rapidly degenerated in conventional normoxia in vitro [152]. Another line of evidence for oxygen changes in early placentation stem from in vitro and in vivo work showing that HIF1A expression in trophoblast cells is markedly elevated prior to 10 weeks of gestation, corresponding to decreased placental blood flow and decreased pO2 [153-155]. The low oxygen

40 environment prior to 10 weeks of gestation is thought to reflect two physiological events: (1) the presence of trophoblast cell plugs that occlude uteroplacental arteries and (2) incomplete remodelling of the uterine spiral arteries, thereby limiting exposure to oxygen [156].

While maintaining a consistent oxygen supply to the fetus is of obvious importance, alterations in oxygen also directly influences trophoblast cell fate. Given that oxygen can be a double-edged sword and generate detrimental reactive oxygen species (ROS), it is important that the developing conceptus be protected from these elements. Reflecting the low oxygen environment, Watson et al (1998) showed that syncytiotrophoblast cells at this stage possess limited antioxidant defense mechanisms for cytoprotection [152]. In particular, they found that prior to 12 weeks of gestation, syncytiotrophoblasts produced very low levels of the antioxidant enzyme, mitochondrial superoxide dismutase (MnSOD) in vivo [152]. Moreover, our laboratory and others have demonstrated that trophoblast cells remain proliferative during this period and that low oxygen tension in vitro inhibits trophoblast cellular differentiation, maintaining them in a non-invasive, intermediate phenotype [153, 156, 157]. This suggests that trophoblast cells are directly capable of sensing changes in oxygen and responding by altering their behaviour.

Around the ninth week of gestation, trophoblastic plugs in the uteroplacental arteries loosen and there is a dramatic increase in maternal blood flow into the intervillous space. This is reflected as an increase in oxygen delivery to the placental unit and an overall rise in oxygen tension to 60-70 mm Hg [1, 158]. Regarding placental oxidative status during this time, Jauniaux et al (2000) showed that these dramatic changes in maternal circulation were paralleled by a sudden burst of

ROS [159]. To mitigate potential damage, the increase in placental oxygen tension during 8 and

14 weeks of gestation is accompanied by increased syncytiotrophoblast MnSOD activity, as well as in the mRNA and protein abundance of a variety of antioxidant enzymes [152, 159].

Interestingly, studies have shown that this transient increase in oxidative stress, accompanied by rising oxygen tension facilitates villous trophoblast differentiation into EVTs, further

41 establishing uteroplacental blood flow. As such, in vitro and ex vivo studies have demonstrated that physiologically normoxic levels of oxygen promote a migratory, invasive phenotype in trophoblast cells [153, 157, 160]. Figure 1.6 depicts oxygen changes in the developing placenta comprising an anchoring column on the fetal and maternal sides.

1.4.3 Oxygen sensing machinery in the developing placenta

While the precise molecular pathways involved in mediating the effects of oxygen on trophoblast cell fate have not been fully elucidated, there is substantial evidence implicating the transcription factor, HIF1 in mediating this process [153, 161]. Seminal work from our laboratory first described the importance of HIF1A as a master regulator of trophoblast cell fate in an oxygen- dependent manner [153]. Antisense inhibition of HIF1A in early first trimester placental villous explants maintained in hypoxia resulted in a loss of proliferative capacity and gain of an invasive phenotype, indicating the oxygen-dependent effects on trophoblast cell fate are mediated by

HIF1A [153]. Furthermore, our group has also demonstrated that this effect of HIF1 occurs through the actions of transforming growth factor β3 (TGFB3), another key regulator of placental development [153].

The importance of HIF1A and HIF2A in the placenta is also apparent from murine knockout models lacking these factors. Homozygous loss of Hif1a alone resulted in pronounced vascular defects between E8.75 but by E9.25 and embryonic lethality by E10.5 due to severe cardiac malformations and neural tube defects [162, 163]. Similarly, Hif2a knockouts also died between

E9.5 and E12.5 due to defective vasculogenesis [164]. Examination of Hif1a-/- placentas revealed a variety of phenotypes, including defective chorioallantoic fusion and impaired labyrinthine vascularization [165]. In support of this, concurrent loss of both HIF1A and HIF2A resulted in profound placental cellular architectural, morphological and vascularization defects [161, 165].

From a mechanistic perspective, HIF1 is a known regulator of the transcription of genes involved in proliferation and apoptosis [166] many of whose expression is altered in trophoblast cells with variations in oxygen tension [160]. HIF1A mRNA and protein are elevated prior to 9 weeks of gestation, at a time when placental pO2 levels are relatively hypoxic, while its cognate partner,

HIF1B was highly expressed but remained unchanged throughout pregnancy [154]. During this period, HIF1A protein predominantly localized to cytotrophoblast cells and EVTs in the proximal invading columns, while its upstream regulator, pVHL was primarily found in the syncytiotrophoblasts and EVTs of the distal invading columns [154]. Importantly, examination of the VHLCBC complex that regulates HIF1A stability, revealed that accessory proteins in this complex (CUL2 and NEDD8) associate with pVHL and appear in cytotrophoblast cells at a time when oxygen tension rises and HIF1A degradation is maximal (10-12 weeks). As well, this study demonstrated for the first time that placental expression of the oxygen-sensing EGLN proteins that encode for prolyl hydroxylase enzymes, inversely correlated with that of HIF1A in the first trimester of gestation [154]. Taken together, this work shows that the cellular oxygen sensing machinery is expressed and functional in the human placenta. De Marco & Caniggia (2002) showed that in addition to the canonical oxygen sensors in the hypoxic signalling pathway, trophoblast cells may also utilize the mitochondrial respiratory chain, membrane-bound

NAD(P)H oxidases and/or hemeproteins to sense oxygen and elicit an adaptive response [167].

1.4.4 Placental pathologies characterized by disrupted oxygen sensing

Given the critical importance of oxygen in orchestrating trophoblast events in normal placentation, it is not surprising that abnormalities in oxygen sensing lead to adverse pregnancy outcomes. Placental hypoxia has been linked to the development of several pregnancy complications, among which the best characterized are preeclampsia and intrauterine growth

43 restriction (IUGR). While IUGR is defined by the inability of the fetus to achieve its full growth potential, preeclampsia is manifested as maternal hypertension and multi-organ pathology [168].

Both disorders share many common features, including their risk factors, pathogenesis

(incomplete endovascular trophoblast invasion) and presentation (impaired uteroplacental blood flow) [169]. As such, preeclampsia is frequently complicated by IUGR, and placental dysfunction remains at the core of both pathologies [168].

Preeclampsia is a multi-factorial disorder of pregnancy with potentially devastating consequences. It is estimated to affect between 5-8% of all pregnancies [170] and often involves a multitude of fetal and maternal complications. Clinical diagnosis of preeclampsia has been defined by the American College of Obstetricians and Gynecologists (ACOG) [171] as follows:

New-onset hypertension (systolic blood pressure of 140 mm Hg or higher or diastolic pressure of

90 mm Hg or higher that occurs after 20 weeks of gestation), accompanied by either proteinuria

(urine with greater than 0.3g protein), thrombocytopenia, impaired liver function, renal insufficiency, pulmonary edema or new-onset cerebral or visual disturbances. For over a decade now, preeclampsia has been described as two distinct disorders based on unique biological profiles, feto-maternal outcomes and pathogenesis [172, 173]. Early-onset preeclampsia (E-PE) is manifested prior to 34 weeks of gestation while late-onset preeclampsia (L-PE) occurs after 34 weeks of gestation represents an abnormal maternal response to normal placentation [172].

Strong evidence suggests that E-PE is predominantly of placental origin and although it constitutes a small subset of all preeclamptic cases, it presents the most severe clinical symptoms

[174]. L-PE on the other hand, is believed to stem from increased susceptibility of the maternal endothelium to pro-inflammatory factors, resulting in an abnormal maternal response [174].

While removal of the placenta resolves the clinical symptoms of preeclampsia, emerging evidence indicates that the disease can have long-term health consequences for the mother and offspring. Preeclampsia is the second largest cause of maternal morbidity worldwide and is

44 responsible for 15% of all premature births and related infant illnesses including cerebral palsy, blindness, epilepsy, deafness and lung conditions [170]. The Developmental Origins of Health and Disease (DOHAD) theory originally proposed by David Barker (1990) stated that early exposure of the fetus to adverse environments predicts future risk of disease [175]. In line with this, women with a history of preeclampsia as well as their offspring are at increased risk for the development of hypertension and cardiovascular disorders later in life [176]. In comparison to those from uncomplicated pregnancies, female offspring of preeclamptic pregnancies also demonstrate a greater risk of developing preeclampsia themselves [176]. Moreover, a subset of preeclamptic offspring displayed cognitive functional impairments, including deficits in higher order processes such as memory, attention and information processing [177]. These studies emphasize the importance of unravelling the root mechanisms that underlie this devastating disorder.

1.4.5 Oxygen changes in preeclampsia

Although there is little consensus as to the key contributor to the pathogenesis of preeclampsia, studies have long acknowledged that placental hypoxia is at the center of this pathology. The initiating event in E-PE is thought to stem from shallow trophoblast invasion of extravillous trophoblast cells into the maternal decidua and consequent inadequate remodelling of maternal spiral arteries [178]. This lack of physiological adaptation is associated with decreased uteroplacental blood flow and impaired perfusion, factors that ultimately contribute to uteroplacental hypoxia. This in turn has been implicated as a causative factor for defective trophoblast invasion and ensuing disruption in proliferative capacity of cytotrophoblasts, further exacerbating the defective phenotype [179]. Phenotypic analysis of placentae from E-PE and L-

PE pregnancies using magnetic resonance imaging (MRI) revealed that E-PE pregnancies were associated with a reduction in placental perfusion, while normal pregnancies were characterized by decreased placental perfusion with increasing gestational age [180].

Using a high-throughput functional genomic study of placental villous explants exposed to low oxygen (3% O2), placentae from high-altitude residence, and preeclamptic pregnancies, our laboratory provided first molecular evidence of placental hypoxia in preeclampsia [181].

Microarray analysis revealed a strikingly similar gene expression profile among the three model systems, implicating chronic hypoxia as a key factor in preeclampsia pathogenesis [181].

Furthermore, we demonstrated that hypoxia, via HIF1A, regulates the expression of the VEGF receptor, placental soluble fms-like tyrosine kinase 1 (sFLT1), which, in addition to soluble endoglin (sENG), is markedly elevated in sera of preeclamptic pregnancies [182-184].

Interestingly, pregnancies at high altitude also exhibited elevated sFLT1, further corroborating the contribution of chronic hypoxia in regulating this factor [182]. Also, our laboratory found that hypoxia down-regulates the expression and signalling of Vascular endothelial growth factor receptor 2 (VEGFR-2), which serves as the major receptor for VEGF, and is hence important for proper endothelial function [185]. Similarly, hypoxia was found to regulate placental expression of endoglin through TGFB-signalling, further highlighting the role of oxygen in contributing to preeclampsia development [186].

The molecular mechanisms underlying preeclampsia pathogenesis are only beginning to be dissected. Of relevance to the work in this thesis, disruption in placental oxygen sensing has been established as a major contributing factor. Work from our laboratory and others’ revealed that

HIF1A protein levels are significantly up-regulated in preeclamptic placentae [187, 188]. On one hand, overexpression of HIF1A in preeclamptic placentae can be partly attributed to dysregulation of the canonical oxygen sensing mechanisms involving the PHDs, FIH1 as well as

SIAHs (seven in absentia homologues, a negative regulator of FIH1) [189]. Moreover, placentae from EPE exhibited decreased levels of PHD2, FIH1 and SIAHs, in comparison to LPE placentae, while HIF1A expression was increased [189]. Accordingly, HIF1A hydroxylation at targeted prolines on its ODD was also decreased in preeclamptic placentae, emphasizing the

46 importance of the PHDs in regulating HIF1A under pathological conditions [189]. On the other hand, hypoxia-induced oxidative stress and resultant excessive ROS generation in PE can also directly enhance HIF1 transcription in PE [190, 191]. While PE is typified by pathological hypoxia, pregnancies at high-altitude represent a physiological model of hypoxia, allowing us to draw important conclusions on adaptations during pregnancy. Gene-repression analyses by

Moore et al (2004) indicated that the HIF1-dependent transcriptional targets show alterations in expression depending on the duration of the respective culture’s residence at high altitude. For instance, Andeans who have resided at high altitude for 10,000 years show remarkable adaptations to the hypoxic environment that were not detected in Europeans that have resided at high altitude for a much shorter period [192]. Molecular characterization of placental hypoxia at high-altitude by our laboratory showed that both HIF1A and pVHL were significantly upregulated in these pregnancies, in comparison to those at moderate (1600 m) and sea level (75 m) altitudes [193].

Other hallmark events in preeclampsia include oxidative stress and maternal vascular endothelial dysfunction due to an imbalance of angiogenic and antiangiogenic factors [179]. More recent work has highlighted preeclampsia as a lysosome storage disorder involving disruption of sphingolipid metabolism, ultimately leading to increased trophoblast cell autophagy [194]. To facilitate accurate clinical approaches to treatment, Kingdom and Kaufmann (1997) stress the need to distinguish between different modes of ‘hypoxia’ and consequences for the fetus. They propose three categories: preplacental hypoxia in which the placenta and fetus are both hypoxic due to reduced oxygen content in maternal blood (e.g., pregnancies at high altitude), uteroplacental hypoxia in which the placenta and fetus are hypoxic due to disruption in the entry of oxygenated maternal blood into uteroplacental circulation (e.g., preeclampsia), and postplacental hypoxia in which blood flow to the fetal unit is restricted (e.g., IUGR with absent umbilical end-diastolic flow) [195]. Reiterating these distinctions, using ovine models of placental insufficiency-linked fetal growth restriction, Regnault et al (2003) showed that

47 postplacental hypoxia underlies alterations in placental angiogenic factors (such as placental growth factor and VEGF), and that the transplacental pO2 gradient was increased in this system

[196]. Ultimately, this resulted in impaired vasculogenesis and fetal hypoxia, culminating as growth restriction [196]. At the cellular level, both IUGR and preeclampsia correlate with limited trophoblast invasion of maternal spiral arteries, while pathologies such as placenta accreta and choriocarcinoma are associated with exuberant invasion [197].

Analysis of gene expression profiles in preeclamptic placentae by several groups revealed dysregulation of key signaling pathways. These include the Notch, Wnt, NF-κB and TGFB signalling, extracellular matrix components, factors involved in endothelial function and angiogenesis, oxidative stress pathways, cell death, immune and inflammatory signalling [198-

200]. Besides alterations in placental gene expression in preeclampsia, single nucleotide polymorphisms (SNP) have been detected in several candidate genes that belong to the afore- mentioned signalling pathways [201]. Recently, Leavey et al (2015) performed large-scale microarray analysis of preeclamptic and control placentae to reveal three distinct sub-classes of the disease [202]. Reflecting the heterogeneity of not only the pathological samples, but also the controls, this study underscores the need to understand the genetic basis of preeclampsia to facilitate prognostic and diagnostic biomarker discovery.

1.4.6 Epigenetics in the Placenta

The placenta is exposed to a remarkable number of environmental influences in its role as the interface between the mother and fetus. EVT cells of the placenta are comparable to invasive tumour-like cells that typically undergo marked changes in DNA methylation status. Hence, epigenetic events are expected to contribute to shaping normal placental function, and noted to be disturbed in pathological conditions.

As a potential link between alterations in epigenetic processes and gene expression outcomes that underlie placental dysfunction, several studies have examined promoter methylation in normal and adverse pregnancy outcomes. Similar to cancer cells, the first trimester placenta is thought to undergo epigenetic loss of genomic imprinting and exhibits global hypomethylation of gene promoters [203, 204]. Novakovic & Saffery (2012) reviewed the literature on epigenetic changes in preeclampsia and IUGR both at a global level and at specific gene loci [205]. They summarize the following alterations: Preeclamptic placentae were characterized by markedly higher levels of global methylation in comparison to healthy placentae, and this included differential methylation of a large number of genes [206]. Moreover, to distinguish between E-

PE and L-PE on an epigenetic basis, one study found higher mRNA expression of the DNA methyltransferase, DNMT1 in E-PE. Also, the same group demonstrated loss of genomic imprinting of the H19 gene in preeclampsia, linking it to the development of hypertension in the disease [207]. Of particular significance to trophoblast differentiation and invasion, Martin et al

(2015) found CpG hypomethylation of genes along the TGFB signaling pathway in preeclamptic placentae, potentially explaining the dysregulation in this axis [208]. Similarly, epigenomic studies on IUGR revealed loss of imprinting of the IGF2 gene (whose expression is linked to

H19 expression), as well as hypomethylation and increase in expression of H19 [209, 210].

Very few studies have examined histone post-translational modifications and their significance in placentation. Using chromatin immunoprecipitation (ChIP) assays, Morris et al (2002) found acetylation of histones H3 and H4 as an important determinant of Interferon-gamma-dependent induction of Class II Major Histocompatibility Complex Transactivator (CIITA) mRNA in the placenta [211]. However, this study was performed in cell lines and yielded limited information on how these processes occur in vivo [211]. Kimura et al (2004) examined profiles of histone modifications at the human growth hormone (hGH) locus and found that a large acetylated domain encompassing di- and trimethylation of H3K4 dictated activation of placenta-specific

49 hGH gene cluster in nuclei of syncytiotrophoblast cells [212]. The in vivo nature of this study is exciting proof that epigenetic events contribute to the transcriptional control of placental genes.

Placental epigenetics is a flourishing area of research. However, while DNA methylation can be considered a principal epigenetic modification that directly impacts on gene transcription, the literature has largely ignored the influence of other epigenetic phenomena (including chromatin and histone changes and micro RNAs) on normal and pathological placentation. To envision a clearer picture of epigenetic outcomes, it is therefore crucial to place DNA modifications in the context of other changes and avoid making causal inferences.

1.5 RATIONALE, HYPOTHESIS, OBJECTIVES

Gap in knowledge / Rationale

At the core of preeclampsia is chronic hypoxia that is manifested as elevated HIF1A expression. This is due to compromised oxygen sensing and impaired function of pVHL, a key executor of the cellular hypoxic response. While efforts have been made to address the importance of pVHL in regulating

HIF1A stability in the developing placenta and in preeclampsia, the knowledge on upstream regulators of VHL (both gene and protein) is lacking. Also, to date, no studies have established the critical dependence of JMJD6 on oxygen, or addressed its dual roles as a histone arginine demethylase and a protein lysyl hydroxylase in shaping normal and pathological placental development. Hence, this thesis aims to examine the precise molecular signature of JMJD6 in the human placenta in physiological conditions and in preeclampsia, and to systematically establish its regulatory relationship with VHL. Understanding the mechanisms underpinning VHL gene and protein not only has significance for HIF1A regulation, but also for the known VHL multi-tasking roles in orchestrating a variety of cellular events.

Overall Hypothesis

JMJD6 is a novel oxygen sensor in the human placenta, where it regulates VHL, and its disruption may contribute to the pathogenesis of preeclampsia.

Objectives

1. Investigate the histone demethylase function of JMJD6 in the human placenta, and its

role in regulating VHL gene expression in physiological and pathological conditions.

2. Ascertain the role of JMJD6 as a lysyl hydroxylase in mediating VHL protein stability in

the human placenta

2 Materials and Methods

2.1 Placental Tissue and Sera from Human Subjects

All procedures were conducted according to Ethics Guidelines outlined by the University of

Toronto, Faculty of Medicine (Toronto, ON, Canada) and the Research Ethics Board of Mount

Sinai Hospital (Toronto, ON, Canada) guidelines from the collaborating Institution and the

World Medical Association Declaration of Helsinki. Informed consent was obtained from each patient prior to collection of tissue samples. Human placental tissue and sera were collected by the Research Centre for Women’s and Infants’ Health (RCWIH) Biobank and by the O.I.R.M

Sant’ Anna Hospital, University of Turin, Italy.

Placentae were obtained from first trimester (5-12 weeks of gestation, n=34), or alternatively, pregnancies complicated by either early (E-PE; n=58) or late-onset preeclampsia (L-PE, n=12) diagnosed in accordance with ACOG criteria [171]. Control placentae were obtained from preterm (PTC) (n=54) and term (TC) (n=19) normotensive age-matched deliveries that did not show signs of disease. Serum samples were obtained at delivery from women exhibiting clinical signs of early onset PE (E-PE, n=10) and from normotensive PTC (n=10). Tissue was randomly sampled from different central and peripheral areas of the placenta and examined to exclude regions with obvious insult. As well, samples with calcification and necrosis were excluded.

Patients with chronic hypertension, diabetes, signs of infection or kidney disease were excluded.

Preterm deliveries were attributed to idiopathic preterm labour, cervical incompetence and premature rupture of membrane. Upon collection, placentae were immediately snap-frozen for

RNA and protein analyses, or alternatively, fixed in paraformaldehyde (PFA) in preparation for histological and immunohistochemical analyses. Table 1 summarizes clinical parameters of control and preeclamptic female subjects employed in the study.

Table 2.1 – Clinical parameters of patient population

PTC E-PE TC L-PE

n=54 n=58 n=19 n=12

Gestational Age at 29.48 ± 2.55 30.54 ± 2.60 34.00 ± 4.50 37.95 ± 0.57 Delivery

Birth Weight 1725.53 ± 441.19 1597.15 ± 3497.50 ± 3305.00 ± (g) 495.71 170.56 618.68

Blood Pressure 113.00 ± 7.87 / 162.65 ± 6.18/ 123.50 ± 1.22 / 153.33 ± 25.63/ (mm Hg, S/D) 69.63 ±5.32 110.92 ± 6.88 82.75 ± 11.24 92.00 ± 3.46

Proteinuria Absent 3.66±0.49 Absent 2.33 ± 1.15 (g/day)

Mode of 50% CS, 50% 69 % CS, 31% 83% CS, 17% 33 % CS, 67 % delivery (%) VD VD VD VD

Data are presented as mean ± standard error of the mean PTC = Preterm Controls E-PE = Early-Onset Preeclampsia TC = Term Controls L-PE = Late-Onset Preeclampsia S/D = Systolic/Diastolic CS = Caesarian Section VD = Vaginal delivery

2.2 Mouse Strains

Animal studies were performed in accordance with guidelines established by the Canadian

Council for Animal Care, and the Animal Care and Use Committee at the Hospital for Sick

Children, Toronto. CD1 WT mice (Strain Code: 022) were obtained from Charles River (St.

Constant, QC). All mice were housed in a temperature controlled room and had free access to food and water. Healthy, pregnant, female mice were randomly assigned to experimental or control groups. Pregnant females were injected daily with the PHD2 inhibitor, FG-4592 (0.5 mg/kg body weight) (Cayman Chemical, Ann Arbor, MI, USA), from embryonic day 7.5 (E7.5) to embryonic day 13.5 (E13.5) (n=3 mice per group for two rounds of injections). Alternatively, pregnant females were injected with the Jumonji histone demethylase inhibitor, JIB-04 (30 mg

JIB-04/kg body weight) (Sigma-Aldrich Corporation, Sigma, St. Louis, MO, USA) daily from

E7.5 to E13.5 (n=3 mice per group for one round of injections). Control mice were injected with an equivalent volume of DMSO (for the FG-4592 study) or sesame oil (for the JIB-04 study) for the same duration. Following both studies, placentae, fetuses and maternal kidneys were harvested by snap-freezing in liquid nitrogen, or fixation in paraformaldehyde (PFA). Placentae were processed for histological, immunohistochemical, qPCR and Western blot analyses.

2.3 Primary Trophoblast Cell Isolation

Primary cells were isolated within two hours of collection of healthy first trimester or term placentae. Immediately after obtaining the placenta, the tissue was dissected into several small pieces to remove blood vessels and connective tissue, and washed multiple times in 0.9% saline solution. Once the tissue was clear, it was dissected further to predominantly retain villi that were free of blood and other material. Sixty grams of this villous tissue was weighed and washed once in HBSS-/- solution.

Tissue was initially digested in freshly made digestion buffer comprised of Dulbecco’s Modified

Eagle’s Minimum Essential Medium (DMEM) with 0.05 mM trypsin (GIBCO 27250-018;

Invitrogen, Carlsbad, CA, USA) and 0.008 mM DNase I (Sigma-Aldrich Corporation, St. Louis,

MO, USA), in a 37C water bath for 30 minutes with agitation (110 rpm). The supernatant, primarily comprised of the syncytiotrophoblast layer, was discarded and the remaining tissue was further incubated in DMEM containing 0.05 mM trypsin alone at 37C water bath for 40 minutes with agitation (110 rpm). The remaining tissue was digested a third time in DMEM containing 0.05 mM trypsin. The supernatant from the second and third digestions (containing the cytotrophoblast cells) was collected and neutralized with FBS, centrifuged at 800 g for 10 min at 4ºC, and the pellet was re-suspended in DMEM. The solution was then filtered using a 70

µM nylon cell strainer, and the ultrafiltrate was spun down at 1185 g for 15 minutes. The pellet was then re-suspended in 5 mL DMEM supplemented with 10% FBS and 1% pen/strep, slowly pipetted onto a 5–70% Percoll (Sigma, St Louis, MO, USA) gradient, and centrifuged at 1400 g for 20 min at 4ºC. The layer between 30% to 50% was collected and washed with DMEM and centrifuged at 1185 g for 15 min. The pellet was once again washed in HBSS solution containing

Mg2+/Ca2+, supplemented with 2% FBS. Cells were purified further by differential attachment, counted using a hematocytometer and Trypan blue staining. They were then seeded at a density of 6x106 cells/well in petri dishes in complete DMEM containing 10% heat-inactivated FBS

(Sigma, St. Louis, MO, USA) and 10,000 units/ml of penicillin and streptomycin at 37oC. Cells were maintained at either 8% O2 (5% CO2, 87% N2) or 3% O2 (5% CO2, 92% N2) and subsequently harvested for qPCR and Western blot analyses.

Advantages: A key advantage to the use of primary isolated cells is their in vivo relevance. They retain several aspects of trophoblast physiology, making them an excellent model to study trophoblast function. Primary cells also express key players in the cellular oxygen sensing machinery, many of whose expression is altered with changing oxygen tension.

Disadvantages: Given their tendency to spontaneously and rapidly syncytialize, primary cells are difficult to maintain in culture. Moreover, they are challenging to transfect for loss- and gain-of- function studies. Additional disadvantages include the cost of obtaining and harvesting placentae and the inherently high degree of variability between human samples.

2.4 Villous Explant Culture and antisense knockdown

First trimester placentae were obtained from elective terminations following informed consent.

