DOCSLIB.ORG

Long Noncoding Intronic Rnas Are Differentially Expressed in Primary

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Long Noncoding Intronic Rnas Are Differentially Expressed in Primary Tahira et al. Molecular Cancer 2011, 10:141 http://www.molecular-cancer.com/content/10/1/141 RESEARCH Open Access Long noncoding intronic RNAs are differentially expressed in primary and metastatic pancreatic cancer Ana C Tahira1, Márcia S Kubrusly2, Michele F Faria1, Bianca Dazzani1, Rogério S Fonseca1, Vinicius Maracaja-Coutinho1, Sergio Verjovski-Almeida1, Marcel CC Machado2 and Eduardo M Reis1* Abstract Background: Pancreatic ductal adenocarcinoma (PDAC) is known by its aggressiveness and lack of effective therapeutic options. Thus, improvement in current knowledge of molecular changes associated with pancreatic cancer is urgently needed to explore novel venues of diagnostics and treatment of this dismal disease. While there is mounting evidence that long noncoding RNAs (lncRNAs) transcribed from intronic and intergenic regions of the human genome may play different roles in the regulation of gene expression in normal and cancer cells, their expression pattern and biological relevance in pancreatic cancer is currently unknown. In the present work we investigated the relative abundance of a collection of lncRNAs in patients’ pancreatic tissue samples aiming at identifying gene expression profiles correlated to pancreatic cancer and metastasis. Methods: Custom 3,355-element spotted cDNA microarray interrogating protein-coding genes and putative lncRNA were used to obtain expression profiles from 38 clinical samples of tumor and non-tumor pancreatic tissues. Bioinformatics analyses were performed to characterize structure and conservation of lncRNAs expressed in pancreatic tissues, as well as to identify expression signatures correlated to tissue histology. Strand-specific reverse transcription followed by PCR and qRT-PCR were employed to determine strandedness of lncRNAs and to validate microarray results, respectively. Results: We show that subsets of intronic/intergenic lncRNAs are expressed across tumor and non-tumor pancreatic tissue samples. Enrichment of promoter-associated chromatin marks and over-representation of conserved DNA elements and stable secondary structure predictions suggest that these transcripts are generated from independent transcriptional units and that at least a fraction is under evolutionary selection, and thus potentially functional. Statistically significant expression signatures comprising protein-coding mRNAs and lncRNAs that correlate to PDAC or to pancreatic cancer metastasis were identified. Interestingly, loci harboring intronic lncRNAs differentially expressed in PDAC metastases were enriched in genes associated to the MAPK pathway. Orientation-specific RT- PCR documented that intronic transcripts are expressed in sense, antisense or both orientations relative to protein- coding mRNAs. Differential expression of a subset of intronic lncRNAs (PPP3CB, MAP3K14 and DAPK1 loci)in metastatic samples was confirmed by Real-Time PCR. Conclusion: Our findings reveal sets of intronic lncRNAs expressed in pancreatic tissues whose abundance is correlated to PDAC or metastasis, thus pointing to the potential relevance of this class of transcripts in biological processes related to malignant transformation and metastasis in pancreatic cancer. Keywords: pancreatic cancer, molecular markers, noncoding RNAs, intronic transcription, metastasis, MAPK , path- way, cDNA microarrays * Correspondence: [email protected] 1Departamento de Bioquímica, Instituto de Química, Universidade de São Paulo, 05508-900, São Paulo, SP, Brasil Full list of author information is available at the end of the article © 2011 Tahira et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Tahira et al. Molecular Cancer 2011, 10:141 Page 2 of 19 http://www.molecular-cancer.com/content/10/1/141 Background targets [14,16-19]. Increased expression of the lncRNA Pancreatic ductal adenocarcinoma (PDAC) is the most MALAT-1 has been observed in several types of tumors, common pancreatic neoplasm and accounts for > 85% including metastatic non-small cell lung cancer [19]. of pancreatic tumor cases [1]. PDAC is a devastating Recently, augmented levels of HOTAIR in primary disease with very poor prognosis for which the only breast tumors were shown to correlate with breast can- curative treatment is resection surgery [2]. However, cer invasiveness and metastasis [18]. Measurement of only 15-20% of patients have resectable pancreatic lncRNA PCA3 in patient urine samples has been shown tumor, and from these only 20% presents a 5-year survi- to allow more sensitive and specific diagnosis of prostate val, which results in an average 5-year survival rate of 3- cancer than the widely used marker prostate-specific 5% [1]. PDAC aggressiveness is mainly associated to the antigen (PSA) [16]. The lncRNA HULC is highly lack of early diagnosis tools and the limited response to expressed in hepatocarcinoma patients and detected in available treatments [2]. the blood by conventional PCR methods [20]. Large-scale gene expression studies of tumor samples There are several reports of aberrant expression of have been extensively employed to delineate the mole- microRNAs in PDAC [21,22], and there is potential in cular pathways and cellular processes involved in tumor- their use as biomarkers for disease diagnosis [23,24]. igenesis and progression of PDAC [3] and to search for However, there is a paucity of information regarding the novel biomarkers for diagnosis and molecular targets for expression of lncRNAs in pancreatic cancer. In an inter- therapeutic intervention in pancreatic cancer [4]. In esting study performed by Ting et al. it was observed spite of the wealth of information generated in recent the aberrant overexpression of satellite repeat RNAs years on the most frequent molecular alterations found (HSATII) ranging from 100 to 5000 nt in patients with in PDAC [5], there are still important open question in PDAC [25]. Interestingly, detection of HSATII by RNA pancreatic cancer biology such as the profound resis- in situ hybridization was able to correctly diagnose tance of primary and metastatic PDAC to chemo- and PDAC in tumor biopsies, including cases in which the radiotherapy [6]. Regarding the identification of molecu- histopathology was non-diagnostic [25]. lar markers for pancreatic cancer diagnostic/prognostic, Our group has previously shown that most (at least while some promising candidate genes have been pro- 74%) annotated protein-coding gene loci generate intra- posed [4], none have been proven effective to signifi- genic lncRNAs that map to intronic regions [26]. Possi- cantly improve early detection and to reduce mortality/ ble relevance of intronic lncRNAs to neoplastic morbidity of the disease. Thus, a better understanding processes was proposed following the observation that of the molecular basis of pancreatic cancer is required subsets of these transcripts are present in gene expres- for the identification of more effective diagnostic mar- sion signatures correlated to the degree of malignancy kers and therapeutic targets. in prostate cancer [17] or to tissue histology in head Over the last decade, advances in genome-wide ana- and neck tumors [27] and renal cell carcinoma [28]. In lyses of the eukaryotic transcriptome have revealed addition, a number of intronic lncRNAs were found to that the majority of the human genome is transcribed, be regulated by androgen stimulation of cultured pros- producing large numbers of long (> 200 nt) noncoding tate cancer cells [29], indicating that these transcripts RNAs (lncRNAs) mapping to intronic and intergenic are expressed in a regulated manner and thus, corrobor- regions [7-10]. These include subsets of polyadenylated ating the idea that intronic lncRNAs are biologically and non-adenylated transcripts that accumulate differ- relevant. ently in the nucleus and cytoplasm of cells [10,11]. In this study, we used a custom cDNA microarray While only a small fraction of lncRNAs have been platform with probes for lncRNAs expressed from intro- characterized in detail, it is clear that these transcripts nic and intergenic regions of the human genome, as may act through diverse molecular mechanisms and well as for a selected set of cancer-related protein-cod- play regulatory and structural roles in important biolo- ing genes to generate expression profiles from a collec- gical processes, such as in genomic imprinting, chro- tion of tumor and non-tumor pancreatic tissue samples. mosome inactivation, cell differentiation and Expression of intronic/intergenic lncRNAs subsets was development, cell proliferation, protein nuclear import, detected across all samples tested. Enrichment of pro- organization of nuclear domains and apoptosis (see moter-associated chromatin marks indicate that these [12] for a review). transcripts originate from independent transcriptional Altered expression of lncRNAs has been documented units. Over-representation of conserved DNA elements in different types of human cancer [13-15] prompting and stable secondary structure predictions suggest that an increasing interest in their use as biomarkers for at least a fraction of these transcripts are under evolu- diagnosis and prognosis as well as potential therapeutic tionary selection and thus potentially functional. Tahira et al. Molecular Cancer 2011, 10:141 Page 3 of 19 http://www.molecular-cancer.com/content/10/1/141
