Phylogenetics and Species Status of Hawai‘i’s Endangered Blackburn’s Sphinx Moth, Manduca blackburni ( Lepidoptera: Sphingidae)1 Daniel Rubinoff,2,3 Michael San Jose,3 and Akito Y. Kawahara3 Abstract: Manduca blackburni, commonly known as Blackburn’s Sphinx Moth, is a federally listed endangered species restricted to localized habitats on three is- lands in the Hawaiian archipelago. Manduca blackburni was thought to be closely related to the widely distributed New World species M. quinquemaculatus, but this has never been formally tested, and shortly after its description, many au- thors dismissed it as a subspecies or form of M. quinquemaculatus. We used one mitochondrial gene, COI, and two nuclear genes, CAD and EF-1α (2,975 bp total), to examine the phylogenetic relationships between M. blackburni and pu- tative sister species in the genus. The phylogeny resulting from two single-gene analyses (CAD, COI) and the concatenation of all three genes suggest that M. blackburni + M. quinquemaculatus are sister taxa, and the monophyly of each spe- cies is supported with relatively high branch support under parsimony, m aximum likelihood, and Bayesian inference. Manduca blackburni and M. quinquemaculatus also differ in genetic distance for CAD and COI, and we therefore consider them separate species. Thus, our molecular results corroborate previous studies on the morphology of M. blackburni and retain the species rank of this taxon. Our re- sults also indicate that one or more South American subspecies of M. sexta may merit elevation to species. Manduca blackburni (Butler, 1880), com- Historically, M. blackburni was a dry-forest in- monly known as Blackburn’s Sphinx Moth habitant found on all of the main Hawaiian (BSM), is Hawai‘i’s largest endemic insect Islands and was noted as an occasional pest on (Figure 1). Manduca contains 70 species, and eggplant and other solanaceous crops (Zim- M. blackburni has the most isolated distribu- merman 1958), much like its sister species tion of any of them (Kitching et al. 2011). M. quinquemaculatus (Haworth, 1803), in the continental United States. However, M. blackburni was never common, and between 1940 and 1970 the moth was recorded only a 1 This research was supported in part by U.S. Depart- handful of times (U.S. Fish and Wildlife Ser- ment of Agriculture Cooperative State Research, Educa- vice 2005). The Bishop Museum (Honolulu, tion, and Extension Service projects HAW00942-H and Hawai‘i) conducted extensive surveys in the HAW00956-H, both administered by the College of mid-1970s but failed to find M. blackburni, Tropical Agriculture and Human Resources, University of Hawai‘i at Mänoa, Honolulu; and in part by the and the moth was presumed extinct (Gagné National Science Foundation (USA) project no. DEB- and Howarth 1982). The moth was later 0918341. Manuscript accepted 5 June 2011. found to persist in a few isolated populations 2 Corresponding author (e-mail: [email protected]). 3 on East Maui (Riotte 1986) and is now also Department of Plant and Environmental Protection known from parts of the islands of Hawai‘i Sciences, University of Hawai‘i at Mänoa, 3050 Maile Way, Honolulu, Hawai‘i 96822. Current address: Florida and Kaho‘olawe, but it was never rediscov- Museum of Natural History, University of Florida, 3215 ered on the islands of Kaua‘i, Läna‘i, Moloka‘i, Hull Road, Gainesville, Florida 32611-2710. or O‘ahu. Because of M. blackburni’s disap- pearance from several islands and the decline across the remaining islands, the species was Pacific Science (2012), vol. 66, no. 1:31 – 41 doi: 10.2984/66.1.2 declared endangered in 2000, one of only two © 2012 by University of Hawai‘i Press moths to ever receive federal protection (U.S. All rights reserved Fish and Wildlife Service 2005). 31 32 PACIFIC SCIENCE · January 2012 Figure 1. Manduca blackburni (Butler), adult male, from Kokomo, Maui. Photographed 15 December 2009. Scale bar, 2 cm. The species status of M. blackburni re- M. quinquemaculatus. In the most recent mained fairly uncertain until recently when r evision of the Sphingidae, Kitching and considerable morphological work was con- C adiou (2000) also treated M. blackburni as a ducted on its immature stages (Riotte 1986). species. Butler (1880 [1881]) described M. blackburni Despite the morphological taxonomic as a species, but Meyrick (1899) sank black- work conducted, no molecular studies have burni as a subspecies of the widespread M. examined the relationship of M. blackburni to quinquemaculatus. Rothschild and Jordan other species in the genus or tested the species (1903) and Zimmerman (1958) followed status of M. blackburni. Moreover, the origins Meyrick and treated M. blackburni as a sub- of M. blackburni remain obscure, as does the species. Zimmerman (1958) created further degree of divergence from its putative sister confusion by claiming that the continental species M. quinquemaculatus. The purpose of species M. quinquemaculatus is also present in this study is to construct a molecular phylog- Hawai‘i, where it has never been found. Like eny of M. blackburni and its close relatives many prior authors, d’Abrera (1986 [1987]) within Manduca, confirm its taxonomic rank treated M. blackburni as a Hawaiian popula- with molecular data, and assess the approxi- tion of M. quinquemaculatus. Riotte (1986) el- mate time of divergence from its sister spe- evated M. blackburni to species and presented cies. Through the phylogenetic placement of detailed evidence of morphological d ifferences M. blackburni we hope to not only answer the in the larvae and adults of M. blackburni and taxonomic uncertainty concerning Manduca Systematic Relationship of Manduca blackburni and M. quinquemaculatus · Rubinoff et al. 33 TABLE 1 Identification Numbers, Collection Data, and GenBank Accession Numbers for the Species Sampled in This Study UH GenBank Accession Numbers extraction UM sample Species ID voucher ID Locality CAD EF-1α COI M. blackburni (Butler, ms567 — USA: Hawai‘i, Maui, JN170048 JN170063 JN170077 1880) Kanaio M. blackburni (Butler, ms568 — USA: Hawai‘i, Maui, JN170049 JN170064 JN170078 1880) Kanaio M. blackburni (Butler, ms569 — USA: Hawai‘i, Maui, JN170050 JN170065 JN170079 1880) Kanaio M. diffissa (Butler, ms618 WJK-03-2903 Ecuador: Pichincha JN170051 JN170066 JN170080 1871) province, Tinalandia M. hannibal (Cramer, ms619 WJK-03-2904 Ecuador: Pichincha JN170052 JN170067 JN170081 1779) province, Tinalandia M. occulta ms621 05-srnp-46038 Costa Rica: JN170054 JN170069 JN170083 (Rothschild & Guancaste, Area Jordan, 1903) de Conservacion M. quinquemaculatus ms622 GS-02-1766 USA: Missouri, Cape JN170055 JN170070 JN170084 (Haworth, 1803) Girardeau M. quinquemaculatus ms623 JPT-02-1535 USA: Arizona, JN170056 JN170071 JN170085 (Haworth, 1803) Harshaw Creek M. quinquemaculatus ms624 DCR-02-1876 USA: Arkansas, Scott JN170057 N/A JN170086 (Haworth, 1803) County, Waldron M. sexta (Linnaeus, ms625 DCR-02-1874 USA: Arkansas, Scott JN170058 JN170072 JN170087 1763) County, Waldron M. sexta (Linnaeus, ms620 JKA-02-1654 Mexico: El Lobo JN170053 JN170068 JN170082 1763) Queretaro M. sexta (Linnaeus, ms626 MM-03-2146 Argentina: INTA JN170059 JN170073 JN170088 1763) Manfredi M. sexta (Linnaeus, ms627 AYK-06-7001 USA: Arizona, Gila JN170060 JN170074 JN170089 1763) County, Payson M. sexta (Linnaeus, ms628 07-SRNP-1020 Costa Rica: JN170061 JN170075 JN170090 1763) Guancaste, Area de Conservacion M. sexta (Linnaeus, ms629 AYK-04-0545 Chile: Reg. VI, JN170062 JN170076 JN170091 1763) Melado Note: UH, University of Hawai‘i at Mänoa, Honolulu; UM, University of Maryland, College Park. in Hawai‘i, but also to evaluate the i mportance M. blackburni specimen was deposited as a and direction of conservation actions for the voucher in the University of Hawai‘i Insect species. For a description of the life history of Museum (UHIM). We also sequenced 12 M. blackburni, see Riotte (1986) and Rubinoff non–M. blackburni specimens from five other and San Jose (2010). species, obtained from the University of Maryland Frozen Lepidoptera Collection materials and methods (UM [Table 1]). The non–M. blackburni se- quences do not have morphological voucher Taxon Sampling, DNA Extraction, samples at UHIM, because they were sent Amplification, and Sequencing from UM. Genomic DNA was extracted from Two legs from each of three adult M. black- all specimens using the DNeasy animal blood burni specimens were used for total genomic and tissue extraction kit following recom- DNA extraction. The remainder of each mended protocols (Qiagen, Inc., Valencia, 34 PACIFIC SCIENCE · January 2012 TABLE 2 Primer Names and Sequences Utilized in This Study Gene Primer Name Sequence (5′-3′) Reference COI LCO-1490 GCTCAACAAATCATAAAGATATTGG Folmer et al. (1994) HCO-2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994) Jerry-k485 CAACATTTATTTTGATTTTTTGG Simon et al. (1994) Pat-k508 TCCAATGCACTAATCTGCCATATTA Simon et al. (1994) EF-1α Oscar-6143 GGCCCAAGGAAATGGGCAAGGG W. Haines, University of Hawai‘i, unpubl. data Bosie-6144 CCGGCGACGTAACCACGACGC W. Haines, University of Hawai‘i, unpubl. data CAD CAD-man-F GCCGAGTTTGGATTATTGTGTTGTC Designed for this study CAD-man-R ATCGATAGTATGACCCCGCTAGGGCG Designed for this study California). The subspecific name of the Chil- cles of (94°C for 30 sec, 50°C for 30 sec, and ean M. sexta in this study is probably M. sexta 70°C for 1 min) with a final 70°C extension caestri (Blanchard, 1854), but we have not for- for 10 min. EF-1α was amplified as one frag- mally assigned a subspecific name because it ment with primers