Briefly, tissue was rinsed in PBS and small fragments were dissected under a dissecting microscope. Villi were then cultured at while those from first trimester were incubated overnight in 3% O2 (5% CO2, 92% N2) at 37°C in DMEM/F12 (GIBCO-BRL, 11039-021), supplemented with 10,000 units/ml of penicillin/streptomycin. For HIF1A knockdown in placental villous explants, phosphorothioate oligonucleotides (of 15 bp targeted to sequences near the AUG start codon of HIF1A) were synthesized on a DNA synthesizer and purified via capillary electrophoresis. The sequences of the antisense and sense oligonucleotides were 5′-

GCCGGCGCCCTCCAT-3′ and 5′-ATGGAGGGCGCCGGC-3′. Following overnight culture, explants were incubated in DMEM/F12 alone or in the presence of 10 μM antisense or sense

HIF1A oligonucleotides.

Advantages: Villous explants are an important tool for studying trophoblast migration and differentiation events. Their intact villous architecture and preserved paracrine interactions make them a highly physiologically relevant model. Unlike primary isolated trophoblast cells, villous explants are amenable to perform loss of function studies using antisense oligonucleotides or neutralizing antibodies.

Disadvantages: Similar to primary isolated trophoblast cells, villous explants cannot be maintained in culture for extended periods of time. As well, they are limited by cost and inter- sample variability.

2.5 Human Cell Lines and Culture Conditions

Human JEG3 choriocarcinoma cells (ATCC, Manassas, VA, USA; authenticated by Short

Tandem Repeat genotyping) and HEK293 cells (ATCC) were grown in Eagle’s Minimum

Essential Medium (EMEM) supplemented with 10% FBS and 1% PS, and maintained in 21% O2 at 37°C. For treatment, cells were seeded at a density of 2x105 cells/well in 6-well plates at 60-

70% confluency. For treatment, cells passaged less than 15 times were plated at a density of

2x105 cells/well in 6-well plates and allowed to reach 60-70% confluency. Subsequently, cells were exposed for 24 h to either 21% O2 or 3% O2 (5% CO2, 92% N2). Primary trophoblast cells isolated from term placentae were maintained at either 8% O2 (5% CO2, 87% N2) or 3% O2 (5%

CO2, 92% N2) in EMEM supplemented with 10% FBS and 1% PS.

Advantages: JEG3 cells are an epithelial trophoblastic cell line that mimic some key features of villous and extravillous trophoblast cells. They are highly amenable to transfections (either silencing or overexpression) and display a homogenous, stable phenotype. Given their proliferative nature, they are a good model to study trophoblast proliferation and cell death events.

Disadvantages: As with any cell line, in vitro data cannot be extrapolated to the intact organism, thereby limiting their in vivo relevance. Since JEG3 cells are immortalized, it is possible that viral transfection methods that were used to extend their lifespan have an impact on the cellular molecular machinery. Given that the present study is centered on oxygen sensing, another important caveat is the use of JEG3 cells to study molecular changes in response to alterations in oxygen tension. Since JEG3 cells are routinely cultured and maintained at room air (21% O2), this might represent hyperoxic conditions for primary trophoblast cells and villous explants, potentially limiting the translation of data obtained from this in vitro model. In addition, JEG3 cells are limited in their use in studying epigenetic mechanisms due to the fact that they are an immortalized/transformed cell line. Despite these limitations, the work done in JEG3 cells

58 warrants future investigation of epigenetic regulation along the JMJD6-VHL axis, in the context of changes in oxygen.

2.5.1 Pharmacological Treatments

For all pharmacological treatment, JEG3 cells initially were grown to ~ 60% confluency in

DMEM containing 10% (v/v) FBS in 6-well plates and incubated with the appropriate inhibitor at 21% O2. For inhibition of lysyl hydroxylation, 10 µM minoxidil, a lysyl hydroxylase activity inhibitor (Sigma-Aldrich, St.Louis, MO, USA) dissolved in 20 µl 95% (v/v) ethanol was added to cells and incubated for 48 h. A similar aliquot of 95% (v/v) ethanol constituted the vehicle control. For proteasomal inhibition, 25µg/µL of Mg132 (Millipore Corp, Bedford, MA, USA) was added to cells and allowed to incubate for 24 h. For inhibition of lysosomal protein degradation via neutralization of internal pH, 10mM of ammonium chloride (NH4Cl) (Sigma-

Aldrich) was dissolved in H2O, added to cells and incubated for 24 h. For inhibition of Jumonji histone demethylase activity, 1 µM JIB-04 (Sigma-Aldrich) dissolved in DMSO was added to cells and incubated for 24 h. For inhibition of DNA methylation, JEG3 cells were exposed to 5

µM of 5-Azacytidine (5-AZA) for 24 h. Following the respective treatment, cells were collected in RIPA+ (radioimmunoprecipitation assay with protease inhibitors) lysis buffer and harvested for Western blotting, or alternatively, in 1mL TRIzol for RNA extraction.

To test the effect of nitrile/oxidative stress, JEG3 cells were treated for 24 h with 2.5 mM of the nitric oxide donor sodium nitroprusside (SNP). Following treatment, the conditioned media was collected. The Amplex Red Hydrogen Peroxide/Peroxidase Assay Kit was used to detect H2O2 release into conditioned media, as per manufacturer’s instructions (Catalog # A22188, Life

Technologies, Carlsbad, CA, USA).

2.6 Iron Assay

Intracellular iron content (both ferrous and ferric ions) in E-PE and L-PE placental tissue was measured using a commercially available Iron Assay Kit (Catalog # ab83366, Abcam Inc.). Briefly, 50-100 mg of placentae was homogenized using a Dounce Homogenizer in an acid buffer. To detect Fe2+ levels, an iron probe containing Ferene S, an iron chromogen, was added to the reaction and the product was a stable coloured complex. Output (absorbance) was measured using a microplate reader at optical density 593 nm for both test samples and iron standard solutions. Alternatively, total iron levels were determined by addition of a reducing agent prior to detection, and Fe3+ levels were calculated by subtracting Fe2+ amounts from total iron. Concentrations were plotted as a function of the standard curve, and final content was normalized relative to starting tissue amounts, expressed as µg iron/µg tissue.

2.7 Antibodies

Primary antibodies used include goat polyclonal anti-human ACTB (#sc-1616, 1:2000, Santa Cruz Biotechnology), goat polyclonal anti-human Ceruloplasmin (#ab8749-500, 1;500, Abcam

Inc, Cambridge, MA, USA), rabbit polyclonal anti-human Cullin 2 (#RB-046-P1, 1:500,

NeoMarkers, Fremont, CA, USA), rabbit polyclonal anti-human JMJD6 (#ab64575, 1:500,

Abcam Inc., Cambridge, MA, USA), rabbit polyclonal anti-human H3R2me2s (#ab194684,

1:1000, Abcam Inc), rabbit polyclonal anti-human H4R3me2s (#ab5823, 1:1000, Abcam Inc.), rabbit polyclonal anti-human Total Histone H4 (#ab10158, 1:1000, Abcam Inc.), goat polyclonal anti-human Total Histone H3 (#sc-8654, 1:500, Santa Cruz Biotechnology, Santa Cruz,

CA,USA), rabbit polyclonal anti-human VHL (#NB100-485, 1:500, Novus Biologicals,

Littleton, Colorado, USA), mouse monoclonal anti-human VHL (#sc-17780, 1:500, Santa Cruz

Biotechnology), mouse monoclonal anti-human HIF1A (#MA1-516, 1:200 and 1:500, Thermo

Scientific, Rockford, IL, USA), rabbit polyclonal anti-human E2F4 (#sc-866, 1:2000, Santa Cruz

Biotechnology), mouse monoclonal anti-human SUMO1 (#sc-5308, 1:500, Santa Cruz

Biotechnology) and mouse monoclonal anti-human polyubiquitinylated conjugates (#BML-

PW8805-0500, 1:200, Enzo Life Sciences, Farmingdale, NY, USA).

Secondary antibodies were HRP-conjugated and were all obtained from Santa Cruz

Biotechnology. They include rabbit anti-mouse HRP (1:2000), goat anti-rabbit HRP (1:2000) and donkey anti-goat HRP (1:2000). For detection of JMJD6 following immunoprecipitation,

HRP-conjugated Light Chain IgG–specific, anti-rabbit secondary antibody (# 211-032-171,

Jackson ImmunoResearch Laboratories, West Grove, PA, USA) was used at a dilution of 1:5000.

In addition to manufacturers’ validation of antibodies in an application-specific manner, primary antibodies were further validated using a combination of synthetic blocking peptide analyses and siRNA knockdown.

2.8 Western Blotting

Total protein was extracted from cells or placental tissue using RIPA+ buffer, yielding whole cell lysates. In the case of tissue, small frozen placental chunks were crushed and finely ground to a powder in liquid nitrogen using a mortar and pestle. The powder was suspended in 1mL of

RIPA+ buffer and homogenized (Ultra-Turrax T25 basic, IKA, Wilmington, NC, USA) for three rounds of 30 second bursts each. In case of cells, 50-100 µL of RIPA+ buffer were added to 6- well plates and incubated for 1 h on ice. Cells were subsequently collected using a cell scraper.

Both cell and tissue suspensions was centrifuged at 14000 g for 10 minutes at 4ºC, and the supernatant was collected and stored at -80ºC until further use.

Upon quantification of protein using a colorimetric Bradford protein assay, 20-50µg lysates were prepared in RIPA+ buffer and 4X sample buffer (RIPA to maintain equal volume between samples and reducing and denaturing 4X sodium dodecyl sulfate (SDS) sample buffer (250 mM

Tris-HCl (pH 6.8), 40% (v/v) glycerol, 8% (w/v) SDS, 0.2% (w/v) bromophenol blue and 20%

(v/v) -mercaptoethanol). Samples were mixed, heated at 95°C for 5 min and resolved by 10%,

12% or 15% SDS-PAGE gels in running buffer (25 mM Tris base, 192 mM glycine and 0.1%

SDS). Upon obtaining the desired amount of separation, gels were transferred onto methanol- activated PVDF membranes in transfer buffer (25 mM Tris base, 192 mM glycine and 20% methanol). Equal transfer was confirmed by staining of membranes with Ponceau S solution

(0.1% (w/v)) and direct visualization of bands. To reduce non-specific binding, membranes were incubated in either 5% (wt/vol) nonfat dry milk in Tris-buffered saline containing 0.1% (vol/vol)

Tween-20 (TBST) or, 5% (wt/vol) bovine serum albumin (BSA), for 60 min. The membranes were then incubated overnight in the appropriate primary antibody diluted with blocking buffer, with gentle shaking at 4ºC. The following day, membranes were incubated with the corresponding HRP (horseradish peroxidase)-conjugated secondary antibody diluted in blocking buffer, for 1 h at room temperature. Images were acquired via membrane visualization by chemiluminescence (Western LightningTM Chemiluminescence Reagent Plus, Perkin Elmer,

Shelton CT, USA) exposure to film (GE Heatlhcare Amersham Hyperfilm). Western blot films were scanned using CanoScanLiDE20 image scanner (Canon Canada Inc. Mississauga, ON) and analyzed for densitometry using Image Quant software 5.0 (Molecular Dynamics).

2.9 Immunoprecipitation

Immunoprecipation experiments were employed to study protein-protein associations in whole cell lysates obtained from JEG3 cells. Two hundred to four hundred µg of total protein were suspended in RIPA+ buffer for initial pre-clearing of lysates with 20 µL protein A or G agarose beads (Santa Cruz, CA, USA) for 1 h at 4ºC. The supernatant was incubated with primary antibody at a concentration of 2 µg per 100-500 µg total protein, and agitated overnight at 4ºC.

The following day, samples were incubated with 30 µL protein A or G bead slurry and agitated for 2 h at 4ºC. The samples were pelleted, resuspended and washed three times in RIPA+ buffer, followed by two washes in PBS. 50 µL of 2 X SDS sample buffer [100 mM Tris-HCl (pH 6.8),

4% (w/v) SDS, 0.25% (w/v) bromophenol blue, 20% (v/v) glycerol, 200 mM -mercaptoethanol]

62 was used to elute the beads, and the mixture was heated at 95 ºC for 5 minutes. The samples were then resolved by SDS-PAGE and probed with the appropriate antibodies.

2.10 Immunohistochemistry and Immunofluorescence

Immunohistochemical staining was performed on placental tissue (approximately 7µm thick) sections embedded in paraffin. Every 20th section of tissue that was cut was stained with hematoxylin and eosin (H&E) to assess tissue morphology and section quality. Slides were heated at 65ºC for 10 min, deparaffinized and rehydrated using an ethanol and xylene series gradient. This included a series of three immersions in 100% xylene, followed by a gradient of alcohol solutions (3x2 min immersions in 100% ethanol, and subsequent single immersions in

95%, 90%, 85%, 80%, 75%, 70%, and 50% ethanol), and finally, two three min washes in PBS.

Antigen retrieval was performed in 10mM sodium citrate buffer (pH 6.0) (total volume 250µL) by heating in an 800-watt microwave for 5 min on power 6, cooling for 20 minutes, heating for 3 min at power 6 and a final cooling cycle of 15 minutes. Endogenous peroxidase activity was inhibited by incubating slides with 3% (vol/vol) hydrogen peroxide in methanol for 30 min.

Sections were subsequently blocked in a solution comprising normal horse serum at 5% (v/v) and 1% BSA in PBS, for 1 h at room temperature in a humidified chamber. Primary antibody, diluted in blocking solution at the appropriate concentration, was added to slides and the apparatus was incubated overnight at 4ºC. The following day, slides were first incubated with biotinylated secondary antibody in blocking solution (1:200) for 2 h at room temperature, and subsequently, with an avidin-biotin complex (consisting of a free avidin solution pre-incubated with biotinylated HRP enzyme) solution for 1 h. Slides were then treated with 0.075% (wt/vol)

3,3-diaminobenzidine tetraaminobiphenyl (DAB) in PBS (pH 7.6) containing 0.002% (vol/vol)

H2O2, and incubated at room temperature until detection of suitable brownish staining. The DAB solution was then drained and slides were washed in tap water to terminate the reaction. Sections were counter-stained in solutions of hematoxylin (30 seconds) and acid ethanol (70% EtOH with

250 µL HCl; 1 second), followed by dehydration in the ascending ethanol – xylene gradient.

Lastly, coverslips were mounted onto slides using mounting medium (Shandon Immu-mountTM,

Thermo Scientific, Waltham, MA, USA).

For immunofluorescence staining, JEG3 cells, seeded onto UV-sterilized glass cover slips were grown to 50-60% confluency, and fixed in 4% (v/v) paraformaldehyde in PBS for 15 min at room temperature. Cells were permeabilized using 0.1% (v/v) Triton X-100 for 5 min and blocked in 5% normal horse serum in PBS for 1 h at room temperature. Subsequently, primary antibody diluted in a 1:1 ratio of antibody diluent to blocking buffer, was added to cells and incubated overnight at 4ºC. An equal concentration of normal IgG corresponding to the primary antibody constituted the negative control. The following day, Alexa Fluor® -conjugated secondary antibody (Invitrogen, Carlsbad, CA, USA) was added at a 1:300 dilution. Cells were counter-stained with 0.5 μg/mL DAPI (4’,6-diamino-2-phenylindole) solution and the coverslips were mounted onto slides using mounting medium (Shandon Immu-mountTM, Thermo Scientific,

Waltham, MA, USA). Images were captured using a DeltaVision Deconvolution microscope

(Applied Precision, LLC, Issaquah, WA, USA).

2.11 siRNA Transfections

JEG3 cells were grown to 50-60% confluency in EMEM containing 10% (v/v) FBS in 6-well plates. JMJD6 Silencer® siRNA duplexes (3 in total; data from the two duplexes yielding >50% knockdown is shown), HIF1A Silencer® siRNA and Silencer® Negative Control siRNA targeting scrambled siRNA sequences were obtained from Ambion Inc., Austin, TX, USA. The transfection protocol was as follows: per reaction, 30 nM JMJD6 or HIF1A siRNA was diluted in 200 μL jetPRIME® buffer (Polyplus transfection™, Illkirch, France), vortex-mixed for 10 seconds and centrifuged. Following this, 4 μL of jetPRIME reagent were added to this mixture, vortex-mixed for 10 seconds, spun down and incubated at room temperature for 10 min. The

64 transfection mix was added to the cells in serum containing medium and incubated for 24-48 h.

Media was replaced 24 h following transfection.

HEK293 cells were employed for siRNA transfections of E2F4 and E2F4/5 siRNA duplexes.

Briefly, cells were cultured to 50-60% confluency in 6-well plates and 30 nM of E2F4 and

E2F4/5 Silencer® siRNA duplexes and control Silencer® Negative Control siRNA (Ambion

Inc., Austin, TX, USA) were transfected using jetPRIME® buffer (Polyplus transfection™,

Illkirch, France). Cells were harvested for RNA and protein isolations after 24 h.

2.12 Plasmid Constructs and Transfections

The JMJD6 WT plasmid (p6352 MSCV-CMV-Flag-HA-JMJD6) was obtained from Addgene,

Cambridge, MA, USA (Plasmid 31358, [213]) in DH5α E.coli. Bacteria were grown overnight in

Luria’s broth (LB) containing ampicillin and colonies were isolated and inoculated in LB and grown overnight. Plasmid DNA was purified using a PureLink® HiPure Plasmid Filter Maxiprep kit according to manufacturer’s instructions (InvitrogenTM, Life Sciences Inc., Burlington, ON).

MSCV PIG (Puro IRES GFP) (Plasmid 18751, Addgene) empty vector backbone was used as a control. Mutant JMJD6 (Mut JMJD6) plasmids were generated using site-directed mutagenesis against JMJD6 WT plasmids whereby histidine 187 was mutated to alanine (H187A) in combination with aspartic acid mutated to alanine (D189A). Mutations were confirmed by sequencing (CMV forward 5’ sequencing primer: CGCAAATGGGCGGTAGGCGTG; MSCV reverse 3’ sequencing primer: CAGCGGGGCTGCTAAAGCGCATGC). Mutant VHL (Mut

VHL) plasmids were generated using site-directed mutagenesis against VHL WT plasmids whereby one of lysines 159, 171, 196, or all three were mutated to arginines. Empty Vector control (EV) for JMJD6 consisted of a MSCV PIG (Puro IRES GFP) plasmid on an empty vector backbone (Plasmid 18751, Addgene), while EV for VHL was a FLAG pcDNA3 (Plasmid #

20011, Addgene). For transfections, JEG3 cells were grown to 60-80% confluency in 6-well

65 plates in EMEM containing 10% (v/v) FBS. One µg plasmid DNA (either Empty Vector, WT

JMJD6, Mut JMJD6, WT VHL or Mut VHL) was added to 200 μL jetPRIME® buffer, vortex- mixed for 10 sec and centrifuged. Subsequently, 4 μL of jetPRIME reagent were added to this mixture, vortex-mixed for 10 sec, centrifuged and incubated at room temperature for 10 min.

The transfection mix was added to the cells in serum-containing medium and incubated for 24-48 h. Media was replaced 6 h following transfection. Cells were harvested for protein and RNA analyses.

2.13 RNA Isolation and Quantitative PCR

Total RNA was extracted from JEG3 cells, primary isolated trophoblast cells, or frozen placental tissue using TRIzol reagent (InvitrogenTM). Samples (1mg tissue or 300,000 cells) were incubated in 1mL TRIzol reagent on ice. In the case of tissue, samples were homogenized in

TRIzol. To this suspension, 200 µL of chloroform were added, shaken vigorously for 15 seconds and incubated on ice for 5 min. Samples were centrifuged at 8900 g for 15 min at 4ºC, following which the supernatant was collected and added to 500 µL of isopropanol. The mixture was incubated at -20ºC for 1 h and centrifuged again at 8900 g for 15 min at 4ºC. The resultant pellet was resuspended in 500 µL of ice cold 70% ethanol in DEPC (Diethyl pyrocarbonate) - treated dH2O, vortexed and centrifuged at 3150 g for 10 min at 4ºC. The pellet were air-dried at room temperature and resuspended in 50 µL of DEPC dH2O. Samples were treated with DNase I to eliminate genomic DNA contamination. One µg of total RNA was reverse transcribed using qScript cDNA SuperMix (Quanta Biosciences, Beverly, MA, USA), containing a blend of Oligo

(dT) and random primers, according to manufacturer’s instructions. Subsequently, cDNA was amplified using a probe against human JMJD6 (TaqMan® Assays-on-DemandTM from Applied

Biosystems (ABI), Foster City, CA, USA) in the presence of TaqMan® Universal PCR Master

Mix (ABI) for quantitative PCR, using the DNA Engine Opticon® 2 System (MJ Research,

Waltham, MA). Data were normalized to 18S ribosomal RNA (TaqMan® Assays-on-Demand™,

ABI) and analyzed according to the CT method as described by Livak and Schmittgen (2001)

[214]. Primers employed in chromatin immunoprecipitation and VHL DNA methylation studies

are listed in Table 2.2.

Table 2.2 – Oligonucleotide sequence for primers employed in qPCR analysis

ChIP H3R2me2s, H4R3me2s VHL DNA Methylation Studies

VHL Promoter (Region a): VHL Primary qPCR Reaction 5’- CGCGTCTGACATGAAGAAAA-3’ 5’- AAACTGCAGGAATTTAGTTAGTTGATTTTTTG-3’ 5’- CTCAGCCTCCCGAGTAGTTG-3’ 5’- GCTCTAGACCTCAAAAAACCTCAATTCCC-3’,

VHL Minimal Promoter excluding VHL Secondary qPCR Reaction: Island I Transcription Start Site (Region b): 5’- AAACTGCAGGAATTTAGTTAGTTGATTTTTTG-3’ 5’- TACAGTAACGAGTTGGCCTAGC-3’ 5’- GCTCTAGACTTAACTCACTACAACCTTAACC-3’ 5’- CGAGTCGACCTCCGTAGTCTT-3’

VHL Minimal Promoter containing VHL Secondary qPCR Reaction: Island II Transcription Start Site (Region c): 5’-AAACTGCAGGGTTAAGGTTGTAGTGAGTTAAG-3’ 5’-GAGCGCGTTCCATCCTCTAC-3’ 5’- GCTCTAGACCTCAAAAAACCTCAATTCCC-3’ 5’-CTTCTTCAGGGCCGTACTCTT-3’ VHL Exon 1: 5’-CCCAGGTCATCTTCTGCAAT-3’ 5’-GCTTCAGACCGTGCTATCGT-3’ GAPDH Promoter 5’-ACGTAGCTCAGGCCTCAAGA-3’ 5’-GCGGGCTCAATTTATAGAAAC-3’

2.14 Histone Isolations and ‘In vitro Demethylation’ Reactions

Total histones were isolated from primary trophoblasts or PE, PTC and TC placentae using the

EpiQuick Total Histone Extraction Kit (OP-0006, Epigentek, Farmingdale, NY, USA),

according to manufacturer’s instructions. Briefly, cells or tissue were incubated in pre-lysis

buffer and lysed on ice for 10 min, followed by centrifuging at 5600 g for 1 minute. The

supernatant was discarded; the pellet was suspended in three volumes of lysis buffer and

incubated on ice for 30 min. Samples were centrifuged at 8064 g for 5 min at 4°C, the

67 supernatant was harvested, to which 0.3 volumes of balance-DTT buffer was immediately added.

The resultant mixture was quantified using a Bradford protein assay.

For enzyme studies, 20 µg of bulk histones (Sigma, St. Louis, MO, USA) or, alternatively, 20µg of histones extracted from primary trophoblasts and from normal and pathological placental tissue were incubated with 25-100 ng of purified human recombinant JMJD6 enzyme (BPS

Bioscience, San Diego, CA, USA) as optimized for each model. Reactions were carried out in a final volume of 100 µL of demethylation buffer (50 mM Tris pH 7.9, 50 mM KCl, 10 mM

2+ MgCl2, 2 mM ascorbate, 1 mM α-KG, 50 µM Fe in dH2O), and exposed to 3%, 8% or 21% O2 for 2 h at 37ºC. The histone demethylase reaction was subsequently stopped by addition of 4 ×

SDS loading buffer [0.25 M Tris-HCl (pH 6.8), 0.5 M DTT, 10% SDS, 0.25% bromophenol blue, 50% glycerol, 10% -mercaptoethanol] and incubated at 95°C for 5 min. Samples were subsequently resolved by SDS-PAGE.

JMJD6 histone demethylase activity was determined using a ‘Histone Demethylase Fluorescence

Activity’ kit (Catalog Number K010-F1, Arbor Assays, Michigan, USA), according to manufacturer’s instructions. Briefly, ‘in vitro demethylation’ reactions were carried out with 20

µg histone substrates (either total bulk histones or histones isolated from PTC and E-PE placentae) in the presence and absence of recombinant JMJD6 enzyme (25ng-200ng) in demethylation buffer for 2 h at 37ºC. Alternatively, the reaction was supplemented with 30µM

Fe2+ or 100 µM of the iron chelator, desferroxamine (DFO). The reaction was stopped and a formaldehyde detection reagent was added to samples and standards for 30 min at 37ºC. The fluorescent product was detected using a Tecan Infinite M200 microplate reader (Tecan Trading

AG, Switzerland) at 510 nm with excitation at 450 nm. Demethylase activity in nmol/min/ml was determined using the linear trend for the standard curve.

2.15 Chromatin Immunoprecipitation

Native Chromatin Immunoprecipitation (N-ChIP) of H3R2me2s and H4R3me2s in JEG3 cells and E-PE, PTC tissue was performed using the AbCam High-Sensitivity ChIP Kit (ab185913), according to manufacturer’s instructions. 1x106 JEG3 cells or 10mg placental tissue were lysed, and chromatin was extracted. This procedure did not involve cross-linking since histones are naturally tightly bound to DNA. Following isolation, chromatin was sheared using a probe-based sonication method and conditions optimized for each cell type. Following isolation of DNA for gel analysis, only the sonication condition that yielded sheared DNA of 100-700 bp with a peak size of 300 bp was chosen for subsequent steps. Having determined the appropriate amount of chromatin to use, the samples were incubated with ChIP-grade antibodies (2µg antibody per 25

µg chromatin) targeted against H4R3me2s and H3R2me2s, at 4ºC overnight. Non-immune IgG was used as negative control, while RNA Polymerase II enrichment at the GAPDH promoter was the positive control. Following immunoprecipitation, protein-DNA complexes were purified and

DNA was extracted. The purified DNA was quantified by qPCR analysis using the Sybr Green® method, employing primers targeting various regions of the VHL gene promoter. These primers were designed to have a Tm (melting temperature) of 58-60°C and a GC content of 30-80%.

Primer sequences employed in ChIP are listed in Table 2.2.

2.16 Bisulfite Treatment, cloning and sequencing

One µg of genomic DNA was digested with EcoRI (Fermentas, Waltham, MA, USA) and denatured in 0.3 M NaOH for 15 min at 37ºC. Deamination was carried out with sodium metabisulfite (pH 5.0) and hydroquinone (final concentration of 2.0 M and 0.5 mM, respectively), for 16 h at 50ºC in the dark. DNA was purified using the QIAquick PCR

Purification kit (Qiagen, Hilden, Germany) and desulfonated with NaOH (0.3M, final) for 15 min at 37º C. The solution was neutralized by adding NH4OAc (pH 7.0) to a final concentration

69 of 3M, and the DNA was precipitated with ethanol, and resuspended in distilled H2O. DNA was amplified by nested PCR. For primer design, the criteria were as follows: annealing with bisulfite-treated DNA without covering any CpG, a similar temperature (55ºC) and a primer length of 20 bp. The electrophoresed PCR fragments were gel purified using QIAEX II Gel

Extraction kit (Qiagen, Hilden, Germany) and ligated into pGEM vector (Invitrogen), cloned into

DH5 bacteria (Invitrogen) and ten clones of each sample were sequenced. Sequences were analyzed using the BiQ Analyzer software.

