Protistology 13 (2), 57–63 (2019) Protistology Ultrastructural aspects of ecdysis in the naked dinoflagellate Amphidinium carterae Mariia Berdieva, Pavel Safonov and Olga Matantseva Institute of Cytology, Russian Academy of Sciences, St. Petersburg, Russia | Submitted April 09, 2019 | Accepted April 29, 2018 | Summary The stressor-induced ecdysis takes a special place in dinoflagellate biology. During ecdysis, a cell loses the plasmalemma, outer amphiesmal vesicle membrane and, in armored species, thecal plates, becomes immotile, and then amphiesma regeneration occurs. Here we report the results of our study of cell covering rearrangement during ecdysis in the naked dinoflagellate species Amphidinium carterae Hulburt 1957. Ecdysis was induced by mechanical treatment (centrifugation). The changes in cell organization at the ultrastructural level were examined using transmission electron microscopy methods. Shedding of the plasma membrane and the outer amphiesmal vesicle membranes, fusion of the inner amphiesmal vesicle membranes were observed. The amorphous cytoplasm zone, which underlies inner amphiesmal vesicle membra- nes in motile cells, retains under the new plasma membrane in ecdysed cells. We showed accumulation of small vesicles and flattened tubules that apparently begin fusion to form juvenile amphiesmal vesicles in this zone. The absence of pellicle in Amphidinium dinoflagellates was suggested. Key words: dinoflagellate, ecdysis, Amphidinium carterae, amphiesma, electron microscopy Introduction (thecal plates). The naked dinoflagellates possess amphiesmal vesicles that either are empty or contain The presence of a complex cell covering (am- amorphous material. An additional pellicular layer phiesma) determines structural organization and (pellicle) may be present in the amphiesma in both physiology of dinoflagellate cells. Flattened alveoli, cases (Morrill and Loeblich, 1983; Pozdnyakov or amphiesmal vesicles, underlie the plasma mem- and Skarlato, 2012). At the ultrastructural level, brane and are closely adjacent to it and to each other. the dinoflagellate cell covering includes three Morphologically, two forms of dinoflagellates are membranes — plasmalemma, outer amphiesmal distinguished depending on the content of alveoli vesicle membrane (OAVM), and inner amphiesmal – naked, or unarmored, and armored (Dodge and vesicle membrane (IAVM). Crawford, 1970; Morrill and Loeblich, 1983). In the This type of cell covering organization makes latter, amphiesmal vesicles contain cellulosic plates it a labile system that can be re-formed in dinofla- doi:10.21685/1680-0826-2019-13-2-2 © 2019 The Author(s) Protistology © 2019 Protozoological Society Affiliated with RAS 58 · Mariia Berdieva, Pavel Safonov and Olga Matantseva gellate life history. The phenomenon of such a the rest of the cell covering in Noctiluca scintillans rearrangement is called ecdysis. Ecdysis is a process (referred as N. miliaris) was mentioned (Melkonian of shedding of the cell covering elements unique to and Höhfeld, 1988). However, those results should dinoflagellates. An ecdysing cell loses plasmalemma, be reconsidered in the light of newly accumulated OAVM and, in armored species, thecal plates information and revision of the model of amphiesma (Pozdnyakov and Skarlato, 2012). These radical changes after ecdysis. changes are followed by the formation of the new Here we present the first results of the study covering. The former IAVM becomes the new of the cell covering rearrangement during ecdysis plasma membrane, and the new amphiesmal vesicles in the naked dinoflagellate species Amphidinium are formed beneath it in the cortical cytoplasm zone. carterae Hulburt 1957. Ecdysis was induced by During this transformation, a cell remains immotile. mechanical treatment (centrifugation). The changes In the vast majority of studied species, the pellicle in cell organization at the ultrastructural level were becomes a well-developed layer and covers a cell examined using transmission electron microscopy until completion of the new amphiesma formation methods. Our observations represent the basis (Morrill, 1984; Bricheux et al., 1992; Höhfeld and for subsequent investigation of the membrane Melkonian, 1992; Sekida et al., 2001, 2004). In the transformation and amphiesma regeneration. literature, the usually short-term immotile stage formed as a result of ecdysis is called “temporary”, “ecdysal”, or “pellicle” cyst (Bravo and Figueroa, Material and methods 2014). Ecdysis is employed at the different stages of CELL CULTURE the dinoflagellate life cycle whenever cell covering rearrangement is necessary. This process occurs The culture of the dinoflagellate isolated from during cytokinesis in species reproducing by eleu- the White Sea and designated