ARPC1B Gene: As a Potential Novel Prostate Cancer Driver

University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2019-12 ARPC1B Gene: As a Potential Novel Prostate Cancer Driver

Zaaluk, Hend

Hend, Z. (2019). ARPC1B Gene: As a Potential Novel Prostate Cancer Driver (Unpublished master's thesis). University of Calgary, Calgary, AB. http://hdl.handle.net/1880/111382 master thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY

ARPC1B Gene: As a Potential Novel Prostate Cancer Driver

Hend Zaaluk

A THESIS

SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE GRADUATE PROGRAM IN BIOCHEMISTRY AND MOLECULAR BIOLOGY

CALGARY, ALBERTA DECEMBER, 2019

Abstract

Prostate cancer is the most common malignancy in men and the second leading cause of cancer- related deaths in western countries. Currently, there is a lack of specific molecular markers that can predict cancer progression and prognosis. Characterization of prostate cancer driver genes is essential for investigating the cellular changes that influence the progression of cancer. This will provide a better understanding to prostate cancer carcinogenesis, elucidate novel biomarkers, and improve clinical outcomes. Previously our lab performed a bioinformatics screen using several public cohorts and identified a panel of genes that are deregulated on the mRNA and DNA levels.

We hypothesize that these gene are potentially acting as oncogenes and tumor suppressors that could be related to the prognosis of prostate cancer. Actin-related protein -2/3 subunit B (ARPC1B) was found to be one of the most highly dysregulated genes. Dysregulation of ARPC1B expression has been detected in multiple human cancers and ARPC1B protein has been implicated in the control of actin polymerization. Moreover, ARPC1B is involved in many pathways such as cytoskeleton remodeling via actin; integrin mediated cell adhesion and movement of cell/subcellular compartments. The purpose of this research was to evaluate the expression levels of ARPC1B in different prostate cancer cell lines and investigate its potential role in disease progression. ARPC1B expression was analysed using western blot and qRT-PCR in multiple cell lines. We found ARPC1B protein and mRNA levels to be upregulated in the PC3 cell line compared to other cell lines. To validate the role of ARPC1B, siRNA was used to knockdown

ARPC1B in PC3 cells which resulted in significant reduction of cell proliferation as measured using the MTS assay. Reduced cell growth and/or reduced migration in cells with ARPC1b knocked down was also seen using scratch assays. Tissue expression levels were also investigated

on a progression tissue microarray and showed increased intensity with disease progression from benign to localized cancer and castrate resistant disease. These data suggest that ARPC1B could be a valid prostate cancer marker.

III

Acknowledgements

First and foremost, I would like to express my sincere gratitude to the Libyan Higher ministries of education & The University of Tripoli, who has given me the opportunity to continue with my education abroad. Beside the Ministries of education, I would like to express my sincere gratitude to my advisor Prof. Tarek Bismar for the continuous support of my master study and related research, for his patience, motivation, and immense knowledge. His guidance helped me in all the time of research and writing of this thesis. I would like to express my special thanks to

Dr. Hatem Abou-Ouf for his valuable thoughts, advice and feedback.

I would like to express my deepest gratitude to thank also my thesis committee members Dr. Bob

Argiropoulos, Markus Eszlinger, Karl T. Riabowol, and Dr. Susan Lees-Miller who provided me an opportunity to join their team and gave me access to the laboratory and research facilities and for their valuable comments and insightful suggestions. Without their precious support, it would not be possible to conduct this research.

I would like to express my deepest thanks to the Faculty of Medicine and the Department of

Biochemistry and Molecular Biology at the University of Calgary for their help and support during these past few years, especially Dr. Sarah J. Childs, and Marion Mildenberger for their guidance and assistance throughout this program.

Moreover, I am deeply thankful for all the members of Dr. Bismar’s laboratory; Dr. Ramy

Sallam and Ms. chung-sze seck.

Dedication: -

In the end, I want to take the opportunity to extend my thanks to my beloved husband (Kamal Hrbeed) and my Parents Dr. Mohamed Zaaluk, and Karema, and my brother and sisters. Also, I would like to thank Dr. Ron Zellner, and Dr. Luana Zellner. Words cannot express how grateful I am to be part of my own family. Your prayer, support, and motivations were what sustained me thus far. I would also like to thank all of my friends who supported me to strive towards my goal.

TABLE OF CONTENTS

CHAPTER 1 : - INTRODUCTION ...... 1

BACKGROUND ...... 1 1.1 Anatomy of the Prostate Gland ...... 1 1.2 Prostate Pathology ...... 3 1.2.1 Benign prostatic hyperplasia (BPH) ...... 3 1.2.2 Prostatic Intraepithelial Neoplasia ...... 3 1.2.3 Prostate Cancer ...... 3 1.3 Epidemiology ...... 4 1.4 Risk Factors ...... 5 1.4.1 Endogenous Risk Factors ...... 5 1.4.2 Exogenous Risk Factors ...... 6 1.5 Progression of prostate cancer ...... 6 1.6 Prostate Detection ...... 9 1.7 Biomarkers in prostate cancer: ...... 9 1.8 ARPC1B ...... 11 1.8.1 The role of ARPC1B in cancer ...... 17 HYPOTHESIS ...... 19 OBJECTIVES ...... 19 CHAPTER 2 : MATERIALS AND METHOD ...... 20

MATERIALS ...... 20 2.1 Cell Lines ...... 20 2.2 Cell culture ...... 22 2.3 Antibodies ...... 23 2.3.1 ARPC1B Antibody ...... 23 2.3.2 GAPDH Antibody ...... 23 METHODS ...... 25 2.4 Protein Extraction from Cell lines ...... 25 2.5 Western Blot ...... 25 2.6 RNA Extraction ...... 26 2.7 cDNA ...... 27 2.8 Real-time reverse transcription – PCR ...... 27 2.9 Transfection and RNA Silencing ...... 29 2.10 Proliferation Assay (MTS) ...... 29 2.11 Wound healing assay ...... 30 2.12 Patients Samples ...... 31 VI

2.13 Scoring of ARPC1B expression ...... 31 2.14 Immunohistochemistry (IHC) ...... 31 CHAPTER 3 : - RESULTS ...... 33

3.1 ARPC1B PROTEIN EXPRESSION IN THE PROSTATE CANCER CELL LINES ...... 33 3.2 WESTERN BLOT ANALYSIS OF ARPC1B IN A HUMAN CELL LINES SK- MEL-30 AND HEK 293 USING ANTI-ARPC1B ...... 36 3.3 ARPC1B MRNA EXPRESSION IN THE PROSTATE CANCER CELL LINES ...... 38 3.4 KNOCKDOWN OF ARPC1B IN PC3 CELL LINE ...... 40 3.5 KNOCKDOWN OF ARPC1B REDUCES THE PROSTATE CANCER CELL PROLIFERATION ...... 43 3.6 ARPC1B EXPRESSION IN CLINICAL PROSTATE CASES ...... 48 CHAPTER 4 : - DISCUSSION ...... 51

4.1. PROSTATE CANCER ...... 51 4.2 ARPC1B ROLE IN PHYSIOLOGICAL PROCESSES ...... 52 4.3 ARPC1B EXPRESSION IN CANCER ...... 53 4.4 FUTURE DIRECTION ...... 55 REFERENCES: - ...... 56

VII

List of Figures and Illustrations

Figure 1.1 Anatomy of the male prostate gland ...... 2 Figure 1.2 Gleason score grading system ...... 8 Figure 1.3 The structure of the protein ARPC1B ...... 16 Figure 1.4 The chromosomal location of the ARPC1B gene...... 16 Figure 1.5 The structure of the Actin-related protein -2/3 complex...... 18 Figure 2.1 western blot analysis western ...... 24 Figure 3.1 Western blot analysis shows the protein expression of the ARPC1B in prostate cancer cell line vs the epithelial cell line...... 35 Figure 3.2 ARPC1B protein expression in HEK293 and SK-MAL28 ...... 37 Figure 3.3 Quantitative real time PCR experiments were used to determine the mRNA expression of ARPC1B in five prostate cancer cell lines ...... 39 Figure 3.4 ARPC1B knockdown in PC3 cell line ...... 42 Figure 3.5 siRNA knockdown of ARPC1B in PC3 cell line for three days...... 44 Figure 3.6 Knockdown of ARPC1B reduces the prostate cancer cell migration ...... 47 Figure 3.7 ARPC1B expression in clinical prostate cases ...... 49 Figure 3.8 Immunohistochemistry staining shows the expression of ARPC1B protein in tissue sample ...... 50

List of tables

Table 2.1 The table shows the different cell lines used in the study ...... 21 Table 2.2 This table shows the primer sequences of genes tested by qRT-PCR ...... 28

VIII

List of Symbols, and Abbreviations

ARPC1B Actin related protein 2/3 complex subunit 1b

AMACR alpha methylacyl-CoA racemase

AR Androgen receptor

BPH Benign prostatic hyperplasia

BMI Body mass index

BPH Benign prostate hyperplasia

CRPC castration resistant prostate cancer cDNA Complementary DNA

°C Degree Celsius

DNA deoxyribonucleic acid

DMEM Dulbecco's modified eagle medium

DMSO Dimethyl sulfoxide

DRE Digital rectal exams

EDCs Endocrine disruptor chemicals

EDTA Ethylenediaminetetraacetic acid

GAPDH Glyceraldehyde 3-phosphate dehydrogenase g Gram

HEK293 cells Human embryonic kidney 293 cells

IHC Immunohistochemistry

mRNA messenger RNA miRNAs Micro RNAs mg Milligram ml Milliliter mM Millimolar

μg microgram

μl microliter

PIN Prostatic intraepithelial neoplasia

PCa Prostate Cancer

PSA prostate-specific antigen

PVDF Polyvinylidene

PCR Polymerase chain reaction

PBS Phosphate buffered saline

RNA Ribonucleic acid

RT Room temperature

RPMI Roswell Park Memorial Institute

SDS Sodium dodecyl sulphate siRNA Small interfering RNA

UTI urinary tract infection

TMA Tissue microarray

Chapter 1 : - Introduction

Background

1.1 Anatomy of the Prostate Gland

The prostate is the largest male reproductive gland. It is located above the urinary bladder and inferior to the urethra as shown in Figure1.1 [1, 2]. Described as the size of a “walnut” it is externally surrounded by collagen and smooth muscle internally which together makeup the prostate capsule[3]. The gland contains three major anatomical regions that represent different biological and histological characteristic , these regions are the peripheral zone (70%), the central zone (25%), and the transition zone (5%)[4, 5]. The peripheral zone is known to show higher cell proliferation and invasive potential than the transitional zone[5, 6]. The gland shows two different compartments, stromal and epithelial, each with its own subdivisions. The stromal cells are either : endothelial cells, fibroblasts or smooth muscle cells[3]. The epithelial cells are either luminal secretory, basal epithelia or neuroendocrine[6, 7]. The main function of the prostate gland for the storage and production of seminal fluid that assists in sperm motility and viability. In addition, the smooth muscles in the prostate assist with ejaculation during sexual activity[6].

