Phylogenetics and Species Status of Hawai'i's Endangered Blackburn's

Home , Manduca, Manduca blackburni

Phylogenetics and Species Status of Hawai‘i’s Endangered Blackburn’s Sphinx Moth, Manduca blackburni ( Lepidoptera: Sphingidae)1

Daniel Rubinoff,2,3 Michael San Jose,3 and Akito Y. Kawahara3

Abstract: Manduca blackburni, commonly known as Blackburn’s Sphinx Moth, is a federally listed endangered species restricted to localized habitats on three islands in the Hawaiian archipelago. Manduca blackburni was thought to be closely related to the widely distributed New World species M. quinquemaculatus, but this has never been formally tested, and shortly after its description, many authors dismissed it as a subspecies or form of M. quinquemaculatus. We used one mitochondrial gene, COI, and two nuclear genes, CAD and EF-1α (2,975 bp total), to examine the phylogenetic relationships between M. blackburni and putative sister species in the genus. The phylogeny resulting from two single-gene analyses (CAD, COI) and the concatenation of all three genes suggest that M. blackburni + M. quinquemaculatus are sister taxa, and the monophyly of each species is supported with relatively high branch support under parsimony, maximum likelihood, and Bayesian inference. Manduca blackburni and M. quinquemaculatus also differ in genetic distance for CAD and COI, and we therefore consider them separate species. Thus, our molecular results corroborate previous studies on the morphology of M. blackburni and retain the species rank of this taxon. Our results also indicate that one or more South American subspecies of M. sexta may merit elevation to species.

Manduca blackburni (Butler, 1880), com- Historically, M. blackburni was a dry-forest in- monly known as Blackburn’s Sphinx Moth habitant found on all of the main Hawaiian (BSM), is Hawai‘i’s largest endemic insect Islands and was noted as an occasional pest on (Figure 1). Manduca contains 70 species, and eggplant and other solanaceous crops (Zim- M. blackburni has the most isolated distribu- merman 1958), much like its sister species tion of any of them (Kitching et al. 2011). M. quinquemaculatus (Haworth, 1803), in the continental United States. However, M. blackburni was never common, and between 1940 and 1970 the moth was recorded only a 1 This research was supported in part by U.S. Depart- handful of times (U.S. Fish and Wildlife Ser- ment of Agriculture Cooperative State Research, Educa- vice 2005). The Bishop Museum (Honolulu, tion, and Extension Service projects HAW00942-H and Hawai‘i) conducted extensive surveys in the HAW00956-H, both administered by the College of mid-1970s but failed to find M. blackburni, Tropical Agriculture and Human Resources, University of Hawai‘i at Mänoa, Honolulu; and in part by the and the moth was presumed extinct (Gagné National Science Foundation (USA) project no. DEB- and Howarth 1982). The moth was later 0918341. Manuscript accepted 5 June 2011. found to persist in a few isolated populations 2 Corresponding author (e-mail: [email protected]). 3 on East Maui (Riotte 1986) and is now also Department of Plant and Environmental Protection known from parts of the islands of Hawai‘i Sciences, University of Hawai‘i at Mänoa, 3050 Maile Way, Honolulu, Hawai‘i 96822. Current address: Florida and Kaho‘olawe, but it was never rediscov- Museum of Natural History, University of Florida, 3215 ered on the islands of Kaua‘i, Läna‘i, Moloka‘i, Hull Road, Gainesville, Florida 32611-2710. or O‘ahu. Because of M. blackburni’s disap- pearance from several islands and the decline across the remaining islands, the species was Pacific Science (2012), vol. 66, no. 1:31 – 41 doi: 10.2984/66.1.2 declared endangered in 2000, one of only two © 2012 by University of Hawai‘i Press moths to ever receive federal protection (U.S. All rights reserved Fish and Wildlife Service 2005).

