Protistology 13 (2), 57–63 (2019) Protistology

Ultrastructural aspects of ecdysis in the naked dinoflagellate Amphidinium carterae

Mariia Berdieva, Pavel Safonov and Olga Matantseva

Institute of Cytology, Russian Academy of Sciences, St. Petersburg, Russia

| Submitted April 09, 2019 | Accepted April 29, 2018 |

Summary

The stressor-induced ecdysis takes a special place in dinoflagellate biology. During ecdysis, a cell loses the plasmalemma, outer amphiesmal vesicle membrane and, in armored species, thecal plates, becomes immotile, and then amphiesma regeneration occurs. Here we report the results of our study of cell covering rearrangement during ecdysis in the naked dinoflagellate species Amphidinium carterae Hulburt 1957. Ecdysis was induced by mechanical treatment (centrifugation). The changes in cell organization at the ultrastructural level were examined using transmission electron microscopy methods. Shedding of the plasma membrane and the outer amphiesmal vesicle membranes, fusion of the inner amphiesmal vesicle membranes were observed. The amorphous cytoplasm zone, which underlies inner amphiesmal vesicle membra- nes in motile cells, retains under the new plasma membrane in ecdysed cells. We showed accumulation of small vesicles and flattened tubules that apparently begin fusion to form juvenile amphiesmal vesicles in this zone. The absence of pellicle in Amphidinium dinoflagellates was suggested.

Key words: dinoflagellate, ecdysis, Amphidinium carterae, amphiesma, electron microscopy

Introduction (thecal plates). The naked dinoflagellates possess amphiesmal vesicles that either are empty or contain The presence of a complex cell covering (am- amorphous material. An additional pellicular layer phiesma) determines structural organization and (pellicle) may be present in the amphiesma in both physiology of dinoflagellate cells. Flattened alveoli, cases (Morrill and Loeblich, 1983; Pozdnyakov or amphiesmal vesicles, underlie the plasma mem- and Skarlato, 2012). At the ultrastructural level, brane and are closely adjacent to it and to each other. the dinoflagellate cell covering includes three Morphologically, two forms of dinoflagellates are membranes — plasmalemma, outer amphiesmal distinguished depending on the content of alveoli vesicle membrane (OAVM), and inner amphiesmal – naked, or unarmored, and armored (Dodge and vesicle membrane (IAVM). Crawford, 1970; Morrill and Loeblich, 1983). In the This type of cell covering organization makes latter, amphiesmal vesicles contain cellulosic plates it a labile system that can be re-formed in dinofla-

