DOCSLIB.ORG

Phylogenetics and Species Status of Hawai'i's Endangered Blackburn's

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetics and Species Status of Hawai'i's Endangered Blackburn's Phylogenetics and Species Status of Hawai‘i’s Endangered Blackburn’s Sphinx Moth, Manduca blackburni ( Lepidoptera: Sphingidae)1 Daniel Rubinoff,2,3 Michael San Jose,3 and Akito Y. Kawahara3 Abstract: Manduca blackburni, commonly known as Blackburn’s Sphinx Moth, is a federally listed endangered species restricted to localized habitats on three is- lands in the Hawaiian archipelago. Manduca blackburni was thought to be closely related to the widely distributed New World species M. quinquemaculatus, but this has never been formally tested, and shortly after its description, many au- thors dismissed it as a subspecies or form of M. quinquemaculatus. We used one mitochondrial gene, COI, and two nuclear genes, CAD and EF-1α (2,975 bp total), to examine the phylogenetic relationships between M. blackburni and pu- tative sister species in the genus. The phylogeny resulting from two single-gene analyses (CAD, COI) and the concatenation of all three genes suggest that M. blackburni + M. quinquemaculatus are sister taxa, and the monophyly of each spe- cies is supported with relatively high branch support under parsimony, m aximum likelihood, and Bayesian inference. Manduca blackburni and M. quinquemaculatus also differ in genetic distance for CAD and COI, and we therefore consider them separate species. Thus, our molecular results corroborate previous studies on the morphology of M. blackburni and retain the species rank of this taxon. Our re- sults also indicate that one or more South American subspecies of M. sexta may merit elevation to species. Manduca blackburni (Butler, 1880), com- Historically, M. blackburni was a dry-forest in- monly known as Blackburn’s Sphinx Moth habitant found on all of the main Hawaiian (BSM), is Hawai‘i’s largest endemic insect Islands and was noted as an occasional pest on (Figure 1). Manduca contains 70 species, and eggplant and other solanaceous crops (Zim- M. blackburni has the most isolated distribu- merman 1958), much like its sister species tion of any of them (Kitching et al. 2011). M. quinquemaculatus (Haworth, 1803), in the continental United States. However, M. blackburni was never common, and between 1940 and 1970 the moth was recorded only a 1 This research was supported in part by U.S. Depart- handful of times (U.S. Fish and Wildlife Ser- ment of Agriculture Cooperative State Research, Educa- vice 2005). The Bishop Museum (Honolulu, tion, and Extension Service projects HAW00942-H and Hawai‘i) conducted extensive surveys in the HAW00956-H, both administered by the College of mid-1970s but failed to find M. blackburni, Tropical Agriculture and Human Resources, University of Hawai‘i at Mänoa, Honolulu; and in part by the and the moth was presumed extinct (Gagné National Science Foundation (USA) project no. DEB- and Howarth 1982). The moth was later 0918341. Manuscript accepted 5 June 2011. found to persist in a few isolated populations 2 Corresponding author (e-mail: [email protected]). 3 on East Maui (Riotte 1986) and is now also Department of Plant and Environmental Protection known from parts of the islands of Hawai‘i Sciences, University of Hawai‘i at Mänoa, 3050 Maile Way, Honolulu, Hawai‘i 96822. Current address: Florida and Kaho‘olawe, but it was never rediscov- Museum of Natural History, University of Florida, 3215 ered on the islands of Kaua‘i, Läna‘i, Moloka‘i, Hull Road, Gainesville, Florida 32611-2710. or O‘ahu. Because of M. blackburni’s disap- pearance from several islands and the decline across the remaining islands, the species was Pacific Science (2012), vol. 66, no. 1:31 – 41 doi: 10.2984/66.1.2 declared endangered in 2000, one of only two © 2012 by University of Hawai‘i Press moths to ever receive federal protection (U.S. All rights reserved Fish and Wildlife Service 2005). 