31 32 PACIFIC SCIENCE · January 2012

Figure 1. Manduca blackburni (Butler), adult male, from Kokomo, Maui. Photographed 15 December 2009. Scale bar, 2 cm.

The species status of M. blackburni re- M. quinquemaculatus. In the most recent mained fairly uncertain until recently when revision of the Sphingidae, Kitching and considerable morphological work was con- Cadiou (2000) also treated M. blackburni as a ducted on its immature stages (Riotte 1986). species. Butler (1880 [1881]) described M. blackburni Despite the morphological taxonomic as a species, but Meyrick (1899) sank black- work conducted, no molecular studies have burni as a subspecies of the widespread M. examined the relationship of M. blackburni to quinquemaculatus. Rothschild and Jordan other species in the genus or tested the species (1903) and Zimmerman (1958) followed status of M. blackburni. Moreover, the origins Meyrick and treated M. blackburni as a sub- of M. blackburni remain obscure, as does the species. Zimmerman (1958) created further degree of divergence from its putative sister confusion by claiming that the continental species M. quinquemaculatus. The purpose of species M. quinquemaculatus is also present in this study is to construct a molecular phylog- Hawai‘i, where it has never been found. Like eny of M. blackburni and its close relatives many prior authors, d’Abrera (1986 [1987]) within Manduca, confirm its taxonomic rank treated M. blackburni as a Hawaiian popula- with molecular data, and assess the approxi- tion of M. quinquemaculatus. Riotte (1986) el- mate time of divergence from its sister spe- evated M. blackburni to species and presented cies. Through the phylogenetic placement of detailed evidence of morphological differences M. blackburni we hope to not only answer the in the larvae and adults of M. blackburni and taxonomic uncertainty concerning Manduca Systematic Relationship of Manduca blackburni and M. quinquemaculatus · Rubinoff et al. 33

TABLE 1 Identification Numbers, Collection Data, and GenBank Accession Numbers for the Species Sampled in This Study

UH GenBank Accession Numbers extraction UM sample Species ID voucher ID Locality CAD EF-1α COI

M. blackburni (Butler, ms567 — USA: Hawai‘i, Maui, JN170048 JN170063 JN170077 1880) Kanaio M. blackburni (Butler, ms568 — USA: Hawai‘i, Maui, JN170049 JN170064 JN170078 1880) Kanaio M. blackburni (Butler, ms569 — USA: Hawai‘i, Maui, JN170050 JN170065 JN170079 1880) Kanaio M. diffissa (Butler, ms618 WJK-03-2903 Ecuador: Pichincha JN170051 JN170066 JN170080 1871) province, Tinalandia M. hannibal (Cramer, ms619 WJK-03-2904 Ecuador: Pichincha JN170052 JN170067 JN170081 1779) province, Tinalandia M. occulta ms621 05-srnp-46038 Costa Rica: JN170054 JN170069 JN170083 (Rothschild & Guancaste, Area Jordan, 1903) de Conservacion M. quinquemaculatus ms622 GS-02-1766 USA: Missouri, Cape JN170055 JN170070 JN170084 (Haworth, 1803) Girardeau M. quinquemaculatus ms623 JPT-02-1535 USA: Arizona, JN170056 JN170071 JN170085 (Haworth, 1803) Harshaw Creek M. quinquemaculatus ms624 DCR-02-1876 USA: Arkansas, Scott JN170057 N/A JN170086 (Haworth, 1803) County, Waldron M. sexta (Linnaeus, ms625 DCR-02-1874 USA: Arkansas, Scott JN170058 JN170072 JN170087 1763) County, Waldron M. sexta (Linnaeus, ms620 JKA-02-1654 Mexico: El Lobo JN170053 JN170068 JN170082 1763) Queretaro M. sexta (Linnaeus, ms626 MM-03-2146 Argentina: INTA JN170059 JN170073 JN170088 1763) Manfredi M. sexta (Linnaeus, ms627 AYK-06-7001 USA: Arizona, Gila JN170060 JN170074 JN170089 1763) County, Payson M. sexta (Linnaeus, ms628 07-SRNP-1020 Costa Rica: JN170061 JN170075 JN170090 1763) Guancaste, Area de Conservacion M. sexta (Linnaeus, ms629 AYK-04-0545 Chile: Reg. VI, JN170062 JN170076 JN170091 1763) Melado