Figure 1.1 Anatomy of the male prostate gland

Anatomy of the male prostate gland and surrounding organs including bladder, seminal vesicle, and urethra, bladder, and the location of the prostate gland. The figure obtained from American cancer society. [8]

1.2 Prostate Pathology

1.2.1 Benign prostatic hyperplasia

Benign prostatic hyperplasia (BPH) is the non-malignant growth of the prostate. This growth can be seen in aging men and is an age-related condition. This condition is typically not presented as problematic, although can be accompanied by subjective symptoms most commonly, lower urinary tract symptoms[9, 10].

1.2.2 Prostatic Intraepithelial Neoplasia

Prostatic intraepithelial neoplasia (PIN) is the uncontrolled development of the intraepithelial cells in the prostate glands[6]. There are versions of PIN, low grade and high grade. Low grade

PIN is described as the crowded and irregularly spaced epithelial cells where the nuclei are hyperchromatic meaning elevated levels of chromatin and the cells appear in various sizes and shapes (pleomorphism)[6, 11, 12]. In high grade PIN, the levels of chromatin and pleomorphism are further increased due to the proliferation. [6, 13, 14]

1.2.3 Prostate Cancer

Normal epithelial cells of the prostate are transformed into cancerous cells due to uncontrolled cell division. Normally tissue homeostasis maintains a balance between proliferation and cell death ratio via a highly regulated process[6, 15]. In case of a mutation in the DNA of an epithelial cell the processes are disturbed and cause cells to divide rapidly and proliferate at a higher rate [6].

Healthy development of the prostate is dependent on normal function of the androgen receptor

(AR). [16] through the androgen hormone. Mutation of the AR may result in increased progression of prostate cancer and failure of endocrine therapy due to error in transcriptional activity by binding of other endogenous hormones. Androgen action involves the production of testosterone and the conversion to 5 alpha-dihydrotestosterone (DHT). Both these substrates bind to AR along with modulators. Around 80-90% of prostate cancers are dependent on androgen at initial diagnosis. Treatment by endocrine therapy relies on the reduction of serum androgen levels and inhibition of AR[17].

Prostate cancer (PCa) is a malignant neoplastic proliferation of the prostate epithelium, resulting from uncontrolled cell growth and dramatic increase in the number of cells [18]. In prostate cancer the disease is thought to arise from a single somatic cell, further mutations usually arise in genes involved in the regulation and growth of a cells [6, 19]. The tumorous cells proliferate in a localised region in the prostate gland, and it spreads to distant sites of the body through the lymphatic and vascular system. The capacity to invade other organs and spread to distant locations is more commonly known as metastasis. [6, 20]

1.3 Epidemiology

The majority (about 95%) of PCa are derived from epithelial cells, which are called adenocarcinoma[21]. The main cause of mortality among prostate cancer patients is related to metastasis from the primary tumor spread to distant organs or tissues such as lymph nodes and bones[22]. Prostate cancer is the most common malignancy in men and the second leading cause

of cancer-related deaths in Western countries, with an estimated incidence of 238,590 new cases and 29,700 deaths in the USA in 2013[23]. According to the American Cancer Society one in six men will develop Prostate Cancer in his lifetime and one in 36 will die from the disease.[23].

In Canada, it is estimated that 21,600 men will be diagnosed with prostate cancer in 2017, and

4100 of those will die from the disease annually despite current therapies and diagnostic tools for the metastatic disease, which is the most commonly diagnosed cancer among Canadian men[24, 25]. Although, prostate cancer can be controlled by surgical excision and radio-therapy, the annual survival rate still remains not optimistic[25, 26], due to delay in diagnosis and lack knowledge of specific molecular markers that can predict the cancer progression and prognosis[27]. Prostate cancer is a silent disease and doesn’t show symptoms until later disease stages[28, 29]. In early stages, symptoms may include increased urination, urgency, pain, burning and presence of blood in urine[30] However, these symptoms are nonspecific and occur in other diseases such as urinary tract infection [30-32].

1.4 Risk Factors

1.4.1 Endogenous Risk Factors

Family history: The risk of prostate cancer is significantly increased in patients that have close family members affected by PCA. However clinical and pathological features of PCa are similar in both familial and non-familial cancer cases, making differentiation in detecting difficult[33,

34].

Hormones: Prostate growth rate and progression of PCA is significantly altered by androgens.

An increase in testosterone, and its metabolite (dihydrotestosterone), over several decades may

increase prostate cancer risk. The progression of the disease relies on the quantity of hormones such as testosterone. [33, 35].

Race: There are three factors in which race can affect risk of PCa. Differences in diet

(exogenous), genetic differences (endogenous), difference in detection in reference to medical accessibility. African-American men are reported to have higher risk of prostate cancer than white American men due to both exogenous and endogenous reasons. [33, 36].

Age: Older men are known to have a significantly higher risk for PCa. Rates seem to rise considerably with age to peak in the 75-79 age groups, which have the highest risk of PCa. Men younger than 50 rarely develop prostate cancer, and the risk is reduced significantly[33, 37].

1.4.2 Exogenous Risk Factors

Environmental agents: Endocrine disruptor chemicals (EDCs) are considered as risk ad factors for PCa [38]. It has shown that a number of EDCs affect hormones other than estrogen, acting as agonists causing binding to occur, disrupting the endocrine system[39]. The increased levels of androgens can occur lead to EDCs being a risk.[33].

1.5 Progression of prostate cancer

Currently, the evaluation of the severity and the aggressiveness of prostate cancer is determined in histologically examined biopsy tissue, which is known as the Gleason score grading system[40, 41]. This system is based on the histology architecture of the cells within the tumor[42]. The Gleason patterns range from 1-5, with 5 being the most aggressive. Figure 1.2 represents the pattern of different Gleason’s score. The overall Gleason’s grades is determined

by the addition of the two predominant patterns in the radical prostate and the worst predominant patterns in needle biopsy according to the International Society of Urological Pathologists

(ISUP) [43]. Thereby changing the range from 2-10, with 10 being the most aggressive[44].

Usually in needle biopsy tissue, the lowest combined score would be 6 [45]. The general trend for this system goes as follows, scores of 7-10 are associated with worse prognosis, and scores 6 is associate with lower progression after therapy. This system has been very popular in predicting disease progression and is used as the international standard for grading prostate cancer[44, 46].

Figure 1.2 Gleason score grading system

Gleason score grading system used to determine the diagnosis of a prostate cancer progression. It is classified in five grades based on the histology of cells within the tumor, grade one being the reference for normal cell structure and grade five being the reference for abnormal and highly aggressive. Figure obtained from [47].

1.6 Prostate Detection

Prostate cancer is a silent disease and does not show symptoms until late in the disease stages[48,

49]. In early stages, symptoms may include increased urination, urgency, pain, burning and presence of blood in urine[50]. However, these symptoms are nonspecific and occur in other disease such as urinary tract infection [51]. Methods such as assessment of prostate specific antigen (PSA) in blood sample, digital rectal exams [21], transrectal ultrasound (TRUS)[52] and bone scans for metastatic detection in bone have been widely used for PCa detection[53, 54].

Prostate specific antigen (PSA) blood screening remains the most common diagnostic test for early prostate cancer detection[55, 56]. When PSA is elevated, it is recommended that patients undergo a prostate biopsy to examine the tissue microscopically. Digital rectal exam [57] is a tool used to assess the prostate gland clinically where the physician assesses any lumps in the prostate gland that could be indicative of PCa [54, 58].

1.7 Biomarkers in prostate cancer:

PSA is a biomarker for prostate cancer[54].PSA blood screening remains the most common indicator for early prostate cancer detection. The normal range of PSA in blood is 0-4ng/ml. The utility of the PSA screening tool depends on the size of the prostate gland and the presence or absence of any inflammation[59]. PSA levels can be increased in benign disease, leading to the misdiagnosis of prostate cancer and its potential overtreatment[60]. A review by Adhya and

Gupta mentioned that even in the “normal” PSA range, there are numerous factors that affect a patient’s PSA levels, such as age and race and prostate cancer can still be detected in such normal levels. [61]. It is normal to have higher baseline PSA levels in older men and among

African individuals compared with middle aged Caucasians[61].Additionally, PSA screening may lead to earlier diagnosis of prostate cancer, because elevated serum PSA is present in non- malignant conditions such as prostatic hyperplasia[62]. Gleason score is grading method used by pathologist to assess the prognosis of prostate cancer [63]. As a result, clinical findings such as

PSA concentration and Gleason score an effective nor accurate tools for the characterization of aggressive forms of prostate cancer, especially when a considerable percentage of indolent prostate cancers can progress to aggressive forms quickly[64, 65]. PCa currently does not have a definitive prognostic test to differentiate between aggressive and indolent tumours. Prognostic biomarkers are critical to avoid over-diagnosis and over-treatment which higher morbidity.

Therefore, there is a significant need to develop other, more accurate biomarkers for prostate cancer.

Phosphate and tensin homolog deleted on chromosome 10 (PTEN) is a tumor suppressor gene. It functions in cell development and genome stability. Progression of prostate cancer has been linked via the PI3K/AKT pathway to the loss of PTEN[66].