Load more

Recommended publications
  • Systematic Data-Querying of Large Pediatric Biorepository Identifies Novel Ehlers-Danlos Syndrome Variant Akshatha Desai1, John J
    Desai et al. BMC Musculoskeletal Disorders (2016) 17:80 DOI 10.1186/s12891-016-0936-8 RESEARCH ARTICLE Open Access Systematic data-querying of large pediatric biorepository identifies novel Ehlers-Danlos Syndrome variant Akshatha Desai1, John J. Connolly1, Michael March1, Cuiping Hou1, Rosetta Chiavacci1, Cecilia Kim1, Gholson Lyon1, Dexter Hadley1 and Hakon Hakonarson1,2* Abstract Background: Ehlers Danlos Syndrome is a rare form of inherited connective tissue disorder, which primarily affects skin, joints, muscle, and blood cells. The current study aimed at finding the mutation that causing EDS type VII C also known as “Dermatosparaxis” in this family. Methods: Through systematic data querying of the electronic medical records (EMRs) of over 80,000 individuals, we recently identified an EDS family that indicate an autosomal dominant inheritance. The family was consented for genomic analysis of their de-identified data. After a negative screen for known mutations, we performed whole genome sequencing on the male proband, his affected father, and unaffected mother. We filtered the list of non- synonymous variants that are common between the affected individuals. Results: The analysis of non-synonymous variants lead to identifying a novel mutation in the ADAMTSL2 (p. Gly421Ser) gene in the affected individuals. Sanger sequencing confirmed the mutation. Conclusion: Our work is significant not only because it sheds new light on the pathophysiology of EDS for the affected family and the field at large, but also because it demonstrates the utility of unbiased large-scale clinical recruitment in deciphering the genetic etiology of rare mendelian diseases. With unbiased large-scale clinical recruitment we strive to sequence as many rare mendelian diseases as possible, and this work in EDS serves as a successful proof of concept to that effect.
    [Show full text]
  • Cytoskeletal Remodeling in Cancer
    biology Review Cytoskeletal Remodeling in Cancer Jaya Aseervatham Department of Ophthalmology, University of Texas Health Science Center at Houston, Houston, TX 77054, USA; [email protected]; Tel.: +146-9767-0166 Received: 15 October 2020; Accepted: 4 November 2020; Published: 7 November 2020 Simple Summary: Cell migration is an essential process from embryogenesis to cell death. This is tightly regulated by numerous proteins that help in proper functioning of the cell. In diseases like cancer, this process is deregulated and helps in the dissemination of tumor cells from the primary site to secondary sites initiating the process of metastasis. For metastasis to be efficient, cytoskeletal components like actin, myosin, and intermediate filaments and their associated proteins should co-ordinate in an orderly fashion leading to the formation of many cellular protrusions-like lamellipodia and filopodia and invadopodia. Knowledge of this process is the key to control metastasis of cancer cells that leads to death in 90% of the patients. The focus of this review is giving an overall understanding of these process, concentrating on the changes in protein association and regulation and how the tumor cells use it to their advantage. Since the expression of cytoskeletal proteins can be directly related to the degree of malignancy, knowledge about these proteins will provide powerful tools to improve both cancer prognosis and treatment. Abstract: Successful metastasis depends on cell invasion, migration, host immune escape, extravasation, and angiogenesis. The process of cell invasion and migration relies on the dynamic changes taking place in the cytoskeletal components; actin, tubulin and intermediate filaments. This is possible due to the plasticity of the cytoskeleton and coordinated action of all the three, is crucial for the process of metastasis from the primary site.