Note: UH, University of Hawai‘i at Mänoa, Honolulu; UM, University of Maryland, College Park. in Hawai‘i, but also to evaluate the importance M. blackburni specimen was deposited as a and direction of conservation actions for the voucher in the University of Hawai‘i Insect species. For a description of the life history of Museum (UHIM). We also sequenced 12 M. blackburni, see Riotte (1986) and Rubinoff non–M. blackburni specimens from five other and San Jose (2010). species, obtained from the University of Maryland Frozen Lepidoptera Collection materials and methods (UM [Table 1]). The non–M. blackburni sequences do not have morphological voucher Taxon Sampling, DNA Extraction, samples at UHIM, because they were sent Amplification, and Sequencing from UM. Genomic DNA was extracted from Two legs from each of three adult M. black- all specimens using the DNeasy animal blood burni specimens were used for total genomic and tissue extraction kit following recom- DNA extraction. The remainder of each mended protocols (Qiagen, Inc., Valencia, 34 PACIFIC SCIENCE · January 2012

TABLE 2 Primer Names and Sequences Utilized in This Study

Gene Primer Name Sequence (5′-3′) Reference

COI LCO-1490 GCTCAACAAATCATAAAGATATTGG Folmer et al. (1994) HCO-2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994) Jerry-k485 CAACATTTATTTTGATTTTTTGG Simon et al. (1994) Pat-k508 TCCAATGCACTAATCTGCCATATTA Simon et al. (1994) EF-1α Oscar-6143 GGCCCAAGGAAATGGGCAAGGG W. Haines, University of Hawai‘i, unpubl. data Bosie-6144 CCGGCGACGTAACCACGACGC W. Haines, University of Hawai‘i, unpubl. data CAD CAD-man-F GCCGAGTTTGGATTATTGTGTTGTC Designed for this study CAD-man-R ATCGATAGTATGACCCCGCTAGGGCG Designed for this study