Micro RNAs (miRNAs) are small non-coding RNAs which controls the expression of the majority (60%) of protein-coding genes that naturally occur in the body[67]. Given its key role, they are potential diagnostic indicators of tumor formation and metastasis miR-21, miR-221 and miR-222 play a role in the microRNA family that is up-regulated in aggressive PCa [67, 68].

Alpha-methylacyl-CoA racemase (AMACR) is a mitochondrial and peroxisomal enzyme that is overexpressed in prostate cancer[69]. Studies that conducted meta-analysis further proved the strong association the AMACR had with PCa. Although this is a useful tool in detection of this

enzyme it is not t is not highly sensitive, and the expression does not stop at prostatic adenocarcinoma, presenting the issue of a false positive[70].

The Ets Related Gene (ERG) belongs to the erythroblast transformation specific erythroblast transformation specific (ETS)[71]. ERG in combination with AR regulated transmembrane protease, serine 2 (TMPRSS2) has been identified to develop the most genomic alterations in prostate cancer[31]. Upon further investigations it allowed for specific detection of benign prostate cancer samples. Both intra and inter-chromosomal genetic rearrangements were found to drive the ERG rearrangements in PCa. Overall, ERG protein expression correlated to patient prognosis representative of either the survival or the development of prostate cancer[57].

1.8 ARPC1B: -

Cellular movement is essential to several normal biological processes, such as the activities of the immune system and tissue repair and regeneration, while aberrantly activated cell migration is involved in many diseases. For example, in cancer, acquired cell migration ultimately leads to lethal metastatic disease. Indeed, the ability to form metastases is defined as one of the hallmarks of a cancer cell (68). The metastatic process, encompassing dissemination from the primary site, transport via the blood stream or lymphatic system to a new location, invasion and colonization into distant tissue, involves key cellular changes, such as changes in cell-to-cell adhesion, induction of epithelial–mesenchymal transition (EMT) and altered tumor-to-stroma crosstalk[72,

73]. In all these events associated with cell migration, actin cytoskeleton remodeling is involved to achieve the proper cellular outcome[73]. The actin cytoskeleton is composed of monomeric globular actin (G-actin) that self-assembles into filamentous F-actin upon hydrolysis of ATP

(75). Major cellular functions of actin include mechanical support for the cell, cellular vesicle

trafficking, muscle contraction, cell division, cell motility and cell adhesion. Many of these functions, including cell motility and cell adhesion, involve contact with the plasma membrane, thus extending the actin network outside of the cell, in order to enable the actin cytoskeleton to respond to extracellular signals, such as chemoattractants (6). In cell migration, membrane protrusions are created at the leading edge of the cell, where actin cytoskeleton re- organization generates the motile force. Depending on the morphological, structural and functional characteristics of these protrusions, they are termed invadopodia, filopodia and lamellipodia[74].

Invadopodia have the capacity to degrade extracellular matrix (ECM) and are particularly linked to cell invasion[74]. Filopodia are long thin membrane protrusions where parallel unbranched actin filaments are tightly bundled[75, 76]. Filopodia are thought to act as pioneers of the leading edge by probing the environment for cues[77]. Lamellipodia, in turn, are flat sheet-like membrane protrusions with branched actin structures[78, 79]. A key component of these lamellipodial actin structures is the actin- related protein 2/3 (ARP2/3) complex that functions as an actin nucleator and mediates actin filament branching [80]. These actin nucleation factors are important accelerators of actin polymerization by introducing the monomeric actin units to the existing actin filament ends or branch sites [80]. The ARP2/3 complex is an evolutionally well- conserved seven-subunit protein complex consisting of two proteins structurally similar to actin, namely the actin-related proteins 2 and 3 (ACTR2 and ACTR3), and of additional five actin- related protein 2/3 complex subunits (ARPC1, ARPC2, ARPC3, ARPC4 and ARPC5)[73].

ARPC1 has two isoforms in humans, ARPC1A and ARPC1B. At the actin branch site, ACTR2 and ACTR3 are in contact with the pointed end of the novel daughter filament, while ARPC2 and ARPC4 connect the complex to the mother filament. The exact functions of the β-propeller protein ARPC1, and ARPC3 and ARPC5 situated at the edge of the complex, remain unknown

[73].While several knockdown studies have demonstrated how the ARP2/3 complex disruption in mouse embryonic fibroblasts leads to inhibition of lamellipodia formation, thus impairing cell migration[73], there are also data showing no evident effect of ARP2/3 depletion on lamellipodia structure[73] . Recently, two studies demonstrated how ARP2/3 complex is indeed critical for lamellipodia formation, and even though disruption of this complex did not entirely abolish cell migration, it did influence the directionality of cell movement, making mouse embryonic fibroblasts unable to sense changes in the ECM and move along these gradients in a coherent manner [73]. Instead of lamellipodia, these ARP2/3 complex-depleted cells formed filopodial structures to support their migration. Further support for the importance of ARP2/3 complex in lamellipodia formation and migration came from a study showing that the correct localization of

ACTR2 mRNA at the protrusions was crucial for the proper directionality of cell migration[73,

81]. Actin-related protein 2/3complex subunit 1B (ARPC1B) is a protein that humans encode by the ARPC1B gene (Figure 1.5)[16]. This gene encodes one of seven subunits of the human

Arp2/3 protein complex[82].The human complex consists of seven subunits which include the actin related ARP2, ARP3, ARCP 4, ARPC 5, ARPC3 and ARPC 1A/B [80]. The ARPC1B is most similar to the protein encoded by gene ARPC1A and the relation between both genes implies that they may function similarly to promote coding of the p41 subunit in Arp2/3 complex facilitating the branching of actin filaments[82].The structure of ARPC1 (P41) contains 6 WD40 repeat domains forming a b-propeller structure which is required for Arp2/3 complex function

(Figure 1.3)[83]

The ARP2/3 complex has homologues in diverse eukaryotes, implying that the structure and function of the complex has been conserved through evolution[84]. Human Arp2 and Arp3 are very similar to family members from other species[85]. The ARPC1B protein has been implicated in the control of

actin polymerization[86-88]. Also, it is a key component of the lamellipodial actin structure, which are flat sheet like membrane protrusions with branched actin structures[73, 89]. ARPC1B functions in actin polymerization as well as it is involved in actin filament branching[88]. These actin nucleation factors are important accelerators of actin polymerization by introducing the monomeric actin units to the existing actin filaments ends or branch sites[90]. Furthermore, it is highly implicated in migration

& metastasis of PCa cells into osseous and soft tissue[73, 87]. Moreover, ARPC1B is involved in many pathways among which is cytoskeleton remodeling via actin; integrin mediated cell adhesion and movement of cell/subcellular compartments[89, 91]. The function of polymerization and the factors involved are crucial to understanding the cell mobility and thereby its potential for metastasis[92]. To further support this it was found that breast cancer cells lines increased their

tumorigenicity and resulted in centrosome amplification when ARPC1B was over expressed[93].

The Arp2/3 protein complex participates in the regulation of cadherin mediated cell-cell adhesion.

Regulation of the actin cytoskeleton by ARP2/3 complex activity has been proposed as mechanism for controlling tumor cell migration, invasion, and metastasis[94]. It was found that the aberrant expression of ARP2/3 complexes were involved in the malignant transformation of the gastric epithelial tissue [94]. In gastric carcinoma, Arp2/3 complex overexpression was positively correlated with tumor size, depth of invasion, venous invasion and UICC staging, indicating that they have an impact on the growth, invasion, metastasis and progression of gastric carcinomas and can be employed to indicate the aggressive behavior of carcinoma[94, 95]. The disruption of the complex does not entirely abolish cell migration, but it did influence the directionality of cell movement, making mouse embryonic fibroblasts unable to sense changes in the extra cellular matrix and move along these gradients in a coherent manner[94]. Silencing of the ARP2/3 complex subunits typically resulted in reduced cell migration capacity[94]. Since the ARPC1B an important

subunit in the ARP2/3 complex therefore, there is a considerable possibility that ARPC1B is involved in metastasis and can be developed into a biomarker for differentiation between indolent and aggressive cancer.

Figure 1.3 The structure of the protein ARPC1B

The WD40 repeat domains forming a b-propeller necessary for the protein function. The numbers in the top indicate the amino acids. The first amino acid start in the N terminal and the last amino acid (372) in the C terminus. The figure was obtained from [83].

Figure 1.4 The chromosomal location of the ARPC1B gene. The ARPC1B gene is located in the long arm of chromosome 7 at position 22.1. Figure obtained from ([96]).

ARPC1A, is another protein encoded by the Actin-related protein 2/3 complex subunit[16, 97]. The similarity between the ARPC1A and ARPC1B proteins suggests that the human Arp2/3 complex facilitates the branching of actin filaments in cells[98]. The similar functions of ARPC1A and ARPC1B are also evident in the recent discovery of patients with severe or total ARPC1B deficient. When observing the lack of ARPC1B using immunoblotting analysis it reveals that those who may have immune system abnormalities still survive, due to compensatory upregulation of ARPC1A expression[16].

1.8.1 The role of ARPC1B in cancer

ARPC1B was hypothesized to be a driver gene due to the reported findings of this gene being highly expressed in pancreatic cancer and being linked to disease progression of several cancers. To observe the expressional consequences of ARPC1B and ARPC1A, each gene was silenced using gene specific siRNAs silencing techniques both individually and simultaneously[16]. The functional characterization of these genes showed ARPC1B and ARPC1A having a strong involvement with cellular mobility and cell proliferation [16]. Thus, the role of ARPC1B proved to be a very significant in the study of cell proliferation in pancreatic cancer[16]. Based on these results I hypothesized that silencing the ARPC1B gene would render the same results in prostate cancer. The purpose of this research proposal is to evaluate the expression levels of the ARPC1B protein subunit in prostate cancer cells. In addition, I will explore the clinic-pathological significance, molecular role of

ARPC1B, its migration potential and its tumorigenic effect through the silencing this protein through siRNA inhibition.

The structure of the Actin-related protein -2/3 complex

Figure 1.5 The structure of the Actin-related protein -2/3 complex. The structure of the Actin-related protein -2/3 complex. In ribbon diagram representing the seven subunits labelled in different colours, ARP2 in blue, ARP3 in yellow, ARCP 4 in pink, ARPC 5 in dark blue, ARPC3 in red and ARPC 1 in green (which is presented in two isoforms in humans, A & B). Figure obtained from [1].

