DOCSLIB.ORG

An Efficient Cloning Strategy for Viral , Double-Stranded Rnas with Unknown Sequences*

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
An Efficient Cloning Strategy for Viral , Double-Stranded Rnas with Unknown Sequences* 日 植 病 報 64: 244-248 (1998) Ann. Phytopathol. Soc. Jpn. 64: 244-248 (1998) An Efficient Cloning Strategy for Viral , Double-stranded RNAs with Unknown Sequences* Masamichi ISOGAI**,Ichiro UYEDA**and Tatsuji HATAYA** Abstract A strategy was designed to efficiently clone double-stranded RNAs (dsRNAs) of unknown sequences and very low availability. From rice plants infected with rice black streaked dwarf fijivirus (RBSDV), ten dsRNA genomic segments were extracted directly. The 3•Œ ends of the plus and minus strands of the dsRNAs were polyadenylated and then used as templates for an initial reverse transcription using an oligo-dT-containing adapter primer (AP). The first-strand cDNAs of both polarities were annealed, filled in and amplified by the polymerase chain reaction using one primer containing an adapter region sequence identical to that in the AP. The amplified cDNA products corresponded in size to the full lengths of RBSDV S5, S6, S7, S8, S9 and S10; full length cDNA clones to RBSDV S8, S9 and S10 containing both terminal nucleotide sequences were obtained. Moreover, the nucleotide sequences of six full length cDNA clones were the same as those previously reported. These data indicate that this method may be applicable to full length cDNA cloning of dsRNAs. (Received January 6, 1998; Accepted March 2, 1998) Key words: cDNA cloning, rice black streaked dwarf virus, double-stranded RNA. In this paper, rice black streaked dwarf fijivirus INTRODUCTION (RBSDV), a ten-segmented dsRNA virus, was used to develope an efficient method for obtaining full length Cashdollar et al.1) first reported a method for cloning cDNAs to dsRNAs with unknown sequences by combin- double-stranded RNA (dsRNA) genomes of reoviruses. ing PCR with the methods of Cashdollar et al.1). The strategy made full use of the double-stranded nature of the genome. The full length ds cDNA mole- MATERIALS AND METHODS cules were synthesized by the addition of oligo (C) to the RNA template, reverse-transcribing them with oligo Source of virus and direct extraction of genomic (dG) primer, hybridizing the cognate plus and minus dsRNAs from infected rice plants The isolate of cDNA strands, and filling the ends with DNA polymer- RBSDV used in this study had been maintained in rice ase I. This method was later modified by first plants for more than twenty years3). polyadenylating the 3•Œ ends of the RNA instead of The dsRNA genomes of RBSDV were extracted adding oligo (C) and is widely used for cloning viral directly by the method in Murao et al.7). In brief, total genomes in the Reoviridae. Because the method requires nucleic acids were extracted from about 0.5g of white 10-50ƒÊg of template RNAs for the first-strand cDNA tumorous stalks of infected rice plants with phenol- synthesis, it is not applicable when only a small amount chloroform and then ethanol precipitated. The ssRNA of the genomic RNAs is available. After commercial was precipitated with 2M LiCl and bound with CC41 kits for gene cloning of single-stranded RNA (ssRNA) cellulose powder (Whatman, UK) to further purify the became available, they have been widely used to synthe- dsRNA. About 2ƒÊg of RBSDV dsRNA genome was size first-strand cDNAs to dsRNAs after denaturation. obtained. In addition, due to the accumulation of nucleotide Preparation of cDNA The 3•Œ termini of both sequence data, polymerase chain reaction (PCR) tech- strands of the dsRNA were first polyadenylated. To 2ƒÊg niques can now be used to make ds cDNAs from a very of total RBSDV genome in 30ƒÊl of H2O, 20ƒÊl of dimeth- small quantity of the template. However, when the yl sulf oxide was added, and the mixture was incubated nucleotide sequence is unknown and only a very small at 95•Ž for 5min to melt the dsRNAs. The denatured quantity of the dsRNA genome is available, full length dsRNA was precipitated with 3vol of ethanol and 1/10 cDNAs are still difficult to clone. vol of 3M sodium acetate, pH 5.2. The precipitate was * This work was supported in part by Research Fellowships of the Japan Society for the Promotion of Science for