2.17 Statistical Analyses

All statistical analyses were performed using GraphPad Prism 7.0 software (San Diego, CA,

USA). While comparing two groups, an unpaired Student’s t-test was used. While comparing three or more groups testing a single variable, a One-Way ANOVA followed by a Tukey post- test was employed. While comparing three or more groups testing two independent variables, a

Two-Way ANOVA followed by a Bonferroni post-test was employed Statistical significance was set at *p<0.05, **p<0.001 and ***p<0.0001. All data are expressed as mean ± SEM

(standard error of the mean) and n values for each experiment are indicated in figure legends.

3 - JMJD6-mediated histone demethylation contributes to epigenetic regulation of VHL in the human placenta

Rationale

Inactivation of the von Hippel Lindau gene, resulting from both genetic and epigenetic dysregulation, drives the pathogenesis of malignant cancer syndromes. However, much of the work on VHL gene regulation has focused on its alterations in renal cell carcinoma (including

SNPs, deletions/insertions and mutations) and to date, the epigenetic mechanisms controlling

VHL remain elusive. Importantly, alterations in the VHL gene that do not affect its protein stability can still have deleterious consequences for cellular oxygen sensing and cancer progression. Previous work from our laboratory demonstrated that VHL is downregulated in placentae from early-onset preeclamptic pregnancies typified by chronic hypoxia and disrupted oxygen sensing. While efforts have been made to address the importance of VHL protein in regulating HIF1A in the placenta, no studies have systematically examined the genetic regulation of VHL. Given the critical dependence of JMJD6 on oxygen in executing its histone demethylase activity, the first objective of this thesis was to investigate the epigenetic regulation of the VHL gene by JMJD6 in the placenta in physiological and pathological conditions.

Objective

The objectives of this chapter are two-fold: 1. Establish the role of oxygen in regulating JMJD6 histone demethylation in placental trophoblast cells, and 2. Investigate the contribution of the

JMJD6 in regulating VHL gene in the human placenta in physiological and pathological conditions.

Dual epigenetic regulation of VHL occurs via JMJD6-dependent histone demethylation and E2F4-mediated repression - Implications for the pathogenesis of preeclampsia

3.1 Introduction

Widely recognized for its roles in the cellular oxygen sensing pathway [29] and the inheritance of a rare cancer syndrome [33], the multi-faceted von Hippel Lindau tumour suppressor protein

(VHL) is also critically required for normal placental development. Evidence for this comes from

Vhl-/- mouse that exhibits embryonic lethality primarily due to abnormal placental vasculogenesis, resulting in hemorrhage and necrotic cell death [65].

Canonically, in response to O2-dependent proline hydroxylation of hypoxia-inducible factor 1 alpha (HIF1A), VHL forms a multiprotein ubiquitin ligase complex with Cullin 2 and Elongins

B and C, targeting HIF1A for polyubiquitination and proteasomal degradation [29]. Thus, by virtue of fine-tuning the HIF1-dependent transcriptional response, VHL is a critical regulator of the global hypoxic gene expression program. In the human placenta, VHL protein is abundantly expressed and exhibits a unique developmental profile. In the first trimester of human gestation,

VHL mRNA and protein abundance inversely correlate with that of HIF1A, while formation of the VHL-Cullin-Elongin (VHLCBC) complex peaks at a time when HIF1A degradation is maximal [154]. In this way, VHL and its accessory proteins regulate HIF1A levels with physiological changes in oxygen tension occurring in the developing placenta.

Despite the wealth of knowledge on the multitasking functions of VHL [72, 74, 75], very little is known about its upstream regulators. At the level of the gene, much of the work has focussed on

VHL genetic and epigenetic inactivation in renal cell carcinoma (RCC), a highly prevalent type of kidney cancer. Particularly, studies have reported both somatic mutations (including SNPs, frameshift deletions/insertions, missense and nonsense mutations) and hypermethylation of CpG

72 islands in VHL in a subtype of RCC tumours affecting renal clear cells (ccRCC) [51, 215].

Recently, I have identified a novel oxygen sensor, Jumonji C (JmjC) domain containing protein 6

(JMJD6) as a positive regulator of VHL stability in the human placenta [216]. JMJD6 belongs to an evolutionarily conserved family of JmjC domain containing proteins that function as protein hydroxylases and histone demethylases, requiring molecular oxygen (O2), α-KG and ferrous iron

(Fe2+) to execute their enzymatic functions. The biochemical reaction proceeds via hydroxylation of the substrate methyl group, yielding formaldehyde, succinate and carbon dioxide in addition to the demethylated substrate [82].

Originally identified as a modulator of chromatin remodelling [108], the JmjC domain is the primary site of substrate-binding and execution of catalytic activity. While the majority of JmjC domain containing proteins including JHDM1A, JMJD1A-C, JMJD2A-C, JARID1A, catalyze histone lysine demethylation (leading to either gene activation or repression), a unique attribute of JMJD6 is its ability to preferentially demethylate histone arginine marks [128], with no evidence of histone lysine demethylase activity in vitro or in vivo [129]. Specifically, JMJD6 demethylates dimethylated histone 3 at arginine 2 (H3R2me2s) as well as dimethylated histone 4 at arginine 3 (H4R3me2s) [128]. Purified WT JMJD6 enzyme demethylated both dimethylated and monomethylated histone 4 at arginine 3, but no other histone arginine or lysine mark [217].

In agreement with this, the enzymatically inactive JMJD6 mutant enzyme did not demonstrate any demethylase activity, suggesting that histone arginine demethylation remains central to

JMJD6 enzyme function.

In spite of the recent advances in elucidating JMJD6 function and its demethylase activity, little is known about its precise epigenetic targets or its impact on the histone code. I have recently described JMJD6 expression and function in the human placenta and shown that it is significantly upregulated in preeclampsia [216], a placental pathology characterized by maternal hypertension, proteinuria and end-organ damage [171]. At the molecular level, preeclampsia is

73 defined by chronic hypoxia/oxidative stress and disrupted HIF1A signalling [181]. It remains to be seen if JMJD6 is functional as a histone demethylase and if so, whether VHL is an epigenetic target of JMJD6 in the human placenta in physiological and pathological conditions.

Hence, to address my first objective, I examined JMJD6 histone demethylation in primary isolated placental trophoblast cells and in cells derived from preeclamptic placentae. Following that, I investigated the impact of JMJD6–dependent histone arginine demethylation on VHL transcription.

In the present study, I demonstrate for the first time that VHL gene expression is controlled by

JMJD6-mediated histone demethylation in the human placenta, and that this regulation is disrupted in preeclampsia due to a hypoxia-iron imbalance. My findings also reveal that methylation of VHL DNA is markedly altered in preeclamptic placentae, with consequences for its transcriptional repression. I propose that in concert, both methylation and demethylation epigenetic events contribute to decreased VHL levels that, in turn, impact on altered HIF1A homeostasis observed in preeclampsia.

3.2 Results

3.2.1 VHL protein and gene expression are altered in early-onset preeclampsia

Preeclampsia is a spectrum disorder and is further defined as early-onset (E-PE) and late-onset

(L-PE) on the basis of etiology, clinical features and feto-maternal outcomes [171, 218].

Examination of VHL mRNA by qPCR revealed a significant decrease in VHL expression in E-PE placentae relative to preterm age-matched controls (PTC), with no changes between L-PE and term control (TC) placentae (Figure 3.1A left panel). Accordingly, pVHL was also significantly reduced in E-PE placentae (Figure 3.1A middle and right panels).

In line with reduced pVHL levels in E-PE, HIF1A protein levels in E-PE were significantly elevated, while its cognate partner, HIF1B was unchanged (Figure 3.1B). Immunohistochemical analysis of placental sections obtained from E-PE and PTC placentae corroborated the loss of pVHL expression in E-PE, concomitant with elevated HIF1A levels, particularly within the trophoblast cell layers (Figure 3.1C).

In executing its function as an E3 ubiquitin ligase, pVHL binds to the Cullin 2 (CUL2) protein, in addition to Elongin B and Elongin C, thereby forming a protein complex that initiates HIF1A proteasomal degradation in normoxic conditions. Immunoprecipitation of VHL and CUL2 in E-

PE and PTC placentae revealed disrupted association between VHL-CUL2 in E-PE placentae

(Figure 3.1D top panel). To control for the inherent reduction in pVHL in E-PE, we immunoprecipitated a significantly higher amount of total protein in E-PE in comparison to PTC

(i.e. 1 mg versus 500 µg, respectively) and still found a marked disruption in VHL-CUL2 association (Figure 3.1D bottom panel). Of note, there were no differences in pVHL-CUL2 binding in L-PE placentae. Corroborating these findings, immunoprecipitation of HIF1A followed by Western blotting for ubiquitin revealed a marked reduction in HIF1A ubiquitination in E-PE, in comparison to PTC placentae (Figure 3.1E).

3.2.2 The Jumonji C domain of JMJD6 regulates VHL gene in an oxygen-dependent manner

VHL function as a classical mediator of the cellular hypoxic response is well established, but little is known about the role of oxygen in regulating VHL. qPCR analysis demonstrated significant downregulation of VHL mRNA (corrected for 18S control) in JEG3 cells exposed to low (3% O2) oxygen (Figure 3.2A left panel). Given the role of JMJD6 as an oxygen-dependent histone arginine demethylase that can influence gene transcription, I examined whether JMJD6 regulated VHL gene, and if so, whether this was dependent on oxygen. qPCR analysis of JEG3

75 cells exposed to 3% or 21% O2 and transfected with either WT JMJD6 construct or pMSCV empty vector control revealed that in ambient air, VHL mRNA levels were significantly upregulated upon JMJD6 overexpression, in 21% O2, but remained unchanged upon overexpression at 3% O2 (Figure 3.2A right panel). Similarly, in primary isolated trophoblast cells, VHL mRNA was significantly lower in 3% O2, in comparison to 8% O2 normoxic controls

(Figure 3.2B).

The Jumonji C catalytic domain of JMJD6 is essential for executing its function as a histone demethylase [82]. However, studies have neglected to address the requirement of this domain in mediating JMJD6 histone arginine demethylase activity as a function of oxygen. Hence, I generated plasmid constructs of JMJD6 carrying two point mutations in the JmjC domain (i.e.

Histidine 187 to Alanine (H187A) and Aspartic acid 189 to Alanine (D189A): Mutant JMJD6), which have previously been reported to abolish its iron-binding capacity, and hence, its demethylase function (Figure 3.2C top panel). Upon transfection of WT JMJD6 in JEG3 cells exposed to 21% O2, I observed a significant increase in VHL mRNA relative to empty vector control (Figure 3.2C bottom panel). Importantly, transfection with Mut JMJD6 failed to upregulate VHL mRNA and significantly reversed the WT JMJD6 stimulatory effect on VHL mRNA (Figure 3.2C bottom panel). Western blotting for VHL revealed a similar trend, whereby overexpression of WT JMJD6 significantly induced VHL protein in 21% O2, while overexpression of Mut JMJD6 abrogated this effect (Figure 3.2D). In 21% O2, overexpression of

WT JMJD6 in JEG3 cells decreased H4R3me2s levels, suggesting demethylation, while overexpression of the mutant failed to do so (Figure 3.2D). Parallel experiments conducted at

3% O2 showed no effect on VHL and H4R3me2s protein upon either WT JMJD6 or Mut JMJD6 overexpression.

Figure 3.1 - Elevated HIF1A in E-PE can be attributed to impaired VHL expression and function

Figure 3.1 - Elevated HIF1A in E-PE can be attributed to impaired VHL expression and function. (A) qPCR for VHL mRNA in early-onset preeclamptic (E-PE), age-matched normotensive preterm control (PTC), late-onset preeclamptic (L-PE) and age-matched normotensive term control (TC) placentae (left panel). Unpaired Student’s t-test; *p<0.05, E-PE vs. PTC, n=22 (PTC), n=23 (E-PE), n=13 (L-PE) and n=22 (TC). Representative Western blot of VHL plus associated densitometry in E-PE and PTC placentae (middle and right panels). Unpaired Student’s t-test; *p<0.05, E-PE vs. PTC, n=10-12 per group. (B) Representative Western blot of HIF1A and HIF1B in E-PE and PTC placentae plus associated densitometry. Unpaired Student’s t-test; *p<0.05, E-PE vs. PTC, n=22 (PTC) and n=23 (E-PE). (C) Representative immunohistographs of VHL and HIF1A in PTC and E-PE placentae (n=6). Arrow indicates the syncytiotrophoblast (ST) layer. (D) Representative Western blots of VHL and Cullin 2 following immunoprecipitation of Cullin 2 and VHL, respectively, in E-PE and PTC placentae (n=8). Western blots of Cullin 2 and VHL following immunoprecipitation of VHL using either 500mg or 1mg E-PE or PTC lysate (bottom panel). (E) Representative Western blot of Ubiquitin following immunoprecipitation of HIF1A in E-PE and PTC placentae. Data are presented as mean ± SEM.

Figure 3.2- The Jumonji C domain of JMJD6 is responsible for regulating VHL gene in normoxic conditions

Figure 3.2 - The Jumonji C domain of JMJD6 is responsible for regulating VHL gene in normoxic conditions. (A-left panel) qPCR for VHL in JEG3 cells exposed to either 3% or 21% oxygen for 24 h. Unpaired Student’s T-test; *p<0.05, 21% EV vs. 21% OE; **p<0.01, 21% EV vs. 3% EV), n=3. (A – right panel) qPCR for VHL in JEG3 cells overexpressing WT JMJD6 and exposed to either 3% or 21% oxygen for 24 h. Two-way ANOVA and Bonferroni post-test revealed an interaction between oxygen and JMJD6 overexpression (*p=0.0226) whereby JMJD6 overexpression increased VHL mRNA at 21% O2 (*p=0.0180), n=4. (B) qPCR for VHL in primary isolated trophoblast cells exposed to 3% and 8% oxygen for 24 h. Unpaired Student’s t-test; **p<0.01, n=4. (C-top) Schematic representation of WT and Mutant JMJD6 constructs indicating sites of mutations (i.e. H187A and D189A). (C-bottom) qPCR for VHL mRNA in JEG3 cells transfected with either WT (OE WT JMJD6) or Mutant JMJD6 (OE Mut JMJD6) in 21% oxygen relative to empty vector (EV) control. One-way ANOVA and Tukey post-hoc test; *p<0.05, ***p<0.001, n=3. (D) Representative Western blots of JMJD6, VHL and H4R3me2s in JEG3 cells overexpressing either WT or Mut JMJD6 in 3% or 21% oxygen (left), and associated densitometry (21% oxygen). Data are presented as mean ± SEM.

3.2.3 JMJD6 demethylates H3R2me2s and H4R3me2s in the human placenta in an oxygen-dependent manner

The critical dependence of JMJD6 on oxygen in executing its histone demethylase function has not been established. Surprisingly, JMJD proteins’ affinity for oxygen has not been fully investigated, and there is no information on the impact of changing oxygen tension on the enzyme function of JMJD6. Hence, in the current study, I initially exposed bulk histones to the dynamic range of oxygen values (3%, 8% or 21% O2) in the presence of various doses of recombinant JMJD6 enzyme (25 ng, 50 ng, 100 ng and 200 ng). Our data revealed that 100 ng of

JMJD6 enzyme decreased the expression of both histone targets in 21% O2, indicating effective demethylation in the presence of excess oxygen (Figure 3.3A). JMJD6 showed a gradient preference for demethylation of the H4R3me2s mark in both 8% and 21% O2, while no changes were observed for the H3R2me2 mark in 8% O2 (Figure 3.3A). To quantify JMJD6 demethylase activity as a function of oxygen, I performed a histone demethylase fluorescent activity assay, employing the principle of formaldehyde detection during the demethylation reaction (schematic of reaction mechanism is depicted in Figure 3.3B top panel). Following incubation of bulk histones with recombinant JMJD6 enzyme in 3, 8 and 21% O2, JMJD6 demethylase activity (nmol/min/ml) was found to be minimal at 3% O2, with an increase in activity at 8% and 21% O2. (Figure 3.3B bottom panel).

I next examined JMJD6-mediated histone demethylation in primary trophoblasts from term placentae. I isolated histones from primary trophoblasts cultured in 3% versus 8% O2 and subsequently performed Western blotting for H3R2me2s and H4R3me2s targets. Western blotting revealed a significant increase in the expression of both marks upon exposure to 3% O2 in comparison to 8% O2 (Figure 3.3C).

Figure 3.3– JMJD6 demethylates H3R2me2s and H4R3me2s histone marks in an oxygen- dependent manner in bulk histones

Figure 3.3 – JMJD6 demethylates H3R2me2s and H4R3me2s histone marks in an oxygen- dependent manner in bulk histones (A) Schematic representation of experimental strategy for in vitro demethylation of bulk histones by recombinant JMJD6 enzyme (left panel). Representative Western blots of H3R2me2s and

H4R3me2s in bulk histones upon incubation with 100 ng recombinant JMJD6 enzyme in 3%,

8% or 21% oxygen (right panel). Total levels of histones 3 and 4 (H3 and H4) are respective loading controls. Experiment was repeated twice with similar results. (B – top panel) Schematic representation of arginine demethylation reaction yielding formaldehyde as a by-product. (B – bottom panel) JMJD6 enzyme demethylase activity using bulk histones as substrates, with reaction carried out at 3%, 8% or 21% oxygen for 2 h at 37ºC. One-way ANOVA and Tukey post-test; *p<0.05, **p<0.01 n=3. (C) Representative Western blots of H3R2me2s and

H4R3me2s in histones isolated from primary CT cells exposed to 3% or 8% oxygen and associated densitometry. Unpaired Student’s t-test; *p<0.05, n=4.

3.2.4 JMJD6-mediated histone demethylation is compromised in preeclamptic placentae

Western blotting for H3R2me2s and H4R3me2s in histone extracts from E-PE and PTC placentae revealed a significant increase in the expression of both targets in E-PE relative to PTC

(Figure 3.4A). As an indirect measure of JMJD6 demethylase activity in vivo, I next performed the histone demethylase fluorescent activity assay on histone substrates isolated from PTC and

E-PE placentae. Our data revealed that relative to PTC tissue, JMJD6 demethylase activity was markedly decreased in E-PE tissue (Figure 3.4B). Alternatively, I performed an ‘in vitro demethylation’ reaction by incubating histones isolated from E-PE and PTC placentae with recombinant JMJD6 enzyme at 3% and 21% oxygen. Western blotting for the H3R2me2s and

H4R3me2s marks in histones from PTC placentae revealed a decrease in the expression of

H3R2me2s and H4R3me2s, upon addition of JMJD6 enzyme (Figure 3.4C left panel) while no differences were observed upon enzyme addition in histones from E-PE placentae (Figure 3.4C right panel), suggesting an impaired capacity for E-PE histones to respond to JMJD6-mediated demethylation in vitro. Conversely, in both PTC and E-PE, there were no differences in the expression of either histone target when the demethylation reaction was carried out in low oxygen (3% O2).

Women with PE have significantly elevated serum iron levels [218], a finding that has been linked to the oxidative stress status typical of this disease [219]. However, there is no information available on whether tissue/cellular content is altered in E-PE. In the present study, I detected significantly elevated levels of the ferroxidase enzyme, CP in both sera and placentae from E-PE pregnancies relative to PTC (Figure 3.5A). CP functions as a ferroxidase by converting ferrous iron (Fe2+) to ferric iron (Fe3+). Given that Fe2+ is a critical co-factor for

JMJD6 activity, I examined iron content in PTC and E-PE placentae using an Iron Assay Kit and found that Fe2+ content in E-PE tissue was significantly decreased in comparison to controls

(Figure 3.5B). Next, given that lack of Fe2+ in E-PE tissue likely exacerbates the impairment in

JMJD6 function in this pathology, I reasoned that supplementing the in vitro demethylation reaction with excess Fe2+ might assist in JMJD6-mediated demethylation of E-PE histones.

Hence, I incubated histones from E-PE placentae with recombinant JMJD6 enzyme in the presence and absence of varying concentrations of excess Fe2+ (data shown for 15 µM) or alternatively, in the presence of an iron chelator (100 µM DFO). The data revealed that addition of Fe2+ significantly increased JMJD6 histone demethylase activity not only in PTC, but also in

E-PE (Figure 3.5C). Furthermore, addition of DFO significantly abrograted demethylase activity, confirming the central role of Fe2+ in mediating JMJD6 function (Figure 3.5C).

Corresponding to this, Western blotting showed that both, H3R2me2s and H4R3me2s marks were demethylated upon addition of 15µM Fe2+ in PTC and E-PE histones (Figure 3.5D). This suggests that E-PE histones are in fact sensitive to Fe2+-assisted JMJD6 demethylation, but fail to respond below threshold levels of Fe2+ availability.

Figure 3.4– JMJD6-mediated histone demethylation is impaired in preeclamptic placentae.

Figure 3.4 – JMJD6-mediated histone demethylation is impaired in preeclamptic placentae.

(A) Representative Western blot of H3R2me2s and H4R3me2s (left panel) in E-PE and PTC placentae, and associated densitometry (right panel). Unpaired Student’s t-test; *p<0.05, n=9

(PTC), n=11 (E-PE). (B) JMJD6 histone demethylase activity in E-PE and PTC placentae, measured as a function of formaldehyde released during the demethylation reaction. Unpaired

Student’s t-test; *p<0.05, n=5 (PTC, E-PE). (C) Schematic representation of experimental strategy for in vitro demethylation of histones isolated from preeclamptic and control placentae by recombinant JMJD6 enzyme, performed at 3% and 21% O2 (top panel). Representative

Western blot of H3R2me2s and H4R3me2s in histones isolated from PTC (left panel) and E-PE placentae (right panel), upon incubation with 25ng recombinant JMJD6 enzyme at ambient air. n=4. Associated densitometric analysis of B. Unpaired Student’s t-test; *p<0.05, n=3 (PTC, E-

PE). Data are presented as mean ± SEM.

Figure 3.5 – Excess Fe2+ partially rescues JMJD6-mediated demethylation of its histone targets in preeclampsia.

(A) Western blot of CP in placental lysates and maternal sera obtained from E-PE and PTC pregnancies. (B) Graphical representation of total iron, Fe2+ and Fe3+ content in E-PE placental tissue denoted as fold change relative to PTC placentae. Iron content (µg) was initially normalized per µg tissue. Unpaired Student’s t-test, *p<0.05, n=5 (PTC, E-PE). (C) JMJD6 histone demethylase activity in E-PE and PTC placentae, in the presence of excess Fe2+ (15 µM) or the iron chelator, DFO (100 µM), measured as a function of formaldehyde released during the demethylation reaction. One-way ANOVAs and Tukey post-tests; *p<0.05, **p<0.01. n=5

(PTC, E-PE). (D) Representative Western blot of H3R2me2s and H4R3me2s in histones from

PTC (left panel) and E-PE placentae (right panel) upon incubation with 25 ng recombinant

JMJD6 enzyme in the presence or absence of excess Fe2+ (15 µM). Data are presented as mean

± SEM.

3.2.5 VHL gene is subject to modification by JMJD6-dependent histone arginine demethylation

Typically, histone modifications of actively transcribed or repressed genes occur at the promoter regions and have implications for transcription of associated genes [86]. Therefore, to understand the impact of JMJD6–dependent histone arginine demethylation on VHL gene transcription, I first performed chromatin immunoprecipitation (ChIP) of H4R3me2s in JEG3 cells overexpressing JMJD6, and subsequently analyzed VHL gene expression by qPCR. Using four sets of primers spanning different regions of the VHL promoter (-540 to -309 (a), -163 to -9 (b), -

63 to +53 (c) and +289 to +399 (d)), I found that overexpression of JMJD6 resulted in a >8 fold enhancement in the association between H4R3me2s and the VHL gene in comparison to empty vector controls in a region of the VHL promoter that is upstream of its minimal promoter (region a) and a 1.6 fold enhancement in a region within the minimal promoter, but excluding the transcription start site (region b) (Figure 3.6A bottom panel). I did not detect alterations in

H4R3me2s-VHL binding in the minimal promoter region encompassing the transcription start

site (region c) or within Exon 1 of the gene (region d).

Finally, I performed ChIP of H3R2me2s and H4R3me2s in E-PE and PTC placentae and subsequently examined VHL gene expression in regions a-d. Examination of H3R2me2s- and

H4R3me2s-VHL associations revealed that in PTC placentae, the H4R3me2s mark is significantly more enriched throughout regions a, b and c, while in E-PE, there was minimal enrichment of either histone mark across VHL (Figure 3.6B). In the region spanning the VHL promoter upstream of the minimal promoter, I detected a 21.27 fold down-regulation in the association between H4R3me2s-VHL and a 3.03 fold decrease in the association between

H3R2me2s-VHL in E-PE tissue relative to PTC (Figure 3.6C left panel, region a). Within the

VHL minimal promoter, H4R3me2s-VHL and H3R2me2s-VHL binding was decreased 8.93 and

6.80 fold, respectively, in E-PE relative to PTC (Figure 3.6C right panel, region b). In line with

90 our findings in JEG3 cells overexpressing JMJD6, I did not detect alterations in H4R3me2s- or

H3R2me2s-VHL binding in the regions c or d.

Figure 3.6 – VHL is subject to changes in JMJD6-mediated histone arginine demethylation.

(A – top panel) Schematic representation of the VHL gene indicating primer sets spanning various regions (a-d) of the VHL gene. (A – bottom panel) qPCR for VHL following ChIP of

H4R3me2s upon overexpression of WT JMJD6 in JEG3 cells, using primers spanning regions a- c. Fold enrichment was assessed relative to mock IgG negative controls. (B) qPCR for VHL in regions a, b and c following ChIP of H3R2me2s and H4R3me2s in E-PE and PTC placentae.

Enrichment across VHL is expressed as percent input DNA. Unpaired Student’s t-tests, *p<0.05,

**p<0.01, n=4 per group (C) qPCR for VHL in regions a (left panel) and b (right panel) following ChIP of H3R2me2s and H4R3me2s in E-PE and PTC placentae. Unpaired Student’s t- test, *p<0.05, n=4 per group. Data are presented as mean ± SEM.

