Microrna-451 Negatively Regulates Hepatic Glucose Production and Glucose Homeostasis by Targeting Glycerol Kinase–Mediated Gluconeogenesis

3276 Diabetes Volume 65, November 2016

Shu Zhuo,1,2 Mengmei Yang,1 Yanan Zhao,1 Xiaofang Chen,1 Feifei Zhang,3 Na Li,1 Pengle Yao,1 Tengfei Zhu,1 Hong Mei,1 Shanshan Wang,1 Yu Li,3 Shiting Chen,1,2 and Yingying Le1,2

MicroRNA-451 Negatively Regulates Hepatic Glucose Production and Glucose Homeostasis by Targeting Glycerol Kinase–Mediated Gluconeogenesis

Diabetes 2016;65:3276–3288 | DOI: 10.2337/db16-0166

MicroRNAs (miRNAs) are a new class of regulatory mole- Type 2 diabetes (T2D) is characterized by insulin re- cules implicated in type 2 diabetes, which is charac- sistance and abnormally elevated hepatic glucose pro- terized by insulin resistance and hepatic glucose duction primarily from sustained gluconeogenesis (1–3), overproduction. We show that miRNA-451 (miR-451) is but the underlying mechanisms are poorly understood. elevated in the liver tissues of dietary and genetic mouse Hepatic gluconeogenesis is induced by glucagon and gluco- models of diabetes. Through an adenovirus-mediated corticoids and inhibited by insulin through the tran- gain- and loss-of-function study, we found that miR-451 scriptional regulation of glucose-6-phosphatase (G6Pase) negatively regulates hepatic gluconeogenesis and blood and PEPCK, two rate-limiting gluconeogenic enzymes fi glucose levels in normal mice and identi ed glycerol (3,4). CREB, FOXO1, and peroxisome proliferator– kinase (Gyk) as a direct target of miR-451. We demon- activated receptor g coactivator 1a (PGC-1a) are major METABOLISM strate that miR-451 and Gyk regulate hepatic glucose transcription factors and transcriptional coactivators that production, the glycerol gluconeogenesis axis, and the mediate hormonal regulation of hepatic gluconeogenic AKT-FOXO1-PEPCK/G6Pase pathway in an opposite enzyme expression (3,5–7). The expression or activity of manner; Gyk could reverse the effect of miR-451 on gluconeogenic enzymes and transcriptional factors/ hepatic gluconeogenesis and AKT-FOXO1-PEPCK/ G6Pase pathway. Moreover, overexpression of miR-451 coactivators are increased in the livers of humans with or knockdown of Gyk in diabetic mice significantly diabetes and diabetic rodents (8,9); knockdown or inhibi- fi inhibited hepatic gluconeogenesis, alleviated hypergly- tion of these molecules signi cantly improves hyperglyce- – cemia, and improved glucose tolerance. Further studies mia in diabetic mouse models (10 12). Thus, inhibition of showed that miR-451 is upregulated by glucose and the gluconeogenic pathway in the liver could be a poten- insulin in hepatocytes; the elevation of hepatic miR-451 tial strategy for combating diabetic hyperglycemia. in diabetic mice may contribute to inhibiting Gyk expres- MicroRNAs (miRNAs) are small endogenous noncoding sion. This study provides the first evidence that miR-451 RNAs that regulate gene expression through transla- and Gyk regulate the AKT-FOXO1-PEPCK/G6Pase path- tional repression or degradation of target mRNAs. Recent way and play critical roles in hepatic gluconeogenesis and studies of liver samples from diabetic animal models glucose homeostasis and identifies miR-451 and Gyk and humans with diabetes suggest that dysregulation of as potential therapeutic targets against hyperglycemia hepaticmiRNAsmayleadtoT2D.SeveralmiRNAs in diabetes. contribute to insulin resistance in vivo (13–17), but