Young Scientists. ** Faculty of Agriculture , Hokkaido University, Kita 9, Nishi 9, Kita-ku, SapPoro 060-8589, Japan 北 海 道 大 学 農 学 部 Ann. Phytopathol. Soc. Jpn. 64 (4). August, 1998 245 suspended in 51ƒÊl of H2O; and 40ƒÊl of polyadenylation Sequencing The cloned cDNA was sequenced by reaction mixture (125mM Tris-HCI, pH 7.9, 500mM the dideoxynucleotide chain terminator method9) using a NaCl, 25mM MgCl2, 5mM MnCl2, 2.5mM dithio- Thermo Sequenase fluorescent labeled primer cycle threitol), 2ƒÊl of 100mM ATP and 2ƒÊl of poly (A) sequencing kit with 7-deaza-dGTP for Li-Cor sequencer polymerase (1.2U/ƒÊl) were added. After incubation at (Amersham). Deduced nucleotide sequences were assem- 37•Ž for 30min, polyadenylated RNA was extracted bled and analyzed by the computer program DNASIS with phenol/chloroform and precipitated with 2.5vol of (Hitachi Software Engineering Co., Ltd.). ethanol and 1/2vol of 7.5M ammonium acetate. It was then suspended in 12ƒÊl of H2O; and 1ƒÊl of 10ƒÊM RESULTS oligo-dT-containing adapter primer (AP), 5•ŒCGATGGT- ACCTGCAGGCGCGCC(T)17 3•Œ, was added. After incu- PCR amplification bation at 95•Ž for 2min, the mixture was quickly chilled The strategy used to clone RBSDV genes was on ice. To this mixture was added 2ƒÊl of 10•~reverse designed to synthesize full length ds cDNA copies of transcriptase buffer (200mM Tris-HCl, pH 8.4, 500mM unknown dsRNA genes. A flow diagram of the proce- KCl), 2ƒÊl of 25mM MgCl2, 1ƒÊl of 10mM dNTP mixture dure is shown in Fig. 1. The 3•Œtermini of both strands of and 2ƒÊl of 0.1M dithiothreitol. After preincubation at the RBSDV dsRNA were polyadenylated using poly (A) 42•Ž for 2min, 1ƒÊl of SuperScriptTM reverse tran- polymerase after denaturation in dimethyl sulf oxide. scriptase (200U/ƒÊl; GIBCO BRL) was added, and the The polyadenylated products were used as a template mixture was then incubated for 50min at 42•Ž. The for an initial reverse transcription using AP, the oligo- reaction was terminated by heating at 70•Ž for 15min, dT-containing adapter primer. The AP initiated cDNA and the mixture was placed on ice for 3min. One ƒÊl of synthesis at the polyadenylated regions. Products were RNase H (2U/ƒÊl) was then added, and the mixture was amplified with PCR using AUAP containing an adapter incubated for 20min at 37•Ž. The cDNA was passed region sequence identical to that in the AP. through a Sephadex G-50 column to remove unincorpo- In the early phase of PCR, the first-strand cDNAs rated nucleotides and short cDNAs. Eluted cDNAs were from both strands (+ and -) were annealed to each precipitated by ethanol and suspended in 100ƒÊl of H2O. other and extended to the 3•Œ ends. As a result, the A 20-ƒÊl portion of the suspension was used for sequence of the adapter region at the 5•Œ end and the amplification with 2ƒÊl of 10ƒÊM primer containing complementary sequences of the adapter region at the 3 adapter region sequences identical to that in the AP end were added to both strands of the first-strand cDNA. (AUAP), 5•ŒCGATGGTACCTGCAGGCGCGCC 3•Œ, for 30 In the late phase of PCR, ds cDNA to full length dsRNA cycles at 95•Ž (1min), 60•Ž (2min), and 72•Ž (3min) in 50 was amplified only by AUAP. The products of the PCR l Takara EX Taq polymerase buffer with 5U of were analyzed by electrophoresis in a Tris-borate- Takara EX Taq (Takara). buffered agarose gel (Fig. 2). Five size classes of cDNA Fig. 1. Strategy for full length cDNA cloning of the dsRNA. AP and AUAP are the oligo-dT-containing adapter primer and the primer containing adapter region sequences, respectively. 246 日本植物病理学会報 第64巻 第4号 平成10年8月 1 2 A Fig. 2. PCR products analyzed on a 1% agarose gel stained with ethidium bromide. Lane 1, RBSDV genome. Lane 2, amplified cDNAs of RBSDV genome. molecules were clearly detected. The sizes of these cDNAs were the same as those of RBSDV S5-S10. According to Kawano et al.4), the molecular weight of RBSDV S5 was estimated to be about 2.0•~106 daltons (about 3kbp), showing that dsRNAs of 3kbp can be converted to full length cDNAs. Full length cloning The PCR products were electrophoresed on 5% poly- acrylamide gel in Tris-borate buffer, and then two bands, one corresponding to RBSDV S8 and the other corresponding to a mixture of S9 and S10, were excised Fig. 3. Typical sequence analysis of the terminal and eluted from