DOCSLIB.ORG

Protistology Ultrastructural Aspects of Ecdysis in the Naked Dinoflagellate

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Protistology Ultrastructural Aspects of Ecdysis in the Naked Dinoflagellate Protistology 13 (2), 57–63 (2019) Protistology Ultrastructural aspects of ecdysis in the naked dinoflagellate Amphidinium carterae Mariia Berdieva, Pavel Safonov and Olga Matantseva Institute of Cytology, Russian Academy of Sciences, St. Petersburg, Russia | Submitted April 09, 2019 | Accepted April 29, 2018 | Summary The stressor-induced ecdysis takes a special place in dinoflagellate biology. During ecdysis, a cell loses the plasmalemma, outer amphiesmal vesicle membrane and, in armored species, thecal plates, becomes immotile, and then amphiesma regeneration occurs. Here we report the results of our study of cell covering rearrangement during ecdysis in the naked dinoflagellate species Amphidinium carterae Hulburt 1957. Ecdysis was induced by mechanical treatment (centrifugation). The changes in cell organization at the ultrastructural level were examined using transmission electron microscopy methods. Shedding of the plasma membrane and the outer amphiesmal vesicle membranes, fusion of the inner amphiesmal vesicle membranes were observed. The amorphous cytoplasm zone, which underlies inner amphiesmal vesicle membra- nes in motile cells, retains under the new plasma membrane in ecdysed cells. We showed accumulation of small vesicles and flattened tubules that apparently begin fusion to form juvenile amphiesmal vesicles in this zone. The absence of pellicle in Amphidinium dinoflagellates was suggested. Key words: dinoflagellate, ecdysis, Amphidinium carterae, amphiesma, electron microscopy Introduction (thecal plates). The naked dinoflagellates possess amphiesmal vesicles that either are empty or contain The presence of a complex cell covering (am- amorphous material. An additional pellicular layer phiesma) determines structural organization and (pellicle) may be present in the amphiesma in both physiology of dinoflagellate cells. Flattened alveoli, cases (Morrill and Loeblich, 1983; Pozdnyakov or amphiesmal vesicles, underlie the plasma mem- and Skarlato, 2012). At the ultrastructural level, brane and are closely adjacent to it and to each other. the dinoflagellate cell covering includes three Morphologically, two forms of dinoflagellates are membranes — plasmalemma, outer amphiesmal distinguished depending on the content of alveoli vesicle membrane (OAVM), and inner amphiesmal – naked, or unarmored, and armored (Dodge and vesicle membrane (IAVM). Crawford, 1970; Morrill and Loeblich, 1983). In the This type of cell covering organization makes latter, amphiesmal vesicles contain cellulosic plates it a labile system that can be re-formed in dinofla- doi:10.21685/1680-0826-2019-13-2-2 © 2019 The Author(s) Protistology © 2019 Protozoological Society Affiliated with RAS 58 · Mariia Berdieva, Pavel Safonov and Olga Matantseva gellate life history. The phenomenon of such a the rest of the cell covering in Noctiluca scintillans rearrangement is called ecdysis. Ecdysis is a process (referred as N. miliaris) was mentioned (Melkonian of shedding of the cell covering elements unique to and Höhfeld, 1988). However, those results should dinoflagellates. An ecdysing cell loses plasmalemma, be reconsidered in the light of newly accumulated OAVM and, in armored species, thecal plates information and revision of the model of amphiesma (Pozdnyakov and Skarlato, 2012). These radical changes after ecdysis. changes are followed by the formation of the new Here we present the first results of the study covering. The former IAVM becomes the new of the cell covering rearrangement during ecdysis plasma membrane, and the new amphiesmal vesicles in the naked dinoflagellate species Amphidinium are formed beneath it in the cortical cytoplasm zone. carterae Hulburt 1957. Ecdysis was induced by During this transformation, a cell remains immotile. mechanical treatment (centrifugation). The changes In the vast majority of studied species, the pellicle in cell organization at the ultrastructural level were becomes a well-developed layer and covers a cell examined using transmission electron microscopy until completion of the new amphiesma formation methods. Our observations represent the basis (Morrill, 1984; Bricheux et al., 1992; Höhfeld and for subsequent investigation of the membrane Melkonian, 1992; Sekida et al., 