1Key Laboratory of Food Safety Research, Institute for Nutritional Sciences, Received 3 February 2016 and accepted 19 July 2016. Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Uni- This article contains Supplementary Data online at http://diabetes versity of the Chinese Academy of Sciences, Shanghai, China .diabetesjournals.org/lookup/suppl/doi:10.2337/db16-0166/-/DC1. 2Key Laboratory of Food Safety Risk Assessment, Ministry of Health, Beijing, © 2016 by the American Diabetes Association. Readers may use this article as China long as the work is properly cited, the use is educational and not for profit, and the 3Key Laboratory of Nutrition and Metabolism, Institute for Nutritional Sciences, work is not altered. More information is available at http://www.diabetesjournals Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Uni- .org/content/license. versity of Chinese Academy of Sciences, Shanghai, China Corresponding author: Yingying Le, [email protected]. diabetes.diabetesjournals.org Zhuo and Associates 3277 very few are involved in gluconeogenesis and T2D miR-451 sponges (Anti-451), Gyk (Ad-Gyk), or green (17–19). miRNA-451 (miR-451) is dysregulated in multi- fluorescent protein (Ad-GFP) were prepared by using the ple types of cancers and contributes to tumorigenesis, AdEasy Adenoviral Vector System (Agilent) according to tumor progression, and metastasis by targeting various the manufacturer’s instructions and the literature (35). molecules (20–22). Recent studies have indicated that Recombinant adenoviruses expressing Gyk shRNA and miR-451 may be involved in metabolic disorders. miR- control scrambled shRNA were generated by using the 451 is decreased in liver tissues of patients with nonalco- BLOCK-iT Adenoviral RNAi Expression System (Thermo holic steatohepatitis and the corresponding mouse model. Fisher Scientific). Eight- to 10-week-old C57BL/6 mice, It negatively regulates fatty acid–induced inflammation HFD-induced diabetic mice, or db/db mice were injected through the LKB1/AMPK/AKT pathway by targeting with adenoviruses through the tail vein at 1 3 109 plaque- CAB39, a component of the LKB1-STRAD-CAB39 complex forming units in 0.2 mL of PBS. All experiments were (23). Microarray analysis has shown that miR-451 levels carried out within 1 week after injection. are elevated in the livers of diabetic and obese animal Glucose Metabolism Test models (13,24). We also found that hepatic miR-451 is For glucose tolerance test (GTT), pyruvate tolerance test elevated in high-fat diet (HFD)–induced diabetic mice and (PTT), and glycerol tolerance test (GlyTT), mice fasted for db/db mice by real-time PCR (S. Zhuo, unpublished obser- 6 h were intraperitoneally injected with glucose, pyruvate, vation). However, whether miR-451 contributes to diabetes is unclear. We speculate that miR-451 might be involved or glycerol, respectively, at 2 g/kg body weight. For the insulin tolerance test (ITT), mice fasted for 4 h were injected in the regulation of hepatic glucose metabolism and T2D with insulin intraperitoneally at 0.75 or 1 unit/kg body because miR-451 has been reported to be upregulated by weight. Blood glucose concentrations were measured before glucose in glioma cells, and some target molecules and and after injection with a glucometer (FreeStyle; Abbott). signaling pathways that mediate the effects of miR-451 on cancer cell growth and migration, such as 14-3-3 pro- Blood and Liver Biochemical Analysis teins, CAB39, and LKB1/AMPK and PI3K/AKT (25–28), Serum insulin and glycerol levels were determined by an are critical regulators of hepatic glucose metabolism and ELISA kit (Millipore) and an enzymatic glycerol assay kit therapeutic targets of T2D (29–34). (Applygen, Beijing, China), respectively. Liver glycogen In this study, we show that miR-451 is elevated in content was measured as previously described (36). livers of HFD-induced diabetic mice and db/db mice and identified glycerol kinase (Gyk) as a target of miR-451. Quantitative Real-Time PCR Through adenovirus-mediated gain- and loss-of-function Total RNA was extracted from tissues or cells using TRIzol studies, we demonstrate that miR-451 negatively regu- reagent (Invitrogen) and treated with RNase-free DNase lates hepatic gluconeogenesis and glucose homeostasis. We to degrade contaminating genomic DNA. cDNA was further explored the signaling pathways involved in the reg- synthesized with 2 mg of total RNA using Moloney mu- ulation of hepatic gluconeogenesis by miR-451 and Gyk and rine leukemia virus reverse transcriptase and oligo (dT) examined the regulation of hepatic miR-451 and/or Gyk primers; 500 ng of total RNA was reverse-transcribed – fi 9 in vitro and in HFD-fed mice. Finally, we checked the effect by using an miR-451 speci c stem-loop primer (5 - of overexpression of miR-451 or knockdown of Gyk on CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACT 9 glucose metabolism in the diabetic mouse models. CAGT-3 ). Quantitative real-time PCR (qRT-PCR) was performed by using an ABI Prism 7900 sequence detection RESEARCH DESIGN AND METHODS system (Applied Biosystems) with SYBR Green PCR Master Animals and Treatment Mix (Applied Biosystems). Transcriptional levels for mRNA Male C57BL/6 and db/db mice were obtained from Shanghai and miR-451 were normalized to 36B4 and U6,respectively. Laboratory Animal Co. (Shanghai, China) and the Model The relative expression of mRNA or miR-451 was calculated Animal Research Center of Nanjing University (Nanjing, using the 2-DDCT method. Primer sequences used for qRT- China), respectively. Eight-week-old mice were fed an HFD PCR are listed in the Supplementary Table 1. (D12492; Research Diets) or control chow (D12450J; Re- Western Blotting search Diets) for the same period. All animals were killed Western blotting was carried out according to standard under an anesthetic condition, serum was stored at 280°C, protocols. Target proteins were detected with SuperSignal and livers were collected and snap-frozen in liquid nitrogen West Pico Chemiluminescent Substrate (Thermo Fisher for further analysis. Animal experiments were performed in Scientific), quantified with Adobe Photoshop CS5, and accordance with the guidelines of the Institutional Animal b Care and Use Committee of the Institute for Nutritional normalized to total protein or -actin. Primary antibodies used for Western blotting are listed in Supplementary Table 2. Sciences, Chinese Academy of Sciences. Generation and Administration of Recombinant Dual Luciferase Reporter Assay Adenoviruses Gyk luciferase reporter construct (Gyk wild type [WT]) Recombinant adenoviruses expressing miR-451 pre-miRNA was constructed by inserting a Gyk mRNA 39 untranslated (Ad-451) or control scrambled short hairpin RNA (shRNA), region (UTR) fragment containing the miR-451 binding 3278 miR-451 Targeting of Gluconeogenesis Diabetes Volume 65, November 2016 site into a pRL-TK vector (Promega). Luciferase reporter constructs containing the mutated miR-451 binding site were generated by mutation of the miR-451 binding site from 59-AACGGTT-39 to 59-AACGCTT-39 (Mut1 Gyk) or 59-AAGCGTT-39 (Mut2 Gyk). Human embryonic kidney (HEK) 293T cells were transfected with 20 ng of luciferase reporter construct together with 20 nmol of miR-451 mimics or negative control oligos using Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific). A reporter plasmid encoding firefly luciferase was cotransfected for normalization purposes. Cells were collected Figure 1—miR-451 expression is increased in liver tissues of diabetic mice. Body weight (A), blood glucose levels (B), and miR-451 24 h after transfection andassayedusingtheDual- levels in liver tissues (C) were examined in HFD-induced diabetic Luciferase Reporter Assay System (Promega). mice and control chow-fed mice by qRT-PCR (n =6–8/group). miR- 451 expression in liver tissues of WT and db/db mice (n = 5/group) Primary Hepatocyte Culture and Treatment (D). Data are mean 6 SEM, representing three experiments in HFD- Primary hepatocytes were prepared by collagenase perfu- induced diabetic mice and two experiments in db/db mice, with sion as described previously (37). Hepatocytes infected the number of mice included in each group in each experiment P < A–C with Ad-GFP or Ad-Gyk for 24 h were cultured in serum- indicated. ** 0.01 compared with chow-fed mice ( )or WT mice (D). free DMEM overnight and stimulated with 100 nmol/L glucagon for 2 h to examine the expression of gluconeogenic genes with qRT-PCR. Hepatocytes cultured in serum- free DMEM overnight were treated with 100 nmol/L insulin, expression of miR-451 is significantly increased in dietary 10 nmol/L dexamethasone, or various concentrations of glu- and genetic mouse models of diabetes. cose for 4 h to examine the expression of miR-451. miR-451 Contributes to Glucose Homeostasis by Glucose Production Assay Regulating Hepatic Gluconeogenesis Glucose production was measured as described previously To determine whether hepatic miR-451 is involved in with slight modification (38). Briefly, mouse primary he- glucose homeostasis, we overexpressed miR-451 (Ad-451) patocytes infected with Ad-Gyk or Ad-GFP for 24 h were in liver tissues of C57BL/6 mice through adenovirus washed, incubated for 2 h in glucose-, L-glutamine–, phe- infection (Fig. 2A). miR-451 overexpression had no effect nol red–, sodium pyruvate–, sodium bicarbonate–free on body weight and food intake (Supplementary Fig. 1A DMEM (Sigma) supplemented with or without gluconeo- and B). Both fed and fasting blood glucose levels were genic substrates (200 mmol/L glycerol only or 10 mmol/L significantly lower in Ad-451–treated mice compared sodium lactate and 2 mmol/L sodium pyruvate). Glucose with control adenovirus (Ad-NC)–treated mice (Fig. 2B). in the medium was measured using a glucose oxidase kit Serum insulin levels and insulin sensitivity were not dif- (Sigma) and normalized with total cellular protein. Glu- ferent between these mice (Fig. 2C and D). GTT showed cose production through gluconeogenesis was calculated that exogenous glucose was cleared faster in Ad-451– by subtracting glucose production without gluconeogenic treated mice than in Ad-NC–treated mice (Fig. 2E). We substrates from glucose production with gluconeogenic further checked hepatic glycogen metabolism and gluco- substrates. neogenesis, two main contributors to blood glucose homeostasis, in Ad-451– and Ad-NC–infected mice and Statistical Analysis found hepatic glycogen content to be comparable (Fig. 6 All data are expressed as mean SEM. Unpaired two- 2F). PTT showed that de novo hepatic glucose produc- t fi tailed Student test was used to assess signi cance tion in Ad-451 mice was lower than in control mice P , between control and treated groups. 0.05 was considered (Fig. 2G), indicating that hepatic overexpression of miR-451 fi statistically signi cant. inhibited gluconeogenesis. These results demonstrate that elevation of miR-451 in liver leads to hypoglycemia by RESULTS inhibiting hepatic gluconeogenesis. miR-451 Is Upregulated in Liver Tissues of Diabetic We further inhibited the function of hepatic miR-451 Mice with miR-451 sponges expressed by adenoviruses (Anti- We examined the expression of miR-451 in liver tissues of 451). The blood glucose levels in Anti-451–treated mice two mouse models of diabetes: HFD-fed mice and db/db slightly increased under the fed condition compared with mice. Mice fed an HFD for 12 weeks were obese and had control adenovirus–treated mice (Anti-null) (Fig. 2H). hyperglycemia (Fig. 1A and B). Hepatic miR-451 expres- GTT and PTT showed that inhibition of miR-451 in sion was significantly increased in HFD-fed mice com- mice impaired glucose tolerance and enhanced hepatic pared with control chow–fed mice (Fig. 1C). Similarly, gluconeogenesis, respectively (Fig. 2I and J). Inhibition hepatic miR-451 levels were higher in db/db mice than of miR-451 had no effect on serum insulin levels, hepatic in WT mice (Fig. 1D). These data show that hepatic glycogen content, body weight, and food intake (Fig. 2K diabetes.diabetesjournals.org Zhuo and Associates 3279