the gel. Eluted DNAs with both termini domains of a full length cDNA clone (RBH14) containing an adapter region with Pst I were inserted corresponding to RBSDV S10. (A) Analysis of into the Pst I site of pBluescript II SK- (Stratagene, the 5•Œ terminus of the S10 coding strand. (B) USA), and then Escherichia coli strain MV1184 was Analysis of the 5•Œterminus of S10 noncoding transformed. The inserts were confirmed initially by strand. The homopolymer tails added during sequencing across the plasmid/insert junction. Inserts of cDNA synthesis can be observed below the full length cDNA to RBSDV S8-S10 were followed by indicated sequences. sequences of the adapter region and added poly (A) (Fig. 3). Comparison of nucleotide sequences of six cDNA T at the 11th position from the 5•Œend, which was exactly clones to RBSDV S10 the same position as those of RBH13 and RBH16 (Fig.
Load more

Recommended publications
  • Molecular Studies of Piscine Orthoreovirus Proteins
    Piscine orthoreovirus Series of dissertations at the Norwegian University of Life Sciences Thesis number 79 Viruses, not lions, tigers or bears, sit masterfully above us on the food chain of life, occupying a role as alpha predators who prey on everything and are preyed upon by nothing Claus Wilke and Sara Sawyer, 2016 1.1. Background............................................................................................................................................... 1 1.2. Piscine orthoreovirus................................................................................................................................ 2 1.3. Replication of orthoreoviruses................................................................................................................ 10 1.4. Orthoreoviruses and effects on host cells ............................................................................................... 18 1.5. PRV distribution and disease associations ............................................................................................. 24 1.6. Vaccine against HSMI ............................................................................................................................ 29 4.1. The non ......................................................37 4.2. PRV causes an acute infection in blood cells ..........................................................................................40 4.3. DNA
    [Show full text]
  • RNA Silencing-Based Improvement of Antiviral Plant Immunity
    viruses Review Catch Me If You Can! RNA Silencing-Based Improvement of Antiviral Plant Immunity Fatima Yousif Gaffar and Aline Koch * Centre for BioSystems, Institute of Phytopathology, Land Use and Nutrition, Justus Liebig University, Heinrich-Buff-Ring 26, D-35392 Giessen, Germany * Correspondence: [email protected] Received: 4 April 2019; Accepted: 17 July 2019; Published: 23 July 2019 Abstract: Viruses are obligate parasites which cause a range of severe plant diseases that affect farm productivity around the world, resulting in immense annual losses of yield. Therefore, control of viral pathogens continues to be an agronomic and scientific challenge requiring innovative and ground-breaking strategies to meet the demands of a growing world population. Over the last decade, RNA silencing has been employed to develop plants with an improved resistance to biotic stresses based on their function to provide protection from invasion by foreign nucleic acids, such as viruses. This natural phenomenon can be exploited to control agronomically relevant plant diseases. Recent evidence argues that this biotechnological method, called host-induced gene silencing, is effective against sucking insects, nematodes, and pathogenic fungi, as well as bacteria and viruses on their plant hosts. Here, we review recent studies which reveal the enormous potential that RNA-silencing strategies hold for providing an environmentally friendly mechanism to protect crop plants from viral diseases. Keywords: RNA silencing; Host-induced gene silencing; Spray-induced gene silencing; virus control; RNA silencing-based crop protection; GMO crops 1. Introduction Antiviral Plant Defence Responses Plant viruses are submicroscopic spherical, rod-shaped or filamentous particles which contain different kinds of genomes.
