February 2005 ⅐ Vol. 7 ⅐ No. 2 article Clinical testing for multiple endocrine neoplasia type 1 in a DNA diagnostic laboratory Roger D. Klein, MD, Sana Salih, MD, Jesse Bessoni, and Allen E. Bale, MD Purpose: Based on results of diagnostic MEN1 testing, we have attempted to further define the mutational spectrum of the MEN1 gene and the clinical features most frequently associated with MEN1 mutations. Methods: Mutation testing was performed on blood samples by PCR amplification and sequencing of exons 2 to 10 of the MEN1 gene and the corresponding intron-exon junctions. Pedigree phenotypic information was obtained by written questionnaire. Results: Among 288 presumably unrelated pedigrees, 73 independent mutations were found in 89 families. Five mutations were found in 2 pedigrees, and 4 mutations were seen in more than 2 pedigrees. There were 17 nonsense mutations (23.3%), 2 in-frame deletions (2.7%), 18 frameshift-deletion mutations (24.7%), 10 frameshift-insertion or -duplication mutations (13.7%), 13 splice-site mutations (17.8%), and 13 presumptive missense mutations (17.8%). Thirty-nine of 56 pedigrees with parathyroid and pancreatic islet neoplasia tested positive, compared with 4/24 and 8/32 pedigrees affected with hyperparathyroidism or hyperparathyroidism and pituitary tumors. MEN1 mutations were found in 6/20 sporadic patients, all of whom had both parathyroid and pancreatic neoplasms. Of 14 mutation-negative sporadic patients, 10 exhibited hyperparathyroidism and pituitary tumors without islet cell neoplasia. Somatic mosaicism was detected in 1 sporadic patient. Conclusion: Patients from pedigrees with hyperparathyroidism and pancreatic islet tumors are most likely to test positive for MEN1 mutations. Mutations are less often detected in patients from pedigrees with hyperparathyroidism alone or in combination with pituitary tumors without pancreatic islet neoplasia. Sporadic cases are less likely to test positive than familial cases, in part due to somatic mosaicism. Genet Med 2005:7(2):131–138. Key Words: mutation, hyperparathyroidism, pancreatic islet tumor, pituitary tumor, MEN1. MEN1 is an autosomal dominant disorder that is character- the frequency of occurrence may be as high as 25 per 10,000.7 ized by parathyroid (95%–100%), benign and malignant pan- The clinical expression of MEN1 generally manifests in the creatic islet (35%–75%), and anterior pituitary neoplasms third to fourth decade, with nearly complete penetrance by the (15%–40%). Foregut carcinoid tumors (thymic and bron- early fifties. Clinical disease is uncommon before 10 years of chial), adrenocortical hyperplasia, multiple lipomas, facial an- age.1,3,8 giofibromas, and skin collagenomas may also be seen in the The MEN1 gene, located at chromosome 11q13, is approx- syndrome.1–4 Unusual features of MEN1-related tumors in- imately 9.8 kb in length and contains 10 exons. The 1830-bp clude their multiplicity, both within and among target organs, coding region in exons 2 to 10 generates a 610 amino acid and an earlier age of onset than similar sporadic tumors.5 protein of unknown function called “menin.” Menin appears Symptoms in MEN1 are caused by an overproduction of to reside primarily in the nucleus and bears no homology to specific hormones, neoplasm mass effects, or malignant trans- other known proteins. It is expressed in a wide range of tissues formation. Although most tumors in MEN1 patients are be- and is conserved through evolution from Drosophila to hu- nign, pancreatic islet and carcinoid neoplasms have significant mans. Because MEN1-related tumors demonstrate loss of het- malignant potential and are currently the most important erozygosity (LOH) of the chromosome 11q13 region, menin cause of MEN1-related mortality.3,6 Based on biochemical has been proposed to function as a tumor suppressor in accor- data, the prevalence of MEN1 is estimated at 10 to 175 per dance with the Knudson “two-hit” hypothesis.9–13 However, 1,000,000 individuals, although autopsy findings suggest that several investigations suggest that MEN1 may be involved in the maintenance of genomic integrity in a manner similar to From DNA Diagnostic Laboratory, Department of Genetics, Yale University School of Med- that of BRCA1 and BRCA2 or the genes underlying HNPCC, icine, New Haven, Connecticut. which also show LOH in tumors.14,15 Roger D. Klein, MD, DNA Diagnostic Laboratory, Department of Genetics, Yale University The discovery of the MEN1 gene by positional cloning in School of Medicine, 333 Cedar Street, New Haven, CT 06520-8005. 