Figure 2—Hepatic miR-451 contributes to glucose homoeostasis through regulating gluconeogenesis. C57BL/6 mice infected with Ad-451 or Ad-NC for 5 days were examined for hepatic miR-451 levels (A), blood glucose levels (B), insulin levels (C), ITT (D), GTT (E), liver glycogen levels (F), and PTT (G)(n =6–7/group). C57BL/6 mice infected with Anti-451 or Anti-null for 5 days were examined for blood glucose levels (H), GTT (I), PTT (J), blood insulin levels (K), and liver glycogen levels (L)(n =6–7/group). Data are mean 6 SEM, representing three independent experiments, with the number of mice included in each group in each experiment indicated. *P < 0.05, **P < 0.01 compared with Ad-NC–infected mice (A–G) or Anti-null–infected mice (H–L). NS, not signiﬁcant.

and L and Supplementary Fig. 1C and D). These results CREB and FOXO1 are two transcription factors that support the finding that hepatic miR-451 plays an impor- control hepatic G6Pase and PEPCK expression, and PGC- tant role in glucose homeostasis through regulating he- 1a is a coactivator of FOXO1. We found that overexpres- patic gluconeogenesis. sion of miR-451 in mice had no effect on hepatic CREB phosphorylation and PGC-1a expression (Fig. 3A and C) miR-451 Regulates Hepatic Gluconeogenesis and the but significantly enhanced hepatic FOXO1 phosphoryla- AKT-FOXO1-PEPCK/G6Pase Pathway tion (Fig. 3D, left panel). Besides the reduction of To address the mechanisms underlying gluconeogenesis G6pase and PEPCK expression, IGF binding protein regulation by miR-451, we examined the effect of miR-451 1 (IGFBP1), an additional downstream molecule of FOXO1, on hepatic gluconeogenic gene expression by adenovirus- was decreased in the livers of miR-451–overexpressed mice mediated overexpression of miR-451 or miR-451 sponges. (Fig. 3A). In contrast, inhibition of miR-451 in mice Overexpression of miR-451 in mice significantly inhibited through miR-451 sponges greatly increased the hepatic hepatic G6Pase and PEPCK expression (Fig. 3A) consistent expression of IGFBP1 (Fig. 3B) and decreased phos- with the inhibitory effect of miR-451 on hepatic glucose pro- phorylation of FOXO1 (Fig. 3D,rightpanel).Similarly, duction (Fig. 2G). Conversely, inhibition of miR-451 function no changes of CREB phosphorylation and PGC-1a expres- with miR-451 sponges in mice increased the mRNA levels of sion were observed in the livers of miR-451–inhibited G6pase and PEPCK in liver tissues (Fig. 3B). These data reveal mice (Fig. 3B and C). These results indicate that hepatic that miR-451 regulates hepatic gluconeogenesis by affecting miR-451 negatively regulates gluconeogenic gene expres- the transcription of gluconeogenic genes. sion through FOXO1. In the fed state, FOXO1 is mainly 3280 miR-451 Targeting of Gluconeogenesis Diabetes Volume 65, November 2016

Figure 3—miR-451 regulates hepatic gluconeogenesis and the AKT-FOXO1-PEPCK/G6Pase pathway. C57BL/6 mice infected with Ad-451, Anti-451, or corresponding Ad-NC and Anti-null, respectively, for 5 days were examined for gluconeogenic gene expression in liver by qRT- PCR (A and B) and for phosphorylation of CREB (C), and phosphorylation of IRb and AKT and its downstream molecules (D) in liver by Western blot (n =6–8/group). Data are mean 6 SEM, representing three independent experiments, with the number of mice included in each group in each experiment indicated. *P < 0.05, **P < 0.01 compared with Ad-NC–infected mice (A and D) or Anti-null–infected mice (B and D).