31 32 PACIFIC SCIENCE · January 2012 Figure 1. Manduca blackburni (Butler), adult male, from Kokomo, Maui. Photographed 15 December 2009. Scale bar, 2 cm. The species status of M. blackburni re- M. quinquemaculatus. In the most recent mained fairly uncertain until recently when r evision of the Sphingidae, Kitching and considerable morphological work was con- C adiou (2000) also treated M. blackburni as a ducted on its immature stages (Riotte 1986). species. Butler (1880 [1881]) described M. blackburni Despite the morphological taxonomic as a species, but Meyrick (1899) sank black- work conducted, no molecular studies have burni as a subspecies of the widespread M. examined the relationship of M. blackburni to quinquemaculatus. Rothschild and Jordan other species in the genus or tested the species (1903) and Zimmerman (1958) followed status of M. blackburni. Moreover, the origins Meyrick and treated M. blackburni as a sub- of M. blackburni remain obscure, as does the species. Zimmerman (1958) created further degree of divergence from its putative sister confusion by claiming that the continental species M. quinquemaculatus. The purpose of species M. quinquemaculatus is also present in this study is to construct a molecular phylog- Hawai‘i, where it has never been found. Like eny of M. blackburni and its close relatives many prior authors, d’Abrera (1986 [1987]) within Manduca, confirm its taxonomic rank treated M. blackburni as a Hawaiian popula- with molecular data, and assess the approxi- tion of M. quinquemaculatus. Riotte (1986) el- mate time of divergence from its sister spe- evated M. blackburni to species and presented cies. Through the phylogenetic placement of detailed evidence of morphological d ifferences M. blackburni we hope to not only answer the in the larvae and adults of M. blackburni and taxonomic uncertainty concerning Manduca Systematic Relationship of Manduca blackburni and M. quinquemaculatus · Rubinoff et al. 33 TABLE 1 Identification Numbers, Collection Data, and GenBank Accession Numbers for the Species Sampled in This Study UH GenBank Accession Numbers extraction UM sample Species ID voucher ID Locality CAD EF-1α COI M. blackburni (Butler, ms567 — USA: Hawai‘i, Maui, JN170048 JN170063 JN170077 1880) Kanaio M. blackburni (Butler, ms568 — USA: Hawai‘i, Maui, JN170049 JN170064 JN170078 1880) Kanaio M. blackburni (Butler, ms569 — USA: Hawai‘i, Maui, JN170050 JN170065 JN170079 1880) Kanaio M. diffissa (Butler, ms618 WJK-03-2903 Ecuador: Pichincha JN170051 JN170066 JN170080 1871) province, Tinalandia M. hannibal (Cramer, ms619 WJK-03-2904 Ecuador: Pichincha JN170052 JN170067 JN170081 1779) province, Tinalandia M. occulta ms621 05-srnp-46038 Costa Rica: JN170054 JN170069 JN170083 (Rothschild & Guancaste, Area Jordan, 1903) de Conservacion M. quinquemaculatus ms622 GS-02-1766 USA: Missouri, Cape JN170055 JN170070 JN170084 (Haworth, 1803) Girardeau M. quinquemaculatus ms623 JPT-02-1535 USA: Arizona, JN170056 JN170071 JN170085 (Haworth, 1803) Harshaw Creek M. quinquemaculatus ms624 DCR-02-1876 USA: Arkansas, Scott JN170057 N/A JN170086 (Haworth, 1803) County, Waldron M. sexta (Linnaeus, ms625 DCR-02-1874 USA: Arkansas, Scott JN170058 JN170072 JN170087 1763) County, Waldron M. sexta (Linnaeus, ms620 JKA-02-1654 Mexico: El Lobo JN170053 JN170068 JN170082 1763) Queretaro M. sexta (Linnaeus, ms626 MM-03-2146 Argentina: INTA JN170059 JN170073 JN170088 1763) Manfredi M. sexta (Linnaeus, ms627 AYK-06-7001 USA: Arizona, Gila JN170060 JN170074 JN170089 1763) County, Payson M. sexta (Linnaeus, ms628 07-SRNP-1020 Costa Rica: JN170061 JN170075 JN170090 1763) Guancaste, Area de Conservacion M. sexta (Linnaeus, ms629 AYK-04-0545 Chile: Reg. VI, JN170062 JN170076 JN170091 1763) Melado Note: UH, University of Hawai‘i at Mänoa, Honolulu; UM, University