3.2.6 VHL DNA methylation is altered in preeclamptic placenta

Emerging evidence suggests that histone modifications often occur in concert with DNA methylation changes, to collectively influence gene transcription [220]. Hence, we sought to examine whether VHL DNA was subject to differential methylation, and if so, whether it was altered in E-PE. Following Methprimer software analysis [221], we identified two CpG islands in the promoter and first exon of the VHL gene (Figure 3.7A). We examined the methylation status of TC, PTC and E-PE placentae employing bisulfite genomic sequencing [222]. Six to eight individual samples per group were sequenced 10 times. We examined the methylation status of two CpG rich islands (-501 to -337 base pairs; -237 to 305 base pairs) in the VHL promoter (Figure 3.7A). Several binding sites for transcription factors (BARX homeobox 2,

E2F4 and the NuRD complex containing chromatin remodelling and histone-deacetylase activities) were significantly differentially methylated (Figure 3.7B). Notably, the binding site for the E2F4 transcriptional repressor in this CpG island exhibited a significant (>40%) reduction in methylation in E-PE placentae relative to both PTC and TC placentae (Figure 3.7B).

To examine the association of E2F4 to VHL we conducted qPCR for VHL following ChIP of

E2F4 in untreated HEK293 cells. Binding of E2F4 to the VHL promoter was enhanced relative to negative control IgG (Figure 3.7C). Total histone 3 was employed as positive control. To confirm that loss of methylation at the E2F4 binding site impacted VHL gene transcription, we employed a well-known pharmacological inhibitor of DNA methylation, 5-Azacytidine (5-AZA)

[223]. ChIP of E2F4 and qPCR for VHL across the minimal promoter (-400 to +1) following exposure of HEK293 cells to 5µM 5-AZA resulted in decreased VHL-E2F4 association (Figure

3.7D). Next, we performed siRNA knockdown of E2F4 in HEK293 cells using a combination of siRNA duplexes and found a significant upregulation of VHL mRNA upon E2F4 knockdown

(Figure 3.7E left panel). Accordingly, VHL protein was also significantly increased upon E2F4 knockdown (Figure 3.7E right panel) suggesting that E2F4 functions as a negative regulator of

VHL. Finally, to establish whether the reduced methylation at the E2F4 binding site in E-PE contributed to the decreased VHL in this pathology, we performed ChIP of E2F4 and subsequently analyzed E2F4-bound VHL by qPCR. In line with the finding that E2F4 is a transcriptional repressor, our data revealed a significant increase in the association between E2F4 and VHL promoter in E-PE tissue, relative to PTC (Figure 3.7F).

Figure 3.7 – Reduced VHL in preeclampsia is in part due to altered VHL DNA methylation favoring E2F4-mediated transcriptional repression

Figure 3.7 – Reduced VHL in preeclampsia is in part due to altered VHL DNA methylation favoring E2F4-mediated transcriptional repression. (A) Graphical representation of the VHL promoter and the first exon showing GC percent and CpG islands. CpG sites are indicated by red vertical bars. (B) Percent methylation of CpG dinucleotides in the VHL promoter (Island 1) in PE, PTC and TC placentae as determined by bisulfite sequencing (n=6-8 samples per group). CpG sites in NuRD, BARX2 and E2F4 binding sites exhibiting significant changes in methylation status are indicated by arrows. Unpaired Student’s t-test; *p<0.05. (C) qPCR for the VHL promoter following ChIP of E2F4 in HEK293 cells; total histone 3 and IgG were used as positive and negative controls respectively. (D) qPCR for the VHL promoter following ChIP of E2F4 in HEK293 cells treated with and without the DNA methylation inhibitor, 5-AZA. Representative of two separate experiments. (E-left panel) qPCR for E2F4 and VHL mRNA following siRNA knockdown of E2F4 and E2F4/5 in HEK293 cells using various siRNA duplexes (D1, D2). (E-right panel) Corresponding representative Western blot of E2F4 and VHL upon E2F4 and E2F4/5 siRNA knockdown. Unpaired Student’s t-test, *p<0.05, **p<0.01, n= 4. SS=scrambled sequence. (F) qPCR for the VHL promoter following ChIP analysis of E2F4 in E-PE and PTC placentae. Unpaired Student’s t-test: *p<0.05, n=3 per group. Data are presented as mean ± SEM.

3.2.7 JMJD6 histone demethylase function and VHL expression are disrupted in a murine model of pharmacological hypoxia during pregnancy

Placental hypoxia is at the core of early-onset preeclampsia [224]. Administration of Roxadustat

(FG-4592), a α-KG analogue and small molecule inhibitor of the HIF1A hydroxylase, PHD2 in humans and mice has been shown to enhance HIF1A activity, suggesting that it can be used as a pharmacological model of molecular hypoxia [225, 226]. However, the effects of FG-4592 treatment during pregnancy, and in particular, its impact on the placenta, have not been studied.

Hence, to establish the impact of molecular hypoxia on JMJD6 regulation of VHL during pregnancy, we administered FG-4592 to pregnant mice daily with either DMSO vehicle or FG-

4592 from embryonic day 7.5 (E7.5) to embryonic day 13.5 (E13.5), a time encompassing placental development in the mouse in vivo (Figure 3.8A). Hematoxylin and eosin (H&E) staining of placental sections from these mice revealed visible disruptions in placental architecture, particularly within the labyrinthine zone in the FG-4592 mice (Figure 3.8B left panels), including its compaction and decreased branching and vascularization, as evident from staining for the endothelial cell marker, CD34 (Figure 3.8B right panels). Consistent with the induction of molecular hypoxia, indicated by increased HIF1A levels (data not shown), VHL protein and mRNA were decreased in the FG-4592 mice (Figure 3.8C). Concomitantly, E2F4 protein levels were increased upon FG-4592 treatment, accompanied by increased JMJD6 expression (Figure 3.8D), in line with our previous finding that JMJD6 is a transcriptional target of HIF1A [216].

Upon Western blotting analysis of JMJD6 histone targets, I observed significantly higher levels of H3R2me2s and H4R3me2s in histones isolated from FG-4592-treated mice (Figure 3.9A), suggesting an impairment in JMJD6-mediated demethylation. In addition, as per the aforementioned reports of hypoxic induction of the ferroxidase CP in E-PE, I detected an

98 increase in placental CP expression upon FG-4592 treatment (Figure 3.9B). Consistent with our hypothesis that the Fe2+ imbalance resulting from elevated CP impaired JMJD6 demethylation, incubation of histone extracts from DMSO and FG-4592-treated mice placentae with JMJD6 enzyme revealed that (i) JMJD6 demethylase activity is compromised upon FG-4592 treatment

(Figure 3.9C) and (ii) Addition of excess Fe2+ significantly rescues loss of JMJD6 demethylase activity in histones from FG-4592-treated mice placentae (Figure 3.9C). Importantly, Western blotting for H3R2me2s and H4R3me2s revealed that JMJD6 enzyme demethylated histone substrates from DMSO controls, but not FG-4592 mice (particularly so, for the H3R2me2s mark), and (ii) addition of excess Fe2+ facilitated JMJD6-mediated demethylation of histones in both DMSO and FG-4592 mice (Figure 3.9D).

Figure 3.8 – Placental VHL is dysregulated in a murine model of pharmacological hypoxia.

100

Figure 3.8 – Placental VHL is dysregulated in a murine model of pharmacological hypoxia. (A) Schematic representation of timeline for injection of FG-4592 during mouse gestation. (B)

Hematoxylin & eosin (H&E) (left panels) and CD34 (right panels) staining of E13.5 placentae from DMSO and FG-4592 treated mice. D=decidua, S=spongiotrophoblast, L=labyrinthine zone.

E13.5 placentae of DMSO and FG-4592 treated mice. Unpaired Student’s t-test; *p<0.05, n=4 per group. Data are presented as mean ± SEM. (D) Representative Western blots of E2F4 (top panel) and JMJD6 (bottom panel) upon FG-4592 treatment. n=4 per group.

101

Figure 3.9 – JMJD6 histone demethylase activity is disrupted in the murine placenta upon

FG-4592 treatment.

102

Figure 3.9 – JMJD6 histone demethylase activity is disrupted in the murine placenta upon

FG-4592 treatment. (A) Representative Western blots of H3R2me2s and H4R3me2s in histones from E13.5 placentae of DMSO and FG-4592 treated mice, and associated densitometry (right panel).

Unpaired Student’s t-test; *p<0.05, n=4 per group. (B) Western blot of CP in E13.5 placentae from DMSO and FG-4592 treated mice. (C) JMJD6 histone demethylase activity in E-PE and

PTC placentae, in the presence of excess Fe2+ (30 µM), measured as a function of formaldehyde released during the demethylation reaction. One-way ANOVA and Tukey post-tests; *p<0.05,

**p<0.01, n=4. (D) Representative Western blots of H3R2me2s and H4R3me2s in histones from

DMSO and FG-4592 treated mice, incubated with 50 ng recombinant JMJD6 enzyme in the presence or absence of excess Fe2+(30 µM). A minimum of five placentae from two mice per group were used. Data are presented as mean ± SEM.

103

3.2.8 Inhibition of Jumonji histone demethylation during pregnancy disrupts placental architecture

The pan Jumonji histone demethylase inhibitor, JIB-04 (5-Chloro-2-[(E)-2-[phenyl (pyridin-2-yl) methylidene] hydrazin-1-yl] pyridine) is a small-molecule inhibitor that demonstrated biological in vivo and in vitro activity [227]. While the majority of studies have addressed the significance of histone methylation in vivo, use of JIB-04 in mice showed for the first time that histone demethylation catalyzed by the Jumonji family of enzymes played an equally important role in affecting molecular and physiological outcomes [227]. Thus, to understand whether histone demethylation impacted VHL gene expression, I first exposed JEG3 choriocarcinoma cells as well as primary isolated trophoblast cells to JIB-04 and assayed for VHL mRNA. I found that exposure of JEG3 cells to 1µM JIB-04 (a concentration that has previously been shown to inhibit

Jumonji demethylase activity in vitro [227]) decreased VHL mRNA levels (Figure 3.10A).

Furthermore, to unravel the contribution of Jumonji histone demethylation to placental development, we injected pregnant mice daily with either DMSO vehicle or JIB-04 from embryonic day 7.5 (E7.5) to embryonic day 13.5 (E13.5) (Figure 3.10B). Similar to FG-4592 mice, JIB-04 treatment also resulted in compaction of the labyrinthine layer responsible for nutrient and gas exchange, accompanied by decreased branching and overall vascularization, as evident from H&E staining and immunohistochemical analysis of the endothelial cell marker,

CD34 respectively (Figure 3.10C). These findings indicate that overall inhibition of Jumonji demethylation (i) negatively impacts on VHL mRNA and (ii) is crucial for proper placental development and establishment of a functional labyrinthine layer.

104

Figure 3.10 – Inhibition of Jumonji histone demethylation disrupts placental architecture. (A) qPCR analysis of VHL in JEG3 cells exposed to 1µM JIB-04 for 24 h. (B) Schematic representation of timeline for injection of JIB-04 during mouse gestation, spanning from embryonic day 7.5 to embryonic day 13.5. (C) Hematoxylin & eosin (H&E) (left panels) and CD34 (right panels) staining of E13.5 placentae from DMSO and JIB-04 treated mice. D=decidua,

S=spongiotrophoblast, L=labyrinthine zone.

105

3.1 Discussion

The current study presents evidence of dual epigenetic regulation of VHL, a multi-faceted tumour suppressor protein that is critically required for proper placental development. I discovered that the bifunctional oxygen sensor, JMJD6, is a regulator of VHL gene expression in the human placenta via targeted histone arginine demethylation. I demonstrate that VHL DNA is also concomitantly subjected to differential methylation, with significant consequences for its transcriptional repression by E2F4 in preeclamptic placentae. Importantly, I show that in preeclampsia, JMJD6 histone demethylase function is impaired due to a hypoxia-iron imbalance, contributing to VHL downregulation in this serious disorder of pregnancy.

3.1.1 JMJD6 exhibits oxygen-dependent histone arginine demethylation in the human placenta

Hypoxia is a powerful inducer of the molecular machinery underlying epigenetic events [119].

The general consensus is that hypoxia upregulates the expression of several JmjC domain proteins while attenuating their activity, thereby maintaining a dynamic balance of global epigenetic modifications. Accordingly, I observed that JMJD6 exhibits histone arginine demethylation in primary trophoblast cells in their physiological normoxic environment (i.e. 8%

O2). While some studies have failed to detect evidence of histone arginine demethylase activity for JMJD6, others have corroborated it in HEK293 cells [130, 217]. Interestingly, I detected an oxygen gradient preference for demethylation of H4R3me2s, but not H3R2me2s. This likely reflects physiological differences in sensitivity of the enzyme to one histone mark over the other, subject to oxygen availability. This is not surprising because different JmjC proteins exhibit widely different KM values for oxygen and, consequently, they demethylate their substrates over a gradient of PO2 values [119]. For instance, biochemical studies on the lysine demethylase,

KDM4E (histone lysine demethylase 4E) demonstrated that the sensitivity of the enzyme to

106 demethylate its histone substrates varied with oxygen tension [228]. Therefore, identifying the physiologically relevant concentrations of oxygen that modulate JMJD6 function is critical for understanding epigenetic outcomes in an organ like the human placenta that uniquely adapts and responds to physiological and pathological changes in oxygen tension during the course of pregnancy. As such, our data indicate that the hypoxic preeclamptic placenta renders JMJD6 functionally inactive, thereby negatively impacting VHL gene expression via histone arginine demethylation.

3.1.2 VHL is subject to dual epigenetic regulation via histone modifications and DNA methylation

Histone modifications and DNA methylation are epigenetic events that often work in concert to influence gene expression. While it is arduous to dissect the precise interactions between these events, it is imperative to study both processes to understand their influence on gene transcription. A seminal study found that in ccRCC tumours, hypermethylation of a CpG island in the first exon of VHL was largely responsible for gene inactivation and loss of function [52].

Incidentally, this study also utilized an inhibitor of DNA methylation, namely 5-AZA-2, to demonstrate that suppression of CpG island methylation rescued the loss of VHL gene expression. Other studies detected hypermethylation of CpG islands specific to the VHL promoter, in a subset of ccRCC patients [229]. Herein we provide evidence that in the human placenta, the VHL gene is subject to DNA methylation-dependent transcriptional repression by

E2F4 in an oxygen-dependent manner. E2F4 belongs to the E2F family of transcription factors that are important in cell cycle control [230]. Unlike its cognates E2Fs 1-3, E2F4 predominantly functions as a transcriptional repressor [230]. Notably, work on the Rb-/- (Retinoblastoma gene) and E2f4-/- single and double mutant mice suggests that both proteins act in a cooperative fashion to shape proper extra-embryonic development, including formation of the placental labyrinthine layer [231]. Given the critical role of VHL in placental labyrinthine development [65], it will be

107 important to establish precisely how interactions between these factors are orchestrated.

Moreover, in addition to our previous report that E2F4 expression is significantly elevated in E-

PE placentae (in a TGFB1/3-dependent manner) [194], we show here that this factor represses

VHL gene expression by enhanced direct association and transcriptional control, contributing to

VHL gene downregulation in E-PE. This was further validated by our finding that E2F4 silencing increased VHL expression.

This study also provides evidence that in E-PE, a pathology characterized by compromised

JMJD6 histone demethylation despite elevated gene expression/protein abundance [216], VHL promoter association to histones 3 and 4 at targeted arginine residues is strikingly decreased. I detected alterations in VHL-histone associations in regions upstream of the transcription start site

(TSS), in areas that are particularly enriched in transcription factor binding sites. For instance,

Zatyka et al (2002) analyzed the VHL promoter and determined that region between nucleotides

−49 to −19 (ensconced within region b: -163 to -9) significantly reduced VHL gene activity

[232]. Moreover, given that the E2F4 binding site is also within region a: -540 to -309, it is possible that in addition to DNA methylation status, specific VHL-histone associations have consequences for E2F4-VHL binding and subsequent transcriptional repression. These findings then raise the question of whether demethylation of the two JMJD6 histone targets is directly responsible for changes in VHL gene expression. Some evidence comes from work showing that dimethylation of histone 4 at arginine 3 results in global gene repression [233, 234]. In line with this, our in vitro ChIP data indicate that overexpression of JMJD6 enhanced H4R3me2s-VHL association at the distal promoter region of the gene, congruent with overall elevated VHL levels.

In light of the extensive cross-talk between histone modifications and DNA methylation, it is possible that demethylation of the H4R3me2s and/or the H3R2me2s marks recruits DNA methyltransferase enzymes (that function in de novo DNA methylation) to the VHL promoter and transcriptionally silence the gene. In support of this, transcription of the human beta-globin gene

108 is regulated by arginine methylation of histone 4 (H4R3me2s), which in turn recruits the de novo

DNA methyltransferase, DNMT3A, to the site of histone modification, thereby mediating gene silencing [234]. Similarly, symmetric dimethylation of H4R3 is associated with increased DNA methylation of the insulin growth factor 2 (IGF2) locus [235]. Collectively, these studies provide insight into the complex interplay between epigenetic modifications, and serve as a cautionary tale when studying downstream effects of epigenetic events.

3.1.3 VHL mRNA and protein are downregulated in severe early- onset preeclampsia and a murine model of pharmacological molecular hypoxia

The literature on VHL in pregnancy remains sparse to date. Work on its importance in placentation is restricted to Vhl-/- mice that exhibit in utero mortality due to placental failure [65].

Impaired vessel formation, syncytiotrophoblast cell development and resultant placental necrosis were pinpointed as the primary events underlying embryonic death in these mice. This work underscores the importance of VHL in mediating placental vasculogenesis. In agreement with this, our data indicate that downregulation of VHL in a pharmacological model of ‘molecular hypoxia’ (using FG-4592) and a small molecule inhibitor of Jumonji histone demethylation

(using JIB-04) is accompanied by profound disruptions in the placental labyrinthine layer, and abnormal vasculogenesis. These findings may be extended to the preeclamptic placenta, whereby we detected significant downregulation of VHL mRNA and protein only in our cohort of severe

E-PE, a subset of preeclamptic pregnancies defined by chronic hypoxia and aberrant oxygen sensing [236]. It is established that tumour-derived loss-of-function mutations in either α or β domains of VHL abrogate the ability of the protein to form a functional VHLCBC complex that drives HIF1A degradation [45]. Notably, in a sub-category of VHL syndrome (i.e. Type 2C) that is characterized by missense germline mutations in VHL, the association with its binding partners, Elongins B,C and CUL2 is disrupted in vivo [237]. In addition to decreased VHL

109 mRNA expression, previous work from our laboratory revealed disrupted binding of VHL to

CUL2. The consequence is a substantial decrease in HIF1A ubiquitination and subsequent degradation. The former finding is in contrast to a study [238] that found no significant changes in the protein abundance of either VHL isoform between PE and control placentae. One possible explanation for this discrepancy is that while we used severe early-onset preeclamptic cases (as defined by ACOG of blood pressure higher than 160/110 mm Hg) [171], the aforementioned study primarily examined L-PE placentae with an average gestational age >35 weeks. This further highlights the unique molecular signature of early- versus late-onset preeclampsia and the need to distinguish the two pathologies. Interestingly, in our investigation of pregnancies at high altitude, representing a physiological model of placental hypoxia, we demonstrated that VHL mRNA and protein are highly elevated, in parallel with increased HIF1A expression[239]. Taken together, these studies highlight the intricate differences in the molecular mechanisms characterizing physiological and pathological hypoxia during pregnancy.

3.1.4 Hypoxia-iron imbalance impairs JMJD6 function in human and murine models of hypoxia during pregnancy

Given the highly reactive property of ferrous iron, it is critical that intracellular iron levels are tightly controlled. In concert with the membrane iron transporter ferroportin 1, the ferroxidase enzyme, CP is used by many tissues in the body to facilitate iron export and subsequent transport by transferrin [240]. In this way, CP regulates both, systemic and intracellular iron levels, thereby playing a critical role in iron homeostasis [241-243]. Surprisingly, although CP is a copper-containing enzyme, it has not been implicated in copper transport or metabolism. In addition, recent studies have identified a placental multicopper ferroxidase known as zyklopen, sharing high homology with CP [244]. Given the lack of in vivo data supporting a placenta- specific role for zyklopen, the extent of its contribution to placental iron transfer remains to be established. As well, despite CP being present in the plasma, other studies have proven its

110 existence in syncytiotrophoblasts of the placenta, highlighting a role for CP in placental iron export [245]. In line with our finding of elevated CP upon FG-4592 treatment, CP is known to be transcriptionally upregulated in hypoxia via HIF1A [243, 246]. Moreover, consistent with reports in the literature [247, 248], our study found significantly elevated CP in both the sera and placentae of preeclamptic women. Besides the increased expression of the enzyme, the ferroxidase activity of CP is also reportedly enhanced in PE [249], lending credence to our hypothesis of enhanced Fe2+outflux from preeclamptic trophoblast cells.

Further corroborating this, I show first evidence of significantly lower levels of Fe2+in E-PE placentae relative to age-matched PTC tissue. This in turn has important implications not only for JMJD6 function, but also for the activity of numerous Fe2+- dependent enzymes that orchestrate diverse cellular processes. While work on CP so far has primarily linked this enzyme to the pathogenesis of oxidative stress in PE, I show that altered iron status, along with hypoxia, disrupts the function of a higher order epigenetic regulator like JMJD6, impacting on VHL expression.

Can alterations in iron metabolism be ameliorated in preeclampsia? From a clinical standpoint, there is no evidence that dietary iron supplementation improves pregnancy outcomes. This is likely because increasing iron intake alone does not ensure optimal iron absorption. Therefore, any potential therapeutic targets must take into consideration the complex interplay between hypoxia-induced changes in the cellular oxygen sensing machinery and the exuberant Fe2+ efflux.

To this end, supplementation with antioxidant enzymes that preserve the ferroxidase activity without impacting on Fe2+ export may be beneficial. In addition, there is growing interest in the use of small molecule inhibitors that target histone arginine methyltransferase enzymes that antagonize demethylase activity. For instance, methylation of the two JMJD6 histone targets,

H3R2me2s and H4R3me2s is catalyzed by specific protein arginine methyltransferases; inhibition of these enzymes maintains the marks in their demethylated state [250].

111

In conclusion, the findings reported herein shed new light on VHL epigenetic regulation in the human placenta as an intricate balance between DNA methylation and histone modifications, both of which are disrupted in preeclampsia (Figure 3.11). Taken together, this work provides novel insights on oxygen sensing in this pathology, while raising new questions on its pathogenesis and providing novel therapeutic targets for further investigation.

112

Figure 3.11. Putative model of epigenetic repression of VHL gene in preeclampsia. Chronic hypoxia in preeclamptic placentae enhances the association of the transcriptional repressor E2F4

(whose expression is increased in E-PE) to the VHL promoter due to altered DNA methylation of the E2F4 binding site. Concomitantly, JMJD6 histone demethylation is compromised by low oxygen. This is further exacerbated by lack of Fe2+ availability as a co-factor (due to increased activity of the ferroxidase, CP) for histone demethylation of JMJD6 targets, H3R2me2s and

H4R3me2s. This in turn negatively impacts VHL gene transcription.

113

4 The Jumonji C domain containing protein 6 is a novel oxygen sensor in the human placenta

Rationale:

Oxygen is a key determinant of placental trophoblast cell fate, orchestrated via the hypoxic molecular machinery. While our data highlights a role for JMJD6, an oxygen-dependent histone arginine demethylase, in regulating VHL gene expression, mounting evidence also implicates

JMJD6 as a mediator of lysyl hydroxylation of target proteins. As well, VHL protein (pVHL) is a known target of a gamut of post-translational modifications, including those at its C-terminal lysine residues that affect its stability and/or interaction with protein complexes that execute

HIF1A degradation in normoxia. Therefore, regulation of pVHL has direct, significant consequences for modulation of the cellular hypoxic response.

Objective:

The objective of the work described in this chapter was to establish the role of JMJD6 in mediating VHL protein stability in the human placenta under physiological and pathological conditions. Irrespective of VHL regulation, given that the hypoxic gene expression program is tightly coupled to epigenetic signalling, I also investigated the regulatory relationship between

JmjC domain containing protein 6 (JMJD6) and hypoxia-inducible factor (HIF1A) in the human placenta.

114

Jumonji Domain Containing Protein 6 – A novel oxygen sensor in the human

placenta

Sruthi Alahari1,3 Martin Post3,4,5 and Isabella Caniggia1,2,3*

1Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital, Toronto, Ontario, Canada, 2Department of Obstetrics and Gynecology, University of Toronto, Toronto, Ontario, Canada, 3Department of Physiology, University of Toronto, Toronto, Ontario, Canada, 4Department of Pediatrics, University of Toronto, Toronto, Ontario, Canada, 5The Hospital for Sick Children, Toronto, Ontario, Canada

Abbreviated Title: JMJD6 regulation of pVHL stability

Key words: Jumonji C (JmjC) domain containing protein, von Hippel-Lindau tumour suppressor protein, Hypoxia-Inducible Factor, SUMOylation, Placenta, Preeclampsia

Number of figures and tables: 11

*Corresponding Author and person to whom reprint requests should be addressed: Isabella Caniggia, Mount Sinai Hospital, Lunenfeld-Tanenbaum Research Institute, 25 Orde Street, Room 6-1004-3, Toronto, Ontario, Canada M5T 3H7, Phone: 416-586-4803, Fax: 416-586-5116, E-mail: [email protected]

Funding: Supported by the Canadian Institutes of Health Research (CIHR) Grant (MOP-14096). Sruthi Alahari is a recipient of a Lunenfeld-Tanenbaum Ontario Student Opportunity Trust Funds (OSOTF) award

Disclosure Statement: The authors have nothing to disclose

115

4.1 Introduction

One of the remarkable features of the human placenta is the profound changes in oxygen tension it undergoes during the course of its development [1, 160]. Early placentation occurs in a relatively low oxygen environment with oxygen tension ranging between 15-20 mm Hg.

Afterwards, as maternal blood flow markedly increases following opening of the intervillous space, placental oxygen tension rapidly rises to 60-70 mm Hg. These changes tightly orchestrate proper trophoblast cell differentiation events that are crucial for placental development and a successful pregnancy. Ample evidence implicates the Hypoxia-Inducible Factor (HIF) family of transcription factors in mediating these oxygen-regulated events [154, 251].

HIF1 is composed of an inducibly expressed, oxygen-regulated alpha subunit (HIF1A) and a constitutively active beta subunit, termed HIF1B [4, 21]. Seminal studies have addressed HIF1A expression and function in the human placenta at physiological and pathological conditions. In early gestation, HIF1A expression inversely correlates with changes in oxygen tension experienced by the developing placenta in vivo [154, 155, 251] and, during this period, HIF1A is widely implicated in mediating the effects of oxygen in regulating the expression/function of key genes involved in trophoblast cell fate [166, 252]. HIF1A expression and signalling are disrupted in preeclampsia [187, 188], a placental pathology characterized by hypoxia/oxidative stress

[253].

Distinct molecular mechanisms involving dioxygenase hydroxylase enzymes regulate HIF1A stability and transcriptional activity on the basis of oxygen availability [26, 27, 30]. In normoxia, prolyl hydroxylase domain proteins (designated PHD1, 2, 3) hydroxylate specific proline residues of HIF1A, targeting it for pVHL-mediated proteasomal degradation [26, 29].

