日 植 病 報 64: 244-248 (1998) Ann. Phytopathol. Soc. Jpn. 64: 244-248 (1998) An Efficient Cloning Strategy for Viral , Double-stranded RNAs with Unknown Sequences* Masamichi ISOGAI**,Ichiro UYEDA**and Tatsuji HATAYA** Abstract A strategy was designed to efficiently clone double-stranded RNAs (dsRNAs) of unknown sequences and very low availability. From rice plants infected with rice black streaked dwarf fijivirus (RBSDV), ten dsRNA genomic segments were extracted directly. The 3•Œ ends of the plus and minus strands of the dsRNAs were polyadenylated and then used as templates for an initial reverse transcription using an oligo-dT-containing adapter primer (AP). The first-strand cDNAs of both polarities were annealed, filled in and amplified by the polymerase chain reaction using one primer containing an adapter region sequence identical to that in the AP. The amplified cDNA products corresponded in size to the full lengths of RBSDV S5, S6, S7, S8, S9 and S10; full length cDNA clones to RBSDV S8, S9 and S10 containing both terminal nucleotide sequences were obtained. Moreover, the nucleotide sequences of six full length cDNA clones were the same as those previously reported. These data indicate that this method may be applicable to full length cDNA cloning of dsRNAs. (Received January 6, 1998; Accepted March 2, 1998) Key words: cDNA cloning, rice black streaked dwarf virus, double-stranded RNA. In this paper, rice black streaked dwarf fijivirus INTRODUCTION (RBSDV), a ten-segmented dsRNA virus, was used to develope an efficient method for obtaining full length Cashdollar et al.1) first reported a method for cloning cDNAs to dsRNAs with unknown sequences by combin- double-stranded RNA (dsRNA) genomes of reoviruses. ing PCR with the methods of Cashdollar et al.1). The strategy made full use of the double-stranded nature of the genome. The full length ds cDNA mole- MATERIALS AND METHODS cules were synthesized by the addition of oligo (C) to the RNA template, reverse-transcribing them with oligo Source of virus and direct extraction of genomic (dG) primer, hybridizing the cognate plus and minus dsRNAs from infected rice plants The isolate of cDNA strands, and filling the ends with DNA polymer- RBSDV used in this study had been maintained in rice ase I. This method was later modified by first plants for more than twenty years3). polyadenylating the 3•Œ ends of the RNA instead of The dsRNA genomes of RBSDV were extracted adding oligo (C) and is widely used for cloning viral directly by the method in Murao et al.7). In brief, total genomes in the Reoviridae. Because the method requires nucleic acids were extracted from about 0.5g of white 10-50ƒÊg of template RNAs for the first-strand cDNA tumorous stalks of infected rice plants with phenol- synthesis, it is not applicable when only a small amount chloroform and then ethanol precipitated. The ssRNA of the genomic RNAs is available. After commercial was precipitated with 2M LiCl and bound with CC41 kits for gene cloning of single-stranded RNA (ssRNA) cellulose powder (Whatman, UK) to further purify the became available, they have been widely used to synthe- dsRNA. About 2ƒÊg of RBSDV dsRNA genome was size first-strand cDNAs to dsRNAs after denaturation. obtained. In addition, due to the accumulation of nucleotide Preparation of cDNA The 3•Œ termini of both sequence data, polymerase chain reaction (PCR) tech- strands of the dsRNA were first polyadenylated. To 2ƒÊg niques can now be used to make ds cDNAs from a very of total RBSDV genome in 30ƒÊl of H2O, 20ƒÊl of dimeth- small quantity of the template. However, when the yl sulf oxide was added, and the mixture was incubated nucleotide sequence is unknown and only a very small at 95•Ž for 5min to melt the dsRNAs. The denatured quantity of the dsRNA genome is available, full length dsRNA was precipitated with 3vol of ethanol and 1/10 cDNAs are still difficult to clone. vol of 3M sodium acetate, pH 5.2. The precipitate was * This work was supported in part by Research Fellowships of the Japan Society for the Promotion of Science for Young Scientists. ** Faculty of Agriculture , Hokkaido University, Kita 9, Nishi 9, Kita-ku, SapPoro 060-8589, Japan 北 海 道 大 学 農 学 部 Ann. Phytopathol. Soc. Jpn. 64 (4). August, 1998 245 suspended in 51ƒÊl of H2O; and 40ƒÊl of polyadenylation Sequencing The cloned cDNA was sequenced by reaction mixture (125mM Tris-HCI, pH 7.9, 500mM the dideoxynucleotide chain terminator method9) using a NaCl, 25mM MgCl2, 5mM MnCl2, 2.5mM dithio- Thermo Sequenase fluorescent labeled primer cycle threitol), 2ƒÊl of 100mM ATP and 2ƒÊl of poly (A) sequencing kit with 7-deaza-dGTP