of Maryland, College Park. in Hawai‘i, but also to evaluate the i mportance M. blackburni specimen was deposited as a and direction of conservation actions for the voucher in the University of Hawai‘i Insect species. For a description of the life history of Museum (UHIM). We also sequenced 12 M. blackburni, see Riotte (1986) and Rubinoff non–M. blackburni specimens from five other and San Jose (2010). species, obtained from the University of Maryland Frozen Lepidoptera Collection materials and methods (UM [Table 1]). The non–M. blackburni se- quences do not have morphological voucher Taxon Sampling, DNA Extraction, samples at UHIM, because they were sent Amplification, and Sequencing from UM. Genomic DNA was extracted from Two legs from each of three adult M. black- all specimens using the DNeasy animal blood burni specimens were used for total genomic and tissue extraction kit following recom- DNA extraction. The remainder of each mended protocols (Qiagen, Inc., Valencia, 34 PACIFIC SCIENCE · January 2012 TABLE 2 Primer Names and Sequences Utilized in This Study Gene Primer Name Sequence (5′-3′) Reference COI LCO-1490 GCTCAACAAATCATAAAGATATTGG Folmer et al. (1994) HCO-2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994) Jerry-k485 CAACATTTATTTTGATTTTTTGG Simon et al. (1994) Pat-k508 TCCAATGCACTAATCTGCCATATTA Simon et al. (1994) EF-1α Oscar-6143 GGCCCAAGGAAATGGGCAAGGG W. Haines, University of Hawai‘i, unpubl. data Bosie-6144 CCGGCGACGTAACCACGACGC W. Haines, University of Hawai‘i, unpubl. data CAD CAD-man-F GCCGAGTTTGGATTATTGTGTTGTC Designed for this study CAD-man-R ATCGATAGTATGACCCCGCTAGGGCG Designed for this study California). The subspecific name of the Chil- cles of (94°C for 30 sec, 50°C for 30 sec, and ean M. sexta in this study is probably M. sexta 70°C for 1 min) with a final 70°C extension caestri (Blanchard, 1854), but we have not for- for 10 min. EF-1α was amplified as one frag- mally assigned a subspecific name because it ment with primers
Load more

Recommended publications
  • Pu'u Wa'awa'a Biological Assessment
    PU‘U WA‘AWA‘A BIOLOGICAL ASSESSMENT PU‘U WA‘AWA‘A, NORTH KONA, HAWAII Prepared by: Jon G. Giffin Forestry & Wildlife Manager August 2003 STATE OF HAWAII DEPARTMENT OF LAND AND NATURAL RESOURCES DIVISION OF FORESTRY AND WILDLIFE TABLE OF CONTENTS TITLE PAGE ................................................................................................................................. i TABLE OF CONTENTS ............................................................................................................. ii GENERAL SETTING...................................................................................................................1 Introduction..........................................................................................................................1 Land Use Practices...............................................................................................................1 Geology..................................................................................................................................3 Lava Flows............................................................................................................................5 Lava Tubes ...........................................................................................................................5 Cinder Cones ........................................................................................................................7 Soils .......................................................................................................................................9
    [Show full text]
  • Further Records of Ecuadorian Sphingidae (Lepidoptera: Sphingidae) 137-141 - 1 3 7