phosphorylated by AKT, a key molecule in the insulin the transcription of gluconeogenic genes through the signaling pathway. We found that miR-451 overexpres- AKT-FOXO1 signaling pathway. sion increased the phosphorylation of AKT and its downstream target glycogen synthase kinase 3b (GSK3b), but Gyk Is a Target of miR-451 had no effect on phosphorylation of insulin receptor b We used bioinformatics tools (TargetScan, MiRanda, and (IRb) in mouse liver (Fig. 3D, left panel). Further studies DIANA microT-CDS) to predict the targets of miR-451. showed that inhibition of miR-451 in mouse liver sup- Among the putative targets, Cab39, 14-3-3z, and Gyk are pressed the phosphorylation of AKT and GSK3b and all involved in glucose metabolism (26,29,30,39). Although did not affect IRb phosphorylation (Fig. 3D, right panel). Cab39 and 14-3-3z have been reported to mediate miR-451 Collectively, these results indicate that miR-451 regulates functions other than gluconeogenesis (25–27,40), the diabetes.diabetesjournals.org Zhuo and Associates 3281 relationship between miR-451 and Gyk is unknown. We indicate that miR-451 directly inhibits Gyk protein ex- found that adenovirus-mediated overexpression of miR- pression at the translational level. 451 in mice had no effect on protein levels of Cab39 and 14-3-3z in liver tissues (data not shown), indicating that Gyk Regulates the Hepatic Glycerol Gluconeogenesis hepatic Cab39 and 14-3-3z were not targets of miR-451. Axis and AKT-FOXO1-PEPCK/G6Pase Pathway Sequence alignment showed that a 39 UTR fragment of Gyk Gyk is a rate-limiting enzyme that converts glycerol to mRNA is complementary to the seed region of miR-451 glycerol 3-phosphate, which is the first step on the and exhibits high conservation among human, mouse, glycerol gluconeogenesis axis (39,41,42). After we identi- rat, chimpanzee, and rhesus (Fig. 4A). To investigate fied Gyk as a target of miR-451 and found that miR-451 whether Gyk expression can be regulated by miR-451, pRL regulated the hepatic AKT-FOXO1-PEPCK/G6Pase path- promoter–based Gyk 39UTR reporter was cotransfected way, we investigated whether Gyk could regulate both with miR-451 mimics or negative control oligos to the glycerol gluconeogenesis axis and the AKT-FOXO1- HEK293T cells. miR-451 mimics significantly inhibited PEPCK/G6Pase pathway. We found that overexpression luciferase activity of WT Gyk 39UTR reporter but has of Gyk (Ad-Gyk) in mouse liver tissues (Fig. 5A and G) no effect on mutated Gyk 39UTR reporters (Fig. 4B). Cor- reduced blood glycerol levels and increased blood glucose respondingly, protein levels of Gyk were decreased by levels in a random fed state (Fig. 5B and C). Both GlyTT miR-451 mimics in HEK293 cells and the murine hepatic and PTT showed that de novo hepatic glucose production cell line AML-12 (Fig. 4C). In addition, adenovirus- was higher in Ad-Gyk mice than in Ad-GFP mice (Fig. 5D mediated overexpression or inhibition of miR-451 in and E), indicating that Gyk enhanced gluconeogenesis by mouse liver showed that miR-451 negatively regulated promoting glycerol metabolism and using both glycerol hepatic Gyk expression at protein levels but had no ef- and pyruvate as precursors. Compared with Ad-GFP– fect on Gyk mRNA levels (Fig. 4D and E). These results infected mice, Ad-Gyk–infected mice had higher mRNA

Figure 4—Gyk is a target of miR-451. A: Sequence alignment of miR-451 with the 39 UTRs of Gyk mRNA in human (Has), mouse (Mmu), rat (Rno), chimpanzee (Ptr), and rhesus (Mml). B: Luciferase activities in HEK293T cells cotransfected with luciferase reporter constructs containing the WT or mutated 39 UTR of Gyk mRNA (WT Gyk, Mut1 Gyk, and Mut2 Gyk) and miR-451 mimics (miR-451) or negative control oligos (NC) in triplicate. C: Western blot analysis of Gyk in HEK293T and AML-12 cells transfected with NC or miR-451 mimics (miR-451). D and E: Hepatic Gyk mRNA and protein levels in mice infected with Ad-451 or Ad-NC and expressing Anti-451 or Anti-null (n =4–6/group). Data are mean 6 SEM, representing three independent in vitro experiments and three in vivo experiments, with the number of mice included in each group in each experiment indicated. *P < 0.05, **P < 0.01 compared with cells transfected with NC (B and C) or mice infected with Ad-NC (D) or Anti-null (E). 3282 miR-451 Targeting of Gluconeogenesis Diabetes Volume 65, November 2016

Figure 5—Gyk regulates the hepatic glycerol gluconeogenesis axis and the AKT-FOXO1-PEPCK/G6Pase pathway. Mice infected with Ad-Gyk or Ad-GFP for 5 days were examined for hepatic Gyk mRNA and protein expression (A and G); blood glycerol and glucose levels (B and C); glucose production using glycerol (GlyTT) (D) or pyruvate (PTT) (E) as precursors; hepatic gene expression (F); and hepatic AKT, FOXO1, and CREB phosphorylation (G)(n =6–9/group). Mice infected with adenoviruses expressing Gyk shRNA (Sh-Gyk) or control sequence (Sh-NC) were examined for hepatic Gyk expression and AKT and FOXO1 phosphorylation (H) and PTT (I)(n =7–9/group). Mouse primary hepatocytes infected with Ad-Gyk or Ad-GFP in triplicate were examined for glucose production with various precursors (J), AKT and FOXO1 phosphorylation (K), and gluconeogenic gene expression in the presence or absence of 100 nmol/L glucagon (L). Data are mean 6 SEM, representing two independent in vitro experiments and three in vivo experiments, with the number of mice included in each group in each experiment indicated. *P < 0.05, **P < 0.01 compared with Ad-GFP–infected mice (A–G) or hepatocytes (J–L) or with Sh-NC–infected mice (H and I).