Alternatively, another hydroxylase termed Factor Inhibiting HIF1 (FIH1), hydroxylates an asparigine residue in the C-terminal transactivation domain of HIF1A to prevent its association

116 with transcriptional co-activators, p300/CBP (cyclic adenosine monophosphate response element-binding protein Binding Protein), resulting in blockage of its transcriptional activity [27,

30]. In hypoxia, the activity of PHDs and FIH1 is inhibited [26, 30], thereby promoting HIF1A stabilization and subsequent target gene transcription [4].

In addition to the canonical oxygen sensors, a growing body of evidence implicates a novel group of histone demethylases containing the Jumonji C (JmjC) catalytic domain as oxygen sensors and mediators of hypoxic gene expression [82]. So far, twenty seven different JmjC domain proteins have been identified in humans, all of which share histone demethylase activity

[254]. Similar to the PHDs, members of this family are paradoxically upregulated in hypoxia despite requiring molecular oxygen to execute their enzymatic function [116]. Interestingly, sequence analysis of JMJD6, a histone arginine demethylase, revealed structural homology with

FIH1, that also is classified as a JmjC domain containing protein [128, 255, 256]. JMJD6 has recently been found to hydroxylate specific lysine residues resident of a RNA splicing factor termed U2AF65 [136] and of the tumour suppressor protein, p53 [143]. The protein structure of human JMJD6 revealed several conserved features to those found in the other hydroxylases, including three nuclear localization signals, a DNA binding motif and an α-KG- and Fe2+- dependent oxygenase activity domain [122].

We have reported that the canonical oxygen sensing mechanisms involving PHDs and FIH1play a critical role in regulating HIF1A stability and activity in the developing placenta and that their dysregulation contribute to the overexpression of HIF1A in preeclampsia [189], a devastating disorder affecting 5-7% of all pregnancies that is clinically characterized by maternal hypertension (American College of Obstetricians and Gynecologists, ACOG [171]). To date, the role of JMJD6 in placental oxygen sensing remains to be elucidated and no information is available on JMJD6’s interplay with HIF1A.

117

In the current study I sought to examine the expression and function of JMJD6 in human placental development at physiological and pathological conditions. I report that JMJD6 is significantly elevated during early placental development and in preeclampsia. In vitro experiments revealed that not only is JMJD6 induced in low oxygen and oxidative stress, but that this novel lysyl hydroxylase is a target of HIF1A. Moreover, I found a novel mode of regulation of pVHL stability by JMJD6-mediated lysyl hydroxylation. Overall, our findings signify a role for JMJD6 as an oxygen sensor and controller of HIF1A stability via regulation of pVHL expression and stability in the human placenta during development and disease.

4.2 Results

4.2.1 JMJD6 spatial and temporal placental expression in vivo

Studies have established that JMJD6 is a dioxygenase requiring molecular oxygen to execute its enzymatic functions [128]. As early placental development is characterized by striking changes in oxygen tension, I first examined JMJD6 protein abundance in the human placenta during early gestation. Western blotting for JMJD6 in placental lysates revealed that this dioxygenase is expressed as a doublet of 50 and 53 kDa, respectively (Figure 4.1A). This was confirmed using a JMJD6 synthetic blocking peptide, demonstrating that both bands are effectively competed for

(Figure 4.1B). JMJD6 expression was markedly elevated in early development (7-9 weeks) coincident with low oxygen tension in vivo, and subsequently declined between 10-13 weeks, when oxygen levels begin to rise (Figure 4.1A, left panel). Densitometric analysis confirmed significant differences in JMJD6 expression between the two gestational periods (Figure 4.1A, right panel).

118

Figure 4.1 – JMJD6 protein abundance during early placental development

119

Figure 4.1 – JMJD6 protein abundance during early placental development

(A) Western blot of JMJD6 in placental tissue from first trimester of gestation (left panel) and associated densitometric analysis (right panel). Unpaired Student’s t-test, **p=0.0011, n=10 (7-9 week) placentae, n=12 (10-13 week) placentae. (B) Western blot of JMJD6 in JEG3 cells with and without synthetic JMJD6 blocking peptide. (C) Immunohistochemical analysis of JMJD6 expression and spatial distribution in placental tissue between 5-11 weeks of gestation. Arrow heads indicate JMJD6 localization in specific structures within the placenta. ST = syncytiotrophoblast cells; CT = cytotrophoblast cells; AC = anchoring column; EVT = extravillous trophoblast cells. (D) Western blot and associated densitometric analysis of JMJD6 in primary isolated trophoblast cells from first trimester placentae, and exposed to 21% or 3%

O2. Student’s t-test, **p=0.0042, n=4. Data are presented as mean ± SEM.

120

In order to assess JMJD6 spatial distribution in human placentae, I performed immunohistochemical analysis in placental sections from early gestation. Representative images from 5 and 8 weeks of gestation, respectively, reveal that JMJD6 localizes to nuclei of cytotrophoblast and, to a lesser extent, syncytiotrophoblast cells (Figure 4.1C, top panel).

Positive nuclear signal for JMJD6 was also found in extravillous trophoblast cells (EVT) comprising the anchoring column (Figure 4.1C, middle panel). At 11 weeks of gestation, JMJD6 expression is reduced and largely restricted to nuclei of cytotrophoblast cells of chorionic villi

(Figure 4.1C, bottom panel). I next isolated primary villous cytotrophoblast cells from first trimester placentae, and subsequently characterized JMJD6 expression by Western blotting. In line with the in vivo data, JMJD6 protein is markedly reduced at 11 weeks of gestation compared to 8.3 weeks, coinciding with a rise in oxygen tension experienced by the developing placenta

(Figure 4.1D). Notably, upon exposure to low oxygen (3%), JMJD6 is significantly elevated in cells from both time-points (Figure 4.1D).

4.2.2 JMJD6 is elevated in severe early-onset preeclamptic placentae

We have previously reported that aberrant oxygen sensing mediated by PHDs is a defining feature of early-onset preeclampsia [189]. Hence, I examined JMJD6 expression in human placentae from severe early-onset (E-PE) and late-onset preeclampsia (L-PE). Western blotting analysis of placental tissues revealed that JMJD6 is significantly elevated in E-PE (n=29) relative to normotensive age-matched control placentae (PTC; n=27) (Figure 4.2A, top left and right panels). Interestingly, no changes in JMJD6 expression were detected in L-PE (n=11) relative to term control (TC) placentae (n=11) (Figure 4.2A, bottom left and right panels). In line with these observations, qPCR showed elevated JMJD6 mRNA in EPE placentae (Figure 4.2B).

Immunohistochemical analysis of JMJD6 spatial localization showed a marked increase in

JMJD6 immunoreactivity in sections from E-PE placentae. Particularly, strong positive immunoreactivity for JMJD6 was detected in the nuclei of trophoblast cells and in syncytial

121

Figure 4.2 – JMJD6 is elevated in early-onset preeclamptic placentae

122

Figure 4.2 – JMJD6 is elevated in early-onset preeclamptic placentae

(A) Western blot of JMJD6 in early-onset preeclamptic (E-PE), age-matched normotensive preterm control (PTC) placentae (top panel), late-onset preeclamptic (L-PE) and age-matched normotensive term control (TC) placentae (bottom panel). Densitometric analysis of JMJD6 in pathological and control placentae (A, right panel)). Unpaired Student’s t-tests, PTC vs. E-PE

(*p < 0.05), n=27 (PTC) placentae, n=29 (E-PE) placentae; n=11(TC) placentae, n=12 (L-PE) placentae. (B) qPCR analysis of JMJD6 in PTC and E-PE placentae. Unpaired Student’s t-test,

PTC vs. E-PE (*p < 0.05), n=13 per group (C) Immunohistochemical analysis of JMJD6 expression and spatial distribution in E-PE and PTC placental tissue (top panels). Staining with non-immune rabbit IgG is presented as a negative control (PTC (-) bottom left panel). JMJD6 expression in EVT cells at the feto-maternal interface in E-PE is shown in bottom right panel.

Arrows indicate JMJD6 localization primarily within syncytiotrophoblast cells and syncytial knots. n=4 (PTC, E-PE). ST = syncytiotrophoblast cells; SK = syncytial knot; EVT = extravillous trophoblast cells. Data are presented as mean ± SEM.

123 knots, while low positive signal was noted within the syncytium in PTC tissues (Figure 4.2C, top panels). Interestingly, we also observed elevated JMJD6 immunoreactivity within EVTs at the fetal-maternal interface (Figure 4.2C, bottom right panel). Normal rabbit IgG serum was used as a negative control for the primary antibody (Figure 4.2C, bottom left panel).

4.2.3 JMJD6 is induced in low oxygen and oxidative stress and is a target of HIF1A

To further understand the effects of low oxygen on JMJD6 expression in the placenta, I employed an immortalized human JEG3 choriocarcinoma cell line. Western blotting analysis demonstrated that exposure of JEG3 cells to 3% O2 significantly increased JMJD6 protein compared to standard (21% O2) control conditions (Figure 4.3A). Immunofluorescence analysis showed that JMJD6 was more abundant in nuclei of cells exposed to 3% O2 compared to 21%

O2, particularly within nucleoli (Figure 4.3B, left panels). Staining with the nucleoli marker, nucleophosmin (B23), which typically associates with nucleolar resident ribonucleoproteins, corroborated that JMJD6 localizes to the nucleoli in JEG3 cells (Figure 4.3B, right panels).

Besides hypoxia, placental oxidative stress is implicated in the pathogenesis of preeclampsia

[224, 257, 258]. Therefore, in parallel experiments, I exposed JEG3 cells to sodium nitroprusside

(SNP: a well-known nitric oxide donor and inducer of nitrile stress). The effectiveness of SNP to induce oxidative stress in vitro was validated by measuring hydrogen peroxide (H2O2) release.

An exposure of villous explants (6 weeks and 9 weeks of gestations) or JEG3 cells to 2.5 mM

SNP for 24 h triggered a marked increase in H2O2 release into the media, relative to vehicle- treated controls (Figure 4.3D). Western blotting revealed a significant increase in JMJD6 protein following 2.5 mM SNP treatment (Figure 4.3E). Immunofluorescence analysis showed that

SNP stimulated the nuclear distribution of JMJD6 to both nucleoli and nucleoplasm when compared to 21% O2 controls (Figure 4.3F)

124

Figure 4.3 – JMJD6 is elevated in conditions of low oxygen and oxidative stress in vitro

125

Figure 4.3 – JMJD6 is elevated in conditions of low oxygen and oxidative stress in vitro

(A) Representative Western blot of JMJD6 in JEG3 cells exposed to 3% or 21% O2 (left panel) and its densitometric analysis (right panel). Unpaired Student’s t-test, *p=0.0284, n=3 separate experiments. (B) Western blot of JMJD6 in 6.5 week-old placental villous explants exposed to

3% O2 or 2.5mM SNP for 24 h. (C) Immunofluorescence staining of JMJD6 (green) in JEG3 cells exposed to 3% O2 and 21% O2 standard conditions (left panels). Staining for the nucleolus marker, nucleophosmin (B23; red) in JEG3 cells in 21% O2 standard conditions (most right panel). Non-immune IgG was used as negative control (middle right panel). Nuclei are counterstained by DAPI (blue). Arrows indicate JMJD6 and B23 localization within nucleoli.

Scale bar = 15 µm. (D) Quantification of H2O2 release into media upon treatment of placental villous explants (left panel) or JEG3 cells (right panel) with SNP for 24 h. Data are presented as relative fluorescent units. (E) Western blot analysis of JMJD6 in JEG3 cells treated with 2.5mM

SNP in standard 21% O2 conditions (top panel) and associated densitometric analysis (bottom panel). Unpaired Student’s t-test, *p=0.0359, n=3 separate experiments. (F)

Immunofluorescence staining of JMJD6 (green) in JEG3 cells following exposure to 2.5mM

SNP. Arrows indicate JMJD6 localization to nucleoli. Scale bar = 15 µm. Data are presented as mean ± SEM.

126

In silico analysis of JMJD6 revealed the presence of three putative hypoxia response elements

(HRE) of the consensus motif ‘ACGTG’ within the promoter region of the gene, suggesting that

JMJD6 may be a HIF1 target at low oxygen (Figure 4.4A). To investigate this possibility,

HIF1A was knocked down in JEG3 cells kept at 3% O2 using anti-HIF1A RNAi. In placental villous explants, antisense oligonucleotides against HIF1A were used [251, 259]. Scrambled siRNA and oligonucleotides were employed as negative controls. qPCR analysis demonstrated that JMJD6 mRNA was significantly reduced in both JEG3 cells (Figure 4.4B, left panel) and placental villous explants (Figure 4.4B, right panel) after HIF1A knockdown in low oxygen, in line with JMJD6 being a transcriptional target of HIF1A.

127

Figure 4.4– JMJD6 is putative transcriptional target of HIF1A. (A) In silico analysis of the

JMJD6 promoter reveals the presence of three putative hypoxia response element (HRE) consensus sequences ‘ACGTG’. +1 represents the transcription start site, while numbers underneath the HRE indicate distance from the transcription start site. (B) qPCR analysis of

JMJD6 mRNA following HIF1A knockdown in JEG3 cells maintained in 3% O2, using 30nM siRNA (left panel). Unpaired Student’s t-test, *p=0.0148, n=4 separate experiments. qPCR analysis of JMJD6 mRNA following HIF1A anti-sense oligonucleotide knockdown in placental villous explants maintained in 3% O2 (right panel). Unpaired Student’s t-test, **p=0.0044, n=3 separate experiments. SS= Scrambled siRNA sequence; siHIF1A = RNAi knockdown of HIF1A;

SS = scrambled oligonucleotide sequence; AS HIF1A = anti-sense oligonucleotides knockdown of HIF1A. Data are presented as mean ± SEM.

128

4.2.4 JMJD6 mediates HIF1A stability through its actions on pVHL in normoxia

To further delineate a regulatory relationship between JMJD6 and HIF1A, I examined HIF1A protein abundance following RNAi knockdown of JMJD6 in JEG3 cells cultured at 21% O2.

Knockdown efficiency of RNAi duplexes was validated by qPCR (Figure 4.5A) and Western blotting (Figure 4.5B). Intriguingly, JMJD6 knockdown increased HIF1A levels (Figure 4.5C), suggesting that JMJD6 contributes to maintaining low levels of HIF1A at 21% O2. In contrast,

pVHL regulates HIF1A stability in normoxia by mediating its ubiquitination and proteasomal degradation, while it is functionally inactive in hypoxia [29]. Hence, I postulated that JMJD6 knockdown indirectly impacts on HIF1A stability by regulating pVHL abundance, stability and/or function. I observed a significant decrease in pVHL levels following RNAi knockdown of JMJD6 in JEG3 cells maintained at 21% O2 (Figure 4.6A) indicating that JMJD6 is a positive regulator of pVHL. To confirm this, I overexpressed JMJD6 in JEG3 cells kept at 21% O2 and found that JMJD6 overexpression markedly increased pVHL levels (Figure 4.6B). In line with the JMJD6 knockdown effect on HIF1A, JMJD6 overexpression decreased HIF1A protein levels, while HIF2A remained unchanged (Figure 4.6C).

Next, I determined whether the JMJD6-mediated increase in pVHL in JEG3 cells maintained at

21% O2, would affect its interaction with HIF1A. Immunoprecipitation of HIF1A followed by

Western blotting for VHL revealed increased binding between pVHL and HIF1A in JMJD6 overexpressing cells when compared to empty vector transfected controls (Figure 4.6D left panel). This was accompanied by increased association of HIF1A with Ubiquitin (Figure 4.6D right panel), suggesting that JMJD6 affects HIF1A degradation via pVHL.

129

Figure 4.5 – JMJD6 is a negative regulator of HIF1A

130

Figure 4.5 – JMJD6 is a negative regulator of HIF1A. (A) qPCR analysis of JMJD6 mRNA following JMJD6 RNAi knockdown in JEG3 cells (left panel). Unpaired Student’s t-test, *p=0.0254 SS vs D1 and ***p=0.0005 SS vs D2, n=3 separate experiments. (B) Western blot and associated densitometric analysis of JMJD6 following JMJD6

RNAi knockdown with siJMJD6 duplex D2 in JEG3 cells cultured at 21% O2. Unpaired

Student’s t-test, **p=0.0015 SS vs D2, n=4 separate experiments. SS= Scrambled negative control; D1, D2 = JMJD6 siRNA duplexes, siJMJD6 = RNAi knockdown of JMJD6. (C)

Western blot and associated densitometric analysis of HIF1A following JMJD6 RNAi knockdown. Unpaired Student’s t-test, **p=0.0021 SS vs. D2, n=3 separate experiments.

131

Figure 4.6 – JMJD6 is a positive regulator of pVHL stability.

132

Figure 4.6 – JMJD6 is a positive regulator of pVHL stability.

(A) Representative Western blot of JMJD6 and VHL following JMJD6 RNAi knockdown in

JEG3 cells (left panel). Densitometric analysis of VHL following JMJD6 RNAi knockdown

(right panel). Unpaired Student’s t-test, *p=0.0301, n=4 separate experiments. SS= Scrambled negative control; D2= JMJD6 siRNA duplex; siJMJD6 = RNAi knockdown of JMJD6. Dashed line indicates grouping of images from different parts of the same blot. (B) Representative

Western blots of JMJD6 and VHL following JMJD6 overexpression in JEG3 cells (left panel).

Densitometric analysis of JMJD6 and VHL following JMJD6 overexpression (right panel).

Unpaired Student’s t-test, JMJD6: **p=0.0083, n=4 separate experiments; VHL: *p=0.0166, n=3 separate experiments. (C) Western blot of HIF1A (left panel) and HIF2A (right panel) upon

JMJD6 overexpression. (D – left panel) Immunoprecipitation of HIF1A followed by Western blotting for VHL and HIF1A in JEG3 following JMJD6 overexpression (top and middle panels).

Western blot of JMJD6 following JMJD6 overexpression (bottom panel). (D – right panel)

Immunoprecipitation of HIF1A followed by Western blotting for Ubiquitin and HIF1A in JEG3 following JMJD6 overexpression. Data are presented as mean ± SEM.

133

I first investigated whether JMJD6 interacted with pVHL, and whether this was dependent on oxygen. Immunoprecipitation of endogenous JMJD6 in JEG3 cells exposed to 3% and 21% O2 for 24 h, followed by Western blotting for VHL revealed that (i) JMJD6 physically associates with pVHL and (ii) JMJD6-pVHL association is enhanced in 21% O2 relative to 3% O2 (Figure

4.7A). Immunohistochemical analysis of JMJD6 and VHL in serial placental sections from early first trimester (5 and 8 weeks of gestation, coincident with low oxygen in vivo) revealed that at both time points, JMJD6 and VHL co-localized in the cytotrophoblast cell layer (Figure 4.7B).

Moreover, in line with previous findings from our laboratory, pVHL was detected in cytoplasm of EVTs of the distal anchoring columns at 8 weeks of gestation, where it plays a role in trophoblast cell invasion (Figure 4.7B bottom panels). At the same time, positive nuclear signal for JMJD6 was observed throughout the anchoring column, including cells that express VHL

(Figure 4.7B bottom panels).

JMJD6 is unique among the JmjC domain containing proteins by virtue of its α-KG and Fe2+- dependent lysyl hydroxylase activity. Recent work has uncovered a growing list of target proteins [136, 143, 260, 261], whose protein stability is impacted by this JMJD6-dependent post- translational modification. To determine whether inhibition of lysine hydroxylation impacted pVHL stability, I exposed JEG3 cells for 48 h at 21% O2 to 10 µM minoxidil - a cyclic lysyl hydroxylase inhibitor [262, 263]. Western blotting revealed a decrease in VHL protein levels following treatment with minoxidil (Figure 4.8A). To investigate whether JMJD6 is involved in lysyl hydroxylation of pVHL, I overexpressed JMJD6 in the presence of minoxidil and subsequently examined pVHL stability. As anticipated, under control conditions, pVHL levels were reduced in the presence of minoxidil while JMJD6 overexpression increased pVHL (Figure

4.8B). Upon minoxidil treatment, however, JMJD6-enhanced stabilization of pVHL was abrogated (Figure 4.8B). Furthermore, the total loss of pVHL after JMJD6 knockdown in the presence of minoxidil further supports the idea that pVHL stability is uniquely dependent on

JMJD6 lysyl hydroxylase activity (Figure 4.8C).

134

Figure 4.7 – JMJD6 associates with pVHL in an oxygen-dependent manner

135

Figure 4.7 – JMJD6 associates with pVHL in an oxygen-dependent manner

(A) Immunoprecipitation of JMJD6 followed by Western blotting for VHL and JMJD6 in JEG3 cells exposed to 3% or 21% O2 for 24 h. (B) Immunohistochemical analysis of JMJD6 and VHL in placental serial sections obtained from 5 weeks (top panels) and 8 weeks (bottom panels) of gestation respectively. VHL and JMJD6 positive signal in EVTs of the anchoring column at 8 weeks is also depicted. Arrowheads point to positive signal in cytotrophoblast cell nuclei expressing both JMJD6 and VHL. AC = anchoring column.

136

I next examined whether JMJD6-mediated stabilization of pVHL occurred via the ubiquitin- proteasome pathway, which is the primary mode of protein degradation in mammals [264].

Hence, I exposed JEG3 cells for 24 h at 21% O2 to Mg132, an established proteasome inhibitor

[265]. Surprisingly, Mg132 treatment failed to stabilize pVHL; in contrast, it decreased pVHL levels (Figure 4.8D, top left panel). Besides the ubiquitin-proteasome pathway, studies have shown that proteins can be degraded by the lysosome [266]. To test the hypothesis that pVHL may be targeted for lysosomal degradation in 21% O2, I treated JEG3 cells with 10mM ammonium chloride (NH4Cl), an inhibitor of lysosomal activity. In contrast to Mg132, NH4Cl treatment increased pVHL (Figure 4.8D, bottom left panel). Immunofluorescence for VHL following NH4Cl treatment confirmed the overall increase as well as revealed a shift in VHL localization from the perinuclear cytoplasmic region to the nucleus (Figure 4.8D, right panels).

Following the observation of a physical association between JMJD6 and pVHL, I next sought to uncover the precise lysine residues on pVHL that were potential target sites for JMJD6-mediated hydroxylation. Analysis of the VHL protein sequence revealed the presence of three lysine residues on its C-terminal end: namely, K159, K171 and K196. Each of these residues has been shown to be involved in modulating VHL protein stability either by means of SUMOylation or ubiquitylation or both [60]. To discern whether JMJD6 targeted any or all of the three lysine residues for hydroxylation, I generated plasmid constructs containing point mutations in each of the afore-mentioned lysine residues, and a construct containing all three mutations (Figure

4.9A). In silico analysis of potential lysyl hydroxylation sites in pVHL using the software, RF-

Hydroxysite. Using the primary amino acid sequence as input, the algorithm predicted that the

K159 site on pVHL was the most likely site among the three to be targeted by hydroxylation

(Figure 4.9B). Importantly, immunoprecipitation of JMJD6 following transfection of either WT or mutant VHL constructs in JEG3 cells revealed that both the K159 and K196 sites in pVHL are important for JMJD6 binding to pVHL (Figure 4.9C).

137

Figure 4.8 – JMJD6 is a putative pVHL lysyl hydroxylase

138

Figure 4.8 – JMJD6 is a putative pVHL lysyl hydroxylase

(A) Western blot of VHL in JEG3 cells exposed to the lysyl hydroxylase inhibitor (10μM minoxidil) or control vehicle (95% ethanol). (B) Western blot of VHL in JEG3 cells exposed to minoxidil with and without JMJD6 overexpression. (C) Western blot of VHL following exposure of JEG3 cells to minoxidil in combination with RNAi knockdown of JMJD6. SS =

Scrambled controls, siJMJD6 = JMJD6 RNAi. (D) Western blot of VHL in JEG3 cells exposed to either 8.41 µM of the proteasomal inhibitor Mg132 (top left panel) or 10 mM of the lysosomal inhibitor NH4Cl (bottom left panel). Immunofluorescence staining for VHL (green) in JEG3 cells exposed to NH4Cl is shown on the right. Arrowheads indicate positive signal for VHL

139

Figure 4.9 – JMJD6 association to pVHL is disrupted upon mutation of specific lysine residues (A) Schematic of wildtype (WT) and mutated VHL constructs depicting lysines 159, 171 and 196 in the C-terminal. (B) RF-Hydroxysite analysis of putative lysine hydroxylation sites in pVHL. (C) Representative Western blots of JMJD6 and VHL upon immunoprecipitation of

JMJD6 following overexpression of either WT or mutant VHL constructs in JEG3 cells. n=3.

Arrows indicate mutated VHL sites showing reduced association to endogenous JMJD6, relative to WT VHL.

140

While the dynamics of VHL regulation are largely unknown, pVHL has recently been shown to be a target of SUMOylation resulting in increased stability and nuclear redistribution [60, 61]. In an effort to identify whether SUMOylation is responsible for NH4Cl-mediated VHL stabilization,

I performed Western blotting and immunofluorescence analyses of SUMO1 following NH4Cl treatment in JEG3 cells kept at 21% O2. Western blotting for SUMO1 following immunoprecipitation of VHL showed enhanced SUMOylation of VHL upon NH4Cl treatment

(Figure 4.10A, left panel). Accordingly, immunofluorescence staining revealed enrichment of

SUMO1 within the nuclei of cells upon NH4Cl treatment relative to controls (Figure 4.10A, right panel). Western blotting for VHL following exposure of JEG3 cells to NH4Cl in combination revealed an additive effect upon overexpression of JMJD6 (Figure 4.10B).

Given the role of SUMOylation in promoting pVHL stability, we next examined whether

JMJD6-mediated pVHL stabilization is dependent on its SUMOylation. Similar to NH4Cl treatment, immunoprecipitation of VHL followed by Western blotting for SUMO1 revealed enriched SUMOylation of pVHL upon JMJD6 overexpression (Figure 4.10C).

Immunofluorescence analysis of SUMO1 and VHL corroborated the increase in nuclear SUMO1 as well as redistribution of VHL to the nucleus upon JMJD6 overexpression relative to empty vector (EV) controls (Figure 4.10D). In order to identify whether JMJD6 lysyl hydroxylase activity promotes pVHL SUMOylation, I next immunoprecipitated VHL from JEG3 cells transfected with empty or JMJD6 expression vector in the presence and absence of minoxidil and probed for SUMO1. Our data revealed a decrease in pVHL SUMOylation upon minoxidil treatment in both empty vector as well as JMJD6 overexpression conditions (Figure 4.10E).

141

Figure 4.10 – JMJD6 promotes pVHL stability via SUMO1-dependent SUMOylation

142

Figure 4.10 – JMJD6 promotes pVHL stability via SUMO1-dependent SUMOylation.