Hypothesis

According to bioinformatics analysis that was performed by our lab and in addition to literature publications on the role of ARPC1B in other cancers, we hypothesize that the inhibition of

ARPC1B gene will reduce cell proliferation and cellular migration in prostate cancer cells and potentially could have a prognostic value in prostate cancer.

Objectives

1. Examine the expression level of ARPC1B protein and mRNA in prostate cancer cell line

and in epithelial cell lines.

2. Investigate the effect of siRNA of ARPC1B on cell line characteristics using in-vitro

models

3. Assess ARPC1B protein expression in prostate cancer tissue sample and its relation to

disease progression.

Chapter 2 : Materials and Method

Materials

2.1 Cell Lines

Human prostate Cancer cell lines used in this project were LNCap, VCap, PC3, C4-2, and

DU145. all of these cell lines were purchased from American Type Culture Collection (ATCC;

Manassas, CA, USA) as shown in table 1. The RWPE-1 cell line was kindly provided by Dr.

Karl Riabowol. Hek293 cells also provided by Dr. Karl Riabowol's lab , were used as a positive control in the western blot experiments. SK-melanoma cell line was provided by Dr. Oliver bathe’s lab and it was used as a negative control. DU145, PC3 and LNCap prostate cancer lines were cultured in RPMI 1640 medium (GIBCO life technology, Grand Island, NY, USA) supplemented with 10% FBS at 37° in 5% CO2 atmosphere. C4-2 and VCap cell line were grown in DMEM media (GIBCO) with 10% FBS. RWPE-1 cells were grown in Keratinocyte-Serum

Free Medium (Catalog number #17005042) by GIBCO by Life technology, Grand Island, NY,

USA. Human embryonic HEK293 cell line was grown in RPMI medium with 10% FBS at 37° in

5% CO2 atmosphere. The SK-Melanoma cell line was also cultured in RPMI medium.

Table 2.1 The table shows the different cell lines used in the study

Cell Line Type of Prostate cell line

Normal epithelial cell line

RWPE-1 HPV-18 immortalized prostate cell line

Prostate cancer Cell lines: -

LNCaP Lymph node metastasis

C4-2 Lymph node metastasis

VCaP Vertebral metastasis

PC3 Bone metastasis

DU145 Brain metastasis

2.2 Cell culture

The cell culture procedure was performed inside the hood using aseptic technique under sterile work area conditions. Sterilization was conducted with alcohol to prevent contamination. The cell lines were stored in DMSO 10 % Dimethyle Sulphoxide (D2640) solution (Sigma, St. Louis,

MO, USA) at -80°C in liquid nitrogen. The frozen cells were thawed immediately at 370 in a water bath until completely thawed. Then the cells were transferred to 15 ml falcon tube

(Franklin lakes, NJ, USA) containing 9-10 ml of the appropriate medium. Then the tube was centrifuged at 1000rpm for 10 minutes to separate the DMSO supernatant from the cell pellets.

The cell pellets were transferred into a flask contain 9 ml of the appropriate medium and then the cells were incubated for 1-3 days until reaching 70-90% confluence. After 70-80 confluence was reached cells were passaged to second plates by trypsinizing them with 1 ml trypsin –EDTA

(GIBCO by Life technology, Grand Island, NY, USA) and incubating for 1-2 minutes. Following that, 9 ml of the appropriate medium containing FBS was added to deactivate trypsin reaction.

For the RWPE1 cell line trypsin inhibitor [99] was added to deactivate the trypsin action.

Following that the cells were transferred to new flask.

2.3 Antibodies

2.3.1 ARPC1B Antibody

Actin-related protein 2/3 complex subunit 1B, 41 kDa. The antibody was purchased from Sigma-

Aldrich # HPA004832.

2.3.1.1 HEK-293 cell line as a negative control

Upon investigation by using western blot with HEK-293 as negative control, the molecular weight and band of ARPC1B was measured.

2.3.1.2 SK-MEL 30 Melanoma cell line as a positive control

SK-MEL 30 was used as a positive control for ARPC1B to confirm the molecular weight and band.

2.3.2 GAPDH Antibody

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH Mouse McAb, Cat No.: 60004-1-Ig) antibody was purchased from Proteintech, USA. The used dilution was (1:1000).

Figure 2.1 western blot analysis western blot of ARPC1B (actin-related protein 2/3 complex subunit B) in human cell lines SK- MEL-30 and HEK 293 using anti-ARPC1B performed by Sigma- Aldrich.Figure obtained from[99].

Methods

2.4 Protein Extraction from Cell lines

All cell lines were obtained from ATCC and were cultured in 37° C in 5% CO2 atmosphere until

70-80% confluence was reached. Cells were washed with ice cold phosphate buffered saline

(PBS), scraped and collected by centrifugation. Radioimmunoprecipitation (RIPA) lysis buffer supplemented with protease inhibitor cocktail tablets (Roche, Mannheim, Germany)) was added to the cells and mixed. Protein lysates were sonicated briefly and subsequently centrifuged, the supernatant was then transferred to fresh pre-chilled tubes. The protein concentration was determined using the Quick Start Bradford Protein Assay Kit (Bio-Rad Laboratories Inc. Hercules,

CA, USA), and (Pierce™ BCA Protein Assay Kit Catalog number 23227) using a Microplate

Procedure. The samples in the plate were read using Bio-Rad Elisa reader. Protein expression from each of the prostate cancer cell-lines (Table 1) versus an epithelial cell line was analysed with western blot using ARPC1B antibody.

2.5 Western Blot

4X loading buffer was added to the samples to a 1X final concentration. Equivalent quantities

(30micro g) of proteins were loaded into each lane and separated by using a 10% polyacrylamide

SDS gel. 10µl of the ladder (Pink Plus Prestained Protein Ladder Cat. No. PM005-0500) was loaded to analyze protein separation and to provide approximate size of protein. Samples were transferred to PVDF membrane (BIO-RAD Immun-Blot® PVDF Membrane) and then it was placed in the transfer buffer (Tris, Glycine, 0.1% SDS and 20% methanol) for two hours at 100V on ice in 4C0. Membrane was incubated with a 10% blocking buffer, 1g of powdered skimmed

milk which was diluted in 10 mL TBS-T /0.1% Tween 20 [99] for 1hr at room temperature with shaking. Following that the membrane was incubated with primary antibody anti-ARPC1B from

(Sigma-Aldrich Cat. No HPA004832) overnight in 4°C with consistent shaking. The antibodies that were used in this study are (Anti-Actin-related protein 2/3 complex subunit 1B, 41 kDa produced in rabbit from (Sigma), and Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a housekeeping gene produced in mouse from (Proteintech, USA). This was followed with the incubation of the membranes with either anti-rabbit IgG or anti-mouse IgG secondary antibody conjugated to HRP horseradish peroxidase in blocking buffer for 1 hr at room temperature. Then the membrane was washed 5 times (4 minutes each) with 0.05% TBS-T. The membrane was later suspended in ECL substrate from Bio-Rad Cat No.: 170-5061for 3-4 minutes. Then the chemiluminescence signal on the membrane was detected by Bio-Rad reader at multiple exposures.

2.6 RNA Extraction

After confluency, cells were washed twice with cold PBS (on ice), then 1 ml Trizol® reagent (cat no. 15596062, Life Technology, Carlsbad) was dropped on the plate, and cells were collected in

1.5 ml microtubes, later vortexed while adding 0.2 ml chloroform per 1 ml Trizol® reagent, and centrifuged at high speed for 15 minutes at 4° C. Then, the samples were separated into three layers, the upper colorless layer, which contains RNA, transferred into a new collection tube with addition of 100% ethanol, mixed and centrifuged, Finally, the RNA was collected with DNAase

RNAse free water into a fresh tube.

2.7 cDNA

RNA extraction protocol is as stated above. Following this, the RNA concentration was quantified using Thermo Scientific™ NanoDrop 2000 and 2000c. For each sample, 1µg of RNA was used as a template to synthesize cDNA using qScriptTM cDNA SuperMix (Quanta BioSciences TM,

Gaithersburg, MD, USA)). The thermal cycler was programmed to 1 cycle for 5 minutes at 25°C,

2nd cycle for 30 minutes at 42°C, 3rd cycle for 5 minutes at 85°C, finally hold for 4 minutes. The final cDNA was then diluted using RNase-free water and stored at 4°C for immediate use and stored at -20°C for a period of time.

2.8 Real-time reverse transcription – PCR mRNA analysis of ARPC1B in cell lines was performed according to standard qRT-PCR procedures using the PerfeCta SYBR Green FastMix ROX according to the manufacture’s protocol, using StepOne Real time PCR system. In 96 well plates, each sample was run in triplicate.

Each well contained cDNA, forward and reverse primers Table 2.2, SYBR green and DNAase and

RNAase free water to make 20µl volume. Plates were cycled using the following conditions: 50°C for 2 minutes, 95°C for 10 minutes, 40 cycles of 95°C for 15s and 60°C for 30s, melt curve generation was performed (95°C for 15s, 60°C for 1 min). A no-template control [100] was used as a negative control. GAPDH expression was used for normalization. Mean cycle threshold value

(i.e. the number of cycles required for the fluorescent signal to cross the threshold) was determined from triplicate PCRs. The experiment was completed in triplicate to find the statistical significance

(student’s t-test using GraphPad Prism).

Table 2.2 This table shows the primer sequences of genes tested by qRT-PCR

Gene Forward sequence Reverse sequence

ARPC1B AAGTGTCGGATCTTTTCAGCC CCGCAGCTACTGCTGGATTC

GAPDH GGATTTGGTCGTATTGGG GGAAGATGGTGATGGGATT

2.9 Transfection and RNA Silencing

The Invitrogen Lipofectamine RNAiMAX was used to transfect siRNA into the PC3 cell line.

Cells were seeded in six well plates until confluence was reached (70-80% confluency). The cells were then treated with Trypsin-EDTA and serum-containing media was added to deactivate the Trypsin.