    [Show full text]
  • Omics in Plant Disease Resistance Current Issues in Molecular Biology
    Article from: Omics in Plant Disease Resistance Current Issues in Molecular Biology. Volume 19 (2016). Focus Issue DOI: http://dx.doi.org/10.21775/9781910190357 Edited by: Vijai Bhadauria Crop Development Centre/Dept. of Plant Sciences 51 Campus Drive University of Saskatchewan Saskatoon, SK S7N 5A8 Canada. Tel: (306) 966-8380 (Office), (306) 716-9863 (Cell) Email: [email protected] Copyright © 2016 Caister Academic Press, U.K. www.caister.com All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, without the prior permission of the publisher. No claim to original government works. Curr. Issues Mol. Biol. Vol. 19. (2016) Omics in Plant Disease Resistance. Vijai Bhadauria (Editor). !i Current publications of interest Microalgae Next-generation Sequencing Current Research and Applications Current Technologies and Applications Edited by: MN Tsaloglou Edited by: J Xu 152 pp, January 2016 xii + 160 pp, March 2014 Book: ISBN 978-1-910190-27-2 £129/$259 Book: ISBN 978-1-908230-33-1 £120/$240 Ebook: ISBN 978-1-910190-28-9 £129/$259 Ebook: ISBN 978-1-908230-95-9 £120/$240 The latest research and newest approaches to the study of "written in an accessible style" (Zentralblatt Math); microalgae. "recommend this book to all investigators" (ChemMedChem) Bacteria-Plant Interactions Advanced Research and Future Trends Omics in Soil Science Edited by: J Murillo, BA Vinatzer, RW Jackson, et al. Edited by: P Nannipieri, G Pietramellara, G Renella x + 228 pp, March 2015 x + 198 pp, January 2014 Book: ISBN 978-1-908230-58-4 £159/$319 Book: ISBN 978-1-908230-32-4 £159/$319 Ebook: ISBN 978-1-910190-00-5 £159/$319 Ebook: ISBN 978-1-908230-94-2 £159/$319 "an up-to-date overview" (Ringgold) "a recommended reference" (Biotechnol.
    [Show full text]
  • Development of Leafhopper Cell Culture to Trace the Early Infection Process of a Nucleorhabdovirus, Rice Yellow Stunt Virus, In
    Wang et al. Virology Journal (2018) 15:72 https://doi.org/10.1186/s12985-018-0987-6 RESEARCH Open Access Development of leafhopper cell culture to trace the early infection process of a nucleorhabdovirus, rice yellow stunt virus, in insect vector cells Haitao Wang, Juan Wang, Yunjie Xie, Zhijun Fu, Taiyun Wei* and Xiao-Feng Zhang* Abstract Background: In China, the rice pathogen Rice yellow stunt virus (RYSV), a member of the genus Nucleorhabdovirus in the family Rhabdoviridae, was a severe threat to rice production during the1960s and1970s. Fundamental aspects of the biology of this virus such as protein localization and formation of the RYSV viroplasm during infection of insect vector cells are largely unexplored. The specific role(s) of the structural proteins nucleoprotein (N) and phosphoprotein (P) in the assembly of the viroplasm during RYSV infection in insect vector is also unclear. Methods: In present study, we used continuous leafhopper cell culture, immunocytochemical techniques, and transmission electron microscopy to investigate the subcellular distributions of N and P during RYSV infection. Both GST pull-down assay and yeast two-hybrid assay were used to assess the in vitro interaction of N and P. The dsRNA interference assay was performed to study the functional roles of N and P in the assembly of RYSV viroplasm. Results: Here we demonstrated that N and P colocalized in the nucleus of RYSV-infected Nephotettix cincticeps cell and formed viroplasm-like structures (VpLSs). The transiently expressed N and P are sufficient to form VpLSs in the Sf9 cells. In addition, the interactions of N/P, N/N and P/P were confirmed in vitro.