doi:10.21685/1680-0826-2019-13-2-2 © 2019 The Author(s) Protistology © 2019 Protozoological Society Affiliated with RAS 58 · Mariia Berdieva, Pavel Safonov and Olga Matantseva gellate life history. The phenomenon of such a the rest of the cell covering in Noctiluca scintillans rearrangement is called ecdysis. Ecdysis is a process (referred as N. miliaris) was mentioned (Melkonian of shedding of the cell covering elements unique to and Höhfeld, 1988). However, those results should dinoflagellates. An ecdysing cell loses plasmalemma, be reconsidered in the light of newly accumulated OAVM and, in armored species, thecal plates information and revision of the model of amphiesma (Pozdnyakov and Skarlato, 2012). These radical changes after ecdysis. changes are followed by the formation of the new Here we present the first results of the study covering. The former IAVM becomes the new of the cell covering rearrangement during ecdysis plasma membrane, and the new amphiesmal vesicles in the naked dinoflagellate species Amphidinium are formed beneath it in the cortical cytoplasm zone. carterae Hulburt 1957. Ecdysis was induced by During this transformation, a cell remains immotile. mechanical treatment (centrifugation). The changes In the vast majority of studied species, the pellicle in cell organization at the ultrastructural level were becomes a well-developed layer and covers a cell examined using transmission electron microscopy until completion of the new amphiesma formation methods. Our observations represent the basis (Morrill, 1984; Bricheux et al., 1992; Höhfeld and for subsequent investigation of the membrane Melkonian, 1992; Sekida et al., 2001, 2004). In the transformation and amphiesma regeneration. literature, the usually short-term immotile stage formed as a result of ecdysis is called “temporary”, “ecdysal”, or “pellicle” cyst (Bravo and Figueroa, Material and methods 2014). Ecdysis is employed at the different stages of CELL CULTURE the dinoflagellate life cycle whenever cell covering rearrangement is necessary. This process occurs The culture of the dinoflagellate isolated from during cytokinesis in species reproducing by eleu- the White Sea and designated as Amphidinium theroschisis (Morrill and Loeblich, 1984; Pfiester, carterae was obtained from the collection at the 1984). Shedding of the cell covering elements also Department of Hydrobiology, Lomonosov Moscow takes place during the transition to the resting cysts State University and is currently maintained in the stage/excystment (Kokinos and Anderson, 1995; protist collection at the Laboratory of Cytology Pfiester, 1989). Ecdysis is considered as a mecha- of Unicellular Organisms (Institute of Cytology nism of the multimembrane cell covering formation RAS). Cells were grown in 17 PSU f/2 medium in the symbiotic Symbiodinium genus (Wakefield et without silicate prepared in artificial seawater (ASW) al., 2000; Wakefield and Kempf, 2001). (Guillard and Ryther, 1962; Kester et al., 1967) at The stressor-induced ecdysis holds a special room temperature, pH 8.2 and 50 µmol photons m−2 place in the dinoflagellate biology. Mechanical s−1 under a 12 h light : 12 h dark cycle. treatment, osmotic shock, temperature, and nutrient changes can act as such stressors (Morrill, 1984; DNA EXTRACTION, PCR AMPLIFICATION, ELECTRO- Bricheux et al., 1992; Höhfeld and Melkonian, 1992; PHORESIS AND SEQUENCING Smayda, 2010; Onda et al., 2014; Chan et al., 2019). As a variant of the stress response, ecdysis appears Cells were lysed by freezing at –80 ºC for 10 min to provide rearrangements in the cell cover, possibly and then thawed at room temperature. Total DNA including alteration in its molecular composition was isolated using a DNA extraction kit (BioSilica which may be necessary for an adequate response Ltd., Russia) in accordance with manufacturer’s to external conditions. Stressor-induced ecdysis instructions. is an appropriate model to study the mechanisms In order to verify the species identity of the underlying shedding and regeneration of the am- dinoflagellates in the culture, several PCR reactions phiesmal elements. It should be noted that such were conducted using 18S rRNA gene-specific studies have hitherto been focused on armored primer pairs 18ScomF1/ Dino18SR1 (Zhang et dinoflagellates (Morrill, 1984; Bricheux et al., al., 2005), RibA/ S20R, and RibA/ RibB (RibA 1992; Kwok and Wong, 2003; Sekida et al., 2001, – ACCTGGTTGATCCTDCCAGT; RibB – 2004). The exception is a work of Höhfeld and TGATCCATCTGCAGGTTCACCTAC; S20R Melkonian (1992) that included data on ecdysis in - GACGGGCGGTGTGTACAA). Amplification the naked species Amphidinium rhynchocephalum. was carried out in 30 µl mixture containing 15 µl 2Х Besides, dissociation of two outer membranes from DreamTaq MasterMix (Thermo Fisher Scientific, Protistology · 59