2001, 2004). In the transformation and amphiesma regeneration. literature, the usually short-term immotile stage formed as a result of ecdysis is called “temporary”, “ecdysal”, or “pellicle” cyst (Bravo and Figueroa, Material and methods 2014). Ecdysis is employed at the different stages of CELL CULTURE the dinoflagellate life cycle whenever cell covering rearrangement is necessary. This process occurs The culture of the dinoflagellate isolated from during cytokinesis in species reproducing by eleu- the White Sea and designated as Amphidinium theroschisis (Morrill and Loeblich, 1984; Pfiester, carterae was obtained from the collection at the 1984). Shedding of the cell covering elements also Department of Hydrobiology, Lomonosov Moscow takes place during the transition to the resting cysts State University and is currently maintained in the stage/excystment (Kokinos and Anderson, 1995; protist collection at the Laboratory of Cytology Pfiester, 1989). Ecdysis is considered as a mecha- of Unicellular Organisms (Institute of Cytology nism of the multimembrane cell covering formation RAS). Cells were grown in 17 PSU f/2 medium in the symbiotic Symbiodinium genus (Wakefield et without silicate prepared in artificial seawater (ASW) al., 2000; Wakefield and Kempf, 2001). (Guillard and Ryther, 1962; Kester et al., 1967) at The stressor-induced ecdysis holds a special room temperature, pH 8.2 and 50 µmol photons m−2 place in the dinoflagellate biology. Mechanical s−1 under a 12 h light : 12 h dark cycle. treatment, osmotic shock, temperature, and nutrient changes can act as such stressors (Morrill, 1984; DNA EXTRACTION, PCR AMPLIFICATION, ELECTRO- Bricheux et al., 1992; Höhfeld and Melkonian, 1992; PHORESIS AND SEQUENCING Smayda, 2010; Onda et al., 2014; Chan et al., 2019). As a variant of the stress response, ecdysis appears Cells were lysed by freezing at –80 ºC for 10 min to provide rearrangements in the cell cover, possibly and then thawed at room temperature. Total DNA including alteration in its molecular composition was isolated using a DNA extraction kit (BioSilica which may be necessary for an adequate response Ltd., Russia) in accordance with manufacturer’s to external conditions. Stressor-induced ecdysis instructions. is an appropriate model to study the mechanisms In order to verify the species identity of the underlying shedding and regeneration of the am- dinoflagellates in the culture, several PCR reactions phiesmal elements. It should be noted that such were conducted using 18S rRNA gene-specific studies have hitherto been focused on armored primer pairs 18ScomF1/ Dino18SR1 (Zhang et dinoflagellates (Morrill, 1984; Bricheux et al., al., 2005), RibA/ S20R, and RibA/ RibB (RibA 1992; Kwok and Wong, 2003; Sekida et al., 2001, – ACCTGGTTGATCCTDCCAGT; RibB – 2004). The exception is a work of Höhfeld and TGATCCATCTGCAGGTTCACCTAC; S20R Melkonian (1992) that included data on ecdysis in - GACGGGCGGTGTGTACAA). Amplification the naked species Amphidinium rhynchocephalum. was carried out in 30 µl mixture containing 15 µl 2Х Besides, dissociation of two outer membranes from DreamTaq MasterMix (Thermo Fisher Scientific, Protistology · 59 USA), 6 µl DNase/RNase-free water, 3 µl of Table 1. Annealing temperature for the used forward and reverse primers and 3 µl of genomic primer pairs. DNA template. PCR reaction started with pre- denaturation at 95 ºC for 5 min followed by 39 Primer pair Annealing temperature (ºC) cycles comprising denaturation at 94 ºC for 30 s, 18ScomF1/ Dino18SR1 58 primer annealing for 1 min (temperature differs for RibA/ S20R 52 each primer pair, Table 1), and elongation at 72 RibA/ RibB 52 ºC for 2 min. The procedure was completed by the elongation step at 72 ºC for 7 min. dehydrated and embedded in Epon 812 – Araldite Separation of PCR products was conducted in M (Fluka, Switzerland) resin mixture. Ultrathin 1.5 % agarose gel in 1× TAE buffer. To estimate sections were cut using an Ultracut E (Reichert amplicon sizes, we used GeneRuler 1000 bp DNA Jung, Austria) ultramicrotome, contrasted with ladder (Thermo Fisher Scientific, USA). After uranyl acetate and lead citrate and examined in a the separation, gels were stained with ethidium Libra 120 (Carl Zeiss, Germany) microscope. bromide, and amplified fragments were visualized under UV light. PCR products were then extracted from gels by means of BioSilica gel extraction Results kit (BioSilica Ltd., Russia) according to the manufacturer’s