California). The subspecific name of the Chil- cles of (94°C for 30 sec, 50°C for 30 sec, and ean M. sexta in this study is probably M. sexta 70°C for 1 min) with a final 70°C extension caestri (Blanchard, 1854), but we have not for- for 10 min. EF-1α was amplified as one frag- mally assigned a subspecific name because it ment with primers Oscar-6143 and Bosie-6144 remains unclear whether the Chilean subspe- from W. Haines (University of Hawai‘i, un- cies should be caestri or eurylochus (Kitching publ. data) under the following PCR condi- et al. 2011). tions: 2 min at 94°C, 40 cycles of (94°C for 30 Three different gene regions were ampli- sec, 60°C for 30 sec, and 70°C for 1 min) with fied: the mitochondrial Cytochrome c Oxidase I a final 70°C extension for 10 min. The frag- gene (COI, 1,484 base pairs [bp]) and the nu- ment of CAD was sequenced with two new clear genes Elongation Factor-1 alpha (EF-1α, primers, CAD-man-F and CAD-man-R, de- 747 bp) and the Carbomoylphosphate Synthase signed specifically for this study and amplified domain of CAD (CAD, 774 bp [Table 2]). We under the following PCR conditions: 2 min at included sequence data from both genomes 94°C, 40 cycles of (94°C for 30 sec, 55°C for to explore evolutionary relationships because 30 sec, and 70°C for 1 min) with a final 70°C mitochondrial and nuclear genomes have dif- extension for 10 min. All PCR products were ferent processes of selection, recombination, visualized on 1% agarose gel and purified and inheritance (Ballard and Whitlock 2004, using QIAquick spin columns (Qiagen, Inc., Rubinoff and Holland 2005, Rubinoff et al. Valencia, California) according to the manu- 2006). These three genes were chosen be- facturer’s protocol. DNA sequencing was cause each has been demonstrated to be infor- performed at the Advanced Studies of Ge- mative in distinguishing hawk moth popula- nomics, Proteomics, and Bioinformatics tions, species, or genera (Regier et al. 2001, (ASGPB) sequencing facility of the University Hundsdoerfer et al. 2005, Rubinoff and Hol- of Hawai‘i at Mänoa (http://asgpb.mhpcc land 2005, Rubinoff and Le Roux 2008, .hawaii.edu/ ). For each sample, both sense Hundsdoerfer et al. 2009, Kawahara et al. and antisense strands of the PCR products 2009, Rubinoff et al. 2009). COI was ampli- were sequenced. fied in two fragments: the primers LCO-1490 and HCO-2198 amplified 658 bp of COI; Sequence Alignment, Nucleotide Composition, Jerry-k485 and Pat-k508 primers amplified and Phylogenetic Analysis 826 bp of the gene (Folmer et al. 1994, Simon et al. 1994). Both fragments were amplified Alignments were performed with the software under the following polymerase chain reac- package Geneious (Drummond et al. 2010). tion (PCR) conditions: 2 min at 94°C, 40 cy- Sequence alignment for each gene was con- Systematic Relationship of Manduca blackburni and M. quinquemaculatus · Rubinoff et al. 35 ducted in Geneious using the “Geneious for arthropods, corresponding to 0.0015 sub- alignment” option with default settings. stitutions per site on the COI data set. Be- PAUP* 4.0b10 (Swofford 2002) was used to cause no adequate fossils exist in Manduca, we calculate nucleotide composition and pairwise used a strict molecular clock with a Yule pro- distances. All three gene regions were tested cess for model of speciation and ran the anal for an appropriate nucleotide substitution ysis for 1 × 107 generations. We realize that model with jModelTest (Posada 2008) under this