    [Show full text]
  • Southern Rice Black-Streaked Dwarf Virus: a White-Backed Planthopper-Transmitted fijivirus Threatening Rice Production in Asia
    REVIEW ARTICLE published: 09 September 2013 doi: 10.3389/fmicb.2013.00270 Southern rice black-streaked dwarf virus: a white-backed planthopper-transmitted fijivirus threatening rice production in Asia Guohui Zhou*, Donglin Xu, Dagao Xu and Maoxin Zhang College of Natural Resources and Environment, South China Agricultural University, Guangzhou, China Edited by: Southern rice black-streaked dwarf virus (SRBSDV), a non-enveloped icosahedral virus with Nobuhiro Szuzki, Tohoku University, a genome of 10 double-stranded RNA segments, is a novel species in the genus Fijivirus Japan (family Reoviridae) first recognized in 2008. Rice plants infected with this virus exhibit Reviewed by: symptoms similar to those caused by Rice black-streaked dwarf virus. Since 2009, the virus Takahide Sasaya, National Agriculture and Food Research Organization, has rapidly spread and caused serious rice losses in East and Southeast Asia. Significant Japan progress has been made in recent years in understanding this disease, especially about the Taiyun Wei, Fujian Agriculture and functions of the viral genes, rice–virus–insect interactions, and epidemiology and control Forestry University, China measures.The virus can be efficiently transmitted by the white-backed planthopper (WBPH, *Correspondence: Sogatella furcifera) in a persistent circulative propagative manner but cannot be transmitted Guohui Zhou, College of Natural Resources and Environment, South by the brown planthopper (Nilaparvata lugens) and small brown planthopper (Laodelphax China Agricultural University, striatellus). Rice, maize, Chinese sorghum (Coix lacryma-jobi) and other grass weeds can Guangzhou, Guangdong 510642, be infected via WBPH. However, only rice plays a major role in the virus infection cycle China e-mail: [email protected] because of the vector’s preference.
    [Show full text]
  • Systematic Identification and Functional Analysis of Circular
    fmicb-11-588009 September 26, 2020 Time: 19:2 # 1 ORIGINAL RESEARCH published: 29 September 2020 doi: 10.3389/fmicb.2020.588009 Systematic Identification and Functional Analysis of Circular RNAs During Rice Black-Streaked Dwarf Virus Infection in the Laodelphax striatellus (Fallén) Midgut Jianhua Zhang1†, Haitao Wang1,2†, Wei Wu1, Yan Dong1,2, Man Wang1,2, Dianshan Yi3, Yijun Zhou1,2 and Qiufang Xu1,2* Edited by: Xiaofei Cheng, 1 Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Nanjing, China, 2 Key Laboratory of Food Quality Northeast Agricultural University, and Safety of Jiangsu Province – State Key Laboratory Breeding Base, Nanjing, China, 3 Nanjing Plant Protection China and Quarantine Station, Nanjing, China Reviewed by: Jing Li, Circular RNAs (circRNAs) are endogenous RNAs that have critical regulatory roles in ZheJiang Academy of Agricultural Sciences, China numerous biological processes. However, it remains largely unknown whether circRNAs Tong Zhang, are induced in response to plant virus infection in the insect vector of the virus as South China Agricultural University, China well as whether the circRNAs regulate virus infection. Rice black-streaked dwarf virus *Correspondence: (RBSDV) is transmitted by Laodelphax striatellus (Fallén) in a persistent propagative Qiufang Xu manner and causes severe losses in East Asian countries. To explore the expression [email protected] and function of circRNAs in the regulation of virus infection, we determined the circRNA † These authors have contributed expression profile in RBSDV-free or RBSDV-infected L. striatellus midgut tissues by equally to this work RNA-Seq. A total of 2,523 circRNAs were identified, of which thirteen circRNAs Specialty section: were differentially expressed after RBSDV infection.