instructions. DNA sequencing of the SPECIES IDENTIFICATION obtained amplicons was performed by Beagle Co. Ltd. with the use of the abovementioned primers, The studied dinoflagellate monoculture was as well as the internal sequencing primer sAF tentatively identified as Amphidinium carterae (CTGGTTGATYCTGCCAG). NCBI nucleotide according to the morphological similarity with the BLAST search was used to confirm the species original description (Fig. 1, A) (Hulburt, 1957). To identity. confirm the species identity, we conducted PCR amplification with total DNA extracted from the INDUCTION OF ECDYSIS, LIGHT AND TRANSMISSION culture and 18S rRNA gene-specific primers. Five ELECTRON MICROSCOPY products were obtained and sequenced. The best BLAST hits showed that all of them were fragments To induce ecdysis, cells were harvested by of 18S RNA
Load more

Recommended publications
  • COMPARISON of HEMOLYTIC ACTIVITY of Amphidinium Carterae and Amphidinium Klebsii
    ENVIRONMENTAL REGULATION OF TOXIN PRODUCTION: COMPARISON OF HEMOLYTIC ACTIVITY OF Amphidinium carterae AND Amphidinium klebsii Leigh A. Zimmermann A Thesis Submitted to University of North Carolina Wilmington in Partial Fulfillment Of the Requirements for the Degree of Master of Science Center for Marine Science University of North Carolina Wilmington 2006 Approved by Advisory Committee ______________________________ ______________________________ ______________________________ Chair Accepted by _____________________________ Dean, Graduate School This thesis was prepared according to the formatting guidelines of the Journal of Phycology. TABLE OF CONTENTS ABSTRACT................................................................................................................................... iv ACKNOWLEDGEMENTS.............................................................................................................v LIST OF TABLES......................................................................................................................... vi LIST OF FIGURES ..................................................................................................................... viii INTRODUCTION ...........................................................................................................................1 METHODS AND MATERIALS.....................................................................................................6 Algal Culture........................................................................................................................6
    [Show full text]
  • Redalyc.Impact of Increasing Water Temperature on Growth
    Revista de Biología Marina y Oceanografía ISSN: 0717-3326 [email protected] Universidad de Valparaíso Chile Aquino-Cruz, Aldo; Okolodkov, Yuri B. Impact of increasing water temperature on growth, photosynthetic efficiency, nutrient consumption, and potential toxicity of Amphidinium cf. carterae and Coolia monotis (Dinoflagellata) Revista de Biología Marina y Oceanografía, vol. 51, núm. 3, diciembre, 2016, pp. 565-580 Universidad de Valparaíso Viña del Mar, Chile Available in: http://www.redalyc.org/articulo.oa?id=47949206008 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative Revista de Biología Marina y Oceanografía Vol. 51, Nº3: 565-580, diciembre 2016 DOI 10.4067/S0718-19572016000300008 ARTICLE Impact of increasing water temperature on growth, photosynthetic efficiency, nutrient consumption, and potential toxicity of Amphidinium cf. carterae and Coolia monotis (Dinoflagellata) Impacto del aumento de temperatura sobre el crecimiento, actividad fotosintética, consumo de nutrientes y toxicidad potencial de Amphidinium cf. carterae y Coolia monotis (Dinoflagellata) Aldo Aquino-Cruz1 and Yuri B. Okolodkov2 1University of Southampton, National Oceanography Centre Southampton, European Way, Waterfront Campus, SO14 3HZ, Southampton, Hampshire, England, UK. [email protected] 2Laboratorio de Botánica Marina y Planctología, Instituto de Ciencias Marinas y Pesquerías, Universidad Veracruzana, Calle Hidalgo 617, Col. Río Jamapa, Boca del Río, 94290, Veracruz, México. [email protected] Resumen.- A nivel mundial, el aumento de la temperatura en ecosistemas marinos podría beneficiar la formación de florecimientos algales nocivos. Sin embargo, la comprensión de la influencia del aumento de la temperatura sobre el crecimiento de poblaciones nocivas de dinoflagelados bentónicos es prácticamente inexistente.
