Drosophila Intersex Orthologue in the Silkworm, Bombyx Mori and Related Species
Total Page：16
File Type：pdf, Size：1020Kb
Genetica DOI 10.1007/s10709-010-9529-x SI-MOLECULAR TECHNOLOGIES TO IMPROVE SIT Drosophila intersex orthologue in the silkworm, Bombyx mori and related species K. P. Arunkumar • J. Nagaraju Received: 19 June 2010 / Accepted: 21 October 2010 Ó Springer Science+Business Media B.V. 2010 Abstract Intersex (ix), a gene required for female sexual Introduction development in Drosophila, acts in concert with doublesex (dsx) at the end of the sex determination pathway. In the The insect order Lepidoptera, in contrast to most other present study a homologue of ix was identified in Bombyx animal groups, has a female heterogametic system. It has a mori. Expression analysis of this gene by RT–PCR and WZ/ZZ (female/male) sex chromosome system, with some RNase protection assay revealed a diagnostic alternative exceptions (Traut et al. 2007). The sex of the domesticated splice form present only in testis, whereas the most com- silkworm, Bombyx mori, is strongly controlled by the mon splice form was found to express in all other tissues presence of the W chromosome. There is a striking dif- from early embryonic developmental stages. The present ference in the mode of sex determination between silk- study provides evidence for the presence of an alternative worms (Bombycids and Saturniids) and Lymantria, even splice form of ix in three species of silkmoths examined. though both belong to the same insect order. In Lymantria, Taken together with the results of an earlier study on ix in intersexes have been found in abundance. In contrast, all piralid moth, Maruca vitrata (Cavaliere et al. 2009), the sexual abnormalities in the silkworm are gynandromorphs, present study suggests that the testis-specific splice form apart from a few rare examples of intersexes (Tanaka and may be a characteristic feature of lepidopterans. Though ix Matsuno 1929). These reported intersexes may have been lacks a conserved splicing pattern it appears to have gynandromorphs for the following reasons: they appeared retained its functional conservation in terminal sexual in a hereditary mosaic strain, and no evidence had been differentiation. We speculate that the presence of an presented of sex alteration proceeding with development additional splice form, perhaps encoding non-functional (Tazima 1947). These observations suggest that there may protein only in testis, may prevent the feminizing effects not be an occurrence of intersexes in silkworms, and exerted by the functional IX protein. Bombyx may possess a sex determination mechanism that is quite distinct from other insect species. Keywords Bombyx mori Á Intersex Á Transcriptome Á Intersex (ix), a gene implicated in female sexual ESTs Á Antheraea development in Drosophila, is expressed and likely pro- duces functional proteins in both sexes and functions together with doublesex (dsx) to regulate terminal sex differentiation (Waterbury et al. 1999). In Drosophila, unlike Sxl, tra and dsx, ix produces only one splice form in all tissues of both males and females, and females express higher levels of ix (Garrett-Engele et al. 2002). K. P. Arunkumar Á J. Nagaraju (&) The IX contains proline-, glycine-, glutamine- and serine- Centre of Excellence for Genetics and Genomics of Silkmoths, rich region similar to known transcriptional activating Centre for DNA Fingerprinting and Diagnostics, Laboratory domains (Garrett-Engele et al. 2002) which forms a of Molecular Genetics, Lab block: Tuljaguda (Opp. MJ Market), Nampally, Hyderabad 500001, India complex that binds to the regulatory regions of DSX e-mail: [email protected] target genes, Yp1 and Yp2. Much of the work on 123 Genetica functional aspect of ix has been done in Drosophila, Expression analysis of B. mori intersex (Bmix) gene whereas among lepidopterans, ix has been reported in B. mori and the piralid agricultural pest, Maruca vitrata. In silico analysis of the testis transcriptome led to the In M. vitrata, a female-specific ix transcript is found only identification of two splice forms of Bmix gene. Comple- in pupae, which appears to be the first described sex- mentary DNA was synthesized from total RNA isolated specific transcript of an ix homologue characterized to from midgut, fatbody, head, silk gland, epidermis and date (Cavaliere et al. 2009). In another study, a B. mori gonads of 5th instar silkworm larvae and, gonads and other homologue of ix (Bmix) was identified using Expressed tissues of pupae and moths, by oligo(dT) priming using Sequence Tags (ESTs) resources, and it was found that MMLV reverse transcriptase (Invitrogen). To determine ix-mutant Drosophila females expressing Bmix cDNA the tissue distribution of Bmix expression, PCR experi- restored partial characteristics of the wild type phenotype ments were performed using cDNAs from multiple tissues (Siegal and Baker 2005). Ix-mutant Drosophila expressing of male and female. Bmix gene specific primers were M. vitrata intersex (Mvix) cDNA also resulted in partial designed using primer 3 software (Rozen and Skaletsky restoration of wild type female features as in the case of 