    ZOBODAT - www.zobodat.at Zoologisch-Botanische Datenbank/Zoological-Botanical Database Digitale Literatur/Digital Literature Zeitschrift/Journal: Neue Entomologische Nachrichten Jahr/Year: 1998 Band/Volume: 41 Autor(en)/Author(s): Racheli Luigi, Racheli Tommaso Artikel/Article: Further records of Ecuadorian Sphingidae (Lepidoptera: Sphingidae) 137-141 - 1 3 7 - Further records of Ecuadorian Sphingidae (Lepidoptera: Sphingidae) by Luigi Racheli & T ommaso Racheli Abstract Distributional records of 22 hawkmoths species of Ecuador are reported. In the past, distributional data on the ecuadorian Sphingidae were reported by Dognin (1886-1897), Campos (1931), Rothschild & J ordan (1903) and Schreiber (1978). Haxaire (1991), describing a new species of Xylophanes from Ecuador, has reported a total of 135 species collected in Ecuador. Racheli & R acheli (1994) listed 167 species, including recent collecting data for 80 species, and all the records for the country extracted from the literature, including also doubtful records such as Manduca muscosa (Rothschild & J ordan , 1903) and Xylophanes juanita Rothschild & J ordan , 1903 which are unlikely to occur in Ecuador. The total number of hawkmoths species of Ecuador may account for approximately 155-160 spe­ cies. Following the recent studies of Racheli & R acheli (1994, 1995), Racheli (1996) and Haxaire (1995, 1996a, 1996b), additional records of Museum specimens and of material collected in Ecuador are given herewith. All the specimens reported below are in the collection of the senior author unless otherwise stated. Abbreviations: Imbabura (IM); Esmeraldas (ES); Pichincha (PI); Ñapo (NA); Pastaza (PA); Morona Santiago (MS). EMEM = Entomologische Museum (Dr, Ulf Eitschberger ), Marktleuthen, Germany; ZSBS = Zoologische Saammlungen des Bayerischen, München, Germany. Sphinginae Manduca lefeburei lefeburei (Guérin-Ménéville , 1844) Remarks: In Ecuador, it is distributed on both sides of the Andes and according to Haxaire (1995) it coexists with Manduca andicola (Rothschild & J ordan , 1916).
    [Show full text]
  • Diversidad De Esfinges (Lepidoptera: Sphingidae) En El Valle Del Río Rímac – Provincia De Lima, Huarochiri Y Cañete, Lima, Perú
    SAGASTEGUIANA 6(2): 91 - 104. 2018 ISSN 2309-5644 ARTÍCULO ORIGINAL DIVERSIDAD DE ESFINGES (LEPIDOPTERA: SPHINGIDAE) EN EL VALLE DEL RÍO RÍMAC – PROVINCIA DE LIMA, HUAROCHIRI Y CAÑETE, LIMA, PERÚ DIVERSITY OF SPHINGES (LEPIDOPTERA: SPHINGIDAE) IN THE RIMAC RIVER VALLEY, LIMA, PERU Rubén A. Guzmán Pittman1 & Ricardo V. Vásquez Condori2 Asociación Científica para la Conservación de la Biodiversidad. [email protected], [email protected] RESUMEN Los lepidópteros nocturnos ostentan una gran diversidad de especies, sobresaliendo los grandes ejemplares denominados esfinges, a continuación en el presente trabajo se procede a citar y describir las especies halladas en el Valle del Rio Rímac - Departamento de Lima registrándose un total de 12 especies de la familia Sphingidae y estas dentro de dos sub familias (Macroglossini, con seis géneros) y (Sphingini con tres géneros) con un total de 9 géneros hallados, siendo estos: Hyles, Erinnyis, Pachylia, Callionima, Aellops, Eumorpha, Agrius, Cocytius y Manduca) entre las cuales la sub familia Sphingini es la más diversificada con 5 especies y 3 géneros. Palabras Clave: Entomología, Esfinges, Lepidópteros, Lima, Diversidad. ABSTRACT The nocturnal lepidoptera have a great diversity of species, with the large specimens called sphinxes standing out. In this paper, the species found in the Rímac River Valley - Department of Lima are cited and described, registering a total of 12 species of the family Sphingidae and these within two sub-families (Macroglossini, with six genera) and (Sphingini with three genera) with a total of 9 genera found, these being: Hyles, Erinnyis, Pachylia, Callionima, Aellops, Eumorpha, Agrius, Cocytius and Manduca) among which the Sphingini subfamily is the most diversified with 5 species and 3 genera.