    [Show full text]
  • The Planktonic Protist Interactome: Where Do We Stand After a Century of Research?
    bioRxiv preprint doi: https://doi.org/10.1101/587352; this version posted May 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Bjorbækmo et al., 23.03.2019 – preprint copy - BioRxiv The planktonic protist interactome: where do we stand after a century of research? Marit F. Markussen Bjorbækmo1*, Andreas Evenstad1* and Line Lieblein Røsæg1*, Anders K. Krabberød1**, and Ramiro Logares2,1** 1 University of Oslo, Department of Biosciences, Section for Genetics and Evolutionary Biology (Evogene), Blindernv. 31, N- 0316 Oslo, Norway 2 Institut de Ciències del Mar (CSIC), Passeig Marítim de la Barceloneta, 37-49, ES-08003, Barcelona, Catalonia, Spain * The three authors contributed equally ** Corresponding authors: Ramiro Logares: Institute of Marine Sciences (ICM-CSIC), Passeig Marítim de la Barceloneta 37-49, 08003, Barcelona, Catalonia, Spain. Phone: 34-93-2309500; Fax: 34-93-2309555. [email protected] Anders K. Krabberød: University of Oslo, Department of Biosciences, Section for Genetics and Evolutionary Biology (Evogene), Blindernv. 31, N-0316 Oslo, Norway. Phone +47 22845986, Fax: +47 22854726. [email protected] Abstract Microbial interactions are crucial for Earth ecosystem function, yet our knowledge about them is limited and has so far mainly existed as scattered records. Here, we have surveyed the literature involving planktonic protist interactions and gathered the information in a manually curated Protist Interaction DAtabase (PIDA). In total, we have registered ~2,500 ecological interactions from ~500 publications, spanning the last 150 years.
    [Show full text]
  • Peridinin-Containing Dinoflagellates Are Eukaryotic Protozoans, Which
    Investigation of Dinoflagellate Plastid Protein Transport using Heterologous and Homologous in vivo Systems Dissertation zur Erlangung des Doktorgrades der Naturwissenschaften (Dr. rer. nat.) Vorgelegt dem Fachbereich Biologie der Philipps-Universität Marburg von Andrew Scott Bozarth aus Columbia, Maryland, USA Marburg/Lahn 2010 Vom Fachbereich Biologie der Philipps-Universität als Dissertation angenommen am 26.07.2010 angenommen. Erstgutachter: Prof. Dr. Uwe-G. Maier Zweitgutachter: Prof. Dr. Klaus Lingelbach Prof. Dr. Andreas Brune Prof. Dr. Renate Renkawitz-Pohl Tag der Disputation am: 11.10.2010 Results! Why, man, I have gotten a lot of results. I know several thousand things that won’t work! -Thomas A. Edison Publications Bozarth A, Susanne Lieske, Christine Weber, Sven Gould, and Stefan Zauner (2010) Transfection with Dinoflagellate Transit Peptides (in progress). Bolte K, Bullmann L, Hempel F, Bozarth A, Zauner S, Maier UG (2009) Protein Targeting into Secondary Plastids. J. Eukaryot. Microbiol. 56, 9–15. Bozarth A, Maier UG, Zauner S (2009) Diatoms in biotechnology: modern tools and applications. Appl. Microbiol. Biotechnol. 82, 195-201. Maier UG, Bozarth A, Funk HT, Zauner S, Rensing SA, Schmitz-Linneweber C, Börner T, Tillich M (2008) Complex chloroplast RNA metabolism: just debugging the genetic programme? BMC Biol. 6, 36. Hempel F, Bozarth A, Sommer MS, Zauner S, Przyborski JM, Maier UG. (2007) Transport of nuclear-encoded proteins into secondarily evolved plastids. Biol Chem. 388, 899-906. Table of Contents TABLE OF CONTENTS
    [Show full text]
  • Horizontal Gene Transfer Is a Significant Driver of Gene Innovation in Dinoflagellates