levels of G6Pase, PEPCK, and IGFBP1 (Fig. 5F), lower lev- gluconeogenesis through both glycerol and AKT-FOXO1 els of phosphorylated AKT and FOXO1 (Fig. 5G), and gluconeogenic pathways. Gyk overexpression in mice comparable mRNA levels of PGC-1a and phosphorylated had no effect on body weight and food intake (Supple- CREB (Fig. 5F and G), indicating that hepatic Gyk promotes mentary Fig. 1E and F). In contrast with results of Gyk diabetes.diabetesjournals.org Zhuo and Associates 3283 overexpression, knockdown of Gyk in mice with adeno- Hepatic Overexpression of miR-451 or Knockdown of viruses expressing Gyk shRNA enhanced phosphoryla- Gyk Alleviates Hyperglycemia and Glucose Intolerance tion of AKT and FOXO1 in liver tissues (Fig. 5H), in Diabetic Mice inhibited G6Pase and PEPCK expression (Fig. 6I), and re- Because hepatic miR-451 negatively regulates gluconeo- duced glucose production by using pyruvate as a precursor genesis and blood glucose levels in normal C57BL/6 mice (Fig. 5I). These results indicate that Gyk regulates gluco- through Gyk, forced expression of miR-451 in liver under neogenesis through both the glycerol gluconeogenic axis diabetic conditions may be helpful in reducing blood and the AKT-FOXO1-PEPCK/G6Pase pathway. In mouse glucose level. We checked this possibility by adenovirus- primary hepatocytes, overexpression of Gyk promoted mediated overexpression of miR-451 in diabetic mouse glucose production by using glycerol or lactate and pyru- models. Mice fed an HFD for 12 weeks showed a higher vate as precursors (Fig. 5J),inhibitedAKTandFOXO1 fasting blood glucose level, impaired glucose tolerance, phosphorylation (Fig. 5K), and enhanced glucagon- enhanced gluconeogenesis, and decreased insulin sensi- induced G6Pase and PEPCK expression (Fig. 5L), further tivity compared with normal chow-fed mice (Fig. 7A–C). supporting that Gyk promotes hepatic gluconeogenesis The results of GTT, PTT, and ITT showed that infection of through the AKT-FOXO1-PEPCK/G6Pase pathway. Alto- HFD-induced diabetic mice with control adenoviruses had gether, these results indicate that Gyk regulates gluconeo- no significant effect on blood glucose levels, glucose tol- genesis not only by promoting glycerol metabolism in the erance, glucose production, and insulin sensitivity (Fig. glycerol gluconeogenesis axis but also through modulating 7A–C). However, overexpression of miR-451 in HFD-fed the AKT-FOXO1-PEPCK/G6Pase pathway. mice significantly improved glucose tolerance, decreased gluconeogenic capacity, improved insulin sensitivity, de- miR-451 Inhibits Gluconeogenesis by Downregulating creased blood glucose and insulin levels as well as the Gyk In Vivo expression of Gyk and gluconeogenic genes (G6Pase and To verify that miR-451 regulates gluconeogenesis through PEPCK), and increased the phosphorylation of their up- Gyk in vivo, we first examined the effect of miR-451 on stream molecules AKT and FOXO1 in liver tissues (Fig. glycerol metabolism and glycerol gluconeogenesis in mice. 7A–G). These results demonstrate that the elevation of We found that blood glycerol levels were upregulated in miR-451 in HFD-induced diabetic mice could alleviate hy- miR-451 overexpressed mice and downregulated when perglycemia and inhibit gluconeogenesis and the AKT- miR-451 function was inhibited by miR-451 sponges (Fig. FOXO1 gluconeogenic pathway. We further found that 6A). Overexpression of hepatic miR-451 in mice impaired knockdown of Gyk in HFD-fed mice significantly reduced glycerol gluconeogenesis (Fig. 6B). Because miR-451 di- blood glucose levels (Fig. 7H) and serum insulin levels rectly regulates the expression of Gyk, which is involved (Fig. 7I), and improved glucose intolerance (Fig. 7J). in glycerol metabolism and glycerol gluconeogenesis, these These results indicate that Gyk plays an important role results indicate that miR-451 inhibits hepatic glycerol me- in HFD-induced diabetic syndrome. Taken together, these tabolism and glycerol gluconeogenesis through Gyk. We results from HFD-induced diabetic mice indicate that ele- next checked whether elevation of Gyk in mice could re- vation of miR-451 could inhibit gluconeogenesis and alle- verse the inhibitory effect of miR-451 on hepatic gluconeo- viate hyperglycemia through Gyk. genesis through the AKT-FOXO1-PEPCK/G6Pase pathway. We also examined the effect of miR-451 on glucose We observed that overexpression of Gyk with miR-451 in metabolism in db/db mice. Compared with WT control mice totally reversed miR-451 elevation–induced hypoglyce- mice treated with Ad-NC, Ad-NC–treated db/db mice had mia, inhibition of glucose production, and gluconeogenic hyperglycemia, enhanced gluconeogenesis, impaired glu- gene expression as well as AKT and FOXO1 phosphorylation cose tolerance, and insulin sensitivity (Fig. 7M–O). Consis- (Fig. 6C–F), indicating that miR-451 inhibits hepatic gluco- tent with the effect of miR-451 on glucose metabolism in neogenesis and the AKT-FOXO1gluconeogenicpathwayby HFD-induced diabetic mice, overexpression of miR-451 in targeting Gyk. We further checked whether knockdown of db/db mice significantly decreased blood glucose levels, in- – GykinmicecouldreversemiR-451inhibition induced upreg- creased glucose tolerance, inhibited gluconeogenic capacity, ulation of gluconeogenesis and found that knockdown of Gyk and decreased serum insulin levels (Fig. 7K–N and P). by adenovirus-mediated RNA interference in mice could de- Forced expression of miR-451 in both HFD-induced dia- crease blood glucose levels and gluconeogenic gene expres- betic mice and db/db mice had no significant effect on food G–I sion in normal mice (Fig. 6 ). These results show that the intake and body weight (data not shown). Taken together, decreased expression of Gyk mimics the effect of increased these results demonstrate that elevation of hepatic miR- B A miR-451 on glucose metabolism (Figs. 2 and 3 ). Further- 451 in diabetic mice decreases blood glucose levels by more, the upregulation of blood glucose level and gluconeo- inhibiting Gyk-mediated hepatic gluconeogenesis. genic gene expression by miR-451 inhibition could be reversed by Gyk RNA interference (Fig. 6H and I). Taken together, Regulation of miR-451 in Hepatocytes and Liver the data demonstrate that miR-451 regulates hepatic Tissues of Diabetic Mice gluconeogenesis and glucose homeostasis through targeting Because hepatic miR-451 is elevated in diabetic mice, Gyk-mediated glycerol and AKT-FOXO1 gluconeogenesis. which have hyperglycemia and hyperinsulinemia, we 3284 miR-451 Targeting of Gluconeogenesis Diabetes Volume 65, November 2016

Figure 6—miR-451 inhibits hepatic gluconeogenesis through downregulating Gyk. Mice infected with Ad-451, Anti-451, or corresponding Ad-NC and Anti-null, respectively, were examined for blood glycerol levels (n = 5/group) (A) and glucose production using glycerol as a precursor (n = 6/group) (B). Mice infected with control adenoviruses (Ad-NC + Ad-GFP) or Ad-451 combined with Ad-GFP (Ad-451 + Ad-GFP) or Ad-Gyk (Ad-451 + Ad-Gyk) for 5 days were examined for blood glucose levels under a random fed state (C), PTT (D), hepatic gluconeogenic gene expression (E), and hepatic Gyk protein levels and AKT/FOXO1 phosphorylation (F)(n =7–9/group). Mice infected with adenoviruses expressing Gyk shRNA (Sh-Gyk) or control sequence (Sh-NC) were examined for hepatic Gyk expression at the mRNA level (n =7–9/group) (G). Mice infected with Anti-null or Anti-451 combined with Sh-NC or Sh-Gyk for 5 days were examined for blood glucose levels under a random fed state (H) and the expression of hepatic gluconeogenic genes and IGFBP1 (I)(n =5–6/group). Data are mean 6 SEM, representing two independent animal experiments, with the number of mice included in each group in each experiment indicated. *P < 0.05, **P < 0.01 compared with Ad-NC– or Anti-null–infected mice (A and B) and comparing the Ad-451 + Ad-GFP group with the Ad-NC + Ad-GFP group (C–F), Sh-Gyk–infected mice with Sh-NC–infected mice (G), and the Sh-Gyk + Anti-null group with the Sh-NC + Anti-null group or the Sh-Gyk + Anti-451 group with the Sh-NC + Anti-451 group (H and I); #P < 0.05, ##P < 0.01 comparing the Ad-451 + Ad-Gyk group with the Ad-451 + Ad-GFP group (C–F) and the Anti-451 + Sh-NC group with the Anti-null + Sh-NC group (I).