Viable cells were counted using a haemocytometer through the exclusion of Trypan-Blue

(Gibco™ Trypan Blue Solution, 0.4%) staining, and 100,000 cells were added to wells containing the transfection mixture. Each well contained 5ul of Lipofectamine RNAiMAX in

500ul of opti-MEM MEDIA containing 10uL of ARPC1B siRNA1, siRNA2 or a scramble siRNA as a negative control. Incubated for (20-30) minutes at room temperature. Cells were incubated at 5% CO2 for 24-72 hours at 37°C. Then western blot was performed to determine the efficiency of the ARPC1B knock down and duration of the knock down. Incubation times of

24hrs, 48hrs and 72hrs were used to determine the duration of the knockdown. Results were observed through western blot and qPCR.

2.10 Proliferation Assay (MTS)

CellTiter-AQueous MTS assay (Promega) was used to measure the viable cells in cell proliferation assay. PC3 cells were seeded for 48 hours in a 96 well plate until confluence was reached. The cells were then washed with (PBS) Dulbecco’s Phosphate Buffered Saline (Life

Technology). Cell number and viability was determined by trypan blue exclusion and cells were 29

suspended to a final concentration of 1x10 ^5 cells/ml in optimum medium((GIBCO life technology, Grand Island, NY, USA) ) 50 µl of suspension (5000 cells) was dispensed into each well of the plate with individual or pooled ARPC1B siRNAs or control scramble siRNA.

Additional negative controls were wells containing no cells, or cells with media alone. The plate was incubated for 48hrs at 37 degrees and humidified in a 5% CO2 atmosphere. Following this

20microL of MTS/PMS ((Promega)) solution was added to each well. The plate was incubated again for 2 hrs and the absorbance reading was measured at 490nm using an ELISA plate reader over the course of three days. Each experiment was repeated 3 times.

2.11 Wound healing assay

The PC3 cell line was seeded in 6 cm tissue culture dishes with RPMI medium for 48hrs until

80-90% confluency was reached. Then the cells were transfected with siRNA1, siRNA2 or the scrambled siRNA as a negative control to compare the difference between the migrated cells.

Cells with media alone (no siRNA) were also used as a negative control. Then scratches were made by using a sterile 200uL pipette tip to create a linear scratch. The wound was observed at different time points, 0, 16, and 24 hours after the making the scratch. Cells were photographed using a Carl Zeiss Axiovert 200M microscope at 10 x magnification and imported into

Photoshop Creative Suite, version 6.0 and the extent of wound healing was determined by measuring the total distance between the edges of the scratch.

2.12 Patients Samples

Progression Tissue microarray (TMA) was constructed from patient cohort of 160 men treated for prostate cancer. The cases included samples from castration resistant prostate cancer (CRPC) cores (n=60), localized prostate cancer cores (n=157) and benign cases cores (n=83). The cases were collected between 2007-2009. The average of the cores of each cohort include two cores per case.

2.13 Scoring of ARPC1B expression

Scoring of ARPC1B intensity semi quantitatively using four-tiered system (negative; 0, weak; 1, moderate; 2, strong; 3). For each core, the highest intensity was recorded when at least 25% of the sample was showing this intensity. The analysis was performed on the TMA samples using a bright field microscope by Dr. Sallem under the direction of Dr. Bismar.

2.14 Immunohistochemistry (IHC)

The IHC stain was performed on Dako Omnis auto-stainer (Agilent, Santa Clara, CA, USA) at the AP Research Lab of Calgary Laboratory Services as routine procedure. Four µ FFPE sections were pretreated with target retrieval citrate antigen buffer, high pH (Agilent) this was followed by a series staining and washing. Rabbit polyclonal [18] or rabbit monoclonal [101] antibody was commercially purchased from Sigma (Sigma WH0006690M1, Oakville, Ontario) or Abcam,

Inc (Cambridge, MA, USA). The ARPC1B antibody was diluted at 1/200 dilution [99] using

Dako antibody diluent. Twenty minutes incubation was conducted for both ARPC1B and secondary antibody. A rabbit linker was applied to amplify the staining signal following primary incubation of ARPC1B. DAB+ Substrate Chromogen system (Agilent, Santa Clara, CA,

USA) was used as post incubation detection reagent. This procedure was conducted by Ms.

Shohung Liu.

Chapter 3 : - Results

3.1 ARPC1B protein expression in the prostate cancer cell lines

Western blot analysis was performed to determine the protein levels of ARPC1B in the immortalized normal prostate cell line (RWPE-1) and prostate cancer cell lines (PC3, C4-2, DU145, LNCaP,

VCaP) using the ARPC1B antibody. A single band running at approximately 41 kDa was observed.

ARPC1B protein levels were highest in PC3 and DU145 cell lines as well as in the immortalized prostate cell line RWPE-1. The C4-2, DU145, LNCaP, VCaP cell lines are respectively lower in comparison to control as shown in figure 3.1. Student-test was used, and results were considered significant and the figure illustrates the experiment repeated three times (n=3).

Figure 3.1 Western blot analysis shows the protein expression of the ARPC1B in prostate cancer cell line vs the epithelial cell line. A) The complete cell lysate of (PC3, C4-2, DU145, LNCAP, VCAP) prostate cell lines was loaded onto 10% SDS -PAGE gels and transferred to a PDVF membrane. The membrane was blotted with anti-ARPCIB antibody [99] to detect the protein level of ARPC1B through western blot analysis. Immortalized prostate epithelium (RWPE1) was used as a control, GAPDH was used as a loading control. Levels of ARPC1B were high in the RWPE, PC3, and DU145 and lower LnCAP, VcAP, and C4-2 respectively. B) Quantification of ARPC1B protein expression from western blots N=3) using Image J analysis to quantify each band. Student t-test was used for statistical analysis * P value <0.05, and ** P ≤ 0.01 was considered significant in all cell lines.

3.2 Western blot analysis of ARPC1B in a human cell lines SK- MEL-30 and

HEK 293 using anti-ARPC1B

Western blot analysis was preformed to confirm the positive and negative control for the

ARPC1B, the HEK293, and the SK-MAL 28 cell line. As shown in the (Figure 3.2) the protein level of ARPC1B is low in HEK293 whereas in SK-MAL 28 it resulted in higher levels comparative to the negative control. This antibody is specific for ARPC1B. This protocol was repeated in order to validate the initial test performed by the company in the methodology. The results from this study are similar to the data released by the company.

Figure 3.2 ARPC1B protein expression in HEK293 and SK-MAL28 ARPC1B protein was detected it in SK-MAL28 while in Hek 293 was not. GADPH was used as a loading control.

3.3 ARPC1B mRNA expression in the prostate cancer cell lines

Quantitive real time PCR procedure was performed to determine ARPC1B expression for five prostate cancer cell lines (PC3, C4-2, DU145, LNCaP, and VCaP) relative to the expression of

ARPC1B in immortalized normal prostate cell line (RWPE-1). GAPDH was used as housekeeping gene. The table 2.2 shows the primers that were used in this experiment. The expression of ARPC1B in PC3, and DU145 cell line was significantly higher when we compared with RWPE1 as shown in figure 3.3. Student t-test was used, and results were considered significant and the figure illustrates the experiment repeated three times (n=3).

Figure 3.3 Quantitative real time PCR experiments were used to determine the mRNA expression of ARPC1B in five prostate cancer cell lines Quantitative Real time PCR experiments were used to determine the mRNA expression of ARPC1B in five prostate cancer cell lines (PC3, C4-2, DU145, LNCaP, VCaP) relative to the expression of ARPC1B in immortalized prostate cancer epithelial cell line RWPE-1. GAPDH was used as a loading control. The figure shows three experimental replicates. Student T-test was used for statistical analysis. P value <0.05 was considered significant in all cell lines.

3.4 Knockdown of ARPC1B in PC3 cell line

Based on qPCR results and western results, PC3 was chosen as prostate cancer cell line to complete the knockdown of ARPC1B. The knockdown of ARPC1B was determined through western blot and qPCR on PC3 cell lines by comparison of the transfected cell line by using

Lipofectamine RNAiMA to the negative control, the duration of knockdown was also investigated. At the 24hour mark of the experiment, the results were observed as shown in the figure 3.4 [1]. In this time point there is no knockdown observed. After 48 hours the figure 3.4

[1] shows the beginning of reduction in ARPC1B protein levels by both siRNA1 and siRNA2 compared to the negative control. At 72 hrs the results present similarly to the figure shown at

48hrs. It was observed that the knockdown lasted for four days. In figure 3.4 [3] the messenger

RNA level was significantly reduced in siRNA 1 and siRNA 2 compared to the negative control.

Figure 3.4 ARPC1B knockdown in PC3 cell line

ARPC1B knockdown in PC3 cell line, was confirmed by Western blot analysis after cells were transfected with siRNA for 48 h. B) Quantitative Real time PCR was used to determine the mRNA expression of

ARPC1B in knockdown of the ARPC1B in PC3 cell line by using siRNA compared with the negative control scramble siRNA. GAPDH was used as a loading control. The figure shows three experimental replicates.

Student t-test was used for statistical analysis. * P value <0.05 was considered significant in siRNA1 and the negative control.

3.5 Knockdown of ARPC1B reduces the prostate cancer cell

proliferation

Cell proliferation assay (MTS) in prostate cancer cell line followed by the knockdown was critical in determining the requirement for ARPC1B expression for cancer cell growth. The figure indicates that siRNA 1 and siRNA 2 knockdown of ARPC1B significantly reduced the proliferation of the PC3 cell line, in comparison to the negative control siRNA in the span of three days as shown in figure 3.5.