(A) Western blots of VHL and SUMO1 following immunoprecipitation (IP) of VHL in JEG3 cells exposed to NH4Cl. (left panel). SUMO1 staining (green) following NH4Cl treatment in

JEG3 cells (right panel). (B) Western blot of VHL following exposure of JEG3 cells to ammonium chloride (NH4Cl) in combination with overexpression of JMJD6. (C) Western blots of VHL and SUMO1 following immunoprecipitation of VHL in JEG3 cells overexpressing

JMJD6. EV = Empty Vector. (D) Immunofluorescence for SUMO1 (green) and VHL (red) following JMJD6 overexpression in JEG3 cells. Arrowheads indicate positive signal for VHL.

(E) Western blots of VHL and SUMO1 following immunoprecipitation (IP) of VHL in JEG3 cells exposed to minoxidil with and without JMJD6 overexpression. EV = Empty Vector. Scale bar = 15µm.

143

4.3 Discussion

In the present study, I report for the first time that the JmjC domain containing lysyl hydroxylase,

JMJD6, is expressed in the human placenta in a spatial and temporal fashion coinciding with physiological oxygen changes. The in vitro findings verify that JMJD6 is induced in low oxygen and is a downstream target of HIF1. Moreover, JMJD6 stabilizes VHL via oxygen-dependent lysyl hydroxylation that promotes SUMOylation and nuclear sequestration of VHL, thereby promoting nuclear HIF1A degradation in normoxic conditions.

4.3.1 JMJD6 is regulated by changes in oxygen tension in the human placenta

During early gestation, low oxygen is critical for orchestrating proper placental development by regulating the expression of several genes governing trophoblast cell differentiation, an event that is largely mediated by HIF1 [160, 165]. Herein I show that JMJD6 expression profile in situ, i.e. high abundance at 7 to 9 weeks of gestation, when oxygen tension is low, is consistent with oxygen-mediated JMJD6 levels. These changes in JMJD6 protein abundance are corroborated by our in situ findings of its spatial distribution. Similar to HIF1A during early placentation, JMJD6 is predominantly expressed within the nuclei of cytotrophoblasts and EVTs comprising the anchoring column [154]. Given the relative hypoxic environment during this gestational period, this finding suggests that JMJD6 is upregulated in cells that express HIF1A.

JMJD1A and JMJD2B have been shown to be direct transcriptional targets of HIF1 [116]. In the present study, I show that JMJD6 is upregulated by low oxygen and SNP. Furthermore, I show that HIF1A knockdown reduces the low O2-induced upregulation of JMJD6 protein levels.

Together with the in silico identification of putative HREs within the JMJD6 promoter, these data suggest that JMJD6 is also a direct target of HIF1.

144

In the present study I found that JMJD6 accumulation in the nucleoli of JEG3 cells kept at low oxygen is enhanced. A previous study using JMJD6 reporter constructs has shown that JMJD6 subcellular localization is highly nuclear whereby it is predominantly localized to the nucleoplasm with occasional shuttling to the nucleolus following recovery from arrest in the G0 phase [129]. Interestingly, other canonical mediators of HIF1A stability, namely PHD2 and pVHL are also subject to shuttling between cellular compartments in an oxygen-dependent manner with implications for spatial regulation of HIF1A stability [29, 267].

4.3.2 JMJD6 is a novel regulator of pVHL stability in the human placenta

The observed spatial restriction of JMJD6 to cytotrophoblast cells when oxygen tension rises coincides with the appearance of pVHL and loss of HIF1A within the same subset of trophoblastic cells suggesting a potential interaction between JMJD6 and pVHL [154]. HIF1A stability is predominantly mediated by the PHD2 enzyme [268], which targets it for pVHL- mediated proteasomal degradation in normoxia. However, while abrogating PHD2 is sufficient to increase HIF1A, it is likely not the only factor affecting HIF1A stability. Herein, I demonstrate that knocking down JMJD6 in placental trophoblast cells kept at 21% O2 increases

HIF1A stability via JMJD6-mediated regulation of pVHL. While much work has focussed on upstream regulators of HIF1A, the literature on modulators of pVHL stability is rather scarce. So far, an E2-endemic pemphigus foliaceus (EPF) ubiquitin carrier protein (UCP) has been identified in targeting pVHL for degradation [55, 56]. Similarly, SUMOylation of pVHL by

SUMO1 has recently been established as an important post-translational modification that protects pVHL from cytoplasmic ubiquitination, thereby promoting its stabilization and nuclear translocation [60]. Our data are supportive of JMJD6 mediating pVHL stability by inducing its nuclear shuttling and SUMOylation by SUMO1. I also show that lysyl hydroxylation may be an important post-translational modification for mediating pVHL stability in normoxia. The lysyl

145 hydroxylase inhibitor, minoxidil, is a proven suppressor of the enzyme activity of procollagen- lysine 5-dioxygenase (PLOD1) [269], which is the only known lysyl hydroxylase to date besides the JmjC domain containing enzymes, JMJD4, JMJD5 and JMJD6. Among the JmjC proteins,

JMJD6 is unique for its ability in catalyzing lysyl 5-hydroxylation, similar to PLOD1. Studies have only recently begun to uncover novel substrates of JMJD6-mediated lysine hydroxylation

[136, 143, 261], implicating this factor in diverse physiological processes. Herein, I show that pVHL is likely subjected to JMJD6-mediated lysine hydroxylation in normoxia, resulting in its

SUMOylation and nuclear sequestration. I found that JMJD6-mediated regulation of pVHL is independent of the 26S proteasome, which is typically a prime candidate for protein degradation.

In contrast, inhibition of the 26S proteasome with Mg132 decreased pVHL levels, suggesting that other pVHL degradation pathways were activated [266]. Here I provide evidence that in placental trophoblast cells, JMJD6 does in fact stabilize pVHL by interfering with its lysosomal degradation, thereby promoting its SUMOylation and nuclear localization.

4.3.3 JMJD6 is significantly elevated in severe early-onset preeclampsia

An altered oxygen milieu plays an important role in the etiopathogenesis of preeclampsia, and elevated HIF1A levels found in this pathology are critical to the distorted expression of genes responsible for trophoblast cell differentiation [165]. Our present finding of elevated JMJD6 in severe early-onset preeclamptic placentae is consistent with JMJD6 being a downstream target of

HIF1 that is upregulated due to placental hypoxia/oxidative stress. Work from our laboratory has previously demonstrated that HIF1A hydroxylation (and subsequent degradation) by PHD2 is disrupted in early, but not late-onset preeclampsia, thereby contributing to elevated HIF1A levels in early-onset preeclampsia [189]. Our present data show a striking increase in JMJD6 protein abundance in early, but not late, onset preeclamptic placentae. Collectively, these findings

146 implicate altered oxygen sensing as a defining characteristic of early-onset preeclampsia, and underscore the importance of examining JMJD6 as another marker in providing this distinction.

If JMJD6 is a negative regulator of HIF1A stability, why is JMJD6 elevated in preeclampsia?

One explanation is that the hypoxic/oxidative stress environment in the preeclamptic placenta induces HIF1A protein, which in turn upregulates JMJD6. The latter could be a feedback mechanism to counteract excessive HIF1A levels. However, JMJD6 dioxygenase requires oxygen and Fe2+ for its activity. In preeclamptic placentae, JMJD6 dioxygenase activity is reduced due to low oxygen availability as well as by inhibition due to reactive oxygen species that alter Fe2+ redox state by chelation [270]. This lack of JMJD6 dioxygenase (lysyl hydroxylase) activity results in reduced pVHL stabilization and consequently elevated HIF1A in preeclampsia.

In summary, I propose a novel model of regulation of HIF1A stability in trophoblast cells

(Figure 4.11). In normoxia, JMJD6 hydroxylates pVHL on lysine residues, alongside promoting

SUMO1-dependent SUMOylation and subsequent translocation to the nucleus. VHL is thus freely available to contribute to nuclear HIF1A degradation. In low oxygen, HIF1 upregulates

JMJD6 protein, but JMJD6 dioxygenase activity is reduced, resulting in pVHL degradation and further HIF1A accumulation.

147

Figure 4.11 – Putative model of JMJD6-mediated pVHL and HIF1A regulation in normoxia. In the presence of molecular oxygen, JMJD6 stabilizes pVHL via lysine hydroxylation leading to its nuclear translocation and SUMOylation by SUMO1. pVHL is thus free to target nuclear HIF1A for degradation. Concurrently, loss of HIF1-mediated transcriptional induction of JMJD6 in normoxia contributes to lower levels of JMJD6 when compared to hypoxic conditions.

148

5 Overall Conclusions

Oxygen deprivation underlies a multitude of pathologies including cancer, cardiac, metabolic, pulmonary and vascular disorders, and in particular, pathologies of pregnancy. Although decades of research have highlighted the importance of oxygen in regulating proper placentation, the epigenetic mechanisms leading to a successful pregnancy are still not well understood. The purpose of this study was to define how cross-talk between oxygen and the epigenome shapes normal and pathological placentation. I show that the oxygen sensor, JMJD6, executes dual functions in the placenta in a dual fashion: On the one hand, it regulates VHL gene expression in trophoblast cells via site-specific histone arginine demethylation, while independently impacting

VHL protein stability through lysyl hydroxylation (summarized in a putative model, Figure 5.1).

Moreover, both roles of JMJD6 critically depend on oxygen tension, and are consequently disrupted in preeclampsia, a pathology characterized by chronic placental hypoxia.

Mirroring the findings in this thesis, studies have shown that CP mRNA, protein and importantly, its ferroxidase activity are markedly elevated in pregnancies compromised by preeclampsia, but not IUGR, and that the source of this increased CP is the chronic hypoxic placental environment that characterizes PE [248, 249]. While this upregulation is believed to be an adaptive response to combat the inflammatory state and oxidative damage in the pathology, the data reported herein identify CP as a culprit in exacerbating JMJD6 functional impairments in preeclampsia and impinging on the JMJD6-VHL regulatory axis.

VHL genetic regulation by JMJD6

2+ The first data chapter of this thesis provides new evidence that JMJD6, an Fe and O2-dependent demethylase that specifically targets histones 3 (H3R2me2s) and 4 (H4R3me2s) at arginine residues, is a positive regulator of VHL gene. In particular, I show that not only are the unique

JMJD6 histone targets detected at the VHL gene locus, but also that aberrant histone

149 demethylation by JMJD6 results in altered promoter occupancy of VHL by these marks in preeclamptic placentae. Importantly, impaired JMJD6 activity in preeclampsia was due to chronic hypoxia, exacerbated by alterations in iron availability. This is the first account to highlight oxygen-governed epigenetic dysregulation of a critical factor required for proper placental development. Building on existing work in our laboratory showing alterations in the

DNA methylation status of VHL in preeclampsia, this study juxtaposes the two sides of the epigenetic code in contributing to VHL changes.

In the realm of histone modifications and gene regulation, context is crucial. While the data reported in this thesis show that JMJD6 histone target protein levels are altered in preeclampsia, correlating with altered VHL promoter occupancy of both marks in the disease, the data presented herein indicate that JMJD6 is recruited to these marks to alter arginine demethylation status. What are some potential mechanisms involved in VHL gene regulation by JMJD6? There are a few key possibilities:

1. Changes in methylation of either or both histone marks may alter the physical structure

of chromatin and affect the accessibility of transcription factors to the underlying VHL

DNA. Indirect evidence for this scenario comes from our work showing that JMJD6 is a

negative regulator of the transcriptional repressor, E2F4, which our laboratory has

shown to be a negative regulator of VHL mRNA and protein in the human placenta

[194]. This permits us to posit a putative model of VHL gene regulation, whereby in

physiological conditions, JMJD6 maintains active VHL gene transcription through

constitutive histone arginine demethylation while simultaneously downregulating E2F4.

150

Figure 5.1– Putative model of JMJD6 dual regulation of VHL gene and protein in preeclampsia. Compromised JMJD6 activity in low oxygen is further exacerbated by reduced availability of its co-factor, Fe2+ due to elevated CP. This results in decreased demethylation of its histone targets, thus impacting on VHL gene transcription. Concomitantly, reduced JMJD6 lysyl hydroxylase activity prevents the SUMO1-dependent stabilization of VHL, allowing

HIF1A to escape proteasomal degradation. In a feedback manner, elevated HIF1A further induces JMJD6 expression, while its function remains compromised.

151

In the case of preeclampsia, when JMJD6 activity is compromised, E2F4 protein is

elevated and contributes to overall VHL downregulation via transcriptional repression.

2. My data show that histones isolated from primary trophoblast cells were bound by

JMJD6 at both of its targets, namely H3R2me2s and H4R3me2s. Hence, it is likely that

JMJD6 also acts an epigenetic ‘reader’ and directly binds to its histone targets to either

execute its demethylase function directly or, alternatively, recruit different ‘reader’

proteins with chromatin-binding domains. For instance, the JMJD2A histone lysine

demethylase specifically recognizes its target histone mark (H3K4me) via its double

tudor domain. Interestingly, analysis of JMJD6 domain structure reveals that unlike many

other members of the JmjC family, it does not contain a chromatin-binding domain. This

suggests that the observed interaction between JMJD6 and its histone targets is primarily

due to enzyme-substrate interactions that catalyze the demethylation reaction, and is

unlikely to recruit other chromatin modifying factors.

pVHL protein regulation by JMJD6

The second data chapter in this thesis highlights the lysyl hydroxylase role of JMJD6 in regulating the protein stability of VHL in the human placenta. I show that in normoxia, JMJD6 physically associates with pVHL at targeted lysine residues and executes its hydroxylation to protect it from lysosomal degradation. Moreover, JMJD6 is an integral part of the Alterations in

VHL-HIF1A axis, forming a feedback loop that maintains HIF1A levels under control.

One major question that remains to be addressed is whether the histone demethylation role of

JMJD6 on VHL gene is linked to the lysyl hydroxylation of pVHL. Owing to the complexities of teasing apart transcriptional, translational and post-translational effects, it may be difficult to provide a clear-cut answer. Nevertheless, the data presented in this thesis provide some clues:

152

Firstly, JMJD6 physically associates with pVHL, and this interaction is compromised in hypoxia.

This suggests that the two ‘arms’ of JMJD6 catalytic activity are likely independent of each other, and supported by recent advances highlighting lysyl hydroxylation as a primary biological function for JMJD6.

Comparison of the in vitro and in vivo use of JIB-04 (a Jumonji-domain specific histone demethylase inhibitor that occupies the O2-binding domain of JMJDs) [227] and FG-4592 (a α-

KG mimetic that chelates Fe2+) revealed that both chemical hindrances impinged on VHL protein and mRNA, and resulted in similar ultrastructural vascular placental abnormalities and adverse maternal outcomes. It remains to be seen if the relative contributions of JMJD6 histone demethylase versus lysyl hydroxylase activities to placental development can be further dissected. Detailed analysis using specific inhibitors in in vivo and in vitro models will provide important insights on which ‘face’ of JMJD6 regulates VHL, whether the two axes intersect, and ultimately, how the resultant phenotypes can be ameliorated.

JMJD6 in placental pathology

Recent evidence increasingly implicates the Jumonji family of proteins in the pathogenesis of cancer. Particularly, JMJD6 is emerging as a marker of poor prognosis in breast and colon carcinogenesis [143, 271], and is believed to mediate this process through its interactions with tumour suppressors and oncogenic factors. While there is no information on JMJD6 in the pathogenesis of pregnancy-related pathologies, many parallels can be drawn between tumour progression and pregnancy. Both ‘syndromes’ are characterized by invasive cells and heightened immune resistance. The difference however is that unlike the tumour microenvironment, extravillous trophoblast proliferation, migration and invasion are tightly controlled processes that are necessary for physiological spiral artery remodelling, and represent an epithelial- mesenchymal transition (EMT). In case of pregnancy-associated disorders such as preeclampsia, studies have shown that this EMT-like process is impaired during placental development,

153 resulting in shallow trophoblast invasion that is typical of the disease [272]. Thus far, the data presented in this thesis show that JMJD6 exerts its actions in the placenta (in physiological and pathological conditions) via epigenetic and post-translational control over VHL, indirectly affecting placental vascular development. However, I cannot exclude the possibility that JMJD6 controls trophoblast events independent of VHL. For instance, JMJD6 has been shown to induce

EMT through histone arginine demethylation, by promoting the motility and invasiveness of breast cancer cells in vitro [271]. Given that placental EVT invasion during early development is akin to an EMT-like process, it is possible that JMJD6 directly contributes to the fundamental events that shape placentation. Global gene profiling upon loss and gain-of JMJD6 function in trophoblast cells may facilitate the discovery of previously undiscovered targets and provide insight into the diverse functions of this factor.

Epigenetic changes represent an attractive target for devising therapeutic strategies for disease.

The utility of so-called ‘epigenetic inhibitors’ has been particularly highlighted in the field of cancer, where epigenetic changes were found to underlie a large share of gene alterations. While this is primarily comprised of hypermethylation-induced silencing of tumour suppressor genes

(including VHL) and alterations in histone modifiers, the inherent ‘reversibility’ of these marks has shifted focus on to the use of histone demethylases in targeting cancer. For instance, histone deacetylase inhibitors (HDACi) have been used to selectively modify gene transcription and modify ‘carcinogenic’ processes such as uncontrolled angiogenesis, proliferation and cell growth

[273]. Similarly, several compounds that target histone methylation and demethylation have been developed and are at various stages of clinical testing. Of relevance to the data presented in this thesis, use of the first true in vivo epigenetic inhibitor, JIB-04, resulted in profound alterations in placental vasculature and maternal kidney morphology. Hence, it would be of tremendous clinical significance to identify specific epigenetic inhibitors that can enhance JMJD6 activity in the preeclamptic milieu and improve VHL-mediated outcomes in the placenta.

154

6 Limitations of the study

6.1 Limitations of mouse models

While the mouse models employed in the present study provide valuable insights into the overall effects of dysregulation of the cellular hypoxic response on placental morphology, there are some limitations in their use.

Primarily, both small molecule inhibitors (FG-4592 and JIB-04) were administered by intraperitoneal (IP) injection and may have global effects on animal physiology. Hence, it is possible that the resultant placental phenotype is a secondary effect of insult to other organs. In addition, there is potential for off-target effects in the molecular pathways in which the inhibitors are aimed to intervene. For instance, FG-4592 is a α-KG analogue that inhibits activity of several members of the α-KG dioxygenase enzyme family that also encompasses the JMJDs. Hence, it is plausible that FG-4592 treatment inhibits JMJD6 activity and mediates downstream effects independent of PHD2-inactivation. Similarly, JIB-04 inhibition in general is not specific to

JMJD6-mediated histone demethylation, and may have other systemic effects that were not explored.

These limitations can be largely addressed by generation of tissue-specific conditional knockout models of key players in the oxygen sensing pathway, or alternatively, by inducible knockout models that allow for precise temporal control of gene inactivation. Strategy for creating a placenta-specific Jmjd6-/- murine model is detailed in section 7.2.

155

7 Future Directions

7.1 Role of other JMJD family members in shaping placental development

While the work in this thesis focused on JMJD6, I do not exclude the possibility that other

JMJDs may be vital to shaping placentation. Surprisingly, with the exception of JMJD6, there is no information on other Jumonji family members in the placenta. Strong candidates include the oxygen-regulated, HIF1A transcriptional targets, JMJD1A, 2A and 2B that are widely expressed in a variety of tissues. Among these, JMJD2A was found to repress the gene expression of

ASCL2 (achaete scute-like homologue 2; also known as Mash2 in rodents), a transcription factor critical for trophoblast proliferation and placental development [274]. This suggests an indirect, but significant role for this histone lysine demethylase in mediating trophoblast cell fate events.

To test the involvement of JMJD2A in mediating the effects of oxygen, I first determined whether JMJD2A was induced in hypoxia in JEG3 choriocarcinoma cells. Preliminary data indicates that in line with JMJD2A being a HIF1 target, JEG3 cells exposed to 3% oxygen for 24 h upregulated JMJD2A protein (Figure 5.2A). Unlike JMJD6 however, overexpression of

JMJD2A in 3%, 8% or 21% oxygen had no impact on pVHL levels in JEG3 cells (Figure 5.2B).

Moreover, examination of JMJD2A protein in E-PE placentae also revealed a high amount of variability among both PTC and E-PE tissue, yielding no significant differences in protein abundance between the two groups (Figure 5.2C). These data suggest that JMJD2A impact on trophoblast proliferation is unlikely to be mediated via VHL, but cannot be ignored nevertheless.

A more thorough, systematic examination of the JMJD2A-ASCL2 axis in shaping trophoblast cell events, particularly in the context of oxygen sensing, is an exciting avenue for future investigation.

156

Figure 5.2 – Mapping of JMJD2A protein in JEG3 cells and early-onset preeclamptic placentae. (A) Western blotting for JMJD2A in JEG3 cells exposed to 3% O2 for 24 h. (B)

Western blotting for VHL upon overexpression of JMJD2A in JEG3 cells exposed to 3%, 8% or

21% O2 for 24 h. (C) Western blotting for JMJD2A in E-PE and age-matched PTC placentae.

157

7.2 Generate a placenta-specific Jmjd6-/- murine model

The work presented here provides evidence that JMJD6 is important for proper placentation.

However, the utility of cell culture models is limited, and modelling disease processes in isolated cells cannot fully mimic the early placental environment. Hence, tissue-specific ablation of our target gene in animal models will provide a wealth of information on the genetic basis of pregnancy-associated disorders. Since it is well established that JMJD6 is critical for embryogenesis as a whole, it would be vastly informative to assess the specific contribution of this factor to placental development, and determine if JMJD6 loss is reminiscent of a preeclamptic phenotype. This can be accomplished by engineering placenta-specific (either in the labyrinthine or spongiotrophoblast layers) Jmjd6 knockout mice using Cre recombinase- mediated deletion in vivo.

End-point readouts will include the thorough characterization of the basic physiological phenotype of wildtype and knockout mice, in addition to studying placental function in depth.

Timed matings will be performed to precisely document the contribution of JMJD6 to maintaining a successful pregnancy in general. In the event that Jmjd6-/- mice complete pregnancy to term, their placentae (and kidneys) will be harvested and examined for histological and morphological analyses and detailed molecular characterization of players in the hypoxic signalling pathway. Animals will be sacrificed at E13.5 (coinciding with formation of a mature placenta), E16 and E20 to detect possible alterations dependent on gestational age. Other physiological parameters that will be monitored during pregnancy include: Maternal blood pressure (using a tail-cuff system), serum analysis of circulating anti-angiogenic factors such as sFlt-1 for evidence of preeclampsia, urine collection for proteinuria analysis. These studies will provide important information on the genetic basis of placental disease processes and how they contribute to pregnancy outcomes.

158

7.3 Does JMJD6-dependent histone demethylation affect HIF1A gene transcription?

Despite its central role in mediating the cellular hypoxic response, and the intricate cross-talk between oxygen and chromatin, so far, there is limited information on whether the HIF1A gene itself is subject to epigenetic control. Lin et al (2011) reported that hypoxia differentially regulated the transcription of HIF1A and HIF2A by impacting on the acetylation status of core histones, H3 and H4 in the promoter/enhancer region of the genes [275]. Specifically, they found that hypoxia decreased H3 and H4 acetylation at the proximal, but not distal region of the HIF1A promoter, suggesting an early epigenetic contribution to HIF1A regulation that precedes its actions as a transcription factor [275].

The data reported in this thesis revealed a novel regulatory relationship between JMJD6 and

HIF1A. Firstly, I found that JMJD6 contains a putative hypoxia response element and is induced in hypoxia via HIF1A. This is in line with other studies that found hypoxic transcriptional induction of several Jumonji C domain family members by HIF1A. This mechanism is believed to be an adaptive response to maintain global histone methylation levels in check. Secondly, studies using siRNA knockdown and overexpression constructs in JEG3 cells revealed that the

HIF1A gene is negatively regulated by JMJD6. In line with this, chromatin immunoprecipitation of the JMJD6 histone target, H4R3me2s, following overexpression of JMJD6, or alternatively, exposure to 2.5 mM sodium nitroprusside revealed that (a) in control empty vector, the

H4R3me2s strongly associates with the HIF1A core promoter containing the transcriptional start site and (b) overexpression of JMJD6, resulting in enhanced demethylation of targets, and induction of oxidative stress reverted this pattern of association (Figure 5.3). Notably, this pattern of association is in striking contrast to H4R3me2s-VHL binding, as reported in Chapter 3.

159

Based on these preliminary findings, I hypothesized that JMJD6, through its histone targets,

H3R2me2s and H4R3me2s, is a higher-order controller of HIF1A gene expression in normoxia.

To test this hypothesis, future studies will employ the following strategy: Having first conclusively established that JMJD6 controls HIF1A gene, I will perform chromatin immunoprecipitation analysis of JMJD6 targets, H3R2me2s and H4R3me2s in primary isolated trophoblasts exposed to 3% or 8% oxygen (representing physiological hypoxia and normoxia for term placentae respectively), JEG3 cells upon JMJD6 siRNA knockdown, and finally, in early- onset preeclamptic placentae. Subsequent qPCR analysis of different regions spanning the

HIF1A promoter will be performed to study histone-gene interactions and their consequences for transcription.

160

Figure 5.3 –Demethylation of H4R3me2s decreased its association with HIF1A. Top panels:

Schematic of the HIF1A gene indicating its promoter region containing the transcription start site, region targeted by primers and exons (1-15). Forward and reverse primer sequences used to analyze H4R3me2s-HIF1A interaction are listed. Bottom panel: qPCR for HIF1A (using the primers depicted in the top panel) following chromatin immunoprecipitation of the JMJD6 histone target, H4R3me2s upon overexpression of JMJD6 and treatment with 2.5mM sodium nitroprusside for 24 h.

161

7.4 Is VHL subject to cross-talk between DNA methylation and histone modifications?

Given the immense amount of cross-talk between various histone modifications as well between histone modifications and DNA methylation, it is appealing to speculate that VHL gene transcription is a product of such cross-talk, and that disruption of these events predisposes cells to pathology. Particularly, histone methylation is context-dependent and does not linearly correlate with specific biological outcomes. There is increasing evidence that distinct histone methylation marks can affect other types of modifications on distant amino acid residues on the same histone tail, as evident from acetylation of histone H4 on lysines 5, 8, 12 and 16 repressing methylation of histone 4 at arginine 3 (H4R3) by the arginine methyltransferase, PRMTI [276].