examined whether glucose and insulin could regulate glucose and insulin in T2D and elevation of hepatic hepatic miR-451 expression. We found that glucose and miR-451 may be helpful in lowering blood glucose levels. insulin signiﬁcantly induced miR-451 expression in To check this possibility, we ﬁrst examined the levels of mouse primary hepatocytes, but dexamethasone had no hepatic miR-451 and Gyk in mice fed an HFD for various effect on miR-451 expression (Fig. 8A and B). These re- periods. We found that both miR-451 and Gyk mRNA sults indicate that hepatic miR-451 may be upregulated by levels increased during obesity progression. However, diabetes.diabetesjournals.org Zhuo and Associates 3285

Figure 7—Overexpression of miR-451 alleviates hyperglycemia through Gyk in diabetic mice. Mice fed an HFD for 12 weeks were injected with PBS, Ad-NC, or Ad-451 through the tail vein. Mice fed a control chow diet were injected with PBS. GTT (A), PTT (B), and ITT (C) were performed; blood glucose levels (D), random serum insulin levels (E), hepatic gluconeogenic gene expression (F), and Gyk protein levels and AKT/FOXO1 phosphorylation (G) were examined after 5–7 days (n =6–10/group). Mice fed an HFD for 12 weeks were injected with adenoviruses expressing Gyk shRNA (Sh-Gyk) or control sequence (Sh-NC), and glucose levels under fed or fasting conditions (H), serum insulin levels (I), and GTT (J) were examined after 5–7 days (n =6–8/group). The db/db mice infected with Ad-NC or Ad-451 and control WT mice infected with Ad-NC were examined for hepatic miR-451 levels (K), blood glucose levels (L), PTT (M), GTT (N), ITT (O), and random serum insulin levels (P) after 5–7 days (n =5–7/group). Data are mean 6 SEM, representing three experiments with HFD-induced diabetic mice and two experiments with db/db mice, with the number of mice included in each group in each experiment indicated. *P < 0.05, **P < 0.01 comparing HFD-fed mice injected with PBS or Ad-NC with chow-fed mice injected with PBS (A–C), compared with Ad-NC–treated HFD-induced diabetic mice (D–G)ordb/db mice (K, L, and P), compared with Sh-NC–treated HFD-induced diabetic mice (H–J), and comparing Ad-NC–infected db/db with WT mice (M–O); #P < 0.05, ##P < 0.01 comparing Ad-451 injection with Ad-NC injection in HFD- induced diabetic mice (A–C)ordb/db mice (M and N). 3286 miR-451 Targeting of Gluconeogenesis Diabetes Volume 65, November 2016

Figure 8—Regulation of miR-451 expression in hepatocytes, diabetic liver, and the proposed model of hepatic miR-451 function on glucose homeostasis. A and B: Mouse primary hepatocytes deprived of serum overnight were cultured in medium containing various concentrations of glucose, 100 nmol/L insulin, or 10 nmol/L dexamethasone in triplicate for 4 h. miR-451 levels were then examined with qRT-PCR. Data are mean 6 SEM, representing three independent experiments. *P < 0.05, **P < 0.01 compared with untreated cells. C: Mice fed an HFD for various periods were examined for hepatic miR-451 levels and Gyk at mRNA and protein levels (n = 6/group). Data are mean 6 SEM. **P < 0.01, ##P < 0.01 compared with untreated mice. D: Model of hepatic miR-451 regulation and its contribution to glucose homeostasis. Hepatic miR-451 is upregulated by glucose and insulin. Elevation of miR-451 in liver inhibited Gyk translation, which resulted in gluconeogenesis inhibition and blood glucose level reduction through reducing glycerol conversion to glycerol 3-phosphate (G-3-P) in the glycerol gluconeogenesis axis and enhancing AKT phosphorylation and subsequent FOXO1 phosphorylation to inhibit gluconeogenic gene PEPCK and G6Pase expression through mechanisms that need further investigation. Con, control; DEX, dexamethasone; F16P2, fructose-1,6-bisphosphate; INS, insulin; PEP, phosphoenolpyruvate.