Figure 3.5 siRNA knockdown of ARPC1B in PC3 cell line for three days. This data shows that the down regulation of ARPC1B inhibits the cell proliferation of PC3 in S1 and S2 compared to negative control. Relative growth rate to the control siRNA at day1. Cells were transfected with control S1 or S2 to A/B. After 2 days cells were harvested and analyzed using the MTS assay. It shows statistically significant, two-way ANOVA was performed, *** means P< 0.001. Error bars indicate the SEM

3.6 Knockdown of ARPC1B reduces the prostate cancer cell migration

To investigate the potential function of ARPC1B in cell migration wound healing assay was performed. Doing this allowed for the comparison of knockdown of ARPC1B on PC3 cell line with control cell line. The PC3 cell line was transiently transfected with SiRNA, later wound healing assay was preformed to observe the cell migration. The images were captured at different time periods (0, 16, 24). Carl Zeiss Axiovert 200M microscope at 10 x magnification and imported into Photoshop Creative Suite, version 6.0 was preformed to generate the images. The migration rate was measured by calculating the total distance between the edges of the scratch as described previously [51]. Each experiment was repeated at least 3 times. Analyzing the result reveals a drastic decrease in the ARRPC1G knockdown cell migration at every time period compared to the control. The most prevalent difference was observed after the 16-hr mark, in the control more than half the cells have already reached the midpoint whereas the knockdown cells showed much less migration even at the 24 hr mark. Analysis of these results strongly show that the knockdown of ARPC1B reduces cell migration supporting, it’s vital role in migration (see

Figure 3.6)

Figure 3.6 Knockdown of ARPC1B reduces the prostate cancer cell migration

A) All cells are grown to confluency in 6cm plates. The upper panel PC3 cells were transiently transfected with a control SiRNA. In the lower panel the cells were transiently transfected with SiRNA, ARPC1B for 24 hours and the next day scratches were made, and wound healing was observed as described in Materials and Methods. ARRPC1B knockdown cells migration was measured at different time periods (0,16,24hrs).

B) Representative images are shown. Scale bar = 100 μm. Average scratch widths, normalized to the width at 0 hours, from three different experiments. Student t-test was preformed P value <0.05 was considered significant in siRNA control and siRNA ARPC1B. Error bars indicate the SEM.

3.6 ARPC1B expression in clinical prostate cases

To investigate the protein expression level of ARPC1B in clinical samples, we used cohort of

(n=202) cases which included benign prostate tissue cores (n=50), localized prostate cancer

(n=103), and CRPC cores (49). The ARPC1B expression was preformed using Immuno- histochemical staining IHC using Dako Omnis auto-stainer (Agilent, Santa Clara, CA, USA).

The intensity was evaluated on 4-tiered system (0-3 corresponding to negative to high intensity).

Mean intensity values were significant between benign, localized PCa and CRPC sample. Mean intensity values were all weak and under 1, therefore benign, localized PCa, and CRPC, are considered equal. The standard deviation for the means was 0.31 +/-SD, 0.52+/- SD and 0.49+/-

SD in the benign, localized PCa, and CRPC, respectively (Figure 3.6).

An example of the Immunohistochemistry tissue staining for localized prostate cancer [17], castration resistance prostate cancer CRPC[102], and Benign [47]using ARPC1B antibody as shown in (Figure 3.7). Overall, there is an increase of the ARPC1B staining castration resistance prostate cancer CRPC, and localized PCa compared with benign as shown in (Figure 3.6).

P<0.0123

P<0.0144

Figure 3.7 ARPC1B expression in clinical prostate cases

The percentage of the mean expression of ARPC1B and its relation with disease progression between Benign, localized prostate cancer, and castration resistance prostate cancer (CRPC) human tissue samples. ARPCIB protein expression levels were observed through immunostaining using ARPC1B [99]. Each sample was scored semi quantitatively using four- tiered system (negative; 0, weak; 1, moderate; 2, strong; 3). The error bars indicate the Standard error of the mean. Student t-test was preformed P value <0.05 was considered significant between prostate cancer CRPC, and localized PCa compared with benign.

A B

Figure 3.8 Immunohistochemistry staining shows the expression of ARPC1B protein in tissue sample Immunohistochemistry staining shows the expression of ARPC1B protein in tissue sample from localized prostate cancer [17], castration resistance prostate cancer [17] CRPC[102], and Benign [17] [47]using ARPC1B antibody[99]. Staining was visualized using high-power 20X magnification photographed using an Olympus camera.

Chapter 4 : - Discussion

4.1. Prostate cancers

Prostate cancer is the most commonly diagnosed cancer among Canadian men[103]. Even given the current detection and treatment options available for PCa the prediction of disease progression is not as accurate. In 2013, there has been 23 600 new cases of PCa, and mortality occurred in over 3900 cases with 17% of the new cases resulting in death. This stresses the need for efficient diagnostic and prognostic tools for PCa [23].

The evaluation of the prognosis and the severity of prostate cancer is determined in biopsy via the examination of tissue cells[104]. The architecture of the cells is assessed under the microscope and then graded based on the Gleason score grading system[105]. The revised grade grouping of Gleason system uses grades from 1-5 with 1 being best differentiated and 5 being worst differentiated (corresponding to Gleason score 6-10). The general trend for this system goes as follows, scores of 7-10 are associated with worse prognosis, and scores 6 is associate with lower progression after therapy. [106]. However, this system contains error when assessed in tissue needle biopsy for being accurately reflecting the whole gland. Therefore, there is a critical need for additional biomarkers to allow more accurate prediction of disease progression[107-109].

Studies from our lab using bioinformatics screening of several public cohorts, had identified a panel of potential oncogenes and tumor suppressors that could relate to disease progression and prognosis in prostate cancer. Oncomine was utilized to establish gene expression patterns of PCa

compared to non-malignant tissue, as such the top 10% of genes that are amplified or overexpressed in PCa were selected for verification in different PCa cohorts. That was followed by a functional analysis to filter out the top 10% of PCa amplified or overexpressed genes with well-established oncogenes in cancer via the Database for Annotation, Visualization and

Integration Discovery [102]. ARPC1B was identified as one of the top differentially expressed genes.

4.2 ARPC1B role in physiological processes

The ARPC1B gene a sub-unit of the Actin related protein 2/3 complex. It has significant involvement in the regulation of actin polymerization, which is required for many types of cellular movement, like chemotaxis, nerve cell cone movement, and platelet activation[88].

ARPC1B specifically, allows for the stabilization of actin filaments and promotion of cell movement through the formation of micro spikes in lamellipodia[1, 110], and is found to be heavily expressed in blood cells.[83] A study tested the role of this gene using the knockdown of

ARPC1B in megakaryocytic cells, which revealed a reduction in the proplatelet formation, and increased expression of ARPC1A to compensate for the loss of the counterpart sub unit[83]. This loss presented with a variety of abnormalities in platelets and tissues in haematopoietic/immune systems. In support of the role of ARPC1B in cells, its part in cell proliferation has proven critical and therefore is the main focus of this study[83].

4.3 ARPC1B expression in cancer

A recent study done by[16] hypothesized that silencing the ARPC1B through siRNA there is a large decrease in pancreatic cancer cell migration and invasion. Furthermore, modification to the

Arp 2/3 complex such as silencing the ARPC1B subunit, reduction of cell migration and cell mobility was observed. Showcasing the critical role of ARPC1B in cell movement. [16, 73].

This was profound because it shows the significance of the ARPC1B on the regulatory activity of the Arp2/3 complex. Thus the excess activity of ARPC1B is important in the function of the entire complex[16].

Based on the previous data we further investigated the role of ARPC1B in prostate cancer.

Initially, we performed screening of ARPC1B in a variety of prostate cancer cell lines in order to investigate the level of expression of the ARPC1B gene in comparison to the epithelial cell line.

The results showed a differential expression of ARPC1B among prostate cancer cell lines. The protein levels of ARPC1B in RWPE1, PC3, DU145 were found to be in high levels respectively in comparison with Vcap, LNCap, and C4-2. Whereas the mRNA level of ARPC1B in the qPCR screening, showed high level of expression in PC3, DU145, and RWPE1 respectively compared with Vcap, C4-2, and LNCap. According to these results PC3 cell line was chosen as a candidate to knockdown ARPC1B due to the high relative level of ARPC1B expression. Following the screening, successful knockdown of ARPC1B was performed in PC3 cell line. We assessed the period of the knockdown using western blot and qPCR and observed reduced protein level for three days and confirmed the knockdown by observing mRNA expression for two days.

Following this, proliferation assay was performed to investigate the cell proliferation and migration of ARPC1B knockdown cells, reduction of PC3 proliferation was observed. In addition to this, wound healing assay was performed in PC3 cell line with siARPC1B which 53

resulted in a reduction of the migration. Observation of the results from the proliferation assay wound healing assay was preformed to analyze how the effect of the knockdown ARPC1B on the cell migration of the PC3 cell line. Upon the knockdown there was a reduction in the cell migration as the time progressed. Which supports the hypothesis in stating that inhibition of

ARPC1B reduces cell migration of the prostate cancer cell line.

We characterized ARPC1B using proliferation assay documenting decrease in cell proliferation when knocking down ARPC1B and further we documented decrease in cell migration as evident by wound healing assays. These results support a role of ARPC1B in prostate cancer progression and invasion. Furthermore, ARPC1B protein expression as assessed by IHC confirmed increased levels from benign to localized PCA and CRPC disease. The mean expression of ARPC1B was under 1 because the concentration of the antibody used was weak therefore as an improvement next time the use of a higher concentration of antibody would perhaps yield a higher mean intensity. Although the intensities observed were concluded as equal due to being under 1, there was still a significant disparity between the benign, localized PCA and CRPC disease. This is further evidence of the potential role of ARPC1B as prognostic marker in patients with PCa.

According to our finding, and other literatures [16] ARPC1AB a strong candidate for monitoring cancer progression. Potentially could have a prognostic value in prostate cancer. For example,

Laurila et al, preformed a knockdown for ARPC1B and ARPC1A in pancreatic cancer cell lines and similar to our study observed a reduction on cell migration, and they suggested that ARPC1B could be one of the prognostic tools for pancreatic cancer. Our findings may validate that the

ARPC1B as a prognostic tool in multiple cancers including prostate cancer.

4.4 Future Direction

This study is among few in which the role of ARPC1B expression is used to analyze progression in prostate cancer. The differentiation of this study lies in the observation of the inhibition of

ARPC1B in prostate cancer cell lines and assess ARPC1B protein expression in prostate cancer tissue sample and its relation to disease progression. The success of the results pointed towards a plausible prognostic role in the progression of prostate cancer. Since there is a definite need to develop and validate efficient prognostic tools to predict PCa progression and metastasis. This study provides a supportive role in the search of prognostic tools. To support our study demonstrating the level of EMT markers such as E-cadherin, N-cadherin and vimentin in PC3 cell line would provide additional information on the role of ARPC1B as an oncogene in prostate cancer, since metastasis is one of the main hallmarks of cancer.