as Amphidinium theroschisis (Morrill and Loeblich, 1984; Pfiester, carterae was obtained from the collection at the 1984). Shedding of the cell covering elements also Department of Hydrobiology, Lomonosov Moscow takes place during the transition to the resting cysts State University and is currently maintained in the stage/excystment (Kokinos and Anderson, 1995; protist collection at the Laboratory of Cytology Pfiester, 1989). Ecdysis is considered as a mecha- of Unicellular Organisms (Institute of Cytology nism of the multimembrane cell covering formation RAS). Cells were grown in 17 PSU f/2 medium in the symbiotic Symbiodinium genus (Wakefield et without silicate prepared in artificial seawater (ASW) al., 2000; Wakefield and Kempf, 2001). (Guillard and Ryther, 1962; Kester et al., 1967) at The stressor-induced ecdysis holds a special room temperature, pH 8.2 and 50 µmol photons m−2 place in the dinoflagellate biology. Mechanical s−1 under a 12 h light : 12 h dark cycle. treatment, osmotic shock, temperature, and nutrient changes can act as such stressors (Morrill, 1984; DNA EXTRACTION, PCR AMPLIFICATION, ELECTRO- Bricheux et al., 1992; Höhfeld and Melkonian, 1992; PHORESIS AND SEQUENCING Smayda, 2010; Onda et al., 2014; Chan et al., 2019). As a variant of the stress response, ecdysis appears Cells were lysed by freezing at –80 ºC for 10 min to provide rearrangements in the cell cover, possibly and then thawed at room temperature. Total DNA including alteration in its molecular composition was isolated using a DNA extraction kit (BioSilica which may be necessary for an adequate response Ltd., Russia) in accordance with manufacturer’s to external conditions. Stressor-induced ecdysis instructions. is an appropriate model to study the mechanisms In order to verify the species identity of the underlying shedding and regeneration of the am- dinoflagellates in the culture, several PCR reactions phiesmal elements. It should be noted that such were conducted using 18S rRNA gene-specific studies have hitherto been focused on armored primer pairs 18ScomF1/ Dino18SR1 (Zhang et dinoflagellates (Morrill, 1984; Bricheux et al., al., 2005), RibA/ S20R, and RibA/ RibB (RibA 1992; Kwok and Wong, 2003; Sekida et al., 2001, – ACCTGGTTGATCCTDCCAGT; RibB – 2004). The exception is a work of Höhfeld and TGATCCATCTGCAGGTTCACCTAC; S20R Melkonian (1992) that included data on ecdysis in - GACGGGCGGTGTGTACAA). Amplification the naked species Amphidinium rhynchocephalum. was carried out in 30 µl mixture containing 15 µl 2Х Besides, dissociation of two outer membranes from DreamTaq MasterMix (Thermo Fisher Scientific, Protistology · 59 USA), 6 µl DNase/RNase-free water, 3 µl of Table 1. Annealing temperature for the used forward and reverse primers and 3 µl of genomic primer pairs. DNA template. PCR reaction started with pre- denaturation at 95 ºC for 5 min followed by 39 Primer pair Annealing temperature (ºC) cycles comprising denaturation at 94 ºC for 30 s, 18ScomF1/ Dino18SR1 58 primer annealing for 1 min (temperature differs for RibA/ S20R 52 each primer pair, Table 1), and elongation at 72 RibA/ RibB 52 ºC for 2 min. The procedure was completed by the elongation step at 72 ºC for 7 min. dehydrated and embedded in Epon 812 – Araldite Separation of PCR products was conducted in M (Fluka, Switzerland) resin mixture. Ultrathin 1.5 % agarose gel in 1× TAE buffer. To estimate sections were cut using an Ultracut E (Reichert amplicon sizes, we used GeneRuler 1000 bp DNA Jung, Austria) ultramicrotome, contrasted with ladder (Thermo Fisher Scientific, USA). After uranyl acetate and lead citrate and examined in a the separation, gels were stained with ethidium Libra 120 (Carl Zeiss, Germany) microscope. bromide, and amplified fragments were visualized under UV light. PCR products were then extracted from gels by means of BioSilica gel extraction Results kit (BioSilica Ltd., Russia) according to the manufacturer’s instructions. DNA sequencing of the SPECIES IDENTIFICATION obtained amplicons was performed by Beagle Co. Ltd. with the use of the abovementioned primers, The studied dinoflagellate monoculture was as well as the internal sequencing primer sAF tentatively identified as Amphidinium carterae (CTGGTTGATYCTGCCAG). NCBI nucleotide according to the morphological similarity with the BLAST search was used to confirm the species original description (Fig. 1, A) (Hulburt, 1957). To identity. confirm the species identity, we conducted PCR amplification with total DNA extracted from the INDUCTION OF ECDYSIS, LIGHT AND TRANSMISSION culture and 18S rRNA gene-specific primers. Five ELECTRON MICROSCOPY products were obtained and sequenced. The best BLAST hits showed that all of them were fragments To induce ecdysis, cells were harvested by of 18S RNA