    [Show full text]
  • Taxonomic Implications for Fijiviruses Based on the Terminal Sequences of Fiji Disease fijivirus
    Arch Virol (1999) 144: 2259–2263 Taxonomic implications for Fijiviruses based on the terminal sequences of Fiji disease fijivirus Brief Report J. A. McMahon, J. L. Dale, and R. M. Harding Centre for Molecular Biotechnology, School of Life Sciences, Queensland University of Technology, Brisbane, Queensland, Australia Accepted May 14, 1999 Summary. The 50 and 30 terminal sequences of the plus strand of Fiji disease fijivirus (FDV) segments 2, 3, 9 and 10 possess the conserved terminal sequences, 50AAGUUUUU.....CAGCAGAUGUC 30. The 50 sequence is identical to that of maize rough dwarf fijivirus (MRDV) and rice black-streaked dwarf fijivirus (RB- SDV), whereas the FDV 30 sequence shares the consensus, CAGCNNNNGUC, with MRDV and RBSDV. The FDV terminal sequences, and the amino acid se- quences from FDV segment 9, are more closely related to those from MRDV and RBSDV than to those from oat sterile dwarf fijivirus (OSDV) and Nilaparvata lugens reovirus (NLRV; a putative Fijivirus). ∗ Plant-infecting reoviruses are classified into three genera, Phytoreovirus, Fijivirus and Oryzavirus, based on the number and size of genome segments and their elec- trophoretic profile, virion morphology, serology and insect vectors [2]. Fiji disease fijivirus (FDV) is the type member of the genus Fijivirus and the sole member of its serogroup 1. Serogroup 2 fijiviruses include rice black-streaked dwarf virus (RBSDV), maize rough dwarf virus (MRDV) and pangola stunt virus, whereas the sole member of serogroup 3 is oat sterile dwarf virus (OSDV) [7]. Sequence analyses of several segments of MRDV and RBSDV have shown that the 50 and 30 terminal sequences, 50AAGUUUUU......GUC 30, are found in the genomes of the two serogroup 2 viruses [6, 1].
    [Show full text]
  • End Uridylation in Eukaryotic RNA Viruses
    www.nature.com/scientificreports OPEN Widespread 3′-end uridylation in eukaryotic RNA viruses Yayun Huo1,*, Jianguo Shen2,*, Huanian Wu1, Chao Zhang1, Lihua Guo3, Jinguang Yang4 & Weimin Li1 Received: 01 March 2016 RNA 3′ uridylation occurs pervasively in eukaryotes, but is poorly characterized in viruses. In this Accepted: 15 April 2016 study, we demonstrate that a broad array of RNA viruses, including mycoviruses, plant viruses and Published: 06 May 2016 animal viruses, possess a novel population of RNA species bearing nontemplated oligo(U) or (U)-rich tails, suggesting widespread 3′ uridylation in eukaryotic viruses. Given the biological relevance of 3′ uridylation to eukaryotic RNA degradation, we propose a conserved but as-yet-unknown mechanism in virus-host interaction. Addition of non-templated nucleotides to 3′ -ends of RNA transcripts is a well-known type of post-transcriptional RNA modification in kingdoms of life. The most understood example within this category is polyadenylation, by which multiple adenosines are progressively added to the 3′ -ends of RNA substrates by the canonical poly(A) polymerase (PAP) or non-canonical PAP, thereby resulting in poly(A) or poly(A)-rich tails1–3. This process occurs in almost all organisms but plays opposite roles in control of RNA stability. The long poly(A) tail at the mature 3′ -ends of nucleus-encoded mRNAs in eukaryotes is a key determinant of transcripts stability, as well as nucle- ocytoplasmic export and translation initiation1,4. By contrast, the poly(A) or poly(A)-rich stretches, which are associated with the fragmented molecules of both coding and non-coding RNAs in prokaryotes, eukaryotes and organelles, serve as toeholds for 3′ to 5′ exoribonucleases to attack the RNA2,5,6.