USA), 6 µl DNase/RNase-free water, 3 µl of Table 1. Annealing temperature for the used forward and reverse primers and 3 µl of genomic primer pairs. DNA template. PCR reaction started with pre- denaturation at 95 ºC for 5 min followed by 39 Primer pair Annealing temperature (ºC) cycles comprising denaturation at 94 ºC for 30 s, 18ScomF1/ Dino18SR1 58 primer annealing for 1 min (temperature differs for RibA/ S20R 52 each primer pair, Table 1), and elongation at 72 RibA/ RibB 52 ºC for 2 min. The procedure was completed by the elongation step at 72 ºC for 7 min. dehydrated and embedded in Epon 812 – Araldite Separation of PCR products was conducted in M (Fluka, Switzerland) resin mixture. Ultrathin 1.5 % agarose gel in 1× TAE buffer. To estimate sections were cut using an Ultracut E (Reichert amplicon sizes, we used GeneRuler 1000 bp DNA Jung, Austria) ultramicrotome, contrasted with ladder (Thermo Fisher Scientific, USA). After uranyl acetate and lead citrate and examined in a the separation, gels were stained with ethidium Libra 120 (Carl Zeiss, Germany) microscope. bromide, and amplified fragments were visualized under UV light. PCR products were then extracted from gels by means of BioSilica gel extraction Results kit (BioSilica Ltd., Russia) according to the manufacturer’s instructions. DNA sequencing of the SPECIES IDENTIFICATION obtained amplicons was performed by Beagle Co. Ltd. with the use of the abovementioned primers, The studied dinoflagellate monoculture was as well as the internal sequencing primer sAF tentatively identified as Amphidinium carterae (CTGGTTGATYCTGCCAG). NCBI nucleotide according to the morphological similarity with the BLAST search was used to confirm the species original description (Fig. 1, A) (Hulburt, 1957). To identity. confirm the species identity, we conducted PCR amplification with total DNA extracted from the INDUCTION OF ECDYSIS, LIGHT AND TRANSMISSION culture and 18S rRNA gene-specific primers. Five ELECTRON MICROSCOPY products were obtained and sequenced. The best BLAST hits showed that all of them were fragments To induce ecdysis, cells were harvested by of 18S RNA gene of A. carterae. centrifugation (2000 g for 3 min), carefully re- suspended and incubated at room temperature for CELL MORPHOLOGY AND ULTRASTRUCTURE AFTER ME- 6 h. CHANICAL TREATMENT For intravital observations of A. carterae cells, a Leica DM2500 (Leica-Microsystems, Germany) Some A. carterae cells lost motility almost light microscope equipped with phase and differen- immediately after centrifugation (Fig. 1, B). At tial interference contrast optics was used. the light microscope level, we did not observe any For the electron microscopy studies, cells were distinguishable morphological changes in immotile fixed immediately after centrifugation, 30 min, cells as compared to the untreated motile cells (Fig. 3 h and 6 h after the treatment. Non-centrifuged 1, A, B). They retained elongate-elliptical cell shape cells were fixed for the control. No additional with a small conical epicone. harvesting was carried out prior to fixation. The We examined changes in the organization of A. cell suspensions were incubated with the fixative carterae amphiesma and cortical cytoplasm zone at mixture added directly to the culture medium. The the ultrastructural level using transmission electron mixture contained the following components with microscopy. The intact amphiesma of amphidinoid final concentrations after combining with a sample: vegetative cells consisted of flattened empty (filled 3% (v/v) glutaraldehyde (Sigma-Aldrich, USA), with electron-transparent content) amphiesmal 1% (w/v) osmium tetraoxide (TAAB Laboratories vesicles beneath the plasma membrane (Fig. 2, A). The OAVMs adjoined to the plasma membrane, and Equipment, UK), 1 mM CaCl2, 17 PSU ASW (pH 8.0-8.5). After 30 min fixation, 17 PSU ASW lateral membranes of adjacent vesicles were tightly was added and samples were gently harvested by appressed in sutures. The cortical cytoplasm zone centrifugation (600 g for 3 min). Then cells were under IAVMs was organized as an amorphous layer rinsed in 17 PSU ASW thrice, embedded in 2% agar, (20-30 nm in width) underlain by a discontinuous 60 · Mariia Berdieva, Pavel Safonov and Olga Matantseva