    [Show full text]
  • Loss of the Arp2/3 Complex Component ARPC1B Causes Platelet Abnormalities and Predisposes to Inflammatory Disease
    ARTICLE Received 9 Nov 2016 | Accepted 31 Jan 2017 | Published 3 Apr 2017 DOI: 10.1038/ncomms14816 OPEN Loss of the Arp2/3 complex component ARPC1B causes platelet abnormalities and predisposes to inflammatory disease Walter H.A. Kahr1,2,3, Fred G. Pluthero1, Abdul Elkadri1,4,5, Neil Warner1,4, Marko Drobac1,3, Chang Hua Chen1,3, Richard W. Lo1,3, Ling Li1, Ren Li1,QiLi1,4, Cornelia Thoeni1,4, Jie Pan1,4, Gabriella Leung1,4, Irene Lara-Corrales6, Ryan Murchie1,4, Ernest Cutz7, Ronald M. Laxer8,9, Julia Upton10, Chaim M. Roifman10, Rae S.M. Yeung1,5,8,11, John H. Brumell1,4,5,12 & Aleixo M. Muise1,3,4,5 Human actin-related protein 2/3 complex (Arp2/3), required for actin filament branching, has two ARPC1 component isoforms, with ARPC1B prominently expressed in blood cells. Here we show in a child with microthrombocytopenia, eosinophilia and inflammatory disease, a homozygous frameshift mutation in ARPC1B (p.Val91Trpfs*30). Platelet lysates reveal no ARPC1B protein and greatly reduced Arp2/3 complex. Missense ARPC1B mutations are identified in an unrelated patient with similar symptoms and ARPC1B deficiency. ARPC1B- deficient platelets are microthrombocytes similar to those seen in Wiskott–Aldrich syndrome that show aberrant spreading consistent with loss of Arp2/3 function. Knockout of ARPC1B in megakaryocytic cells results in decreased proplatelet formation, and as observed in platelets from patients, increased ARPC1A expression. Thus loss of ARPC1B produces a unique set of platelet abnormalities, and is associated with haematopoietic/immune symptoms affecting cell lineages where this isoform predominates. In agreement with recent experimental studies, our findings suggest that ARPC1 isoforms are not functionally interchangeable.
    [Show full text]
  • 4036.Full.Pdf
    The Journal of Immunology Disruption of Thrombocyte and T Lymphocyte Development by a Mutation in ARPC1B Raz Somech,*,† Atar Lev,*,† Yu Nee Lee,*,† Amos J. Simon,*,†,‡ Ortal Barel,†,x Ginette Schiby,{ Camila Avivi,{ Iris Barshack,{ Michele Rhodes,‖ Jiejing Yin,‖ Minshi Wang,‖ Yibin Yang,‖ Jennifer Rhodes,‖ Nufar Marcus,# Ben-Zion Garty,# Jerry Stein,** Ninette Amariglio,†,‡,x,†† Gideon Rechavi,†,x David L. Wiest,‖,1 and Yong Zhang‖,1 Regulation of the actin cytoskeleton is crucial for normal development and function of the immune system, as evidenced by the severe immune abnormalities exhibited by patients bearing inactivating mutations in the Wiskott–Aldrich syndrome protein (WASP), a key regulator of actin dynamics. WASP exerts its effects on actin dynamics through a multisubunit complex termed Arp2/3. Despite the critical role played by Arp2/3 as an effector of WASP-mediated control over actin polymerization, mutations in protein components of the Arp2/3 complex had not previously been identified as a cause of immunodeficiency. Here, we describe two brothers with hematopoietic and immunologic symptoms reminiscent of Wiskott–Aldrich syndrome (WAS). However, these patients lacked mutations in any of the genes previously associated with WAS. Whole-exome sequencing revealed a homozygous 2 bp deletion, n.c.G623DEL-TC (p.V208VfsX20), in Arp2/3 complex component ARPC1B that causes a frame shift resulting in premature termination. Modeling of the disease in zebrafish revealed that ARPC1B plays a critical role in supporting T cell and thrombocyte development. Moreover, the defects in development caused by ARPC1B loss could be rescued by the intact human ARPC1B ortholog, but not by the p.V208VfsX20 variant identified in the patients.