    [Show full text]
  • Termini of Some Mrnas of a Double-Stranded RNA Virus, Southern Rice Black-Streaked Dwarf Virus
    Viruses 2015, 7, 1642-1650; doi:10.3390/v7041642 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Communication Presence of Poly(A) Tails at the 3'-Termini of Some mRNAs of a Double-Stranded RNA Virus, Southern Rice Black-Streaked Dwarf Virus Ming He 1, Ziqiong Jiang 2, Shuo Li 3,* and Peng He 1,* 1 State Key Laboratory Breeding Base of Green Pesticide and Agricultural Bioengineering, Key Laboratory of Green Pesticide and Agricultural Bioengineering, Ministry of Education, Guizhou University, Guiyang 550025, China; E-Mail: [email protected] 2 Plant Protection Station, Rural work office, Rongjiang County, Guizhou 557200, China; E-Mail: [email protected] 3 Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Jiangsu Technical Service Center of Diagnosis and Detection for Plant Virus Diseases, Nanjing 210014, China * Authors to whom correspondence should be addressed; E-Mails: [email protected] (S.L.); [email protected] (P.H.); Tel.: +86-025-8439-0394 (S.L.); +86-851-8829-2090 (P.H.). Academic Editor: Thomas Hohn Received: 21 February 2015 / Accepted: 23 March 2015 / Published: 31 March 2015 Abstract: Southern rice black-streaked dwarf virus (SRBSDV), a new member of the genus Fijivirus, is a double-stranded RNA virus known to lack poly(A) tails. We now showed that some of SRBSDV mRNAs were indeed polyadenylated at the 3' terminus in plant hosts, and investigated the nature of 3' poly(A) tails. The non-abundant presence of SRBSDV mRNAs bearing polyadenylate tails suggested that these viral RNA were subjected to polyadenylation-stimulated degradation. The discovery of poly(A) tails in different families of viruses implies potentially a wide occurrence of the polyadenylation-assisted RNA degradation in viruses.
    [Show full text]
  • Plant Virus RNA Replication
    eLS Plant Virus RNA Replication Alberto Carbonell*, Juan Antonio García, Carmen Simón-Mateo and Carmen Hernández *Corresponding author: Alberto Carbonell ([email protected]) A22338 Author Names and Affiliations Alberto Carbonell, Instituto de Biología Molecular y Celular de Plantas (CSIC-UPV), Campus UPV, Valencia, Spain Juan Antonio García, Centro Nacional de Biotecnología (CSIC), Madrid, Spain Carmen Simón-Mateo, Centro Nacional de Biotecnología (CSIC), Madrid, Spain Carmen Hernández, Instituto de Biología Molecular y Celular de Plantas (CSIC-UPV), Campus UPV, Valencia, Spain *Advanced article Article Contents • Introduction • Replication cycles and sites of replication of plant RNA viruses • Structure and dynamics of viral replication complexes • Viral proteins involved in plant virus RNA replication • Host proteins involved in plant virus RNA replication • Functions of viral RNA in genome replication • Concluding remarks Abstract Plant RNA viruses are obligate intracellular parasites with single-stranded (ss) or double- stranded RNA genome(s) generally encapsidated but rarely enveloped. For viruses with ssRNA genomes, the polarity of the infectious RNA (positive or negative) and the presence of one or more genomic RNA segments are the features that mostly determine the molecular mechanisms governing the replication process. RNA viruses cannot penetrate plant cell walls unaided, and must enter the cellular cytoplasm through mechanically-induced wounds or assisted by a 1 biological vector. After desencapsidation, their genome remains in the cytoplasm where it is translated, replicated, and encapsidated in a coupled manner. Replication occurs in large viral replication complexes (VRCs), tethered to modified membranes of cellular organelles and composed by the viral RNA templates and by viral and host proteins.