    [Show full text]
  • Evaluating the Core Microbiome of Manduca Sexta Authors: Macy Johnson, Dr
    Evaluating the Core Microbiome of Manduca sexta Authors: Macy Johnson, Dr. Jerreme Jackson*, and Dr. Tyrrell Conway† Abstract: Microbiomes are complex communities of microorganisms that colonize many surfaces of an animal’s body, especially those niches lined with carbohydrate-rich mucosal layers such as the eyes, male and female reproductive tracts, and the gastrointestinal tract. While a vast majority of data from microbiome studies has relied almost extensively on metagenomics-based approaches to identify individual species within these small complex communities, the contributions of these communities to host physiology remain poorly understood. We used a combination of culture- and non culture-based approaches to identify and begin functionally characterizing microbial inhabitants stably colonized in the midgut epithelium of the invertebrate model Manduca sexta (tobacco hornworm), an agriculture pest of Nicotiana attenuata (wild-tobacco) and many additional solanaceous plants. Keywords: Microbiome, Manduca sexta, Intestine, Nicotiana attenuata, Metagenomics Introduction supports the hypothesis that a core microbiome The animal intestinal microbiome comprises a persists in the intestinal tract of some Lepidopteran diverse community of microorganisms, which species. When the bacteria are transferred vertically, influence host development, physiology, and response they are passed on generationally. When the bacteria to pathogens. However, the mechanism underlying are transferred horizontally, they are passed directly these complex interactions
    [Show full text]
  • Tomato Hornworm Manduca Quinquemaculata (Haworth) (Insecta: Lepidoptera: Sphingidae) 1 Morgan A
    EENY700 Tomato Hornworm Manduca quinquemaculata (Haworth) (Insecta: Lepidoptera: Sphingidae) 1 Morgan A. Byron and Jennifer L. Gillett-Kaufman2 Introduction uncommon in the Southeast and is replaced by the tobacco hornworm in this region. In Florida, hornworm damage on The tomato hornworm, Manduca quinquemacu- tomato is typically caused by the tobacco hornworm, rather lata (Haworth), is a common garden pest that feeds on than the tomato hornworm, despite its common name. plants in the Solanaceae (nightshade) family including tomato, peppers, eggplant, and potato. The adult form of the tomato hornworm is a relatively large, robust-bodied moth, commonly known as a hawk moth or sphinx moth. The adult moth feeds on the nectar of various flowers and, like the larval form, is most active from dusk until dawn (Lotts and Naberhaus 2017). The tomato hornworm (Figure 1) may be confused with the tobacco hornworm, Manduca sexta (L.) (Figure 2), a closely related species that also specializes on solanaceous plant species and is similar in Figure 1. Late instar larva of the tomato hornworm, Manduca appearance. Various morphological features can be used quinquemaculata (Haworth). to differentiate these hornworms, namely that tomato Credits: Paul Choate, UF/IFAS hornworm has V-shaped yellow-white markings on the body and the tobacco hornworm has white diagonal lines. Additionally, the horn, a small protrusion on the final abdominal segment of the caterpillar that gives the horn- worm its name, of the tomato hornworm is black, whereas the horn of the tobacco hornworm is reddish in color. Distribution The tomato hornworm has a wide distribution in North Figure 2.
    [Show full text]
  • Influence of Juvenile Hormone on Territorial and Aggressive Behavior in the Painted Lady (Vanessa Cardui) and Eastern Black Swallowtail (Papilio Polyxenes)
    Colby College Digital Commons @ Colby Honors Theses Student Research 2007 Influence of juvenile hormone on territorial and aggressive behavior in the Painted Lady (Vanessa cardui) and Eastern Black Swallowtail (Papilio polyxenes) Tara Bergin Colby College Follow this and additional works at: https://digitalcommons.colby.edu/honorstheses Part of the Biology Commons Colby College theses are protected by copyright. They may be viewed or downloaded from this site for the purposes of research and scholarship. Reproduction or distribution for commercial purposes is prohibited without written permission of the author. Recommended Citation Bergin, Tara, "Influence of juvenile hormone on territorial and aggressive behavior in the Painted Lady (Vanessa cardui) and Eastern Black Swallowtail (Papilio polyxenes)" (2007). Honors Theses. Paper 29. https://digitalcommons.colby.edu/honorstheses/29 This Honors Thesis (Open Access) is brought to you for free and open access by the Student Research at Digital Commons @ Colby. It has been accepted for inclusion in Honors Theses by an authorized administrator of Digital Commons @ Colby. The Influence of Juvenile Hormone on Territorial and Aggressive Behavior in the Painted Lady (Vanessa cardui)and Eastern Black Swallowtail (Papilio polyxenes) An Honors Thesis Presented to ` The Faculty of The Department of Biology Colby College in partial fulfillment of the requirements for the Degree of Bachelor of Arts with Honors by Tara Bergin Waterville, ME May 16, 2007 Advisor: Catherine Bevier _______________________________________ Reader: W. Herbert Wilson ________________________________________ Reader: Andrea Tilden ________________________________________ -1- -2- Abstract Competition is important in environments with limited resources. Males of many insect species are territorial and will defend resources, such as a food source or egg-laying site, against intruders, or even compete to attract a mate.