    GBE Horizontal Gene Transfer is a Significant Driver of Gene Innovation in Dinoflagellates Jennifer H. Wisecaver1,3,*, Michael L. Brosnahan2, and Jeremiah D. Hackett1 1Department of Ecology and Evolutionary Biology, University of Arizona 2Biology Department, Woods Hole Oceanographic Institution, Woods Hole, MA 3Present address: Department of Biological Sciences, Vanderbilt University, Nashville, TN *Corresponding author: E-mail: [email protected]. Accepted: November 12, 2013 Data deposition:TheAlexandrium tamarense Group IV transcriptome assembly described in this article has been deposited at DDBJ/EMBL/ GenBank under the accession GAIQ01000000. Abstract The dinoflagellates are an evolutionarily and ecologically important group of microbial eukaryotes. Previous work suggests that horizontal gene transfer (HGT) is an important source of gene innovation in these organisms. However, dinoflagellate genomes are notoriously large and complex, making genomic investigation of this phenomenon impractical with currently available sequencing technology. Fortunately, de novo transcriptome sequencing and assembly provides an alternative approach for investigating HGT. We sequenced the transcriptome of the dinoflagellate Alexandrium tamarense Group IV to investigate how HGT has contributed to gene innovation in this group. Our comprehensive A. tamarense Group IV gene set was compared with those of 16 other eukaryotic genomes. Ancestral gene content reconstruction of ortholog groups shows that A. tamarense Group IV has the largest number of gene families gained (314–1,563 depending on inference method) relative to all other organisms in the analysis (0–782). Phylogenomic analysis indicates that genes horizontally acquired from bacteria are a significant proportion of this gene influx, as are genes transferred from other eukaryotes either through HGT or endosymbiosis. The dinoflagellates also display curious cases of gene loss associated with mitochondrial metabolism including the entire Complex I of oxidative phosphorylation.
    [Show full text]
  • Protistology an International Journal Vol
    Protistology An International Journal Vol. 12, Number 3, 2018 ___________________________________________________________________________________ CONTENTS REVIEW Sergei O. Skarlato, Irena V. Telesh, Olga V. Matantseva, Ilya A. Pozdnyakov, Mariia A. Berdieva, Hendrik Schubert, Natalya A. Filatova, Nikolay A. Knyazev and Sofia A. Pechkovskaya Studies of bloom-forming dinoflagellates Prorocentrum minimum in fluctuating environment: contribution to aquatic ecology, cell biology and invasion theory 113 1. Introduction 114 2. Environmental instability, gradients and the protistan species maximum 115 2.1. Gradients in fluctuating environment 2.2. Linking environmental variability to organismal traits 2.3. Large-scale salinity gradients provide subsidy rather than stress to planktonic protists 2.4. Horohalinicum as an ecotone 2.5. Protistan diversity in the ecotone and the Ecological Niche Concept 3. Planktonic dinoflagellates: a brief overview of major biological traits 122 3.1. Dinoflagellates and their role in harmful algal blooms 3.2. Bloom-forming, potentially toxic dinoflagellate Prorocentrum minimum 3.3. Invasion history of Prorocentrum minimum in the Baltic Sea 3.4. Broad ecological niche – a prerequisite to successful invasion 4. Competitive advantages of Prorocentrum minimum in the changing environment 130 4.1. Adaptation strategies 4.2. Mixotrophic metabolism 4.3. Population heterogeneity and its relevance to ecological modelling 5. Cell and molecular biology of dinoflagellates: implications for biotechnology and environmental management 136 5.1. Stress-induced gene expression 5.2. Cell coverings and cytoskeleton 5.3. Chromosome structure 5.4. Ion channels 5.5. Practical use of the cellular and molecular data 6. Outlook: Future challenges and perspectives 141 Acknowledgements 144 References 144 INSTRUCTIONS FOR AUTHORS 158 Protistology 12 (3), 113–157 (2018) Protistology Studies of bloom-forming dinoflagellates Prorocentrum minimum in fluctuating environment: contribution to aquatic ecology, cell biology and invasion theory Sergei O.