the protein levels of hepatic Gyk did not continue to rise hepatic gluconeogenesis and blood glucose levels through after 1 month (Fig. 8C), indicating that Gyk expression was Gyk at both pre- and posttranslational levels. We demon- inhibited at the posttranscriptional level possibly by miR- strate that miR-451 inhibits hepatic gluconeogenesis by 451. We then examined the effect of miR-451 inhibition on downregulating Gyk, which limits glycerol-to-gluconeogenic glucose metabolism in db/db mice. We found that inhibition flux. Furthermore, we found that miR-451 negatively reg- of miR-451 with miR-451 sponges tended to exacerbate ulates hepatic gluconeogenic gene (PEPCK and G6Pase)ex- hyperglycemia and significantly enhanced hepatic gluconeo- pression through the Gyk-AKT-FOXO1 signaling pathway. genic gene expression in these mice (Supplementary Fig. 2). Madiraju et al. (38) reported that mitochondrial glyc- These results support that the increase of miR-451 in di- erophosphate dehydrogenase (mGPD), a downstream en- abetic mice contributes to attenuating hyperglycemia. zyme of Gyk in the glycerol gluconeogenesis axis, regulates hepatic lactate and glycerol gluconeogenesis. Metformin suppresses gluconeogenesis by inhibiting mGPD (38). Glyc- DISCUSSION erol normally is considered a minor gluconeogenic sub- In this study, we show that hepatic miR-451 is markedly strate (45), but the current results and those of Madiraju increased in liver tissues of diabetic animal models and et al. suggest that enzymes in the glycerol gluconeogenesis identified Gyk as a target of miR-451. We found that miR- axis, such as Gyk and mGPD, play important roles in reg- 451 regulated hepatic gluconeogenesis, glucose homeo- ulating hepatic gluconeogenesis. Although mGPD regulates stasis, and the AKT-FOXO1-PEPCK/G6Pase pathway, gluconeogenesis through modulating glycerol and lactate which was conversely regulated and reversed by Gyk. metabolism but has no effect on gluconeogenic enzyme miR-451 was upregulated by glucose and insulin in hepa- expression (38), the current study demonstrates that Gyk tocytes. Overexpression of miR-451 or knockdown of Gyk regulates hepatic gluconeogenesis (using glycerol or other in diabetic mice significantly alleviates hyperglycemia and precursors) through affecting glycerol metabolism and the hyperinsulinemia. The findings indicate that miR-451 and AKT-FOXO1-PEPCK/G6Pase pathway. Therefore, Gyk may Gyk play an important role in glucose homeostasis, and ma- regulate hepatic gluconeogenesis independent of mGPD nipulating these molecules could provide novel opportunities and play a more extensive role than mGPD in gluconeo- for treating diabetes. genesis and glucose homeostasis. To our knowledge, this Liver gluconeogenesis plays a critical role in the study demonstrates for the first time that Gyk can regulate maintenance of glucose homoeostasis (43,44). We have AKT-FOXO1–mediated PEPCK and G6Pase expression and identified Gyk as a target of miR-451 both in vitro and plays an important role in glucose homeostasis. The study in vivo and demonstrate that miR-451 negatively regulates shows that miR-451 and Gyk regulated blood glucose levels, diabetes.diabetesjournals.org Zhuo and Associates 3287 hepatic glucose production, the glycerol gluconeogenesis In summary, this study demonstrates that miR-451 axis, and the AKT-FOXO1-PEPCK/G6Pase pathway in an and Gyk are critical regulators for the hepatic glycerol opposite manner. Overexpression of Gyk in mice could re- gluconeogenesis axis, the AKT-FOXO1-PEPCK/G6Pase verse miR-451–induced phosphorylation of AKT and pathway, and glucose homeostasis and suggests miR-451 FOXO1, inhibition of gluconeogenic gene expression, and and Gyk as potential therapeutic targets for the control of decrease blood glucose levels; knockdown of Gyk in mice hyperglycemia in diabetes. We have identified Gyk as the reversed miR-451 inhibition-induced elevation of blood glu- target of miR-451 and propose that miR-451 regulates cose level and enhancement of gluconeogenic gene expres- hepatic glucose production through targeting the Gyk- sion. According to these results, we propose that Gyk, a mediated glycerol gluconeogenesis axis and AKT-FOXO1 target of miR-451, regulates hepatic gluconeogenesis gluconeogenic pathway (Fig. 8D). through both the glycerol gluconeogenesis axis and the AKT-FOXO1-PEPCK/G6Pase pathway and mediates the function of miR-451 in gluconeogenesis and glucose ho- Funding. This study was supported by grants from The Science and meostasis. The mechanisms underlying the inhibition of Technology Service Network Initiative Project, Chinese Academy of Sciences AKT phosphorylation by Gyk require further investigation. (KFJ-EW-STS-099, KFJ-EW-STS-031); The National Basic Research Program of We also found that hepatic Gyk is upregulated in an HFD- China (973 Program) (2011CB504002); The Science and Technology Commission induced diabetic mouse model. Knockdown of Gyk could of Shanghai Municipality (13JC1404003); and the China Postdoctoral Science Foundation (2015M571609). significantly alleviate hyperglycemia and hyperinsulinemia Duality of Interest. No potential conflicts of interest relevant to this article and improve glucose tolerance. These results indicate that were reported. Gyk is a potential therapeutic target against diabetes. Author Contributions. S.Z. and Y.Le contributed to the experimental miR-451 has been reported to be regulated by glucose design and writing of the manuscript. M.Y., Y.Z., X.C., F.Z., N.L., P.Y., T.Z., H.M., availability in glioblastoma cells (26). Low glucose inhibits S.W., and S.C. researched data. Y.Li provided the HFD-fed mouse liver samples miR-451 transcription by phosphorylating AMPK, which and contributed to the discussion. Y.Le is the guarantor of this work and, as such, in turn phosphorylates and inactivates OCT1, a direct had full access to all the data in the study and takes responsibility for the integrity transcription factor controlling miR-451 expression (46). of the data and the accuracy of the data analysis. We show that in addition to glucose, insulin could also References induce miR-451 expression in hepatocytes. These results indicate that upregulation of hepatic miR-451 by glucose 1. Perriello G, Pampanelli S, Del Sindaco P, et al. Evidence of increased and insulin may be helpful for lowering blood glucose systemic glucose production and gluconeogenesis in an early stage of NIDDM. Diabetes 1997;46:1010–1016 level in T2D. The molecular mechanisms underlying the 2. Wajngot A, Chandramouli V, Schumann WC, et al. Quantitative contributions regulation of hepatic miR-451 by glucose and insulin need of gluconeogenesis to glucose production during fasting in type 2 diabetes further investigation. The current study shows that he- mellitus. Metabolism 2001;50:47–52 patic miR-451 expression is significantly upregulated in 3. Lin HV, Accili D. Hormonal regulation of hepatic glucose production in health two diabetic animal models, which is consistent with pre- and disease. Cell Metab 2011;14:9–19 vious microarray data from obese and diabetic mice 4. Pilkis SJ, Granner DK. Molecular physiology of the regulation of hepatic (13,24). In HFD-fed mice, although hepatic miR-451 gluconeogenesis and glycolysis. Annu Rev Physiol 1992;54:885–909 and Gyk mRNA kept increasing during the progression 5. Oh KJ, Han HS, Kim MJ, Koo SH. CREB and FoxO1: two transcription factors of obesity, the protein level of Gyk only increased in the for the regulation of hepatic gluconeogenesis. BMB Rep 2013;46:567–574 first month and then remained stable. These results in- 6. Jitrapakdee S. Transcription factors and coactivators controlling nutrient and hormonal regulation of hepatic gluconeogenesis. Int J Biochem Cell Biol dicate that elevation of miR-451 in the livers of diabetic 2012;44:33–45 mice may be helpful in inhibiting Gyk expression and 7. Oh KJ, Han HS, Kim MJ, Koo SH. Transcriptional regulators of hepatic gluconeogenesis. gluconeogenesis. Arch Pharm Res 2013;36:189–200 Because hepatic glucose output derived from glycerol 8. Sajan MP, Farese RV. Insulin signalling in hepatocytes of humans with type 2 and other glucogenic precursors is increased in T2D (45) diabetes: excessive production and activity of protein kinase C-i (PKC-i) and de- and Gyk is upregulated in liver tissues of diabetic mice, we pendent processes and reversal by PKC-i inhibitors. Diabetologia 2012;55:1446– hypothesized that elevation of hepatic miR-451 in diabe- 1457 tes may be helpful in maintaining glucose homeostasis. 9. Lu Y, Xiong X, Wang X, et al. Yin Yang 1 promotes hepatic gluconeogenesis As predicted, we found that overexpression of miR-451 in through upregulation of glucocorticoid receptor. Diabetes 2013;62:1064–1073 HFD-induced diabetic mice and db/db mice significantly 10. Gómez-Valadés AG, Méndez-Lucas A, Vidal-Alabró A, et al. Pck1 gene si- inhibited hepatic Gyk expression and gluconeogenesis, lencing in the liver improves glycemia control, insulin sensitivity, and dyslipide- db/db – alleviated hyperglycemia and hyperinsulinemia, and im- mia in mice. Diabetes 2008;57:2199 2210 11. Sakai M, Matsumoto M, Tujimura T, et al. CITED2 links hormonal signaling proved glucose tolerance and insulin sensitivity (Fig. 7). db/db to PGC-1a acetylation in the regulation of gluconeogenesis. Nat Med 2012;18: In contrast, inhibition of miR-451 in mice exac- 612–617 erbated hyperglycemia and enhanced hepatic gluconeo- 12. Ozcan L, Wong CCL, Li G, et al. Calcium signaling through CaMKII regulates genesis (Supplementary Fig. 2). These results support hepatic glucose production in fasting and obesity. Cell Metab 2012;15:739–751 that miR-451 is a pharmacological target in the treat- 13. Trajkovski M, Hausser J, Soutschek J, et al. MicroRNAs 103 and 107 reg- ment of T2D. ulate insulin sensitivity. Nature 2011;474:649–653 3288 miR-451 Targeting of Gluconeogenesis Diabetes Volume 65, November 2016