    [Show full text]
  • 9:00 Am PLACE
    CARTY S. CHANG INTERIM CHAIRPERSON DAVID Y. IGE BOARD OF LAND AND NATURAL RESOURCES GOVERNOR OF HAWAII COMMISSION ON WATER RESOURCE MANAGEMENT KEKOA KALUHIWA FIRST DEPUTY W. ROY HARDY ACTING DEPUTY DIRECTOR – WATER AQUATIC RESOURCES BOATING AND OCEAN RECREATION BUREAU OF CONVEYANCES COMMISSION ON WATER RESOURCE MANAGEMENT STATE OF HAWAII CONSERVATION AND COASTAL LANDS CONSERVATION AND RESOURCES ENFORCEMENT DEPARTMENT OF LAND AND NATURAL RESOURCES ENGINEERING FORESTRY AND WILDLIFE HISTORIC PRESERVATION POST OFFICE BOX 621 KAHOOLAWE ISLAND RESERVE COMMISSION LAND HONOLULU, HAWAII 96809 STATE PARKS NATURAL AREA RESERVES SYSTEM COMMISSION MEETING DATE: April 27, 2015 TIME: 9:00 a.m. PLACE: Department of Land and Natural Resources Boardroom, Kalanimoku Building, 1151 Punchbowl Street, Room 132, Honolulu. AGENDA ITEM 1. Call to order, introductions, move-ups. ITEM 2. Approval of the Minutes of the June 9, 2014 N atural Area Reserves System Commission Meeting. ITEM 3. Natural Area Partnership Program (NAPP). ITEM 3.a. Recommendation to the Board of Land and Natural Resources approval for authorization of funding for The Nature Conservancy of Hawaii for $663,600 during FY 16-21 for continued enrollment in the natural area partnership program and acceptance and approval of the Kapunakea Preserve Long Range Management Plan, TMK 4-4-7:01, 4-4-7:03, Lahaina, Maui. ITEM 3.b. Recommendation to the Board of Land and Natural Resources approval for authorization of funding for The Nature Conservancy of Hawaii for $470,802 during FY 16-21 for continued enrollment in the natural area partnership program and acceptance and approval of the Pelekunu Long Range Management Plan, TMK 5-4- 3:32, 5-9-6:11, Molokai.