    [Show full text]
  • A New Marine Species of Amphidinium (Dinophyceae) from Thermaikos Gulf, Greece
    Acta Protozool. (2009) 48: 153–170 ACTA PROTOZOOLOGICA A New Marine Species of Amphidinium (Dinophyceae) from Thermaikos Gulf, Greece Nicolas P. DOLAPSAKIS and Athena ECONOMOU-AMILLI Faculty of Biology, Department of Ecology and Systematics, University of Athens, Athens, Greece Summary. Genus Amphidinium Claparède et Lachmann (Gymnodiniales, Dinophyceae) sensu lato has recently undergone a reappraisal using extended microscopical methods and genetic comparisons, with the type species and morphologically similar species used for the redescription of the genus Amphidinium sensu stricto. Within the latter concept of the genus, the new species Amphidinium thermaeum is established using light and scanning electron microscopy in combination with LSU rDNA phylogeny. This species was isolated from the Thermaikos Gulf in Greece, and its description is largely based on observations of cultured material. The main diacritic features distin- guishing A. thermaeum from related taxa were: shape, size and plasticity of the cell, position of distal and proximal cingulum ends, site of longitudinal flagellar insertion, sulcal course, pusule details, plastid characteristics, and mode of cell division. Genetic phylogeny applying Bayesian Inference, Maximum Likelihood, and Neighbor-Joining analyses, places A. thermaeum in an independent position within the Amphidinium sensu stricto monophyletic group, and the new species is closely related to its small and morphologically similar siblings (A. massartii, A. klebsii, A. trulla, A. gibbosum, A. carterae). Key words: Amphidinium thermaeum sp. nov., Dinophyceae, microscopy, LSU rDNA, molecular phylogeny. INTRODUCTION gal blooms (e.g., Herdman 1911, Baig et al. 2006) and some are toxic to other organisms (cytotoxic, ichthyo- toxic, or haemolytic, e.g., Steidinger 1983, Yasumoto Species belonging to genus Amphidinium Claparède et Lachmann, 1859 emend.
    [Show full text]
  • Characterization of Acetyl-Coa Carboxylases in the Basal Dinoflagellate Amphidinium Carterae
    marine drugs Article Characterization of Acetyl-CoA Carboxylases in the Basal Dinoflagellate Amphidinium carterae Saddef Haq 1,*, Tsvetan R. Bachvaroff 2 and Allen R. Place 2 1 Graduate Program in Life Sciences, University of Maryland, Baltimore, MD 21201, USA 2 Institute of Marine and Environmental Technology, University of Maryland Center for Environmental Science, Baltimore, MD 21201, USA; [email protected] (T.R.B.); [email protected] (A.R.P.) * Correspondence: [email protected] Academic Editor: Peer B. Jacobson Received: 29 March 2017; Accepted: 23 May 2017; Published: 26 May 2017 Abstract: Dinoflagellates make up a diverse array of fatty acids and polyketides. A necessary precursor for their synthesis is malonyl-CoA formed by carboxylating acetyl CoA using the enzyme acetyl-CoA carboxylase (ACC). To date, information on dinoflagellate ACC is limited. Through transcriptome analysis in Amphidinium carterae, we found three full-length homomeric type ACC sequences; no heteromeric type ACC sequences were found. We assigned the putative cellular location for these ACCs based on transit peptide predictions. Using streptavidin Western blotting along with mass spectrometry proteomics, we validated the presence of ACC proteins. Additional bands showing other biotinylated proteins were also observed. Transcript abundance for these ACCs follow the global pattern of expression for dinoflagellate mRNA messages over a diel cycle. This is one of the few descriptions at the transcriptomic and protein level of ACCs in dinoflagellates. This work provides insight into the enzymes which make the CoA precursors needed for fatty acid and toxin synthesis in dinoflagellates. Keywords: dinoflagellate; acetyl CoA carboxylase; polyketide; fatty acids; Amphidinium carterae; toxin synthesis 1.