including changes that occur at the molecular level, still need to be resolved. The studies of membrane rearrangement at the molecular level should be linked to the morphological and ultrastructural data. For this purpose, we started a revision of the ecdysis process in a representative of the naked dinoflagellates Amphidinium carterae using light and transmission electron microscopy methods. Fixation was performed based on the modified protocols offered by Shigenaka et al. Fig. 1. Morphology of Amphidinium carterae cells (1973) for ciliates and by McFadden and Melkonian (light microscopy): A – motile vegetative cells in (1986) for microalgae. The outer membranes in culture; B – immotile cells after centrifugation. the Amphidinium amphiesma are very vulnerable Scale bars: 10 µm. to the conventional double fixation (Klut et al., 1985). Simultaneous treatment with a mixture of glutaraldehyde and osmium tetraoxide allowed to row of microtubules (Fig. 2, A, B). The membrane preserve their intact structure. Divalent cations, compartment consisting of large vacuoles with e.g. Ca2+, were included in fixatives to improve the electron-transparent content (cytoplasmic vacuoles) preservation of microtubules and other cytoskeletal that contained smaller vesicles and tubules was elements (Shigenaka et al., 1973). localized beneath microtubules. The initial stages of ecdysis were previously After centrifugation the integrity of the plasma described in the other Amphidinium species, A. membrane and OAVMs was disrupted (Fig. 2, rhynchocephalum (Höhfeld and Melkonian, 1992). C). These membranes separated from the sutures, Based on the results of observations of changes in vesiculated and then were shedded by the cell (Fig. amphiesma ultrastructure in A. rhynchocephalum 2, C). Some cells underwent ecdysis immediately and armored species Heterocapsa niei, Höhfeld after treatment. The sutures were disrupted, IAVMs and Melkonian (1992) proposed their ecdysis mo- fused covering the entire cell, and it was the only del. They described the membrane that covered membrane surrounding the cell. The amorphous a cell after shedding of two outer membranes as a zone of cytoplasm and microtubules were retained pellicle membrane. It is formed by IAVMs fusion. in immotile cells (Fig. 2, D). Such a pattern of The amorphous layer beneath this membrane cell covering organization was maintained at that was therefore referred to as pellicular. In A. rhyn- stage. Finally, the new amphiesma began to form chocephalum this layer exists in the vegetative cells in the dinoflagellate cells. The small vesicles and and does not undergo structural changes during flattened tubules were observed in the amorphous amphiesma rearrangement. In H. niei it forms cytoplasm zone between the former IAVM and during ecdysis and has an additional honeycomb- large cytoplasmic vacuoles that also contained patterned layer. However, the model of Höhfeld and small vesicles and membrane structures (Fig. 2, E, Melkonian (1992) did not take into consideration F). The vesicles in the amorphous cytoplasm zone the issue of the origin of the new plasmalemma. apparently began fusion to form juvenile amphiesmal Pozdnyakov and Skarlato (2012) pointed this out in vesicles that would be structural elements of the new the paper revising and generalizing data concerning amphiesma. the amphiesma rearrangement stages. Here it is necessary to mention the modern con- Discussion cept of a pellicle. Currently, the consensus appears to have been reached that a pellicle is an external The ability for ecdysis is one of a number of layer covering a cell over the former IAVM after specific features inherent to this amazing group – ecdysis (Bricheux et al., 1992; Kwok and Wong, the dinoflagellates. This process and the concurrent 2003; Sekida et al., 2001, 2004; Chan et al., 2019). amphiesma rearrangements ensure protection of the It is a temporary covering that bounds an immotile dinoflagellate cells during unfavorable conditions cell in the period of vulnerability and is to be re- or the reproduction period. However, a number moved after amphiesma renovation/completion of issues concerning different aspects of ecdysis, of division. Consequently, the membrane that Protistology · 61