Since this is analogous to JMJD6-mediated demethylation of the same histone residue, examination of the acetylation status of the afore-mentioned lysine marks in the presence and absence of JMJD6 in trophoblast cells will provide further insight into this line of cross-talk. As well, specific histone modifications can affect the actions of DNA methyltransferase enzymes that execute de novo methylation [277]. For instance, PRMT5-executed arginine dimethylation of H4R3 recruits DNMT3A to that site to cooperatively silence target genes [234]. Given our data on dual epigenetic regulation of VHL, it may be of value to understand whether histone modification-dependent changes in VHL also influence its DNA methylation status and subsequent association to E2F4. To unravel potential cross-talk among the two processes, studies can first examine global VHL DNA methylation in the presence of either a histone arginine methyltransferase inhibitor, or alternatively, knockdown of JMJD6. Subsequently, it may be important to assess if knockdown of DNMT3A (known to interact with the JMJD6 histone target, H4R3me2s) has an impact on VHL methylation, and if so, perform ChIP of

DNMT3A to detect potential association to the VHL promoter. Finally, to determine whether these modifications are associated with transcriptionally active VHL, recruitment of RNA

162 polymerase II to the promoter can also be analyzed by ChIP. Collectively, these studies should provide crucial insight into the two epigenetic influences on VHL gene transcription.

7.5 Statement of Conclusion

Overall, the data presented in this thesis lend credence to our hypothesis that JMJD6 is a dynamic player in the human placenta by orchestrating the hypoxic gene expression program through its actions on the von Hippel-Lindau tumour suppressor. In turn, pVHL, through its myriad HIF-dependent and independent functions, is known to impact trophoblast cell fate events that are critically required for proper placental development. In pathological conditions, as in the case of preeclampsia, JMJD6 function is disrupted due to hypoxia and altered iron homeostasis, contributing to pVHL suppression. This raises an important question on the pathogenesis of preeclampsia: Is placental hypoxia the cause or the consequence of preeclampsia? In concert with the data reported in this thesis, work from our laboratory suggests that disrupted oxygen sensing early in placental development impairs trophoblast cell differentiation and fate thereby affecting placental cell homeostasis and function. Hence, the work presented here enables us to further define the unique molecular signature of preeclampsia, which will ultimately aid in the discovery of diagnostic markers and therapeutic targets.

163

Appendix

Research Ethics Board approval was received for all human studies (REB # 11-0287-E)

164

Chapter 3 is comprised of a published body of work in the journal, Endocrinology (2015).

Official permission was obtained from the journal.

Chapter 4 is comprised of a manuscript under review at the journal, PLOS Genetics (2017).

165

References

1. Rodesch, F., et al., Oxygen measurements in endometrial and trophoblastic tissues during early pregnancy. Obstetrics and gynecology, 1992. 80(2): p. 283-5.

2. Carreau, A., et al., Why is the partial oxygen pressure of human tissues a crucial parameter? Small molecules and hypoxia. J Cell Mol Med, 2011. 15(6): p. 1239-53.

3. Lopez-Barneo, J., R. Pardal, and P. Ortega-Saenz, Cellular mechanism of oxygen sensing. Annu Rev Physiol, 2001. 63: p. 259-87.

4. Semenza, G.L. and G.L. Wang, A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Molecular and cellular biology, 1992. 12(12): p. 5447-54.

5. Lahiri, S., et al., Oxygen sensing in the body. Prog Biophys Mol Biol, 2006. 91(3): p. 249-86.

6. Weir, E.K., et al., Acute oxygen-sensing mechanisms. N Engl J Med, 2005. 353(19): p. 2042-55.

7. Fishman, M.C., W.L. Greene, and D. Platika, Oxygen chemoreception by carotid body cells in culture. Proc Natl Acad Sci U S A, 1985. 82(5): p. 1448-50.

8. Lopez-Barneo, J., et al., K+ and Ca2+ channel activity and cytosolic [Ca2+] in oxygen- sensing tissues. Respir Physiol, 1999. 115(2): p. 215-27.

9. Howard, R.B., T. Hosokawa, and M.H. Maguire, Hypoxia-induced fetoplacental vasoconstriction in perfused human placental cotyledons. Am J Obstet Gynecol, 1987. 157(5): p. 1261-6.

10. Hampl, V., et al., Hypoxic fetoplacental vasoconstriction in humans is mediated by potassium channel inhibition. Am J Physiol Heart Circ Physiol, 2002. 283(6): p. H2440- 9.

11. Chandel, N.S. and P.T. Schumacker, Cellular oxygen sensing by mitochondria: old questions, new insight. J Appl Physiol (1985), 2000. 88(5): p. 1880-9.

12. Chandel, N.S., et al., Cellular respiration during hypoxia. Role of cytochrome oxidase as the oxygen sensor in hepatocytes. J Biol Chem, 1997. 272(30): p. 18808-16.

13. Taylor, C.T. and S. Moncada, Nitric oxide, cytochrome C oxidase, and the cellular response to hypoxia. Arterioscler Thromb Vasc Biol, 2010. 30(4): p. 643-7.

14. Minervini, G., et al., Isoform-specific interactions of the von Hippel-Lindau tumour suppressor protein. Sci Rep, 2015. 5: p. 12605.

166

15. Damsky, C.H., et al., Integrin switching regulates normal trophoblast invasion. Development, 1994. 120(12): p. 3657-66.

16. Kietzmann, T., J. Fandrey, and H. Acker, Oxygen Radicals as Messengers in Oxygen- Dependent Gene Expression. News Physiol Sci, 2000. 15: p. 202-208.

17. Jones, R.D., J.T. Hancock, and A.H. Morice, NADPH oxidase: a universal oxygen sensor? Free Radic Biol Med, 2000. 29(5): p. 416-24.

18. Martinkova, M., K. Kitanishi, and T. Shimizu, Heme-based globin-coupled oxygen sensors: linking oxygen binding to functional regulation of diguanylate cyclase, histidine kinase, and methyl-accepting chemotaxis. J Biol Chem, 2013. 288(39): p. 27702-11.

19. Rodgers, K.R. and G.S. Lukat-Rodgers, Insights into heme-based O2 sensing from structure-function relationships in the FixL proteins. J Inorg Biochem, 2005. 99(4): p. 963-77.

20. Semenza, G.L., Hypoxia-inducible factor 1: master regulator of O2 homeostasis. Curr Opin Genet Dev, 1998. 8(5): p. 588-94.

21. Wang, G.L., et al., Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proceedings of the National Academy of Sciences of the United States of America, 1995. 92(12): p. 5510-4.

22. Forsythe, J.A., et al., Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Biol, 1996. 16(9): p. 4604-13.

23. Liu, W., et al., Targeted genes and interacting proteins of hypoxia inducible factor-1. Int J Biochem Mol Biol, 2012. 3(2): p. 165-78.

24. Jiang, B.H., et al., Transactivation and inhibitory domains of hypoxia-inducible factor 1alpha. Modulation of transcriptional activity by oxygen tension. J Biol Chem, 1997. 272(31): p. 19253-60.

25. Eguchi, H., et al., A nuclear localization signal of human aryl hydrocarbon receptor nuclear translocator/hypoxia-inducible factor 1beta is a novel bipartite type recognized by the two components of nuclear pore-targeting complex. J Biol Chem, 1997. 272(28): p. 17640-7.

26. Epstein, A.C., et al., C. elegans EGL-9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation. Cell, 2001. 107(1): p. 43-54.

27. Koivunen, P., et al., Catalytic properties of the asparaginyl hydroxylase (FIH) in the oxygen sensing pathway are distinct from those of its prolyl 4-hydroxylases. The Journal of biological chemistry, 2004. 279(11): p. 9899-904.

28. Semenza, G.L., Hydroxylation of HIF-1: oxygen sensing at the molecular level. Physiology (Bethesda), 2004. 19: p. 176-82.

167

29. Maxwell, P.H., et al., The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature, 1999. 399(6733): p. 271-5.

30. Lando, D., et al., FIH-1 is an asparaginyl hydroxylase enzyme that regulates the transcriptional activity of hypoxia-inducible factor. Genes & development, 2002. 16(12): p. 1466-71.

31. Appelhoff, R.J., et al., Differential function of the prolyl hydroxylases PHD1, PHD2, and PHD3 in the regulation of hypoxia-inducible factor. J Biol Chem, 2004. 279(37): p. 38458-65.

32. Aprelikova, O., et al., Regulation of HIF prolyl hydroxylases by hypoxia-inducible factors. Journal of cellular biochemistry, 2004. 92(3): p. 491-501.

33. Latif, F., et al., Identification of the von Hippel-Lindau disease tumour suppressor gene. Science, 1993. 260(5112): p. 1317-20.

34. Maher, E.R., H.P. Neumann, and S. Richard, von Hippel-Lindau disease: a clinical and scientific review. Eur J Hum Genet, 2011. 19(6): p. 617-23.

35. Maher, E.R., et al., Clinical features and natural history of von Hippel-Lindau disease. Q J Med, 1990. 77(283): p. 1151-63.

36. Richards, F.M., et al., Molecular analysis of de novo germline mutations in the von Hippel-Lindau disease gene. Hum Mol Genet, 1995. 4(11): p. 2139-43.

37. Melmon, K.L. and S.W. Rosen, LINDAU'S DISEASE. REVIEW OF THE LITERATURE AND STUDY OF A LARGE KINDRED. Am J Med, 1964. 36: p. 595-617.

38. Seizinger, B.R., et al., Von Hippel-Lindau disease maps to the region of chromosome 3 associated with renal cell carcinoma. Nature, 1988. 332(6161): p. 268-9.

39. Gossage, L., T. Eisen, and E.R. Maher, VHL, the story of a tumour suppressor gene. Nat Rev Cancer, 2015. 15(1): p. 55-64.

40. Franke, G., et al., Alu-Alu recombination underlies the vast majority of large VHL germline deletions: Molecular characterization and genotype-phenotype correlations in VHL patients. Hum Mutat, 2009. 30(5): p. 776-86.

41. Ang, S.O., et al., Endemic polycythemia in Russia: mutation in the VHL gene. Blood Cells Mol Dis, 2002. 28(1): p. 57-62.

42. Ang, S.O., et al., Disruption of oxygen homeostasis underlies congenital Chuvash polycythemia. Nat Genet, 2002. 32(4): p. 614-21.

43. Schoenfeld, A., E.J. Davidowitz, and R.D. Burk, A second major native von Hippel- Lindau gene product, initiated from an internal translation start site, functions as a tumour suppressor. Proc Natl Acad Sci U S A, 1998. 95(15): p. 8817-22.

168

44. Iliopoulos, O., M. Ohh, and W.G. Kaelin, Jr., pVHL19 is a biologically active product of the von Hippel-Lindau gene arising from internal translation initiation. Proc Natl Acad Sci U S A, 1998. 95(20): p. 11661-6.

45. Stebbins, C.E., W.G. Kaelin, Jr., and N.P. Pavletich, Structure of the VHL-ElonginC- ElonginB complex: implications for VHL tumour suppressor function. Science, 1999. 284(5413): p. 455-61.

46. Iliopoulos, O., et al., Tumour suppression by the human von Hippel-Lindau gene product. Nat Med, 1995. 1(8): p. 822-6.

47. Min, J.H., et al., Structure of an HIF-1alpha -pVHL complex: hydroxyproline recognition in signaling. Science, 2002. 296(5574): p. 1886-9.

48. Beroud, C., et al., Software and database for the analysis of mutations in the VHL gene. Nucleic Acids Res, 1998. 26(1): p. 256-8.

49. Chung, J., et al., Homotypic association between tumour-associated VHL proteins leads to the restoration of HIF pathway. Oncogene, 2006. 25(21): p. 3079-83.

50. Foster, K., et al., Somatic mutations of the von Hippel-Lindau disease tumour suppressor gene in non-familial clear cell renal carcinoma. Hum Mol Genet, 1994. 3(12): p. 2169- 73.

51. Gnarra, J.R., et al., Mutations of the VHL tumour suppressor gene in renal carcinoma. Nat Genet, 1994. 7(1): p. 85-90.

52. Herman, J.G., et al., Silencing of the VHL tumour-suppressor gene by DNA methylation in renal carcinoma. Proc Natl Acad Sci U S A, 1994. 91(21): p. 9700-4.

53. Dulaimi, E., et al., Promoter hypermethylation profile of kidney cancer. Clin Cancer Res, 2004. 10(12 Pt 1): p. 3972-9.

54. Moore, L.E., et al., Von Hippel-Lindau (VHL) inactivation in sporadic clear cell renal cancer: associations with germline VHL polymorphisms and etiologic risk factors. PLoS Genet, 2011. 7(10): p. e1002312.

55. Liu, Z., et al., cDNA cloning of a novel human ubiquitin carrier protein. An antigenic domain specifically recognized by endemic pemphigus foliaceus autoantibodies is encoded in a secondary reading frame of this human epidermal transcript. The Journal of biological chemistry, 1992. 267(22): p. 15829-35.

56. Jung, C.R., et al., E2-EPF UCP targets pVHL for degradation and associates with tumour growth and metastasis. Nat Med, 2006. 12(7): p. 809-16.

57. Pozzebon, M.E., et al., BC-box protein domain-related mechanism for VHL protein degradation. Proc Natl Acad Sci U S A, 2013. 110(45): p. 18168-73.

169

58. Schoenfeld, A.R., E.J. Davidowitz, and R.D. Burk, Elongin BC complex prevents degradation of von Hippel-Lindau tumour suppressor gene products. Proc Natl Acad Sci U S A, 2000. 97(15): p. 8507-12.

59. Stickle, N.H., et al., pVHL modification by NEDD8 is required for fibronectin matrix assembly and suppression of tumour development. Mol Cell Biol, 2004. 24(8): p. 3251- 61.

60. Cai, Q. and E.S. Robertson, Ubiquitin/SUMO modification regulates VHL protein stability and nucleocytoplasmic localization. PloS one, 2010. 5(9).

61. Cai, Q., et al., Hypoxia inactivates the VHL tumour suppressor through PIASy-mediated SUMO modification. PloS one, 2010. 5(3): p. e9720.

62. Ampofo, E., et al., Phosphorylation of the von Hippel-Lindau protein (VHL) by protein kinase CK2 reduces its protein stability and affects p53 and HIF-1alpha mediated transcription. Int J Biochem Cell Biol, 2010. 42(10): p. 1729-35.

63. German, P., et al., Phosphorylation-dependent cleavage regulates von Hippel Lindau proteostasis and function. Oncogene, 2016. 35(38): p. 4973-80.

64. Mohan, S. and R.D. Burk, von Hippel-Lindau protein complex is regulated by cell density. Oncogene, 2003. 22(34): p. 5270-80.

65. Gnarra, J.R., et al., Defective placental vasculogenesis causes embryonic lethality in VHL-deficient mice. Proc Natl Acad Sci U S A, 1997. 94(17): p. 9102-7.

66. Na, X., et al., Overproduction of vascular endothelial growth factor related to von Hippel-Lindau tumour suppressor gene mutations and hypoxia-inducible factor-1 alpha expression in renal cell carcinomas. J Urol, 2003. 170(2 Pt 1): p. 588-92.

67. Siemeister, G., et al., Reversion of deregulated expression of vascular endothelial growth factor in human renal carcinoma cells by von Hippel-Lindau tumour suppressor protein. Cancer Res, 1996. 56(10): p. 2299-301.

68. Ananth, S., et al., Transforming growth factor beta1 is a target for the von Hippel-Lindau tumour suppressor and a critical growth factor for clear cell renal carcinoma. Cancer Res, 1999. 59(9): p. 2210-6.

69. Zhang, S., et al., Loss of VHL expression contributes to epithelial-mesenchymal transition in oral squamous cell carcinoma. Oral Oncol, 2014. 50(9): p. 809-17.

70. Zehetner, J., et al., PVHL is a regulator of glucose metabolism and insulin secretion in pancreatic beta cells. Genes Dev, 2008. 22(22): p. 3135-46.

71. Schermer, B., et al., The von Hippel-Lindau tumour suppressor protein controls ciliogenesis by orienting microtubule growth. J Cell Biol, 2006. 175(4): p. 547-54.

170

72. Pause, A., et al., The von Hippel-Lindau tumour suppressor gene is required for cell cycle exit upon serum withdrawal. Proc Natl Acad Sci U S A, 1998. 95(3): p. 993-8.

73. Roe, J.S., et al., p53 stabilization and transactivation by a von Hippel-Lindau protein. Mol Cell, 2006. 22(3): p. 395-405.

74. Ohh, M., et al., The von Hippel-Lindau tumour suppressor protein is required for proper assembly of an extracellular fibronectin matrix. Mol Cell, 1998. 1(7): p. 959-68.

75. Tang, N., et al., pVHL function is essential for endothelial extracellular matrix deposition. Mol Cell Biol, 2006. 26(7): p. 2519-30.

76. Melvin, A. and S. Rocha, Chromatin as an oxygen sensor and active player in the hypoxia response. Cell Signal, 2012. 24(1): p. 35-43.

77. Wang, F., et al., Roles of Brahma and Brahma/SWI2-related gene 1 in hypoxic induction of the erythropoietin gene. J Biol Chem, 2004. 279(45): p. 46733-41.

78. Shahrzad, S., et al., Induction of DNA hypomethylation by tumour hypoxia. Epigenetics, 2007. 2(2): p. 119-25.

79. Okami, J., D.M. Simeone, and C.D. Logsdon, Silencing of the hypoxia-inducible cell death protein BNIP3 in pancreatic cancer. Cancer Res, 2004. 64(15): p. 5338-46.

80. Jakubickova, L., et al., Methylation of the CA9 promoter can modulate expression of the tumour-associated carbonic anhydrase IX in dense carcinoma cell lines. Int J Oncol, 2005. 26(4): p. 1121-7.

81. Huang, K.T., et al., DNA methylation analysis of the HIF-1alpha prolyl hydroxylase domain genes PHD1, PHD2, PHD3 and the factor inhibiting HIF gene FIH in invasive breast carcinomas. Histopathology, 2010. 57(3): p. 451-60.

82. Tsukada, Y., et al., Histone demethylation by a family of JmjC domain-containing proteins. Nature, 2006. 439(7078): p. 811-6.

83. Marino-Ramirez, L., et al., Histone structure and nucleosome stability. Expert Rev Proteomics, 2005. 2(5): p. 719-29.

84. Strahl, B.D. and C.D. Allis, The language of covalent histone modifications. Nature, 2000. 403(6765): p. 41-5.

85. Tan, M., et al., Identification of 67 histone marks and histone lysine crotonylation as a new type of histone modification. Cell, 2011. 146(6): p. 1016-28.

86. Kouzarides, T., Chromatin modifications and their function. Cell, 2007. 128(4): p. 693- 705.

171

87. Wang, Z., et al., Combinatorial patterns of histone acetylations and methylations in the human genome. Nat Genet, 2008. 40(7): p. 897-903.

88. Wei, Y., et al., Phosphorylation of histone H3 at serine 10 is correlated with chromosome condensation during mitosis and meiosis in Tetrahymena. Proc Natl Acad Sci U S A, 1998. 95(13): p. 7480-4.

89. Champagne, K.S. and T.G. Kutateladze, Structural insight into histone recognition by the ING PHD fingers. Curr Drug Targets, 2009. 10(5): p. 432-41.

90. Maurer-Stroh, S., et al., The Tudor domain 'Royal Family': Tudor, plant Agenet, Chromo, PWWP and MBT domains. Trends Biochem Sci, 2003. 28(2): p. 69-74.

91. Kim, J., et al., Tudor, MBT and chromo domains gauge the degree of lysine methylation. EMBO Rep, 2006. 7(4): p. 397-403.

92. Bannister, A.J., et al., Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature, 2001. 410(6824): p. 120-4.

93. Byvoet, P., et al., The distribution and turnover of labeled methyl groups in histone fractions of cultured mammalian cells. Arch Biochem Biophys, 1972. 148(2): p. 558-67.

94. Murray, K., The Occurrence of Epsilon-N-Methyl Lysine in Histones. Biochemistry, 1964. 3: p. 10-5.

95. Hempel, K., H.W. Lange, and L. Birkofer, [Epsilon-N-trimethyllysine, a new amino acid in histones]. Naturwissenschaften, 1968. 55(1): p. 37.

96. Borun, T.W., D. Pearson, and W.K. Paik, Studies of histone methylation during the HeLa S-3 cell cycle. J Biol Chem, 1972. 247(13): p. 4288-98.

97. Schneider, R., et al., Histone H3 lysine 4 methylation patterns in higher eukaryotic genes. Nat Cell Biol, 2004. 6(1): p. 73-7.

98. Greer, E.L. and Y. Shi, Histone methylation: a dynamic mark in health, disease and inheritance. Nat Rev Genet, 2012. 13(5): p. 343-57.

99. Hon, G.C., R.D. Hawkins, and B. Ren, Predictive chromatin signatures in the mammalian genome. Hum Mol Genet, 2009. 18(R2).

100. Bedford, M.T. and S.G. Clarke, Protein arginine methylation in mammals: who, what, and why. Mol Cell, 2009. 33(1): p. 1-13.

101. Rea, S., et al., Regulation of chromatin structure by site-specific histone H3 methyltransferases. Nature, 2000. 406(6796): p. 593-9.

102. Rice, J.C., et al., Histone methyltransferases direct different degrees of methylation to define distinct chromatin domains. Mol Cell, 2003. 12(6): p. 1591-8.

172

103. Shi, Y., et al., Histone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell, 2004. 119(7): p. 941-53.

104. Maures, T.J., et al., The H3K27 demethylase UTX-1 regulates C. elegans lifespan in a germline-independent, insulin-dependent manner. Aging Cell, 2011. 10(6): p. 980-90.

105. Zegerman, P., et al., Histone H3 lysine 4 methylation disrupts binding of nucleosome remodelling and deacetylase (NuRD) repressor complex. J Biol Chem, 2002. 277(14): p. 11621-4.

106. Takeuchi, T., et al., Gene trap capture of a novel mouse gene, jumonji, required for neural tube formation. Genes Dev, 1995. 9(10): p. 1211-22.

107. Rossant, J. and J.C. Cross, Placental development: lessons from mouse mutants. Nat Rev Genet, 2001. 2(7): p. 538-48.

108. Clissold, P.M. and C.P. Ponting, JmjC: cupin metalloenzyme-like domains in jumonji, hairless and phospholipase A2beta. Trends Biochem Sci, 2001. 26(1): p. 7-9.

109. Balciunas, D. and H. Ronne, Evidence of domain swapping within the jumonji family of transcription factors. Trends Biochem Sci, 2000. 25(6): p. 274-6.

110. Dunwell, J.M., S. Khuri, and P.J. Gane, Microbial relatives of the seed storage proteins of higher plants: conservation of structure and diversification of function during evolution of the cupin superfamily. Microbiol Mol Biol Rev, 2000. 64(1): p. 153-79.

111. Elkins, J.M., et al., Structure of factor-inhibiting hypoxia-inducible factor (HIF) reveals mechanism of oxidative modification of HIF-1 alpha. J Biol Chem, 2003. 278(3): p. 1802-6.

112. Quan, Z., S.G. Oliver, and N. Zhang, JmjN interacts with JmjC to ensure selective proteolysis of Gis1 by the proteasome. Microbiology, 2011. 157(Pt 9): p. 2694-701.

113. Huang, F., et al., The JmjN domain of Jhd2 is important for its protein stability, and the plant homeodomain (PHD) finger mediates its chromatin association independent of H3K4 methylation. J Biol Chem, 2010. 285(32): p. 24548-61.

114. Chen, Y., et al., Crystal structure of human histone lysine-specific demethylase 1 (LSD1). Proc Natl Acad Sci U S A, 2006. 103(38): p. 13956-61.

115. Rudolph, T., S. Beuch, and G. Reuter, Lysine-specific histone demethylase LSD1 and the dynamic control of chromatin. Biol Chem, 2013. 394(8): p. 1019-28.

116. Beyer, S., et al., The histone demethylases JMJD1A and JMJD2B are transcriptional targets of hypoxia-inducible factor HIF. The Journal of biological chemistry, 2008. 283(52): p. 36542-52.

173

117. Xia, X., et al., Integrative analysis of HIF binding and transactivation reveals its role in maintaining histone methylation homeostasis. Proc Natl Acad Sci U S A, 2009. 106(11): p. 4260-5.

118. Wolf, A., C. Schmitz, and A. Bottger, Changing story of the receptor for phosphatidylserine-dependent clearance of apoptotic cells. EMBO Rep, 2007. 8(5): p. 465-9.

119. Shmakova, A., et al., Chromatin and oxygen sensing in the context of JmjC histone demethylases. Biochem J, 2014. 462(3): p. 385-95.

120. Luo, W., et al., Histone demethylase JMJD2C is a coactivator for hypoxia-inducible factor 1 that is required for breast cancer progression. Proc Natl Acad Sci U S A, 2012. 109(49): p. E3367-76.

121. Fadok, V.A., et al., A receptor for phosphatidylserine-specific clearance of apoptotic cells. Nature, 2000. 405(6782): p. 85-90.

122. Cikala, M., et al., The phosphatidylserine receptor from Hydra is a nuclear protein with potential Fe(II) dependent oxygenase activity. BMC Cell Biol, 2004. 5: p. 26.

123. Cui, P., et al., Nuclear localization of the phosphatidylserine receptor protein via multiple nuclear localization signals. Exp Cell Res, 2004. 293(1): p. 154-63.

124. Hahn, P., et al., Genomic structure and expression of Jmjd6 and evolutionary analysis in the context of related JmjC domain containing proteins. BMC Genomics, 2008. 9(293): p. 1471-2164.

125. Bose, J., et al., The phosphatidylserine receptor has essential functions during embryogenesis but not in apoptotic cell removal. J Biol, 2004. 3(4): p. 23.

126. Li, M.O., et al., Phosphatidylserine receptor is required for clearance of apoptotic cells. Science, 2003. 302(5650): p. 1560-3.

127. Kunisaki, Y., et al., Defective fetal liver erythropoiesis and T lymphopoiesis in mice lacking the phosphatidylserine receptor. Blood, 2004. 103(9): p. 3362-4.

128. Chang, B., et al., JMJD6 is a histone arginine demethylase. Science, 2007. 318(5849): p. 444-7.

129. Hahn, P., et al., Analysis of Jmjd6 cellular localization and testing for its involvement in histone demethylation. PLoS One, 2010. 5(10): p. 0013769.

130. Walport, L.J., R.J. Hopkinson, and R. Chowdhury, Arginine demethylation is catalysed by a subset of JmjC histone lysine demethylases. 2016. 7: p. 11974.

131. Poulard, C., et al., JMJD6 regulates ERalpha methylation on arginine. PLoS One, 2014. 9(2): p. e87982.

174

132. Tikhanovich, I., et al., Dynamic Arginine Methylation of Tumour Necrosis Factor (TNF) Receptor-associated Factor 6 Regulates Toll-like Receptor Signaling. J Biol Chem, 2015. 290(36): p. 22236-49.

133. Lawrence, P., J.S. Conderino, and E. Rieder, Redistribution of demethylated RNA helicase A during foot-and-mouth disease virus infection: role of Jumonji C-domain containing protein 6 in RHA demethylation. Virology, 2014. 452-453: p. 1-11.

134. Gao, W.W., et al., Arginine methylation of HSP70 regulates retinoid acid-mediated RARbeta2 gene activation. Proc Natl Acad Sci U S A, 2015. 112(26): p. E3327-36.