    [Show full text]
  • The Planktonic Protist Interactome: Where Do We Stand After a Century of Research?
    The ISME Journal (2020) 14:544–559 https://doi.org/10.1038/s41396-019-0542-5 ARTICLE The planktonic protist interactome: where do we stand after a century of research? 1 1 1 1 Marit F. Markussen Bjorbækmo ● Andreas Evenstad ● Line Lieblein Røsæg ● Anders K. Krabberød ● Ramiro Logares 1,2 Received: 14 May 2019 / Revised: 17 September 2019 / Accepted: 24 September 2019 / Published online: 4 November 2019 © The Author(s) 2019. This article is published with open access Abstract Microbial interactions are crucial for Earth ecosystem function, but our knowledge about them is limited and has so far mainly existed as scattered records. Here, we have surveyed the literature involving planktonic protist interactions and gathered the information in a manually curated Protist Interaction DAtabase (PIDA). In total, we have registered ~2500 ecological interactions from ~500 publications, spanning the last 150 years. All major protistan lineages were involved in interactions as hosts, symbionts (mutualists and commensalists), parasites, predators, and/or prey. Predation was the most common interaction (39% of all records), followed by symbiosis (29%), parasitism (18%), and ‘unresolved interactions’ fi 1234567890();,: 1234567890();,: (14%, where it is uncertain whether the interaction is bene cial or antagonistic). Using bipartite networks, we found that protist predators seem to be ‘multivorous’ while parasite–host and symbiont–host interactions appear to have moderate degrees of specialization. The SAR supergroup (i.e., Stramenopiles, Alveolata, and Rhizaria) heavily dominated PIDA, and comparisons against a global-ocean molecular survey (TARA Oceans) indicated that several SAR lineages, which are abundant and diverse in the marine realm, were underrepresented among the recorded interactions.
    [Show full text]
  • A Review on the Biodiversity and Biogeography of Toxigenic Benthic Marine Dinoflagellates of the Coasts of Latin America
    fmars-06-00148 April 5, 2019 Time: 14:8 # 1 REVIEW published: 05 April 2019 doi: 10.3389/fmars.2019.00148 A Review on the Biodiversity and Biogeography of Toxigenic Benthic Marine Dinoflagellates of the Coasts of Latin America Lorena María Durán-Riveroll1,2*, Allan D. Cembella2 and Yuri B. Okolodkov3 1 CONACyT-Instituto de Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México, Mexico City, Mexico, 2 Alfred-Wegener-Institut, Helmholtz-Zentrum für Polar-und Meeresforschung, Bremerhaven, Germany, 3 Instituto de Ciencias Marinas y Pesquerías, Universidad Veracruzana, Veracruz, Mexico Many benthic dinoflagellates are known or suspected producers of lipophilic polyether phycotoxins, particularly in tropical and subtropical coastal zones. These toxins are responsible for diverse intoxication events of marine fauna and human consumers of seafood, but most notably in humans, they cause toxin syndromes known as diarrhetic shellfish poisoning (DSP) and ciguatera fish poisoning (CFP). This has led to enhanced, but still insufficient, efforts to describe benthic dinoflagellate taxa using morphological and molecular approaches. For example, recently published information on epibenthic dinoflagellates from Mexican coastal waters includes about 45 species Edited by: from 15 genera, but many have only been tentatively identified to the species level, Juan Jose Dorantes-Aranda, with fewer still confirmed by molecular criteria. This review on the biodiversity and University of Tasmania, Australia biogeography of known or putatively toxigenic benthic species in Latin America, restricts Reviewed by: the geographical scope to the neritic zones of the North and South American continents, Gustaaf Marinus Hallegraeff, University of Tasmania, Australia including adjacent islands and coral reefs. The focus is on species from subtropical Patricia A.