for Li-Cor sequencer polymerase (1.2U/ƒÊl) were added. After incubation at (Amersham). Deduced nucleotide sequences were assem- 37•Ž for 30min, polyadenylated RNA was extracted bled and analyzed by the computer program DNASIS with phenol/chloroform and precipitated with 2.5vol of (Hitachi Software Engineering Co., Ltd.). ethanol and 1/2vol of 7.5M ammonium acetate. It was then suspended in 12ƒÊl of H2O; and 1ƒÊl of 10ƒÊM RESULTS oligo-dT-containing adapter primer (AP), 5•ŒCGATGGT- ACCTGCAGGCGCGCC(T)17 3•Œ, was added. After incu- PCR amplification bation at 95•Ž for 2min, the mixture was quickly chilled The strategy used to clone RBSDV genes was on ice. To this mixture was added 2ƒÊl of 10•~reverse designed to synthesize full length ds cDNA copies of transcriptase buffer (200mM Tris-HCl, pH 8.4, 500mM unknown dsRNA genes. A flow diagram of the proce- KCl), 2ƒÊl of 25mM MgCl2, 1ƒÊl of 10mM dNTP mixture dure is shown in Fig. 1. The 3•Œtermini of both strands of and 2ƒÊl of 0.1M dithiothreitol. After preincubation at the RBSDV dsRNA were polyadenylated using poly (A) 42•Ž for 2min, 1ƒÊl of SuperScriptTM reverse tran- polymerase after denaturation in dimethyl sulf oxide. scriptase (200U/ƒÊl; GIBCO BRL) was added, and the The polyadenylated products were used as a template mixture was then incubated for 50min at 42•Ž. The for an initial reverse transcription using AP, the oligo- reaction was terminated by heating at 70•Ž for 15min, dT-containing adapter primer. The AP initiated cDNA and the mixture was placed on ice for 3min. One ƒÊl of synthesis at the polyadenylated regions. Products were RNase H (2U/ƒÊl) was then added, and the mixture was amplified with PCR using AUAP containing an adapter incubated for 20min at 37•Ž. The cDNA was passed region sequence identical to that in the AP. through a Sephadex G-50 column to remove unincorpo- In the early phase of PCR, the first-strand cDNAs rated nucleotides and short cDNAs. Eluted cDNAs were from both strands (+ and -) were annealed to each precipitated by ethanol and suspended in 100ƒÊl of H2O. other and extended to the 3•Œ ends. As a result, the A 20-ƒÊl portion of the suspension was used for sequence of the adapter region at the 5•Œ end and the amplification with 2ƒÊl of 10ƒÊM primer containing complementary sequences of the adapter region at the 3 adapter region sequences identical to that in the AP end were added to both strands of the first-strand cDNA. (AUAP), 5•ŒCGATGGTACCTGCAGGCGCGCC 3•Œ, for 30 In the late phase of PCR, ds cDNA to full length dsRNA cycles at 95•Ž (1min), 60•Ž (2min), and 72•Ž (3min) in 50 was amplified only by AUAP. The products of the PCR l Takara EX Taq polymerase buffer with 5U of were analyzed by electrophoresis in a Tris-borate- Takara EX Taq (Takara). buffered agarose gel (Fig. 2). Five size classes of cDNA Fig. 1. Strategy for full length cDNA cloning of the dsRNA. AP and AUAP are the oligo-dT-containing adapter primer and the primer containing adapter region sequences, respectively. 246 日本植物病理学会報 第64巻 第4号 平成10年8月 1 2 A Fig. 2. PCR products analyzed on a 1% agarose gel stained with ethidium bromide. Lane 1, RBSDV genome. Lane 2, amplified cDNAs of RBSDV genome. molecules were clearly detected. The sizes of these cDNAs were the same as those of RBSDV S5-S10. According to Kawano et al.4), the molecular weight of RBSDV S5 was estimated to be about 2.0•~106 daltons (about 3kbp), showing that dsRNAs of 3kbp can be converted to full length cDNAs. Full length cloning The PCR products were electrophoresed on 5% poly- acrylamide gel in Tris-borate buffer, and then two bands, one corresponding to RBSDV S8 and the other corresponding to a mixture of S9 and S10, were excised Fig. 3. Typical sequence analysis of the terminal and eluted from the gel. Eluted DNAs with both termini domains of a full length cDNA clone (RBH14) containing an adapter region with Pst I were inserted corresponding to RBSDV S10. (A) Analysis of into the Pst I site of pBluescript II SK- (Stratagene, the 5•Œ terminus of the S10 coding strand. (B) USA), and then Escherichia coli strain MV1184 was Analysis of the 5•Œterminus of S10 noncoding transformed. The inserts were confirmed initially by strand. The homopolymer tails added during sequencing across the plasmid/insert junction. Inserts of cDNA synthesis can be observed below the full length cDNA to RBSDV S8-S10 were followed by indicated sequences. sequences of the adapter region and added poly (A) (Fig. 3). Comparison of nucleotide sequences of six cDNA T at the 11th position from the 5•Œend, which was exactly clones to RBSDV S10 the same position as those of RBH13 and RBH16 (Fig.