14. Jordan SD, Krüger M, Willmes DM, et al. Obesity-induced overexpression of 30. Chen S, Synowsky S, Tinti M, MacKintosh C. The capture of phosphopro- miRNA-143 inhibits insulin-stimulated AKT activation and impairs glucose me- teins by 14-3-3 proteins mediates actions of insulin. Trends Endocrinol Metab tabolism. Nat Cell Biol 2011;13:434–446 2011;22:429–436 15. Zhou B, Li C, Qi W, et al. Downregulation of miR-181a upregulates sirtuin-1 31. Schultze SM, Hemmings BA, Niessen M, Tschopp O. PI3K/AKT, MAPK and (SIRT1) and improves hepatic insulin sensitivity. Diabetologia 2012;55:2032– AMPK signalling: protein kinases in glucose homeostasis. Expert Rev Mol Med 2043 2012;14:e1 16. Kornfeld JW, Baitzel C, Könner AC, et al. Obesity-induced overexpression of 32. Towler MC, Hardie DG. AMP-activated protein kinase in metabolic control miR-802 impairs glucose metabolism through silencing of Hnf1b. Nature 2013; and insulin signaling. Circ Res 2007;100:328–341 494:111–115 33. Coughlan KA, Valentine RJ, Ruderman NB, Saha AK. AMPK activation: a 17. Fu X, Dong B, Tian Y, et al. MicroRNA-26a regulates insulin sensitivity and therapeutic target for type 2 diabetes? Diabetes Metab Syndr Obes 2014;7:241– metabolism of glucose and lipids. J Clin Invest 2015;125:2497–2509 253 18. Li K, Zhang J, Yu J, et al. MicroRNA-214 suppresses gluconeogenesis by 34. Yamada E, Lee TW, Pessin JE, Bastie CC. Targeted therapies of the LKB1/ targeting activating transcriptional factor 4. J Biol Chem 2015;290:8185–8195 AMPK pathway for the treatment of insulin resistance. Future Med Chem 2010;2: 19. Liang J, Liu C, Qiao A, et al. MicroRNA-29a-c decrease fasting blood glu- 1785–1796 cose levels by negatively regulating hepatic gluconeogenesis. J Hepatol 2013;58: 35. Kluiver J, Gibcus JH, Hettinga C, et al. Rapid generation of microRNA 535–542 sponges for microRNA inhibition. PLoS One 2012;7:e29275 20. Bitarte N, Bandres E, Boni V, et al. MicroRNA-451 is involved in the self- 36. Lo S, Russell JC, Taylor AW. Determination of glycogen in small tissue renewal, tumorigenicity, and chemoresistance of colorectal cancer stem cells. samples. J Appl Physiol 1970;28:234–236 Stem Cells 2011;29:1661–1671 37. Dentin R, Pégorier JP, Benhamed F, et al. Hepatic glucokinase is required 21. Pan X, Wang R, Wang Z-X. The potential role of miR-451 in cancer di- for the synergistic action of ChREBP and SREBP-1c on glycolytic and lipogenic agnosis, prognosis, and therapy. Mol Cancer Ther 2013;12:1153–1162 gene expression. J Biol Chem 2004;279:20314–20326 22. Jamali Z, Asl Aminabadi N, Attaran R, Pournagiazar F, Ghertasi Oskouei S, 38. Madiraju AK, Erion DM, Rahimi Y, et al. Metformin suppresses gluconeo- Ahmadpour F. MicroRNAs as prognostic molecular signatures in human head and genesis by inhibiting mitochondrial glycerophosphate dehydrogenase. Nature neck squamous cell carcinoma: a systematic review and meta-analysis. Oral 2014;510:542–546 Oncol 2015;51:321–331 39. Kuwada N, Nagano K, MacLennan N, et al. Gene therapy for murine glycerol 23. Hur W, Lee JH, Kim SW, et al. Downregulation of microRNA-451 in non- kinase deficiency: importance of murine ortholog. Biochem Biophys Res Commun alcoholic steatohepatitis inhibits fatty acid-induced proinflammatory cytokine 2005;335:247–255 production through the AMPK/AKT pathway. Int J Biochem Cell Biol 2015;64: 40. Rosenberger CM, Podyminogin RL, Navarro G, et al. miR-451 regulates 265–276 dendritic cell cytokine responses to influenza infection. J Immunol 2012;189: 24. Karolina DS, Armugam A, Tavintharan S, et al. MicroRNA 144 impairs insulin 5965–5975 signaling by inhibiting the expression of insulin receptor substrate 1 in type 2 41. Peroni O, Large V, Beylot M. Measuring gluconeogenesis with [2-13C]glycerol diabetes mellitus. PLoS One 2011;6:e22839 and mass isotopomer distribution analysis of glucose. Am J Physiol 1995;269: 25. Bergamaschi A, Katzenellenbogen BS. Tamoxifen downregulation of miR- E516–E523 451 increases 14-3-3z and promotes breast cancer cell survival and endocrine 42. Baba H, Zhang XJ, Wolfe RR. Glycerol gluconeogenesis in fasting humans. resistance. Oncogene 2012;31:39–47 Nutrition 1995;11:149–153 26. Godlewski J, Nowicki MO, Bronisz A, et al. MicroRNA-451 regulates LKB1/ 43. Klover PJ, Mooney RA. Hepatocytes: critical for glucose homeostasis. Int J AMPK signaling and allows adaptation to metabolic stress in glioma cells. Mol Biochem Cell Biol 2004;36:753–758 Cell 2010;37:620–632 44. Postic C, Dentin R, Girard J. Role of the liver in the control of carbohydrate 27. Tian Y, Nan Y, Han L, et al. MicroRNA miR-451 downregulates the PI3K/AKT and lipid homeostasis. Diabetes Metab 2004;30:398–408 pathway through CAB39 in human glioma. Int J Oncol 2012;40:1105–1112 45. Nurjhan N, Consoli A, Gerich J. Increased lipolysis and its consequences on 28. Li HY, Zhang Y, Cai JH, Bian HL. MicroRNA-451 inhibits growth of human gluconeogenesis in non-insulin-dependent diabetes mellitus. J Clin Invest 1992; colorectal carcinoma cells via downregulation of Pi3k/Akt pathway. Asian Pac J 89:169–175 Cancer Prev 2013;14:3631–3634 46. Ansari KI, Ogawa D, Rooj AK, et al. Glucose-based regulation of miR-451/ 29. Kleppe R, Martinez A, Døskeland SO, Haavik J. The 14-3-3 proteins in AMPK signaling depends on the OCT1 transcription factor. Cell Reports 2015;11: regulation of cellular metabolism. Semin Cell Dev Biol 2011;22:713–719 902–909