    [Show full text]
  • Variation in Protein Coding Genes Identifies Information Flow
    bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number.
    [Show full text]
  • Whole-Exome Sequencing, Proteome Landscape, and Immune Cell Migration Patterns in a Clinical Context of Menkes Disease
    G C A T T A C G G C A T genes Article Whole-Exome Sequencing, Proteome Landscape, and Immune Cell Migration Patterns in a Clinical Context of Menkes Disease Margarita L. Martinez-Fierro 1,* , Griselda A. Cabral-Pacheco 1, Idalia Garza-Veloz 1 , Jesus Acuña-Quiñones 1, Laura E. Martinez-de-Villarreal 2 , Marisol Ibarra-Ramirez 2 , Joke Beuten 3, Samantha E. Sanchez-Guerrero 4, Laura Villarreal-Martinez 5, Ivan Delgado-Enciso 6 , Iram P. Rodriguez-Sanchez 7, Vania Z. Zuñiga-Ramirez 1, Edith Cardenas-Vargas 4 and Viktor Romero-Diaz 8 1 Molecular Medicine Laboratory, Unidad Académica de Medicina Humana y C.S, Universidad Autónoma de Zacatecas, Carretera Zacatecas-Guadalajara Km.6, Ejido la Escondida, Zacatecas 98160, Mexico; [email protected] (G.A.C.-P.); [email protected] (I.G.-V.); [email protected] (J.A.-Q.); [email protected] (V.Z.Z.-R.) 2 Departamento de Genética, Facultad de Medicina, Universidad Autónoma de Nuevo León, Monterrey 64460, Mexico; [email protected] (L.E.M.-d.-V.); [email protected] (M.I.-R.) 3 AiLife Diagnostics, 1920 Country Pl Pkwy Suite 100, Pearland, TX 77584, USA; [email protected] 4 Hospital General Zacatecas “Luz González Cosío”, Servicios de Salud de Zacatecas, Zacatecas 98160, Mexico; [email protected] (S.E.S.-G.); [email protected] (E.C.-V.) 5 Hematology Service, Hospital Universitario “Dr. José Eleuterio González”, Universidad Autónoma de Nuevo Citation: Martinez-Fierro, M.L.; León, Monterrey 64460, Mexico; [email protected] Cabral-Pacheco, G.A.;
    [Show full text]
  • ARPC1B Gene: As a Potential Novel Prostate Cancer Driver
    University of Calgary PRISM: University of Calgary's Digital Repository Graduate Studies The Vault: Electronic Theses and Dissertations 2019-12 ARPC1B Gene: As a Potential Novel Prostate Cancer Driver Zaaluk, Hend Hend, Z. (2019). ARPC1B Gene: As a Potential Novel Prostate Cancer Driver (Unpublished master's thesis). University of Calgary, Calgary, AB. http://hdl.handle.net/1880/111382 master thesis University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY ARPC1B Gene: As a Potential Novel Prostate Cancer Driver by Hend Zaaluk A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE GRADUATE PROGRAM IN BIOCHEMISTRY AND MOLECULAR BIOLOGY CALGARY, ALBERTA DECEMBER, 2019 © Hend Zaaluk 2019 Abstract Prostate cancer is the most common malignancy in men and the second leading cause of cancer- related deaths in western countries. Currently, there is a lack of specific molecular markers that can predict cancer progression and prognosis. Characterization of prostate cancer driver genes is essential for investigating the cellular changes that influence the progression of cancer. This will provide a better understanding to prostate cancer carcinogenesis, elucidate novel biomarkers, and improve clinical outcomes. Previously our lab performed a bioinformatics screen using several public cohorts and identified a panel of genes that are deregulated on the mRNA and DNA levels.