method of divergence estimation has the Akaike information criterion (AIC). AIC problems (Britten 1986, Roger and Hug 2006, selected a general time-reversible model with Lepage et al. 2007), but it provides a starting among-site rate heterogeneity modeled ac- point for future work. cording to a gamma distribution while allow- ing for a proportion of invariable sites (GTR+I+Γ). Phylogenetic analyses were per- results formed with three different optimality cri Nucleotide Composition and Sequence Divergence teria. We used MrBayes 3.1.2 (Ronquist and Huelsenbeck 2003) for Bayesian analyses, Average base frequencies for each gene, along GARLI 0.951 (Zwickl 2006) for maximum with their significance level as estimated by likelihood (ML), and PAUP* for parsimony. the chi-square test were as follows: COI MrBayes was run with a temperature set at (A = 0.32, C = 0.14, G = 0.13, T = 0.41), EF- 0.1, to 1 × 107 generations with a burn-in of 1α (A = 0.24, C = 0.28, G = 0.27, T = 0.21), 3 × 106 generations. All other options were and CAD (A = 0.35, C = 0.15, G = 0.21, kept as default. Bayesian trees were summa- T = 0.29). There were no significant differ- rized in Sumtrees ver. 3.1.0 (Sukumaran and ences in base frequencies between taxa for any 2 Holder 2010) with a minimum clade fre of the genes (COI: c = 4.8, P = 1.00, df = 42; 2 quency of 50%. For ML analyses, 1,000 boot- EF-1α: c = 1.5, P = 1.00, df = 42; CAD: 2 strap replicates were conducted, and branch c = 1.7, P = 1.00, df = 42). Interspecific COI supports > 50% were mapped onto the ML uncorrected pairwise distances between M. tree, selected as the best tree from 1,000 blackburni individuals were low (<0.0041), ML tree searches. To expedite GARLI tree which was also the case for M. quinquemacula- searches, we used Grid computing (Cum- tus (<0.0021). Intraspecific distances between mings and Huskamp 2005) through The Lat- M. blackburni and M. quinquemaculatus speci- tice Project (Bazinet and Cummings 2009). mens were between 0.0185 and 0.0216. By Jobs were submitted to the Grid via the online comparison, M. diffissa and M. occulta had an Lattice Grid portal (Bazinet and Cummings uncorrected pairwise distance of 0.01348. 2011). Parsimony heuristic searches were conducted with default settings, TBR branch Phylogenetic Analyses and Divergence Time swapping, and 1,000 nonparametric bootstrap Estimation reps. We first analyzed each gene separately using all three optimality criteria and subse- Both the concatenated all-gene data set and quently concatenated them into a single data three individual gene analyses resulted in set before tree searches were conducted under nearly identical tree topologies (Figure 2). In parsimony, likelihood, and Bayesian methods. the phylogenies, M. blackburni and M. quin- Trees were examined using PAUP* and Fig- quemaculatus are sister species and this clade Tree v1.3.1 (Rambaut 2009) and rooted with was well supported (1.0 PP, 100% BP). Manduca hannibal Cramer. Divergence time Monophyly of each species was recovered estimation analyses were conducted with with CAD and COI, but not EF-1α. Pair- BEAST 1.6.1 (Drummond and Rambaut wise genetic distance between M. blackburni 2007). We ran an analysis following Brower’s and M. quinquemaculatus is between 1.8% (1994) approximation of mtDNA pairwise se- and 2.6% for COI. This is greater than the quence divergence at 2.3% per million years pairwise distance between two previously 36 PACIFIC SCIENCE · January 2012