Fig. 2. Ultrastructure of cell covering in Amphidinium carterae cells (transmission electron microscopy). A, B – Motile vegetative cells; C – ecdysing cell; integrity of the plasma membrane and OAVMs is disrupted; they separate from the sutures (arrowheads); D – ecdysed cell; after sutures disruption IAVMs fuse and form continuous membrane that covers a cell (new plasma membrane); amorphous cytoplasm zone and microtubules (inset, arrowheads) are retained; E, F – ecdysed cells, 6 h after centrifugation; small vesicles and flattened tubules (arrows) accumulate in the amorphous cytoplasm zone. Abbreviations: az – amorphous cytoplasm zone, av – amphiesmal vesicles, iavm – inner amphiesmal vesicle membrane, lv – large cytoplasmic vesicles, mt – microtubules, npm – new plasmalemma, oavm – outer amphiesmal vesicle membrane, pm – plasmalemma, s - sutures. Scale bars: A, B, E, F – 500 nm, C-D – 1 µm. retains after pellicle shedding should be a new membrane should be considered as the new plasma- plasma membrane. Sekida with co-authors (Sekida lemma derived from fused IAVMs. The amorphous et al., 2004) investigated the changes in the mem- cytoplasm zone is an internal layer and therefore it brane polysaccharide staining pattern and thus cannot be a pellicle in the sense that is described demonstrated that transformation of IAVM into the above. Otherwise, another continuous membrane new plasmalemma occurred after the development would be required under this layer in the ecdysed cell. of a pellicle layer in the armored dinoflagellate The outer membrane of the cytoplasmic vacuoles Scrippsiella hexapraecingula. is localized in this zone but this compartment is For the Amphidinium dinoflagellates, we sup- permanently present in cells of many dinoflagellates pose that Höhfeld and Melkonian’s (1992) pellicle and is likely to remain stable during the membrane 62 · Mariia Berdieva, Pavel Safonov and Olga Matantseva rearrangements (e.g. Wetherbee, 1975; Morrill, study (Orr et al., 2012), the origin of pellicle can 1984; Klut et al., 1985; Lucas and Vesk, 1990; also be a promising albeit complicated issue for such Bricheux et al., 1992). Moreover, we consider the analysis. Further investigations of these aspects in presence of small vesicles and flattened tubules in amphidinioid dinoflagellates and involvement of the amorphous zone as evidence in favor of our more species in the analysis can shed new light on hypothesis. They accumulate freely in this area and this basic problem of dinoflagellate biology. appear to begin fusion to form juvenile amphiesmal vesicles. Besides, A. carterae, A. corpulentum, and A. operculatum were among 45 dinoflagellate species Acknowledgments tested for the presence of a pellicle that is acetolysis- resistant and positively reacts with carbohydrate- The research was funded by the Russian Science specific stains (Morrill and Loeblich, 1981), and the Foundation, project No 18-74-10093. results of this analysis were negative for Amphidinium species. Klut with co-authors (1985) conducted an exa- References mination of A. carterae cell surface using cytoche- mical methods. Notably, they mentioned a so-called Bravo I. and Figueroa R.I. 2014. Towards an amorphous layer, but they did not hypothesize ecological understanding of dinoflagellate cyst about its nature. The authors showed that along functions. Microorganisms. 2, 11–32. with the acid mucopolysaccharide coat overlying Bricheux G., Mahoney D.G. and Gibbs S.P. the plasma membrane, there was a “fuzz” material 1992. Development of the pellicle and thecal plates on the inner surface of amphiesmal vesicles (Klut following ecdysis in the dinoflagellate Glenodinium et al., 1985). It can be assumed that this material foliaceum. Protoplasma. 168, 159–71. is a precursor of glycocalyx, and therefore IAVMs Chan W.S., Kwok A.C.M. and Wong J.T.Y. can be ready to form the new plasmalemma in the 2019. Knockdown of dinoflagellate cellulose case of ecdysis. As we mentioned above, Sekida synthase CesA1 resulted in malformed intracellular with co-authors (Sekida et al., 2004) showed the cellulosic thecal plates and severely impeded cyst- transformation of IAVM into the new plasmalemma to-swarmer transition. Front. Microbiol. 10, 546. after the development of a pellicle layer. Such a Dodge J.D. and Crawford R.M. 1970. A survey transformation can probably occur faster in non- of thecal fine structure in the Dinophyceae. Bot. J. pelliculate species like Amphidinium. Linn. Soc. 63, 53–67. Our hypothesis about nature of the amorphous Guillard R.R.L. and Ryther J.H. 1962. Studies cytoplasm zone does not exclude specificity of its of marine diatoms I. Cyclistella nana Hustedt and structural organization and, apparently, the peculiar Detonula confervacea (Cleve) Gran. Can. J. Micro- molecular composition. Such a layer (interpreted biol. 8, 229–39. as a pellicle) was also shown in Noctiluca cells Höhfeld I. and Melkonian M. 1992. Amphiesmal (Melkonian and Höhfeld, 1988). Interestingly, ultrastructure of dinoflagellates: a reevaluation of the authors noted the dependence of amphiesmal pellicle formation. J. Phycol. 28, 82–89. vesicles shape on the amorphous layer thickness. It Hoppenrath M. 2017. Dinoflagellate taxono- can be assumed that this zone (layer) is responsible my—a review and proposal of a revised classification. for cell rigidity in the absence of other strengthening Mar. Biodivers. 47, 381–403. amphiesmal elements. The special study of the zone Hulburt E.M. 1957. The taxonomy of unarmored structure and its molecular composition is required Dinophyceae of shallow embayments on Cape Cod, to elucidate this issue. Massachusetts. Biol. Bull. 112, 196–219. The genus Amphidinium is considered as the Kester D.R., Duedall I.W., Connors D.N. and basal group of core dinoflagellates according to Pytkowicz R.M. 1967. Preparation of artificial the eight-gene phylogeny (Orr et al., 2012). The seawater. Limnol. Oceanogr. 12, 176–179. abovementioned Noctiluca, which possesses a Ki J.S. 2010. Nuclear 28S rDNA phylogeny similar layer, was also often positioned among basal supports the basal placement of Noctiluca scintillans core dinoflagellates (Ki, 2010; Hoppenrath et al., (Dinophyceae; Noctilucales) in dinoflagellates. Eur. 2017). This similarity allows assuming that pellicle J. Protistol. 46, 111–120. can be absent in the basal groups. Given that the Klut M.E., Bisalputra T. and Antia N.J. 1985. origin of theca was in the focus of the phylogenetic Some cytochemical studies on the cell surface of Protistology · 63