Further testing can be done in order to support the role of ARPC1B. Perhaps the study of

ARPC1A subunit in accordance with the study of ARPC1B can provide a more inclusive result.

The silencing of both genes may present a more efficient results in search of a prognostic tool.

Additional investigation of the prognostic role of ARPC1B may show additional information regarding its clinical utility in the future.

References: -

1. Kumar, V., P.J.I.u. Majumder, and nephrology, Prostate gland: structure, functions and regulation. 1995. 27(3): p. 231-243. 2. McNeal, J.E., The zonal anatomy of the prostate. The prostate, 1981. 2(1): p. 35-49. 3. Lee, C.H., et al., Overview of prostate anatomy, histology, and pathology. 2011. 40(3): p. 565- 575. 4. dos Santos Graça, M.I.P., Impact of epigenetic modulators on the malignant phenotype of prostate cancer cells. 2014. 5. McNeal, J.E., Normal histology of the prostate. The American journal of surgical pathology, 1988. 12(8): p. 619-633. 6. Khan, H., Determinants of prostate cancer: the Birmingham Prostatic Neoplasms Association study. 2011, university of Birmingham. 7. Oyasu, R., X.J. Yang, and O. Yoshida, What are the neuroendocrine cells in prostate cancer? From where are these cells derived? What is the clinical implication of neuroendocrine differentiation in prostate cancer? Questions in Daily Urologic Practice: Updates for Urologists and Diagnostic Pathologists, 2008: p. 39-48. 8. society, A.c. The prostate. Available from: https://www.cancer.org/cancer/prostate-cancer/if- you-have-prostate-cancer.html. 9. Roehrborn, C.G., Benign prostatic hyperplasia: an overview. Reviews in urology, 2005. 7(Suppl 9): p. S3. 10. Grossfeld, G.D. and F.V. Coakley, Benign prostatic hyperplasia: clinical overview and value of diagnostic imaging. Radiologic Clinics of North America, 2000. 38(1): p. 31-47. 11. Ayala, A.G. and J.Y. Ro, Prostatic intraepithelial neoplasia: recent advances. Archives of pathology & laboratory medicine, 2007. 131(8): p. 1257-1266. 12. Lipski, B., R. Garcia, and M. Brawer. Prostatic intraepithelial neoplasia: significance and management. in Seminars in urologic oncology. 1996. 13. Bostwick, D.G. and M.K. Brawer, Prostatic intra‐epithelial neoplasia and early invasion in prostate cancer. Cancer, 1987. 59(4): p. 788-794. 14. Epstein, J.I., et al., Interobserver reproducibility in the diagnosis of prostatic intraepithelial neoplasia. The American journal of surgical pathology, 1995. 19(8): p. 873-886. 15. Kramer, B.S., et al., Prostate cancer screening: what we know and what we need to know. Annals of Internal Medicine, 1993. 119(9): p. 914-923. 16. Laurila, E., et al., Characterization of the 7q21‐q22 amplicon identifies ARPC1A, a subunit of the Arp2/3 complex, as a regulator of cell migration and invasion in pancreatic cancer. Genes, Chromosomes and Cancer, 2009. 48(4): p. 330-339. 17. Hu, R., et al., Ligand-independent androgen receptor variants derived from splicing of cryptic exons signify hormone-refractory prostate cancer. Cancer research, 2009. 69(1): p. 16-22. 18. Hughes, C., et al., Molecular pathology of prostate cancer. Journal of clinical pathology, 2005. 58(7): p. 673-684. 19. Kinzler, K.W. and B. Vogelstein, Lessons from hereditary colorectal cancer. Cell, 1996. 87(2): p. 159-170. 20. Humphrey, P.A., Prostate pathology. 2003: American Society for Clinical Pathology Chicago. 56

21. Fradet, Y., et al., The burden of prostate cancer in Canada. Canadian Urological Association Journal, 2009. 3(3 Suppl 2): p. S92. 22. Lojanapiwat, B., et al., Correlation and diagnostic performance of the prostate-specific antigen level with the diagnosis, aggressiveness, and bone metastasis of prostate cancer in clinical practice. Prostate international, 2014. 2(3): p. 133-139. 23. Siegel, R., D. Naishadham, and A. Jemal, Cancer statistics, 2013. CA: a cancer journal for clinicians, 2013. 63(1): p. 11-30. 24. Andkhoie, M., D. Meyer, and M. Szafron, Factors underlying treatment decision-making for localized prostate cancer in the US and Canada: A scoping review using principal component analysis. Canadian Urological Association Journal, 2018. 13(7). 25. Siegel, R.L., K.D. Miller, and A. Jemal, Cancer statistics, 2016. CA: a cancer journal for clinicians, 2016. 66(1): p. 7-30. 26. Coleman, M.P. and J. Esteve, Trends in cancer incidence, survival and mortality, in Imaging in Oncology, Second Edition. 2004, CRC Press. p. 43-65. 27. Boström, P.J., et al., Genomic predictors of outcome in prostate cancer. European urology, 2015. 68(6): p. 1033-1044. 28. Acker-man, L.V., J.A. Del Regato, and T.L. Stokes, Cancer diagnosis, treatment and prognosis. 1955, LWW. 29. Prakash, K., et al., Symptomatic and asymptomatic benign prostatic hyperplasia: molecular differentiation by using microarrays. Proceedings of the National Academy of Sciences, 2002. 99(11): p. 7598-7603. 30. Carlson, L.E., et al., Mindfulness-based stress reduction in relation to quality of life, mood, symptoms of stress and levels of cortisol, dehydroepiandrosterone sulfate (DHEAS) and melatonin in breast and prostate cancer outpatients. Psychoneuroendocrinology, 2004. 29(4): p. 448-474. 31. Saramäki, O.R., et al., TMPRSS2: ERG fusion identifies a subgroup of prostate cancers with a favorable prognosis. Clinical cancer research, 2008. 14(11): p. 3395-3400. 32. Foxman, B., Epidemiology of urinary tract infections: incidence, morbidity, and economic costs. Disease-a-month, 2003. 49(2): p. 53-70. 33. Bostwick, D.G., et al., Human prostate cancer risk factors. Cancer: Interdisciplinary International Journal of the American Cancer Society, 2004. 101(S10): p. 2371-2490. 34. Pienta, K.J. and P.S. Esper, Risk factors for prostate cancer. Annals of internal medicine, 1993. 118(10): p. 793-803. 35. Henderson, B.E., et al., Endogenous hormones as a major factor in human cancer. Cancer research, 1982. 42(8): p. 3232-3239. 36. Bianchini, F., R. Kaaks, and H. Vainio, Overweight, obesity, and cancer risk. The lancet oncology, 2002. 3(9): p. 565-574. 37. Glass, A.S., K.C. Cary, and M.R. Cooperberg, Risk-based prostate cancer screening: who and how? Current urology reports, 2013. 14(3): p. 192-198. 38. Prins, G.S., Endocrine disruptors and prostate cancer risk. Endocrine-related cancer, 2008. 15(3): p. 649. 39. Diamanti-Kandarakis, E., et al., Endocrine-disrupting chemicals: an Endocrine Society scientific statement. Endocrine reviews, 2009. 30(4): p. 293-342. 40. Partin, A.W., et al., Combination of prostate-specific antigen, clinical stage, and Gleason score to predict pathological stage of localized prostate cancer: a multi-institutional update. Jama, 1997. 277(18): p. 1445-1451.

41. Gleason, D.F., G.T. Mellinger, and V.A.C.U.R. Group, Prediction of prognosis for prostatic adenocarcinoma by combined histological grading and clinical staging. The Journal of urology, 2002. 167(2): p. 953-958. 42. Gleason, D.F., Histologic grading of prostate cancer: a perspective. Human pathology, 1992. 23(3): p. 273-279. 43. Humphrey, P.A., Histological variants of prostatic carcinoma and their significance. Histopathology, 2012. 60(1): p. 59-74. 44. Epstein, J.I., An update of the Gleason grading system. The Journal of urology, 2010. 183(2): p. 433-440. 45. Epstein, J.I., et al., The 2005 International Society of Urological Pathology (ISUP) consensus conference on Gleason grading of prostatic carcinoma. The American journal of surgical pathology, 2005. 29(9): p. 1228-1242. 46. Cheng, L., et al., The combined percentage of Gleason patterns 4 and 5 is the best predictor of cancer progression after radical prostatectomy. Journal of clinical oncology, 2005. 23(13): p. 2911-2917. 47. Council, P.C.E. Gleason Score. 2019 June 20]; Prostate Cancer Grading & Prognostic Scoring]. 48. Folkman, J. and R. Kalluri, Cancer without disease. Nature, 2004. 427(6977): p. 787. 49. Stamey, T.A., et al., Biological determinants of cancer progression in men with prostate cancer. Jama, 1999. 281(15): p. 1395-1400. 50. Shariat, S.F., et al., Tumor markers in prostate cancer I: blood-based markers. Acta oncologica, 2011. 50(sup1): p. 61-75. 51. Duplessis, C.A., et al., Rectal cultures before transrectal ultrasound-guided prostate biopsy reduce post-prostatic biopsy infection rates. Urology, 2012. 79(3): p. 556-563. 52. Terris, M.K., J.E. McNeal, and T.A. Stamey, Detection of clinically significant prostate cancer by transrectal ultrasound-guided systematic biopsies. The Journal of urology, 1992. 148(3 Part 1): p. 829-832. 53. Beheshti, M., et al., Detection of bone metastases in patients with prostate cancer by 18 F fluorocholine and 18 F fluoride PET–CT: a comparative study. European journal of nuclear medicine and molecular imaging, 2008. 35(10): p. 1766-1774. 54. Marks, S., Prostate and cancer: A family guide to diagnosis, treatment, and survival. 2009: Da Capo Lifelong Books. 55. Partin, A.W., et al., Analysis of percent free prostate-specific antigen (PSA) for prostate cancer detection: influence of total PSA, prostate volume, and age. Urology, 1996. 48(6): p. 55-61. 56. Catalona, W.J., D.S. Smith, and D.K. Ornstein, Prostate cancer detection in men with serum PSA concentrations of 2.6 to 4.0 ng/mL and benign prostate examination: enhancement of specificity with free PSA measurements. Jama, 1997. 277(18): p. 1452-1455. 57. Setlur, S.R., et al., Estrogen-dependent signaling in a molecularly distinct subclass of aggressive prostate cancer. Journal of the National Cancer Institute, 2008. 100(11): p. 815-825. 58. Scardino, P.T., R. Weaver, and A.H. M'Liss, Early detection of prostate cancer. Human pathology, 1992. 23(3): p. 211-222. 59. Dhanasekaran, S.M., et al., Delineation of prognostic biomarkers in prostate cancer. Nature, 2001. 412(6849): p. 822. 60. Oon, S.F., et al., Biomarker research in prostate cancer—towards utility, not futility. Nature Reviews Urology, 2011. 8(3): p. 131. 61. Adhyam, M. and A.K. Gupta, A review on the clinical utility of PSA in cancer prostate. Indian journal of surgical oncology, 2012. 3(2): p. 120-129.