Figure 2. Bayesian trees. A, Concatenated, three-gene data set; B, COI only; C, EF-1α only; D, CAD only. Support values above branches are Bayesian posterior probabilities/ML bootstraps/MP bootstraps. NA, North America; SA, South America. Scale bar indicates the number of substitutions per site. recognized species in the study, M. diffissa proximately 0.6 Ma (Figure 3), slightly before and M. occulta (1.3%). Divergence time esti- the formation of the Big Island but after the mation approximates the split between M. surfacing of the Maui Nui complex (Price and blackburni and M. quinquemaculatus to be ap- Clague 2002). Systematic Relationship of Manduca blackburni and M. quinquemaculatus · Rubinoff et al. 37

Figure 2. (continued)

It is interesting that in all trees obtained, tance of these clades is 2.9% – 3.6%. The age two well-supported clades exist within M. of the split between the North and South sexta, one including North American repre- American M. sexta appears to be approximately sentatives and another that includes only 0.9 Ma. However, caution is required when South American samples. The genetic dis- interpreting age estimates because taxon Figure 3. Bayesian tree of M. blackburni and relatives showing 95% confidence intervals of posteriors as calculated in BEAST. Systematic Relationship of Manduca blackburni and M. quinquemaculatus · Rubinoff et al. 39 sampling was relatively low. A formal time- cies of M. sexta to test this hypothesis. For calibrated analysis will be the focus of a future such a biologically and economically impor- study. tant genus, the need to understand species limits and species relationships is of broad relevance to our understanding of other bio- discussion logical systems. Because our sampling is limited, we do not propose any formal taxonomic Phylogenetic Relationships of Manduca changes until additional samples can be ob- blackburni and Related Species tained. A phylogenetic study of Manduca will Manduca blackburni and M. quinquemaculatus be an important next step in understanding constitute a strongly supported monophyletic the evolution of the genus. group in all trees. Branch lengths connecting Our results confirm the sister-group rela- to M. blackburni for the trees generated from tionship of M. blackburni and M. quinquemacu- the all-genes data set exceed divergence levels latus and confirm its status as a unique endemic between M. diffisa and M. occulta. Thus, we Hawaiian species. Further studies focusing on treat M. blackburni as a distinct species cor- the differences between the rare and declining roborating previous morphological interpre- M. blackburni and the widespread American tations (e.g., Butler 1880 [1881], Riotte 1986, M. quinquemaculatus may reveal some of the Kitching and Cadiou 2000). The relatively re- reasons why insular taxa, even when closely cent divergence time estimates for M. black- related to common species, often fare poorly burni suggest that it is one of the most recent when their island environment is altered. Our taxa to colonize Hawai‘i, perhaps less than 0.5 current sampling is restricted to the island of Ma. The West Coast of North America is the Maui, and it is likely that the addition of more geographically closest region to Hawai‘i with samples, particularly including individuals M. quinquemaculatus populations (Opler et al. from the islands of Hawai‘i and Kaho‘olawe, 2011), suggesting that the M. blackburni may will be important to fully understand the ge- be most closely related to the population of netic relationships of the remaining M. black- M. quinquemaculatus from that region. How- burni populations to each other and their sis- ever, given the low levels of divergence across ter species M. quinquemaculatus. North America in M. quinquemaculatus and the limited samples in our study, it is impos- acknowledgments sible for us to confirm the geographic source of M. blackburni. We hope comparisons with Lorena Wada (U.S. Fish and Wildlife Ser- additional samples from continental Manduca vice), Betsy Gagne, and Cynthia King populations will provide further insight into (Hawai‘i Division of Forestry and Wildlife) the origin of M. blackburni. provided support and encouragement. Cyrus The presence of a well-supported South and Caitlin Ghajar provided invaluable field American population within M. sexta implies assistance. Will Haines (University of Hawai‘i that the South American subspecies may need at Mänoa) assisted with fieldwork and pro- to be elevated to species. Although the species vided the photograph of M. blackburni. We was thought to be distributed throughout the thank Charles Mitter, Kim Mitter, and Americas, our results suggest that North Jerome C. Regier (University of Maryland, American M. sexta have been separated from College Park) for providing valuable speci- South American M. sexta for close to a million mens from the University of Maryland Fro- years. In addition, two of the three genes in zen Lepidoptera Collection. Tim Male and the study reported here indicate that North the Environmental Defense Fund provided and South American M. sexta are distinct. financial support that began this project and Clearly, further work is needed to examine made it possible. This research was conducted whether the subspecies of M. sexta in South under permit from the Hawai‘i Division of America need to be elevated to species rank. Forestry and Wildlife and TE-068142-2 from Future studies should sample all six subspe- the U.S. Fish and Wildlife Service. 40 PACIFIC SCIENCE · January 2012