    [Show full text]
  • MOLECULAR EVOLUTION and PHYLOGENETICS of CIRCULAR SINGLE-STRANDED DNA VIRUSES by YEE MEY SEAH a Dissertation Submitted To
    MOLECULAR EVOLUTION AND PHYLOGENETICS OF CIRCULAR SINGLE-STRANDED DNA VIRUSES By YEE MEY SEAH A dissertation submitted to the Graduate School-New Brunswick Rutgers, The State University of New Jersey And The Graduate School of Biomedical Sciences In partial fulfillment of the requirements For the degree of Doctor of Philosophy Graduate Program in Microbiology and Molecular Genetics Written under the direction of Siobain Duffy And approved by _____________________________________ _____________________________________ _____________________________________ _____________________________________ New Brunswick, New Jersey October, 2015 ABSTRACT OF THE DISSERTATION Molecular Evolution and Phylogenetics of Circular Single-stranded DNA Viruses by YEE MEY SEAH Dissertation Director: Siobain Duffy, Ph.D. Viruses infect a wide variety of hosts across all domains of life. Despite their ubiquity, and a long history of virus research, fundamental questions such as what constitutes a virus species, and how viruses evolve and are modeled, have yet to be adequately answered. We compared viral sequences across five genomic architectures (single- and double-stranded DNA and RNA) and demonstrate the presence of substitution bias, especially in single-stranded viruses. Most striking is a consistent pattern of over-represented cytosine-to- thymine substitutions in single-stranded DNA (ssDNA) viruses. This led us to question the validity of using time-reversible nucleotide substitution models in viral phylogenetic inference, as these models assume equal rates of forward and reverse substitutions. We found that an unrestricted substitution model fit the data better for most single- and double-stranded viral datasets, as measured by corrected Akaike Information Criterion, and hierarchical likelihood ratio test scores. We also approached the question of virus species identification by examining members of the most species-rich viral genus Begomovirus (Family ii Geminiviridae), which are circular single-stranded DNA (ssDNA) viral crop pathogens transmitted by whitefly vectors.
    [Show full text]
  • Principles and Applications in Plant Virology
    plants Review Loop Mediated Isothermal Amplification: Principles and Applications in Plant Virology 1, , 2, 3, 1, Stefano Panno * y, Slavica Mati´c y, Antonio Tiberini y, Andrea Giovanni Caruso y , Patrizia Bella 1, Livio Torta 1 , Raffaele Stassi 1 and Salvatore Davino 1,4,* 1 Department of Agricultural, Food and Forest Sciences, University of Palermo, 90128 Palermo, Italy; [email protected] (A.G.C.); [email protected] (P.B.); [email protected] (L.T.); [email protected] (R.S.) 2 Department of Agricultural, Forestry and Food Sciences, University of Turin, 10095 Turin, Italy; [email protected] 3 Council for Agricultural Research and Economics, Research Center for Plant Protection and Certification, 00156 Rome, Italy; [email protected] 4 Institute for Sustainable Plant Protection, National Research Council (IPSP-CNR), 10135 Turin, Italy * Correspondence: [email protected] (S.P.); [email protected] (S.D.); Tel.: +39-0912-389-6049 (S.P. & S.D.) These authors contributed equally to this work. y Received: 6 March 2020; Accepted: 2 April 2020; Published: 6 April 2020 Abstract: In the last decades, the evolution of molecular diagnosis methods has generated different advanced tools, like loop-mediated isothermal amplification (LAMP). Currently, it is a well-established technique, applied in different fields, such as the medicine, agriculture, and food industries, owing to its simplicity, specificity, rapidity, and low-cost efforts. LAMP is a nucleic acid amplification under isothermal conditions, which is highly compatible with point-of-care (POC) analysis and has the potential to improve the diagnosis in plant protection. The great advantages of LAMP have led to several upgrades in order to implement the technique.
    [Show full text]