    [Show full text]
  • ESA 2 0 14 9-12 March 2014 Des Moines, Iowa 2014 NCB-ESA Corporate Sponsors CONTENTS
    NCB ESA 2 0 14 9-12 March 2014 Des Moines, Iowa 2014 NCB-ESA Corporate Sponsors CONTENTS Meeting Logistics ....................................................1 2014 NCB-ESA Officers and Committees .................5 2014 Award Recipients ...........................................7 Sunday, 9 March 2014 At-a-Glance ..................................................18 Afternoon .....................................................19 Monday, 10 March 2014 At-a-Glance ..................................................23 Posters .........................................................25 Morning .......................................................30 Afternoon .....................................................35 Tuesday, 11 March 2014 At-a-Glance ..................................................45 Posters .........................................................47 Morning .......................................................51 Afternoon .....................................................55 Wednesday, 12 March 2014 At-a-Glance ..................................................60 Morning .......................................................61 Author Index ........................................................67 Scientific Name Index ...........................................77 Keyword Index ......................................................82 Common Name Index ...........................................83 Map of Meeting Facilities ..............inside back cover i MEETING LOGISTICS Registration All participants must register
    [Show full text]
  • Chemistry& Metabolism Chemical Information National Library Of
    Chemistry& Metabolism Chemical Information National Library of Medicine Chemical Resources of the Environmental Health & Toxicology Information Program chemistry.org: American Chemical Society - ACS HomePage Identified Compounds — Metabolomics Fiehn Lab AOCS > Publications > Online Catalog > Modern Methods for Lipid Analysis by Liquid Chromatography/Mass Spectrometry and Related Techniques (Lipase Database) Lipid Library Lipid Library Grom Analytik + HPLC GmbH: Homepage Fluorescence-based phospholipase assays—Table 17,3 | Life Technologies Phosphatidylcholine | PerkinElmer MetaCyc Encyclopedia of Metabolic Pathways MapMan Max Planck Institute of Molecular Plant Physiology MS analysis MetFrag Scripps Center For Metabolomics and Mass Spectrometry - XCMS MetaboAnalyst Lipid Analysis with GC-MS, LC-MS, FT-MS — Metabolomics Fiehn Lab MetLIn LOX and P450 inhibitors Lipoxygenase inhibitor BIOMOL International, LP - Lipoxygenase Inhibitors Lipoxygenase structure Lypoxygenases Lipoxygenase structure Plant databases (see also below) PlantsDB SuperSAGE & SAGE Serial Analysis of Gene Expression: Information from Answers.com Oncology: The Sidney Kimmel Comprehensive Cancer Center EMBL Heidelberg - The European Molecular Biology Laboratory EMBL - SAGE for beginners Human Genetics at Johns Hopkins - Kinzler, K Serial Analysis of Gene Expression The Science Creative Quarterly » PAINLESS GENE EXPRESSION PROFILING: SAGE (SERIAL ANALYSIS OF GENE EXPRESSION) IDEG6 software home page (Analysis of gene expression) GenXPro :: GENome-wide eXpression PROfiling
    [Show full text]
  • Taxa Names List 6-30-21
    Insects and Related Organisms Sorted by Taxa Updated 6/30/21 Order Family Scientific Name Common Name A ACARI Acaridae Acarus siro Linnaeus grain mite ACARI Acaridae Aleuroglyphus ovatus (Troupeau) brownlegged grain mite ACARI Acaridae Rhizoglyphus echinopus (Fumouze & Robin) bulb mite ACARI Acaridae Suidasia nesbitti Hughes scaly grain mite ACARI Acaridae Tyrolichus casei Oudemans cheese mite ACARI Acaridae Tyrophagus putrescentiae (Schrank) mold mite ACARI Analgidae Megninia cubitalis (Mégnin) Feather mite ACARI Argasidae Argas persicus (Oken) Fowl tick ACARI Argasidae Ornithodoros turicata (Dugès) relapsing Fever tick ACARI Argasidae Otobius megnini (Dugès) ear tick ACARI Carpoglyphidae Carpoglyphus lactis (Linnaeus) driedfruit mite ACARI Demodicidae Demodex bovis