Literature Cited cytochrome c oxidase subunit I from di- verse metazoan invertebrates. Mol. Mar. Ballard, J. W., and M. C. Whitlock. 2004. Biol. Biotechnol. 3:294 – 299. The incomplete natural history of mito- Gagné, W. C., and F. G. Howarth. 1982. chondria. Mol. Ecol. 13:729 – 744. Conservation status of endemic Hawaiian Bazinet, A. L., and M. P. Cummings. 2009. Lepidoptera. Proceedings of the 3rd Con- The Lattice Project: A Grid research and gress on European Lepidoptera, Cam- production environment combining mul- bridge, England. tiple Grid computing models. Pages 2 – 13 Hundsdoerfer, A. K., I. J. Kitching, and M. in W. H. W. Weber, ed. Distributed and Wink. 2005. A molecular phylogeny of grid computing: Science made transparent the hawkmoth genus Hyles (Lepidoptera: for everyone. Principles, applications and Sphingidae, Macroglossinae). Mol. Phylo- supporting communities. Tectum, Marburg. genet. Evol. 35:442 – 458. ——— . 2011. Computing the tree of life: Le- Hundsdoerfer, A. K., D. Rubinoff, M. Attie, veraging the power of desktop and service M. Wink, and I. J. Kitching. 2009. A re- grids. Fifth workshop on desktop grids and vised molecular phylogeny of the globally volunteer computing systems (PCGrid distributed hawkmoth genus Hyles (Lepi- 2011). (http://lattice.umiacs.umd.edu/ doptera: Sphingidae), based on mitochon- latticefiles/publications/lattice/computing drial and nuclear DNA sequences. Mol. _tree_of_life.pdf ) Phylogenet. Evol. 52:852 – 856. Britten, R. J. 1986. Rates of DNA sequence Kawahara, A. Y., A. A. Mignault, J. C. Regier, evolution differ between taxonomic I. J. Kitching, and C. Mitter. 2009. Phylog- groups. Science ( Washington, D.C.) 231: eny and biogeography of hawkmoths (Lep- 1393 – 1398. idoptera: Sphingidae): Evidence from five Brower, A. V. 1994. Rapid morphological nuclear genes. PLoS ONE 4:e5719. radiation and convergence among races of Kitching, I. J., and J.-M. Cadiou. 2000. Hawk- the butterfly Heliconius erato inferred from moths of the world: Annotated and illus- patterns of mitochondrial DNA evolution. trated revisionary checklist. Cornell Uni- Proc. Natl. Acad. Sci. U.S.A. 91:6491 – 6495. versity Press, Ithaca, New York. Butler, A. G. 1880 [1881]. On a collection of Kitching, I. J., M. J. Scoble, C. R. Smith, nocturnal Lepidoptera from the Hawaiian S. James, R. Young, and V. Blagoderov. Islands. Ann. Mag. Nat. Hist. 40, 41:317 – 2011. CATE Sphingidae. http://www.cate- 333, 392 – 408. sphingidae.org/ (version 25 May 2011). Cummings, M. P., and J. C. Huskamp. 2005. Lepage, T., D. Bryant, H. Philippe, and N. Grid computing. EDUCAUSE Rev. Lartillot. 2007. A general comparison of 40:116 – 117. relaxed molecular clock models. Mol. Biol. d’Abrera, B. 1986 [1987]. Sphingidae Mundi. Evol. 24:2669 – 2680. Hawkmoths of the world. E. W. Classey, Meyrick, E. 1899. Macrolepidoptera. Pages Faringdon. 123 – 275 in D. Sharp, ed. Fauna Ha Drummond, A. J., B. Ashton, S. Buxton, M. waiiensis. Cambridge University Press, Cheung, A. Cooper, J. Heled, M. Kearse, Cambridge. R. Moir, S. Stones-Havas, S. Sturrock, T. Opler, P. A., K. Lotts, and T. Naberhaus. Thierer, and A. Wilson. 2010. Geneious 2011. Butterflies and moths of North version 5.1. (available from http://www America. Big Sky Institute, Bozeman, .geneious.com). Montana. http://www.butterfliesandmoths Drummond, A. J., and A. Rambaut. 2007. .org/ (accessed 28 May 2011). BEAST: Bayesian evolutionary analysis by Posada, D. 2008. jModelTest: Phylogenetic sampling trees. BMC Evol. Biol. 7:214. model averaging. Mol. Biol. Evol. 25:1253 – Folmer, O., M. B. Black, W. Hoch, R. A. 1256. Lutz, and R. A. Vrijenhoek. 1994. DNA Price, J. P., and D. A. Clague. 2002. How old primers for amplification of mitochondrial is the Hawaiian biota? Geology and phy- Systematic Relationship of Manduca blackburni and M. quinquemaculatus · Rubinoff et al. 41