1997 resulted in the development of genetic tests for responsi- Received: September 21, 2004. ble mutations.16,17 Dispersed nonsense, missense, frameshift, Accepted: November 9, 2004. in-frame deletions, and splice-site mutations have been de- DOI: 10.1097/01.GIM.0000153663.62300.F8 scribed in the syndrome, with the majority of pedigrees having Genetics IN Medicine 131 Klein et al. unique mutations. More than 300 mutations in the MEN1 alter restriction sites. Potential splice-site mutations that al- gene have been reported, but no definite genotype-phenotype tered conserved but not invariant bases were confirmed by correlations have been shown.7,18–21 RT-PCR analysis of MEN1 mRNA. In-frame deletions and DNA-based testing for MEN1 provides a means for more missense mutations were judged deleterious if they were not accurate diagnosis. Medical monitoring for signs and symp- found in 200 unaffected individuals, altered highly conserved toms of MEN1-related neoplasms in at-risk individuals can base pairs, and segregated with the disease in those cases for lead to early interventions that are predicted to positively in- which more than one affected family member was available for fluence the course of the disease. Genetic testing has been rec- study. Once the disease causing mutation was identified in a ommended for index cases who meet clinical criteria for famil- family, additional family members were tested by direct se- ial or sporadic MEN1, for those who do not meet formal MEN1 quencing or restriction enzyme digestion. criteria but are suspicious for the syndrome, and for symptom- In one sporadic patient in whom sequencing suggested mo- atic or asymptomatic relatives of patients with known MEN1 saicism for a nonsense mutation, PCR products from the af- mutations. Positive test results can alert presymptomatic fected exon were TA cloned (Invitrogen, Carlsbad, CA) and MEN1 mutation-positive individuals to the need for monitor- directly sequenced. ing, whereas negative tests allow members of affected families to avoid costly, time-consuming, and potentially psychologi- Determining the origin of a recurrent mutation cally distressing screening. Genetic testing can also assist mem- Haplotyping around a recurrent 249delGTCT mutation was bers of MEN1-affected kindreds in family planning.22 performed by PCR amplification of a microsatellite locus at the In this study, we report the results of clinical MEN1 testing human muscle glycogen phosphorylase gene (PYGM) a poly- in a DNA diagnostic laboratory, including data that can assist morphic marker that lies approximately 55 kb 3' to the MEN1 patient counseling and help direct appropriate test ordering. gene,16,20,26 and a CA repeat in the region of the MEN1 gene Because samples and clinical data from patients were not ob- 1680 bp 5' to the start of exon 1 that was developed as part of this tained through a systematic scheme, inaccuracies may have study. The primer sequences used to amplify this latter marker been introduced into some of our results. This objection not- were as follows: F cgcctaattttgtgtgtatg; R agctgggaatccctgtctctg. withstanding, the data are valuable because they reflect the nature, extent, and quality of information likely to be encoun- Statistical analysis tered by “real-world” practitioners. Furthermore, the utility of The statistical significance of differences in the proportions this study is suggested by the concordance of our results and of patients testing positive for MEN1 mutations among various conclusions with those of other investigations with more sys- phenotypes was assessed using the chi-square test or Fisher tematic ascertainment and clinical evaluation of study exact test. subjects. RESULTS MATERIALS AND METHODS Eighty-nine out of the 288 presumably unrelated pedigrees Participants demonstrated MEN1 mutations. Among the 89 MEN1-posi- From October 1997 to May 2003, blood samples from 400 tive pedigrees, 73 independent mutations were identified (Ta- individuals representing 288 pedigrees located primarily in the ble 1). These mutations were scattered throughout the coding United States and Canada were received in the Yale DNA Di- region, with the proportion of mutations found in each exon agnostic Laboratory for MEN1 mutation testing. A request for roughly correlating with exon size (Fig. 1). Most mutations clinical information, including patient and family history, was detected produce truncated proteins. Seventeen nonsense mu- included as a part of our laboratory’s sample requisition form. tations (23.3%), 2 in-frame deletions (2.7%), 18 frameshift- In addition, a one-page patient and family history question- deletion mutations (24.7%), 10 frameshift-insertion or -dupli- naire was mailed to the referring physician or genetic coun- cation mutations (13.7%), 13 splice-site mutations (17.8%), selor for each patient about whom sufficient clinical informa- and 13 presumptive missense mutations (17.8%) were tion did not accompany the sample. Clinical information