    [Show full text]
  • Download Published Versionadobe
    Review Recent Trends in Marine Phycotoxins from Australian Coastal Waters Penelope Ajani 1,*, D. Tim Harwood 2 and Shauna A. Murray 1 1 Climate Change Cluster (C3), University of Technology Sydney, Sydney, NSW 2007, Australia; [email protected] 2 Cawthron Institute, The Wood, Nelson 7010, New Zealand; [email protected] * Correspondence: [email protected]; Tel.: +61‐02‐9514‐7325 Academic Editor: Lucio G. Costa Received: 6 December 2016; Accepted: 29 January 2017; Published: 9 February 2017 Abstract: Phycotoxins, which are produced by harmful microalgae and bioaccumulate in the marine food web, are of growing concern for Australia. These harmful algae pose a threat to ecosystem and human health, as well as constraining the progress of aquaculture, one of the fastest growing food sectors in the world. With better monitoring, advanced analytical skills and an increase in microalgal expertise, many phycotoxins have been identified in Australian coastal waters in recent years. The most concerning of these toxins are ciguatoxin, paralytic shellfish toxins, okadaic acid and domoic acid, with palytoxin and karlotoxin increasing in significance. The potential for tetrodotoxin, maitotoxin and palytoxin to contaminate seafood is also of concern, warranting future investigation. The largest and most significant toxic bloom in Tasmania in 2012 resulted in an estimated total economic loss of ~AUD$23M, indicating that there is an imperative to improve toxin and organism detection methods, clarify the toxin profiles of species of phytoplankton and carry out both intra‐ and inter‐species toxicity comparisons. Future work also includes the application of rapid, real‐time molecular assays for the detection of harmful species and toxin genes.
    [Show full text]
  • Curriculum Vitae Is a Current and Accurate Statement of My Professional Record
    A. R. Place Notarization: I have read the following and certify that this Curriculum Vitae is a current and accurate statement of my professional record _______________ Signature 1/1/2016 Date CURRICULUM VITAE NAME: Allen R. Place PRESENT ADDRESS: Institute for Marine and Environmental Technology, University of Maryland Center of Environmental Sci- ence, Columbus Center, Suite 236, 701 East Pratt Street, Baltimore, Maryland 21202. 1-410-234-8828 PRESENT OCCUPATION: Professor (Since 2001 with tenure) PAST OCCUPATIONS: Professor (2001-2010) Center of Marine Biotechnology, University of Maryland Biotechnology Institute, Columbus Center, Suite 236, 701 East Pratt Street, Baltimore, Maryland 21202. Associate Professor (1987-1989; With tenure 1989-2001) Center of Marine Biotechnology, University of Maryland Biotechnology Institute, Columbus Center, Suite 236, 701 East Pratt Street, Baltimore, Maryland 21202. Assistant Professor of Biology (1980-1987) Department of Biology, Leidy Laboratories/G5, University of Pennsylvania, Philadelphia, Pennsylvania, 19104 Acting Director, Information Resource Group, University of Maryland Biotechnology Institute (1991-1993) Adjunct Associate Professor Center for Environmental and Estuarine Studies !1 A. R. Place Horn Point Environmental Laboratory Cambridge, MD 21613 (1994-1997) Affiliate Associate Professor Department of Poultry Science University of Maryland at College Park College Park, MD (1993-1995) DATE AND PLACE OF BIRTH:May 24, 1951, Norwalk, Connecticut CITIZENSHIP: U.S. MARITAL STATUS: Married, June 23, 1973; three children EDUCATION: Undergraduate: The Johns Hopkins University, Baltimore, Maryland. B.A., Earth and Planetary Sciences, January, 1973. Graduate: The Johns Hopkins University, Baltimore, Maryland. Ph.D., Biochemistry, June, 1979. Postdoctoral: The Johns Hopkins University, Baltimore, Maryland, Molecular Biology, July, 1980. HONORS: B.A.
    [Show full text]