2000). Five primers designed for exons (Table 1) are rescue with Bmix (Cavaliere et al. 2009). This is in shown in Fig. 1a. A pair of primers that bind to first and contrast to the complete rescue of the wild female phe- second exons was also designed to specifically amplify the notype with the expression of Megaselia scalaris ix second splice form (Table 1). PCR was performed for 35 cDNA that is almost indistinguishable from the expres- cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min. sion of ix cDNA of D. melanogaster (Siegal and Baker The primers for b-actin, actin-F CACTGAGGCTCCC 2005). These results suggest that ix, similar to dsx, is CTGAAC and actin-R GGAGTGCGTATCCCTCGTAG, broadly conserved. were used to amplify the endogenous control. PCR prod- Recent high throughput genomics projects have ucts amplified using Bmix gene specific primers were focused on the construction, annotation and analysis of cloned into pCRII- TOPO vector (Invitrogen) and then cell- and tissue-specific transcriptomes that have provided sequenced to confirm the testis-specific splice form. fundamental insights into biological processes. Data RNase protection assays were carried out to study the gathered from ESTs and microarray-based gene expres- expression pattern of Bmix splice forms. A radiolabelled sion profiles provide an important methodology for anti-sense RNA probe of 284 bp was synthesized for the discovery of novel genes that are expressed in a tissue- region comprising first and second exons using MegaScript specific manner. In this context, we investigated the testis in vitro transcription kit (Ambion, Austin, Texas, USA) transcriptome of the domesticated silkworm, B. mori,to identify and analyze testis-specific genes. This study led to the identification of a testis- specific splice form of ix Table 1 Details of primers used in RT–PCR expression analysis of mRNA in addition to the common form expressed in all Bmix gene and primers used to sequence A. assama and S. c. ricini ix tissues. RT–PCR and RNase protection assays confirmed transcripts the two splice forms; one form accumulated exclusively Species Primer name Sequence in the testis and the second form was present ubiquitously B. mori ixA ATGCACGTACCAATGAACCA in all tissues including testis. This finding provides an ixB TCTGCATTGTGATTTTGGTG opportunity to investigate the pleiotropic role of ix in ixC TTCGGGCGGTGATATATTCT sexual differentiation. ixD TTTTTCAAATCTAGGAACAGGATT ixE CGCTTGCTGGATACACGTT Materials and methods ixT-F TCCAAATGTAGCCATGCAAA ixT-R GGAAGATGACCAGGGTTTCA Sequence source and analysis A. assama Aix-A ATATGCACGTCCCGATGAAT Aix-B AATATTTGAGCGGCTGACTTC More than 100,000 ESTs, are available for B. mori in NCBI AixD CAGGTCATCGCTGTTCTCAA dbEST (Mita et al. 2003; Xia et al. 2004). We downloaded Aix-T GGTTCAACTCGGTCAGCAGT 9,614 testis ESTs and a total of 95,051 ESTs derived from Aix-Tr ACTGCTGACCGAGTTGAACC tissues other than testis. ESTs generated from other tissues S. c. ricini Scix_1 AATATGCACGTGCCAATGAA were also downloaded to identify testis-specific genes in Scix_2 AGTTAGCGTTGTTTCCTGTGC B. mori. Since many ESTs may be derived from the same Scix_3 TTCAAATCCACAGAAAGCCATA gene, the sequences were assembled into clusters with the The sequences of A. assama and S. c. ricini ix cDNA can be down- TGICL program (Pertea et al. 2003). loaded from online database ‘WildSilkBase’ 123 Genetica Fig. 1 a Comparison of gene structure and alternative splice forms of Bmix and Mvix. The primers ixA, ixB, ixC, ixD and ixE, were designed for different exons and black arrows indicate their location and direction of primer extension. Primers ix-T and ix-Tr were designed to amplify testis-specific splice form. Thick black line in the gene structure indicates intronic region whereas grey and orange blocks indicate positions of exons. The lines joining the exons above gene structure form common splice form and lines joining below the gene indicate testis splice form in B. mori and second splice form in M. vitrata. Second splice form in both cases leads to introduction of premature stop codon (represented in blue colour). b Dendrogram showing the relationship of IX protein between different species after cloning the fragment into pCRII- TOPO vector Sequencing and phylogenetic analysis of intersex (Invitrogen). This probe contains 89 bp sequence comple- homologs in other Lepidoptera mentary to the second exon and the remaining 195 bp complementary to a part of the first exon. RNA samples Putative homologs of ix in lepidopteran insects were (10 lg each) and aliquots containing 2 9 105 cpm of the identified either by searching the EST databases or by RNA probe were hybridized overnight at 45°Cin20ll sequencing with primers designed for conserved regions. hybridization solution containing 75% formamide/0.5 M DNA sequences found to encode proteins with significant NaCl/10 mM Tris HCl, pH 7.5. After addition of 300 llof similarity to BmIX amino acid sequence were identified by 300 lM NaCl/5 mM EDTA containing RNase A at 60 lg/ml, translated BLAST (tblastn) search against WildSilkbase, an the mixture was incubated for 1 h at 37°C and subse- EST database of wild silkmoths (Arunkumar et al.