135. Wu, T.F., et al., Loading of PAX3 to Mitotic Chromosomes Is Mediated by Arginine Methylation and Associated with Waardenburg Syndrome. J Biol Chem, 2015. 290(33): p. 20556-64.

136. Webby, C.J., et al., Jmjd6 catalyses lysyl-hydroxylation of U2AF65, a protein associated with RNA splicing. Science, 2009. 325(5936): p. 90-3.

137. Wang, F., et al., JMJD6 promotes colon carcinogenesis through negative regulation of p53 by hydroxylation. PLoS Biol, 2014. 12(3).

138. Unoki, M., et al., Lysyl 5-hydroxylation, a novel histone modification, by Jumonji domain containing 6 (JMJD6). J Biol Chem, 2013. 288(9): p. 6053-62.

139. Boeckel, J.N., et al., Jumonji domain-containing protein 6 (Jmjd6) is required for angiogenic sprouting and regulates splicing of VEGF-receptor 1. Proc Natl Acad Sci U S A, 2011. 108(8): p. 3276-81.

140. Yi, J., et al., JMJD6 and U2AF65 co-regulate alternative splicing in both JMJD6 enzymatic activity dependent and independent manner. Nucleic Acids Res, 2016.

141. Lee, Y.F., et al., JMJD6 is a driver of cellular proliferation and motility and a marker of poor prognosis in breast cancer. Breast Cancer Res, 2012. 14(3).

142. Poulard, C., et al., Role of JMJD6 in Breast Tumourigenesis. PLoS One, 2015. 10(5).

143. Wang, F., et al., JMJD6 promotes colon carcinogenesis through negative regulation of p53 by hydroxylation. PLoS Biol, 2014. 12(3): p. e1001819.

144. Hamilton, W.J. and J.D. Boyd, Development of the human placenta in the first three months of gestation. J Anat, 1960. 94: p. 297-328.

145. Castellucci, M., et al., Villous sprouting: fundamental mechanisms of human placental development. Hum Reprod Update, 2000. 6(5): p. 485-94.

146. Graham, C.H. and P.K. Lala, Mechanism of control of trophoblast invasion in situ. J Cell Physiol, 1991. 148(2): p. 228-34.

175

147. Simon, M.C. and B. Keith, The role of oxygen availability in embryonic development and stem cell function. Nat Rev Mol Cell Biol, 2008. 9(4): p. 285-96.

148. Caniggia, I., et al., Endoglin regulates trophoblast differentiation along the invasive pathway in human placental villous explants. Endocrinology, 1997. 138(11): p. 4977-88.

149. Pijnenborg, R., et al., Uteroplacental arterial changes related to interstitial trophoblast migration in early human pregnancy. Placenta, 1983. 4(4): p. 397-413.

150. Jauniaux, E., B. Gulbis, and G.J. Burton, The human first trimester gestational sac limits rather than facilitates oxygen transfer to the foetus--a review. Placenta, 2003. 24 Suppl A: p. S86-93.

151. Jaffe, R., E. Jauniaux, and J. Hustin, Maternal circulation in the first-trimester human placenta--myth or reality? Am J Obstet Gynecol, 1997. 176(3): p. 695-705.

152. Watson, A.L., et al., Susceptibility of human placental syncytiotrophoblastic mitochondria to oxygen-mediated damage in relation to gestational age. J Clin Endocrinol Metab, 1998. 83(5): p. 1697-705.

153. Caniggia, I., et al., Hypoxia-inducible factor-1 mediates the biological effects of oxygen on human trophoblast differentiation through TGFbeta(3). J Clin Invest, 2000. 105(5): p. 577-87.

154. Ietta, F., et al., Dynamic HIF1A regulation during human placental development. Biology of reproduction, 2006. 75(1): p. 112-21.

155. Rajakumar, A. and K.P. Conrad, Expression, ontogeny, and regulation of hypoxia- inducible transcription factors in the human placenta. Biology of reproduction, 2000. 63(2): p. 559-69.

156. Genbacev, O., et al., Hypoxia alters early gestation human cytotrophoblast differentiation/invasion in vitro and models the placental defects that occur in preeclampsia. J Clin Invest, 1996. 97(2): p. 540-50.

157. MacPhee, D.J., et al., Focal adhesion kinase is a key mediator of human trophoblast development. Lab Invest, 2001. 81(11): p. 1469-83.

158. Jaffe, R. and S.L. Warsof, Transvaginal color Doppler imaging in the assessment of uteroplacental blood flow in the normal first-trimester pregnancy. Am J Obstet Gynecol, 1991. 164(3): p. 781-5.

159. Jauniaux, E., et al., Onset of maternal arterial blood flow and placental oxidative stress. A possible factor in human early pregnancy failure. Am J Pathol, 2000. 157(6): p. 2111- 22.

160. Genbacev, O., et al., Regulation of human placental development by oxygen tension. Science, 1997. 277(5332): p. 1669-72.

176

161. Adelman, D.M., et al., Placental cell fates are regulated in vivo by HIF-mediated hypoxia responses. Genes Dev, 2000. 14(24): p. 3191-203.

162. Kotch, L.E., et al., Defective vascularization of HIF-1alpha-null embryos is not associated with VEGF deficiency but with mesenchymal cell death. Dev Biol, 1999. 209(2): p. 254-67.

163. Iyer, N.V., et al., Cellular and developmental control of O2 homeostasis by hypoxia- inducible factor 1 alpha. Genes Dev, 1998. 12(2): p. 149-62.

164. Peng, J., et al., The transcription factor EPAS-1/hypoxia-inducible factor 2alpha plays an important role in vascular remodelling. Proc Natl Acad Sci U S A, 2000. 97(15): p. 8386-91.

165. Cowden Dahl, K.D., et al., Hypoxia-inducible factors 1alpha and 2alpha regulate trophoblast differentiation. Molecular and cellular biology, 2005. 25(23): p. 10479-91.

166. Carmeliet, P., et al., Role of HIF-1alpha in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature, 1998. 394(6692): p. 485-90.

167. De Marco, C.S. and I. Caniggia, Mechanisms of oxygen sensing in human trophoblast cells. Placenta, 2002. 23 Suppl A: p. S58-68.

168. Ness, R.B. and B.M. Sibai, Shared and disparate components of the pathophysiologies of fetal growth restriction and preeclampsia. Am J Obstet Gynecol, 2006. 195(1): p. 40-9.

169. Kaufmann, P., S. Black, and B. Huppertz, Endovascular trophoblast invasion: implications for the pathogenesis of intrauterine growth retardation and preeclampsia. Biol Reprod, 2003. 69(1): p. 1-7.

170. Walker, J.J., Pre-eclampsia. Lancet, 2000. 356(9237): p. 1260-5.

171. Hypertension in pregnancy. Report of the American College of Obstetricians and Gynecologists' Task Force on Hypertension in Pregnancy. Obstetrics and gynecology, 2013. 122(5): p. 1122-31.

172. Raymond, D. and E. Peterson, A critical review of early-onset and late-onset preeclampsia. Obstetrical & gynecological survey, 2011. 66(8): p. 497-506.

173. Stepan, H., et al., Predictive value of maternal angiogenic factors in second trimester pregnancies with abnormal uterine perfusion. Hypertension, 2007. 49(4): p. 818-24.

174. Huppertz, B., Placental origins of preeclampsia: challenging the current hypothesis. Hypertension, 2008. 51(4): p. 970-5.

175. Barker, D.J., The fetal and infant origins of adult disease. Bmj, 1990. 301(6761): p. 1111.

177

176. Anderson, C.M., Preeclampsia: exposing future cardiovascular risk in mothers and their children. J Obstet Gynecol Neonatal Nurs, 2007. 36(1): p. 3-8.

177. Ratsep, M.T., et al., Impact of preeclampsia on cognitive function in the offspring. Behav Brain Res, 2016. 302: p. 175-81.

178. Brosens, I.A., W.B. Robertson, and H.G. Dixon, The role of the spiral arteries in the pathogenesis of preeclampsia. Obstet Gynecol Annu, 1972. 1: p. 177-91.

179. Roberts, J.M. and D.W. Cooper, Pathogenesis and genetics of pre-eclampsia. Lancet, 2001. 357(9249): p. 53-6.

180. Sohlberg, S., et al., Placental perfusion in normal pregnancy and early and late preeclampsia: a magnetic resonance imaging study. Placenta, 2014. 35(3): p. 202-6.

181. Soleymanlou, N., et al., Molecular evidence of placental hypoxia in preeclampsia. J Clin Endocrinol Metab, 2005. 90(7): p. 4299-308.

182. Nevo, O., et al., Increased expression of sFlt-1 in in vivo and in vitro models of human placental hypoxia is mediated by HIF-1. Am J Physiol Regul Integr Comp Physiol, 2006. 291(4): p. R1085-93.

183. Venkatesha, S., et al., Soluble endoglin contributes to the pathogenesis of preeclampsia. Nat Med, 2006. 12(6): p. 642-9.

184. Maynard, S.E., et al., Excess placental soluble fms-like tyrosine kinase 1 (sFlt1) may contribute to endothelial dysfunction, hypertension, and proteinuria in preeclampsia. The Journal of clinical investigation, 2003. 111(5): p. 649-58.

185. Nevo, O., D.K. Lee, and I. Caniggia, Attenuation of VEGFR-2 expression by sFlt-1 and low oxygen in human placenta. PLoS One, 2013. 8(11): p. e81176.

186. Yinon, Y., et al., Severe intrauterine growth restriction pregnancies have increased placental endoglin levels: hypoxic regulation via transforming growth factor-beta 3. Am J Pathol, 2008. 172(1): p. 77-85.

187. Caniggia, I. and J.L. Winter, Adriana and Luisa Castellucci Award lecture 2001. Hypoxia inducible factor-1: oxygen regulation of trophoblast differentiation in normal and preeclamptic pregnancies--a review. Placenta, 2002. 23 Suppl A: p. S47-57.

188. Rajakumar, A., et al., Evidence for the functional activity of hypoxia-inducible transcription factors overexpressed in preeclamptic placentae. Placenta, 2004. 25(10): p. 763-9.

189. Rolfo, A., et al., Abnormalities in oxygen sensing define early and late onset preeclampsia as distinct pathologies. PloS one, 2010. 5(10): p. e13288.

178

190. Guerby, P., et al., [Oxidative stress and preeclampsia: A review]. Gynecol Obstet Fertil, 2015. 43(11): p. 751-6.

191. Pialoux, V., et al., Relationship between oxidative stress and HIF-1 alpha mRNA during sustained hypoxia in humans. Free Radic Biol Med, 2009. 46(2): p. 321-6.

192. Moore, L.G., et al., Maternal adaptation to high-altitude pregnancy: an experiment of nature--a review. Placenta, 2004. 25(71): p. S60-71.

193. Zamudio, S., et al., Human placental hypoxia-inducible factor-1alpha expression correlates with clinical outcomes in chronic hypoxia in vivo. The American journal of pathology, 2007. 170(6): p. 2171-9.

194. Melland-Smith, M., et al., Disruption of sphingolipid metabolism augments ceramide- induced autophagy in preeclampsia. Autophagy, 2015. 11(4): p. 653-69.

195. Kingdom, J.C. and P. Kaufmann, Oxygen and placental villous development: origins of fetal hypoxia. Placenta, 1997. 18(8): p. 613-21; discussion 623-6.

196. Regnault, T.R., et al., The relationship between transplacental O2 diffusion and placental expression of PlGF, VEGF and their receptors in a placental insufficiency model of fetal growth restriction. J Physiol, 2003. 550(Pt 2): p. 641-56.

197. Goldman-Wohl, D. and S. Yagel, Regulation of trophoblast invasion: from normal implantation to pre-eclampsia. Mol Cell Endocrinol, 2002. 187(1-2): p. 233-8.

198. Meng, T., et al., Identification of differential gene expression profiles in placentas from preeclamptic pregnancies versus normal pregnancies by DNA microarrays. Omics, 2012. 16(6): p. 301-11.

199. Centlow, M., et al., Differential gene expression analysis of placentas with increased vascular resistance and pre-eclampsia using whole-genome microarrays. J Pregnancy, 2011. 472354(10): p. 8.

200. Louwen, F., et al., A lesson for cancer research: placental microarray gene analysis in preeclampsia. Oncotarget, 2012. 3(8): p. 759-73.

201. Williams, P.J. and F. Broughton Pipkin, The genetics of pre-eclampsia and other hypertensive disorders of pregnancy. Best Pract Res Clin Obstet Gynaecol, 2011. 25(4): p. 405-17.

202. Leavey, K., S.A. Bainbridge, and B.J. Cox, Large scale aggregate microarray analysis reveals three distinct molecular subclasses of human preeclampsia. PLoS One, 2015. 10(2).

203. Pozharny, Y., et al., Genomic loss of imprinting in first-trimester human placenta. Am J Obstet Gynecol, 2010. 202(4): p. 039.

179

204. Lambertini, L., et al., A sensitive functional assay reveals frequent loss of genomic imprinting in human placenta. Epigenetics, 2008. 3(5): p. 261-9.

205. Novakovic, B. and R. Saffery, The ever growing complexity of placental epigenetics - role in adverse pregnancy outcomes and fetal programming. Placenta, 2012. 33(12): p. 959-70.

206. Kulkarni, A., et al., Global DNA methylation patterns in placenta and its association with maternal hypertension in pre-eclampsia. DNA Cell Biol, 2011. 30(2): p. 79-84.

207. Yu, L., et al., The H19 gene imprinting in normal pregnancy and pre-eclampsia. Placenta, 2009. 30(5): p. 443-7.

208. Martin, E., et al., Epigenetics and Preeclampsia: Defining Functional Epimutations in the Preeclamptic Placenta Related to the TGF-beta Pathway. PLoS One, 2015. 10(10).

209. Koukoura, O., et al., Loss of imprinting and aberrant methylation of IGF2 in placentas from pregnancies complicated with fetal growth restriction. Int J Mol Med, 2011. 28(4): p. 481-7.

210. Koukoura, O., et al., Hypomethylation along with increased H19 expression in placentas from pregnancies complicated with fetal growth restriction. Placenta, 2011. 32(1): p. 51- 7.

211. Morris, A.C., et al., Kinetics of a gamma interferon response: expression and assembly of CIITA promoter IV and inhibition by methylation. Molecular and cellular biology, 2002. 22(13): p. 4781-91.

212. Kimura, A.P., S.A. Liebhaber, and N.E. Cooke, Epigenetic modifications at the human growth hormone locus predict distinct roles for histone acetylation and methylation in placental gene activation. Mol Endocrinol, 2004. 18(4): p. 1018-32.

213. Rahman, S., et al., The Brd4 extraterminal domain confers transcription activation independent of pTEFb by recruiting multiple proteins, including NSD3. Molecular and cellular biology, 2011. 31(13): p. 2641-52.

214. Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001. 25(4): p. 402-8.

215. Young, A.C., et al., Analysis of VHL Gene Alterations and their Relationship to Clinical Parameters in Sporadic Conventional Renal Cell Carcinoma. Clin Cancer Res, 2009. 15(24): p. 7582-7592.

216. Alahari, S., M. Post, and I. Caniggia, Jumonji Domain Containing Protein 6: A Novel Oxygen Sensor in the Human Placenta. Endocrinology, 2015. 156(8): p. 3012-25.

180

217. Liu, W., et al., Brd4 and JMJD6-associated anti-pause enhancers in regulation of transcriptional pause release. Cell, 2013. 155(7): p. 1581-95.

218. Rayman, M.P., et al., Abnormal iron parameters in the pregnancy syndrome preeclampsia. Am J Obstet Gynecol, 2002. 187(2): p. 412-8.

219. Serdar, Z., E. Gur, and O. Develioglu, Serum iron and copper status and oxidative stress in severe and mild preeclampsia. Cell Biochem Funct, 2006. 24(3): p. 209-15.

220. Kondo, Y., Epigenetic cross-talk between DNA methylation and histone modifications in human cancers. Yonsei Med J, 2009. 50(4): p. 455-63.

221. Li, L.C. and R. Dahiya, MethPrimer: designing primers for methylation PCRs. Bioinformatics, 2002. 18(11): p. 1427-31.

222. Frommer, M., et al., A genomic sequencing protocol that yields a positive display of 5- methylcytosine residues in individual DNA strands. Proc Natl Acad Sci U S A, 1992. 89(5): p. 1827-31.

223. Christman, J.K., 5-Azacytidine and 5-aza-2'-deoxycytidine as inhibitors of DNA methylation: mechanistic studies and their implications for cancer therapy. Oncogene, 2002. 21(35): p. 5483-95.

224. Soleymanlou, N., et al., Molecular evidence of placental hypoxia in preeclampsia. The Journal of clinical endocrinology and metabolism, 2005. 90(7): p. 4299-308.

225. Besarab, A., et al., Roxadustat (FG-4592): Correction of Anemia in Incident Dialysis Patients. J Am Soc Nephrol, 2016. 27(4): p. 1225-33.

226. Wu, K., et al., Stabilization of HIF-1alpha by FG-4592 promotes functional recovery and neural protection in experimental spinal cord injury. Brain Res, 2016. 1632: p. 19-26.

227. Wang, L., et al., A small molecule modulates Jumonji histone demethylase activity and selectively inhibits cancer growth. Nat Commun, 2013. 4: p. 2035.

228. Sanchez-Fernandez, E.M., et al., Investigations on the oxygen dependence of a 2- oxoglutarate histone demethylase. Biochem J, 2013. 449(2): p. 491-6.

229. Banks, R.E., et al., Genetic and epigenetic analysis of von Hippel-Lindau (VHL) gene alterations and relationship with clinical variables in sporadic renal cancer. Cancer Res, 2006. 66(4): p. 2000-11.

230. Attwooll, C., E. Lazzerini Denchi, and K. Helin, The E2F family: specific functions and overlapping interests. Embo j, 2004. 23(24): p. 4709-16.

231. Lee, E.Y., et al., E2F4 cooperates with pRB in the development of extra-embryonic tissues. Dev Biol, 2009. 332(1): p. 104-15.

181

232. Zatyka, M., et al., Genetic and functional analysis of the von Hippel-Lindau (VHL) tumour suppressor gene promoter. J Med Genet, 2002. 39(7): p. 463-72.

233. Xu, X., et al., Application of machine learning methods to histone methylation ChIP-Seq data reveals H4R3me2 globally represses gene expression. BMC Bioinformatics, 2010. 11(396): p. 1471-2105.

234. Zhao, Q., et al., PRMT5-mediated methylation of histone H4R3 recruits DNMT3A, coupling histone and DNA methylation in gene silencing. Nat Struct Mol Biol, 2009. 16(3): p. 304-11.

235. Jelinic, P., J.C. Stehle, and P. Shaw, The testis-specific factor CTCFL cooperates with the protein methyltransferase PRMT7 in H19 imprinting control region methylation. PLoS Biol, 2006. 4(11).

236. Rolfo, A., et al., Abnormalities in oxygen sensing define early and late onset preeclampsia as distinct pathologies. PLoS One, 2010. 5(10): p. 0013288.

237. Knauth, K., et al., VHL mutations linked to type 2C von Hippel-Lindau disease cause extensive structural perturbations in pVHL. J Biol Chem, 2009. 284(16): p. 10514-22.

238. Rajakumar, A., et al., Expression of von Hippel Lindau (pVHL) protein in placentae from normal pregnant women and women with preeclampsia. Placenta, 2006. 27(4-5): p. 411- 21.

239. Zamudio, S., et al., Human placental hypoxia-inducible factor-1alpha expression correlates with clinical outcomes in chronic hypoxia in vivo. Am J Pathol, 2007. 170(6): p. 2171-9.

240. Anderson, G.J. and F. Wang, Essential but toxic: controlling the flux of iron in the body. Clin Exp Pharmacol Physiol, 2012. 39(8): p. 719-24.

241. Harned, J., et al., Ceruloplasmin alters intracellular iron regulated proteins and pathways: ferritin, transferrin receptor, glutamate and hypoxia-inducible factor-1alpha. Exp Eye Res, 2012. 97(1): p. 90-7.

242. Frazer, D.M. and G.J. Anderson, The regulation of iron transport. Biofactors, 2014. 40(2): p. 206-14.

243. Chepelev, N.L. and W.G. Willmore, Regulation of iron pathways in response to hypoxia. Free Radic Biol Med, 2011. 50(6): p. 645-66.

244. Chen, H., et al., Identification of zyklopen, a new member of the vertebrate multicopper ferroxidase family, and characterization in rodents and human cells. J Nutr, 2010. 140(10): p. 1728-35.

245. Guller, S., Role of the syncytium in placenta-mediated complications of preeclampsia. Thromb Res, 2009. 124(4): p. 389-92.

182

246. Mukhopadhyay, C.K., B. Mazumder, and P.L. Fox, Role of hypoxia-inducible factor-1 in transcriptional activation of ceruloplasmin by iron deficiency. J Biol Chem, 2000. 275(28): p. 21048-54.

247. Vitoratos, N., et al., Defective antioxidant mechanisms via changes in serum ceruloplasmin and total iron binding capacity of serum in women with pre-eclampsia. Eur J Obstet Gynecol Reprod Biol, 1999. 84(1): p. 63-7.

248. Guller, S., et al., Placental expression of ceruloplasmin in pregnancies complicated by severe preeclampsia. Lab Invest, 2008. 88(10): p. 1057-67.

249. Shakour-Shahabi, L., S. Abbasali-Zadeh, and N. Rashtchi-Zadeh, Serum level and antioxidant activity of ceruloplasmin in preeclampsia. Pak J Biol Sci, 2010. 13(13): p. 621-7.

250. Hu, H., et al., Small Molecule Inhibitors of Protein Arginine Methyltransferases. Expert Opin Investig Drugs, 2016. 25(3): p. 335-58.

251. Caniggia, I., et al., Hypoxia-inducible factor-1 mediates the biological effects of oxygen on human trophoblast differentiation through TGFbeta(3). The Journal of clinical investigation, 2000. 105(5): p. 577-87.

252. Soleymanlou, N., et al., Hypoxic switch in mitochondrial myeloid cell leukemia factor- 1/Mtd apoptotic rheostat contributes to human trophoblast cell death in preeclampsia. The American journal of pathology, 2007. 171(2): p. 496-506.

253. Redman, C.W. and I.L. Sargent, Placental debris, oxidative stress and pre-eclampsia. Placenta, 2000. 21(7): p. 597-602.

254. Klose, R.J., E.M. Kallin, and Y. Zhang, JmjC-domain-containing proteins and histone demethylation. Nat Rev Genet, 2006. 7(9): p. 715-27.

255. Hewitson, K.S., et al., Hypoxia-inducible factor (HIF) asparagine hydroxylase is identical to factor inhibiting HIF (FIH) and is related to the cupin structural family. The Journal of biological chemistry, 2002. 277(29): p. 26351-5.

256. Semenza, G.L., HIF-1 and human disease: one highly involved factor. Genes & development, 2000. 14(16): p. 1983-91.

257. Hubel, C.A., Oxidative stress in the pathogenesis of preeclampsia. Proc Soc Exp Biol Med, 1999. 222(3): p. 222-35.

258. Roberts, J.M. and C.A. Hubel, Is oxidative stress the link in the two-stage model of preeclampsia? Lancet, 1999. 354(9181): p. 788-9.

259. Caniggia, I., et al., Inhibition of TGF-beta 3 restores the invasive capability of extravillous trophoblasts in preeclamptic pregnancies. The Journal of clinical investigation, 1999. 103(12): p. 1641-50.

183

260. Mantri, M., et al., The 2-oxoglutarate-dependent oxygenase JMJD6 catalyses oxidation of lysine residues to give 5S-hydroxylysine residues. Chembiochem, 2011. 12(4): p. 531- 4.

261. Unoki, M., et al., Lysyl 5-hydroxylation, a novel histone modification, by Jumonji domain containing 6 (JMJD6). The Journal of biological chemistry, 2013. 288(9): p. 6053-62.

262. Murad, S. and S.R. Pinnell, Suppression of fibroblast proliferation and lysyl hydroxylase activity by minoxidil. The Journal of biological chemistry, 1987. 262(25): p. 11973-8.

263. Murad, S., et al., Minimum structural requirements for minoxidil inhibition of lysyl hydroxylase in cultured fibroblasts. Arch Biochem Biophys, 1994. 308(1): p. 42-7.

264. Wang, J. and M.A. Maldonado, The ubiquitin-proteasome system and its role in inflammatory and autoimmune diseases. Cell Mol Immunol, 2006. 3(4): p. 255-61.

265. Goldberg, A.L., Development of proteasome inhibitors as research tools and cancer drugs. J Cell Biol, 2012. 199(4): p. 583-8.

266. Clague, M.J. and S. Urbe, Ubiquitin: same molecule, different degradation pathways. Cell, 2010. 143(5): p. 682-5.

267. Mekhail, K., et al., HIF activation by pH-dependent nucleolar sequestration of VHL. Nat Cell Biol, 2004. 6(7): p. 642-7.

268. Berra, E., et al., HIF prolyl-hydroxylase 2 is the key oxygen sensor setting low steady- state levels of HIF-1alpha in normoxia. EMBO J, 2003. 22(16): p. 4082-90.

269. Hautala, T., et al., Minoxidil specifically decreases the expression of lysine hydroxylase in cultured human skin fibroblasts. Biochem J, 1992. 283 ( Pt 1): p. 51-4.

270. Pan, Y., et al., Multiple factors affecting cellular redox status and energy metabolism modulate hypoxia-inducible factor prolyl hydroxylase activity in vivo and in vitro. Molecular and cellular biology, 2007. 27(3): p. 912-25.

271. Lee, Y.F., et al., JMJD6 is a driver of cellular proliferation and motility and a marker of poor prognosis in breast cancer. Breast Cancer Res, 2012. 14(3): p. R85.

272. Sun, Y.Y., et al., Regulation of epithelial-mesenchymal transition by homeobox gene DLX4 in JEG-3 trophoblast cells: a role in preeclampsia. Reprod Sci, 2011. 18(11): p. 1138-45.

273. Golabek, K., et al., Potential use of histone deacetylase inhibitors in cancer therapy. Contemp Oncol (Pozn), 2015. 19(6): p. 436-40.

274. Zhang, D., H.G. Yoon, and J. Wong, JMJD2A is a novel N-CoR-interacting protein and is involved in repression of the human transcription factor achaete scute-like homologue 2 (ASCL2/Hash2). Mol Cell Biol, 2005. 25(15): p. 6404-14.

184

275. Lin, Q., X. Cong, and Z. Yun, Differential hypoxic regulation of hypoxia-inducible factors 1alpha and 2alpha. Mol Cancer Res, 2011. 9(6): p. 757-65.

276. Wang, H., et al., Methylation of histone H4 at arginine 3 facilitating transcriptional activation by nuclear hormone receptor. Science, 2001. 293(5531): p. 853-7.

277. Cedar, H. and Y. Bergman, Linking DNA methylation and histone modification: patterns and paradigms. Nat Rev Genet, 2009. 10(5): p. 295-304.

185