Amphidinium carterae (Dinophyceae). Protoplasma. Pfiester L.A. 1989. Dinoflagellate sexuality. Int. 129, 93–99. Rev. Cytol. 114, 249–272. Kokinos J.P. and Anderson D.M. 1995. Mor- Pozdnyakov I. and Skarlato S. 2012. Dinofla- phological development of resting cysts in cultures of gellate amphiesma at different stages of the life cycle. the marine dinoflagellate Lingulodinium polyedrum Protistology. 7, 108–115. (= L. machaerophorum). Palynology. 19, 143–166. Sekida S., Horiguchi T. and Okuda K. 2001. Kwok A.C.M. and Wong J.T.Y. 2003. Cellulose Development of the cell covering in the dinoflagel- synthesis is coupled to cell cycle progression at G1 late Scrippsiella hexapraecingula (Peridinales, Dino- in the dinoflagellate Crypthecodinium cohnii. Plant phyceae). Phycol. Res. 49, 163–176. Physiol. 131, 1681–1691. Sekida S., Horiguchi T. and Okuda K. 2004. Lucas I.A. and Vesk M. 1990. The fine structure Development of thecal plates and pellicle in the of two photosynthetic species of Dinophysis (Dino- dinoflagellate Scrippsiella hexapraecingula (Peri- physiales, Dinophyceae). J. Phycol. 26, 345–357. diniales, Dinophyceae) elucidated by changes in McFadden G.I. and Melkonian M. 1986. Use stainability of the associated membranes. Eur. J. of Hepes buffer for microalgal culture media and Phycol. 39, 105–114. fixation for electron microscopy. Phycologia. 25. Shigenaka Y., Watanabe K. and Kaneda M. 551–557. 1973. Effects of glutaraldehyde and osmium tetro- Melkonian M. and Höhfeld I. 1988. Amphiesmal xide on hypotrichous ciliates, and determination of ultrastructure in Noctiluca miliaris Suriray (Dino- the most satisfactory fixation methods for electron phyceae). Helgol. Meeresunters. 42, 601–612. microscopy. J. Protozool. 20, 414–420. Morrill L.C. 1984. Ecdysis and the location of Smayda T.J. 2010. Adaptations and selection of the plasma membrane in the dinoflagellate Hetero- harmful and other dinoflagellate species in upwelling capsa niei. Protoplasma. 119, 8–20. systems 1. Morphology and adaptive polymorphism. Morrill L.C. and Loeblich A.R., Ill. 1981. The Prog. Oceanogr. 85, 53–70. dinoflagellate pellicular wall layer and its occurrence Wakefield T.S., Farmer M.A. and Kempf S.C. in the division Pyrrhophyta. J. Phycol. 17, 315–323. 2000. Revised description of the fine structure of Morrill L.C. and Loeblich A.R. 1983. Ultra- in situ “Zooxanthellae” genus Symbiodinium. Biol. structure of the dinoflagellate amphiesma. Int. Rev. Bull. 199, 76–84. Cytol. 82, 151–80. Wakefield T.S. and Kempf S.C. 2001. Develop- Morrill L. and Loeblich A.R., III. 1984. Cell ment of host-and symbiont-specific monoclonal division and reformation of the amphiesma in the antibodies and confirmation of the origin of the pelliculate dinoflagellate, Heterocapsa niei. J. Mar. symbiosome membrane in a cnidarian–dinoflagel- Biol. Assoc. U. K. 64, 939–953. late symbiosis. Biol. Bull. 200, 127–143. Onda D.F.L., Lluisma A.O. and Azanza R.V. Wetherbee R. 1975. The fine structure of Cera- 2014. Development, morphological characteristics tium tripos, a marine armored dinoflagellate: III. and viability of temporary cysts of Pyrodinium Thecal plate formation. J. Ultrastruct. Res. 50, bahamense var. compressum (Dinophyceae) in vitro. 77–88. Eur. J. Phycol. 49, 265–275. Zhang H., Bhattacharya D. and Lin S. 2005. Orr R.J., Murray S.A., Stüken A., Rhodes L. and Phylogeny of dinoflagellates based on mitochondrial Jakobsen K.S. 2012. When naked became armored: cytochrome b and nulear small subunit rDNA an eight-gene phylogeny reveals monophyletic sequence comparisons. J. Phycol. 41, 411-–420. origin of theca in dinoflagellates. PloS one. 7, e50004. Pfiester L.A. 1984. Sexual reproduction. In: Dinoflagellates (Ed: Spector D.L). Academic Press, pp. 181–199.

Address for correspondence: Mariia Berdieva. Institute of Cytology of the Russian Academy of Sciences, Laboratory of Unicellular Organisms, Tikhoretsky Ave. 4, 194064 St. Petersburg, Russia; e-mail: [email protected].