logeny suggest recent divergence. Proc. R. sphinx moths (Proserpinus: Sphingidae). Soc. Lond. B: Biol. Sci. 269:2429 – 2435. PLoS ONE 3:e4035. Rambaut, A. 2009. FigTree, version 1.3.1. Rubinoff, D., K. H. Osborne, and A. Y. Kawa- University of Edinburgh (http://tree.bio hara. 2009. Synonymization of the eupho- .ed.ac.uk/). nious Arctonotus lucidus (Sphingidae) based Regier, J. C., C. Mitter, T. P. Friedlander, on recent DNA evidence. J. Lepid. Soc. and R. S. Peigler. 2001. Phylogenetic rela- 63:233 – 235. tionships and evolution of hostplant use in Rubinoff, D., and M. San Jose. 2010. Life his- Sphingidae (Lepidoptera): Initial evidence tory and host range of Hawaii’s endan- from two nuclear genes. Mol. Phylogenet. gered Blackburn’s sphinx moth (Manduca Evol. 20:311 – 316. blackburni Butler). Proc. Hawaii. Entomol. Riotte, J. C. E. 1986. Re-evaluation of Man- Soc. 42:53 – 59. duca blackburni (Lepidoptera: Sphingidae). Simon, C., F. Frati, A. Beckenbach, B. J. Proc. Hawaii. Entomol. Soc. 27:79 – 90. Crespi, H. Liu, and P. Flook. 1994. Evolu- Roger, A. J., and L. A. Hug. 2006. The origin tion, weighting, and phylogenetic utility of and diversification of eukaryotes: Problems mitochondrial gene sequences and a com- with molecular phylogenetics and molec pilation of conserved polymerase chain ular clock estimation. Philos. Trans. R. reaction primers. Ann. Entomol. Soc. Am. Soc. Lond. B: Biol. Sci. 361:1039 – 1054. 87:651 – 701. Ronquist, F., and J. P. Huelsenbeck. 2003. Sukumaran, J., and M. T. Holder. 2010. Den- MrBayes 3: Bayesian phylogenetic infer- droPy: A Python library for phylogenetic ence under mixed models. Bioinformatics computing. Bioinformatics 26:1569 – 1571. 19:1572 – 1574. Swofford, D. L. 2002. PAUP*: Phylogenetic Rothschild, L. W., and K. Jordan. 1903. A re- analysis using parsimony (*and other meth- vision of the lepidopterous family Sphingi- ods). Version 4.0b10. Sinauer Associates, dae. Novit. Zool. 9:1 – 972. Sunderland. Rubinoff, D., S. Cameron, and K. Will. 2006. U.S. Fish and Wildlife Service. 2005. Recov- A genomic perspective on the shortcom- ery plan for the Blackburn’s Sphinx Moth ings of mitochondrial DNA for ‘‘Bar (Manduca blackburni ). Portland, Oregon. coding’’ identification. J. Hered. 97:581 – Zimmerman, E. C. 1958. Insects of Hawaii. 594. Vol. 7. Macrolepidoptera. University of Rubinoff, D., and B. S. Holland. 2005. Be- Hawai‘i Press, Honolulu. tween two extremes: Mitochondrial DNA Zwickl, D. J. 2006. Genetic algorithm ap- is neither the panacea nor the nemesis of proaches for the phylogenetic analysis of phylogenetic and taxonomic inference. large biological sequence datasets under Syst. Biol. 54:952 – 961. the maximum likelihood criterion. Ph.D. Rubinoff, D., and J. J. Le Roux. 2008. Evi- diss., The University of Texas at Austin dence of repeated and independent salta- (http://www.bio.utexas.edu/faculty/ tional evolution in a peculiar genus of antisense/GARLI/GARLI.html). Copyright of Pacific Science is the property of University of Hawaii Press and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. Systematic Relationship of Manduca blackburni and M. quinquemaculatus · Rubinoff et al. 33

TABLE 1 Identification Numbers, Collection Data, and GenBank Accession Numbers for the Species Sampled in This Study

UH GenBank Accession Numbers extraction UM sample Species ID voucher ID Locality CAD EF-1α COI

TABLE 2 Primer Names and Sequences Utilized in This Study

Gene Primer Name Sequence (5′-3′) Reference