    [Show full text]
  • Meta-Analysis of Molecular Response of Kidney to Ischemia Reperfusion
    Grigoryev et al. BMC Nephrology 2013, 14:231 http://www.biomedcentral.com/1471-2369/14/231 TECHNICAL ADVANCE Open Access Meta-analysis of molecular response of kidney to ischemia reperfusion injury for the identification of new candidate genes Dmitry N Grigoryev1,2,3*, Dilyara I Cheranova1, Daniel P Heruth1, Peixin Huang1, Li Q Zhang1, Hamid Rabb4 and Shui Q Ye1,2,3 Abstract Background: Accumulated to-date microarray data on ischemia reperfusion injury (IRI) of kidney represent a powerful source for identifying new targets and mechanisms of kidney IRI. In this study, we conducted a meta-analysis of gene expression profiles of kidney IRI in human, pig, rat, and mouse models, using a new scoring method to correct for the bias of overrepresented species. The gene expression profiles were obtained from the public repositories for 24 different models. After filtering against inclusion criteria 21 experimental settings were selected for meta-analysis and were represented by 11 rat models, 6 mouse models, and 2 models each for pig and human, with a total of 150 samples. Meta-analysis was conducted using expression-based genome-wide association study (eGWAS). The eGWAS results were corrected for a rodent species bias using a new weighted scoring algorithm, which favors genes with unidirectional change in expression in all tested species. Results: Our meta-analysis corrected for a species bias, identified 46 upregulated and 1 downregulated genes, of which 26 (55%) were known to be associated with kidney IRI or kidney transplantation, including LCN2, CCL2, CXCL1, HMOX1, ICAM1, ANXA1, and TIMP1, which justified our approach. Pathway analysis of our candidates identified “Acute renal failure panel” as the most implicated pathway, which further validates our new method.
    [Show full text]
  • ARPC1B (NM 005720) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC201103 ARPC1B (NM_005720) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ARPC1B (NM_005720) Human Tagged ORF Clone Tag: Myc-DDK Symbol: ARPC1B Synonyms: ARC41; IMD71; p40-ARC; p41-ARC; PLTEID Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC201103 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCTACCACAGCTTCCTGGTGGAGCCCATCAGCTGCCACGCCTGGAACAAGGACCGCACCCAGATTG CCATCTGCCCCAACAACCATGAGGTGCATATCTATGAAAAGAGCGGTGCCAAATGGACCAAGGTGCACGA GCTCAAGGAGCACAACGGGCAGGTGACAGGCATCGACTGGGCCCCCGAGAGTAACCGTATTGTGACCTGC GGCACAGACCGCAACGCCTACGTGTGGACGCTGAAGGGCCGCACATGGAAGCCCACGCTGGTCATCCTGC GGATCAACCGGGCTGCCCGCTGCGTGCGCTGGGCCCCCAACGAGAACAAGTTTGCTGTGGGCAGCGGCTC TCGTGTGATCTCCATCTGTTATTTCGAGCAGGAGAATGACTGGTGGGTTTGCAAGCACATCAAGAAGCCC ATCCGCTCCACCGTCCTCAGCCTGGACTGGCACCCCAACAATGTGCTGCTGGCTGCCGGCTCCTGTGACT TCAAGTGTCGGATCTTTTCAGCCTACATCAAGGAGGTGGAGGAACGGCCGGCACCCACCCCGTGGGGCTC CAAGATGCCCTTTGGGGAACTGATGTTCGAATCCAGCAGTAGCTGCGGCTGGGTACATGGCGTCTGTTTC TCAGCCAGCGGGAGCCGCGTGGCCTGGGTAAGCCACGACAGCACCGTCTGCCTGGCTGATGCCGACAAGA AGATGGCCGTCGCGACTCTGGCCTCTGAAACACTACCACTGCTGGCGCTGACCTTCATCACAGACAACAG CCTGGTGGCAGCGGGCCACGACTGCTTCCCGGTGCTGTTCACCTATGACGCCGCCGCGGGGATGCTGAGC TTCGGCGGGCGGCTGGACGTTCCTAAGCAGAGCTCGCAGCGTGGCTTGACGGCCCGCGAGCGCTTCCAGA
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Dynamic Patterns of Histone Methylation Are Associated With