62. Wulfkuhle, J.D., L.A. Liotta, and E.F. Petricoin, Early detection: proteomic applications for the early detection of cancer. Nature reviews cancer, 2003. 3(4): p. 267. 63. Epstein, J.I., Gleason score 2–4 adenocarcinoma of the prostate on needle biopsy: a diagnosis that should not be made. 2000, LWW. 64. Heidenreich, A., et al., EAU guidelines on prostate cancer. European urology, 2008. 53(1): p. 68- 80. 65. Schröder, F.H., et al., Prostate cancer detection at low prostate specific antigen. The Journal of urology, 2000. 163(3): p. 806-812. 66. Myers, M.P., et al., The lipid phosphatase activity of PTEN is critical for its tumor supressor function. Proceedings of the National Academy of Sciences, 1998. 95(23): p. 13513-13518. 67. Bartel, D.P., MicroRNAs: genomics, biogenesis, mechanism, and function. cell, 2004. 116(2): p. 281-297. 68. Amankwah, E.K., et al., miR-21, miR-221 and miR-222 expression and prostate cancer recurrence among obese and non-obese cases. Asian journal of andrology, 2013. 15(2): p. 226. 69. Rogers, C.G., et al., Prostate cancer detection on urinalysis for α methylacyl coenzyme a racemase protein. The Journal of urology, 2004. 172(4 Part 1): p. 1501-1503. 70. Zhou, M., et al., Alpha-methylacyl-CoA racemase: a novel tumor marker over-expressed in several human cancers and their precursor lesions. The American journal of surgical pathology, 2002. 26(7): p. 926-931. 71. Oikawa, T. and T. Yamada, Molecular biology of the Ets family of transcription factors. Gene, 2003. 303: p. 11-34. 72. Alečković, M. and Y. Kang, Regulation of cancer metastasis by cell-free miRNAs. Biochimica et Biophysica Acta (BBA)-Reviews on Cancer, 2015. 1855(1): p. 24-42. 73. Rauhala, H.E., et al., Silencing of the ARP2/3 complex disturbs pancreatic cancer cell migration. Anticancer research, 2013. 33(1): p. 45-52. 74. Parsons, J.T., A.R. Horwitz, and M.A. Schwartz, Cell adhesion: integrating cytoskeletal dynamics and cellular tension. Nature reviews Molecular cell biology, 2010. 11(9): p. 633. 75. Revenu, C., et al., The co-workers of actin filaments: from cell structures to signals. Nature reviews Molecular cell biology, 2004. 5(8): p. 635. 76. Vignjevic, D., et al., Formation of filopodia-like bundles in vitro from a dendritic network. The Journal of cell biology, 2003. 160(6): p. 951-962. 77. Mattila, P.K. and P. Lappalainen, Filopodia: molecular architecture and cellular functions. Nature reviews Molecular cell biology, 2008. 9(6): p. 446. 78. Bisi, S., et al., Membrane and actin dynamics interplay at lamellipodia leading edge. Current opinion in cell biology, 2013. 25(5): p. 565-573. 79. Chesarone, M.A. and B.L. Goode, Actin nucleation and elongation factors: mechanisms and interplay. Current opinion in cell biology, 2009. 21(1): p. 28-37. 80. Goley, E.D. and M.D. Welch, The ARP2/3 complex: an actin nucleator comes of age. Nature reviews Molecular cell biology, 2006. 7(10): p. 713. 81. Nicholson-Dykstra, S.M., Investigating the role of Arp2/3 complex and formins in assembly of cell surface protrusions. 2008: Dartmouth College. 82. Pollard, T.D. and C.C. Beltzner, Structure and function of the Arp2/3 complex. Current opinion in structural biology, 2002. 12(6): p. 768-774. 83. Kahr, W.H., et al., Loss of the Arp2/3 complex component ARPC1B causes platelet abnormalities and predisposes to inflammatory disease. Nature communications, 2017. 8: p. 14816.

84. Welch, M.D., et al., The human Arp2/3 complex is composed of evolutionarily conserved subunits and is localized to cellular regions of dynamic actin filament assembly. The Journal of cell biology, 1997. 138(2): p. 375-384. 85. Harries, P.A., A. Pan, and R.S. Quatrano, Actin-related protein2/3 complex component ARPC1 is required for proper cell morphogenesis and polarized cell growth in Physcomitrella patens. The Plant Cell, 2005. 17(8): p. 2327-2339. 86. Abella, J.V., et al., Isoform diversity in the Arp2/3 complex determines actin filament dynamics. Nature cell biology, 2016. 18(1): p. 76. 87. Hubert, T., J. Vandekerckhove, and J. Gettemans, Actin and Arp2/3 localize at the centrosome of interphase cells. Biochemical and biophysical research communications, 2011. 404(1): p. 153- 158. 88. Ridley, A., What initiates actin polymerization? Genome biology, 2000. 1(1): p. reviews102. 1. 89. Le Clainche, C. and M.-F. Carlier, Regulation of actin assembly associated with protrusion and adhesion in cell migration. Physiological reviews, 2008. 88(2): p. 489-513. 90. Millard, T.H., S.J. Sharp, and L.M. Machesky, Signalling to actin assembly via the WASP (Wiskott- Aldrich syndrome protein)-family proteins and the Arp2/3 complex. Biochemical Journal, 2004. 380(1): p. 1-17. 91. Freeman, S.A. and S. Grinstein, Phagocytosis: receptors, signal integration, and the cytoskeleton. Immunological reviews, 2014. 262(1): p. 193-215. 92. Bahassi, E.M., et al., Critical regulation of genes for tumor cell migration by AP-1. Clinical & experimental metastasis, 2004. 21(4): p. 293-304. 93. Skinner, M., Cell cycle: ARPC1B—a regulator of regulators. Nature Reviews Molecular Cell Biology, 2010. 11(8): p. 542. 94. Zheng, H.-C., et al., Arp2/3 overexpression contributed to pathogenesis, growth and invasion of gastric carcinoma. Anticancer research, 2008. 28(4B): p. 2225-2232. 95. Yasui, W., et al., Search for new biomarkers of gastric cancer through serial analysis of gene expression and its clinical implications. Cancer science, 2004. 95(5): p. 385-392. 96. SCIENSE, W.I.O. GENE CARDS ( ARPC1B GENE). 2019; Available from: https://www.genecards.org/cgi-bin/carddisp.pl?gene=ARPC1B. 97. Zuo, X., et al., Exo70 interacts with the Arp2/3 complex and regulates cell migration. Nature cell biology, 2006. 8(12): p. 1383. 98. Pizarro-Cerdá, J., et al., The diverse family of Arp2/3 complexes. Trends in cell biology, 2017. 27(2): p. 93-100. 99. sigmaaldrich, Anti-ARPC1B antibody produced in rabbit. 2019. 100. Bostwick, D.G., et al., Human prostate cancer risk factors. Cancer, 2004. 101(10 Suppl): p. 2371- 490. 101. Rodriguez, C., et al., Body mass index, weight change, and risk of prostate cancer in the Cancer Prevention Study II Nutrition Cohort. Cancer Epidemiology and Prevention Biomarkers, 2007. 16(1): p. 63-69. 102. DAVID B. SAMADI, M.D. About Prostate Cancer. [cited 2019 June 20]; Available from: https://www.roboticoncology.com/about-prostate-cancer/. 103. Whittemore, A.S., et al., Family history and prostate cancer risk in black, white, and Asian men in the United States and Canada. American journal of epidemiology, 1995. 141(8): p. 732-740. 104. Takahashi, S., et al., Potential markers of prostate cancer aggressiveness detected by fluorescence in situ hybridization in needle biopsies. Cancer research, 1994. 54(13): p. 3574- 3579.

105. Partin, A.W., et al., The use of prostate specific antigen, clinical stage and Gleason score to predict pathological stage in men with localized prostate cancer. The Journal of urology, 1993. 150(1): p. 110-114. 106. Epstein, J.I., et al., A contemporary prostate cancer grading system: a validated alternative to the Gleason score. European urology, 2016. 69(3): p. 428-435. 107. King, C.R. and J.P. Long, Prostate biopsy grading errors: a sampling problem? International journal of cancer, 2000. 90(6): p. 326-330. 108. Blute, M.L., et al., Use of Gleason score, prostate specific antigen, seminal vesicle and margin status to predict biochemical failure after radical prostatectomy. The Journal of urology, 2001. 165(1): p. 119-125. 109. Patel, A.A., et al., PSA failure following definitive treatment of prostate cancer having biopsy Gleason score 7 with tertiary grade 5. Jama, 2007. 298(13): p. 1533-1538. 110. Auzair, L.B.M., et al., Caveolin 1 (Cav-1) and actin-related protein 2/3 complex, subunit 1B (ARPC1B) expressions as prognostic indicators for oral squamous cell carcinoma (OSCC). European Archives of Oto-Rhino-Laryngology, 2016. 273(7): p. 1885-1893.