Stiles cattle Follicle mite ACARI Demodicidae Demodex brevis Bulanova lesser Follicle mite ACARI Demodicidae Demodex canis Leydig dog Follicle mite ACARI Demodicidae Demodex caprae Railliet goat Follicle mite ACARI Demodicidae Demodex cati Mégnin cat Follicle mite ACARI Demodicidae Demodex equi Railliet horse Follicle mite ACARI Demodicidae Demodex folliculorum (Simon) Follicle mite ACARI Demodicidae Demodex ovis Railliet sheep Follicle mite ACARI Demodicidae Demodex phylloides Csokor hog Follicle mite ACARI Dermanyssidae Dermanyssus gallinae (De Geer) chicken mite ACARI Eriophyidae Abacarus hystrix (Nalepa) grain rust mite ACARI Eriophyidae Acalitus essigi (Hassan) redberry mite ACARI Eriophyidae Acalitus gossypii (Banks) cotton blister mite ACARI Eriophyidae Acalitus vaccinii
    [Show full text]
  • Manduca Quinquemaculata (Haworth)) Tobacco Hornworm (Manduca Sexta (Linnaeus
    Hornworms (Order: Lepidoptera, Family: Sphingidae) Tomato hornworm (Manduca quinquemaculata (Haworth)) Tobacco hornworm (Manduca sexta (Linnaeus)) Description: Adult: These two species are similar in appearance. Both are large moths with a wingspan of 80 to 130 mm. The front wings are larger and much longer than the hind wings. Both species are grayish-brown or dull-gray moths with the abdomen marked by a series of orange-yellow spots down each side (six paired spots on the tobacco hornworm and 5 paired spots on the tomato hornworm). The abdomen tapers to a point. Immature stages: Eggs are spherical to oval and 1.25 to 1.5 mm in diameter. They are light green or yellow when laid and turn white at maturity. The larva is cylindrical, with 5 pair of prolegs (4 abdominal plus anal prolegs) and three pair of thoracic legs. Tobacco hornworm adult. Young larvae are yellowish-white but turn green with white diagonal markings on each side of abdominal segments. The most striking characteristic of these larvae is the presence of a thick pointed structure or ‘horn’ projecting backward from the top of the last abdominal segment. Last instar larvae are large, averaging about 8 cm in length. The large brown to reddish-brown pupae (45-60 mm long) possess a pronounced maxillary loop, which looks similar to a flattened handle on a teacup. Biology: Life cycle: There are likely 2 to 4 generations of these pests in Tobacco hornworm larva with characteristic diagonal Georgia. Both species overwinter in the pupal stage. Females are stripes. reported to lay 250 to 350 eggs but can produce nearly 1400 eggs under favorable conditions.
    [Show full text]
  • Foliicolous Lichens of the World
    Estación de Biología Tropical Los Tuxtlas, Veracruz, México 1 Esfíngidos (Sphingidae) Martha Madora Astudillo & Rosamond Coates Fotos: Martha Madora Astudillo. Producido por: Martha Madora Astudillo & Rosamond Coates. Estación de Biología Tropical Los Tuxtlas, Instituto de Biología, Universidad Nacional Autónoma de México © Martha Madora Astudillo [[email protected]]. Agradecimientos: Al Dr. Fernando Hernández-Baz (Universidad Veracruzana), por la determinación de los ejemplares. [fieldguides.fieldmuseum.org] [824] versión 1 11/2016 1 Adhemarius gannascus 2 Adhemarius ypsilon 3 Aellopos tantalus 4 Aellopos titan titan (Stoll, 1790) Rothschild & Jordan 1903 (Linnaeus, 1758) (Cramer, 1777) Autor1, Autor2, 3, Autor3 & Autor4 1Institución del autor, 2 Institución del autor, 3 Institución del autor, 4 Institución del autor 5 Agrius cingulata 6 Callionima falcifera 7 Callionima inuus 8 Cocytius antaeus (Fabricius 1775) (Gehlen, 1943) Rothschild & Jordan 1903 (Drury, 1773) 9 Enyo lugubris 10 Enyo ocypete 11 Enyo taedium 12 Erinnyis alope (Linnaeus, 1771) (Linnaeus, 1758) Schaus, 1890 Drury, 1773 13 Erinnyis crameri 14 Erinnyis ello 15 Erinnyis lassauxii 16 Erinnyis oenotrus (Schaus, 1898) (Linnaeus, 1758) (Boisduval, 1859) (Cramer, 1780) 17 Eumorpha anchemola 18 Eumorpha labruscae 19 Eumorpha satellitia licaon 20 Eumorpha triangulum (Cramer, 1780) (Linnaeus, 1758) Cramer, 1776 Rothschild & Jordan 1903 Estación de Biología Tropical Los Tuxtlas, Veracruz, México 2 Esfíngidos (Sphingidae) Martha Madora Astudillo & Rosamond Coates Fotos:
    [Show full text]