    Molecular Pharmacology Fast Forward. Published on February 2, 2009 as doi:10.1124/mol.108.052993 MOL #52993 Dynamic Patterns of Histone Methylation are Associated with Ontogenic Expression of the Cyp3a Genes during Mouse Liver Maturation Ye Li, Yue Cui, Steven N. Hart, Curtis D. Klaassen, and Xiao-bo Zhong Department of Pharmacology, Toxicology, and Therapeutics, The University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, Kansas 66160, USA. 1 Copyright 2009 by the American Society for Pharmacology and Experimental Therapeutics. MOL #52993 Running title: Epigenetic control of Cyp3a expression in liver maturation Corresponding author: Dr. Xiao-bo Zhong, Department of Pharmacology, Toxicology, and Therapeutics, The University of Kansas Medical Center, 3901 Rainbow Boulevard, Kansas City, Kansas 66160, USA. Telephone: 913-588-0401; Fax: 913-588-7501; E- mail: [email protected]. Number of text pages: 28 Number of tables: 1 Number of figures: 5 Number of references: 40 Number of words in Abstract: 243 Number of words in Introduction: 736 Number of words in Discussion: 1316 Abbreviations: CYP3A4: human cytochrome P450, family 3, subfamily A, polypeptide 4 gene; CYP3A7: human cytochrome P450, family 3, subfamily A, polypeptide 7 gene; Cyp3a11: mouse cytochrome P450, family 3, subfamily a, polypeptide 11 gene; Cyp3a16: mouse cytochrome P450, family 3, subfamily a, polypeptide 16 gene; DNAme: DNA methylation; H3K4me2: histone 3 lysine 4 dimethylation; H3K27me3: histone 3 lysine 27 trimethylation. 2 MOL #52993 Abstract Human cytochrome P450 3A members (CYP3As) are major drug-metabolizing enzymes in livers. Two genes, CYP3A4 and CYP3A7, exhibit a developmental switch in gene expression during liver maturation.
    [Show full text]
  • Foxk1 Splice Variants Show Developmental Stage-Specific Plasticity of Expression with Temperature in the Tiger Pufferfish Jorge M
    3461 The Journal of Experimental Biology 210, 3461-3472 Published by The Company of Biologists 2007 doi:10.1242/jeb.009183 FoxK1 splice variants show developmental stage-specific plasticity of expression with temperature in the tiger pufferfish Jorge M. O. Fernandes1,2, Matthew G. MacKenzie1,3, James R. Kinghorn1 and Ian A. Johnston1,* 1School of Biology, University of St Andrews, St Andrews, Fife KY16 8LB, UK, 2Department of Fisheries and Natural Sciences, Bodø University College, No-8049 Bodø, Norway and 3School of Life Sciences Research, University of Dundee, Dundee DD1 5EH, UK *Author for correspondence (e-mail: [email protected]) Accepted 24 July 2007 Summary FoxK1 is a member of the highly conserved variants were differentially expressed between fast and forkhead/winged helix (Fox) family of transcription factors slow myotomal muscle, as well as other tissues, and the and it is known to play a key role in mammalian muscle FoxK1-␣ protein was expressed in myogenic progenitor development and myogenic stem cell function. The tiger cells of fast myotomal muscle. During embryonic pufferfish (Takifugu rubripes) orthologue of mammalian development, TFoxK1 was transiently expressed in the FoxK1 (TFoxK1) has seven exons and is located in a region developing somites, heart, brain and eye. The relative of conserved synteny between pufferfish and mouse. expression of TFoxK1-␣ and the other two alternative TFoxK1 is expressed as three alternative transcripts: transcripts varied with the incubation temperature regime TFoxK1-␣, TFoxK1-␥ and TFoxK1-␦. TFoxK1-␣ is the for equivalent embryonic stages and the differences were orthologue of mouse FoxK1-␣, coding for a putative protein particularly marked at later developmental stages.
    [Show full text]